Preventive and / or therapeutic agent for inflammatory lung disease

Abstract

The present invention provides a medicine for an inflammatory pulmonary disease that is capable of effectively preventing and / or treating an inflammatory pulmonary disease. More specifically, the present invention pertains to a prophylactic and / or therapeutic agent for an inflammatory pulmonary disease that comprises, as an active ingredient, an antibody or an antibody fragment having an antigen-binding activity to an S100A8 / A9 heterodimer. Inflammatory pulmonary diseases can be effectively prevented and / or treated by blocking interactions between S100A8 / A9 and receptors thereof. More specifically, inflammatory pulmonary diseases can be effectively prevented and / or treated by blocking an interaction between S100A8 / A9 and RAGE which is a receptor thereof and thus inhibiting the expression of NF-κB, which is a transcription factor in the downstream of RAGE and induces the expression of various inflammatory cytokines, and, at the same time, inhibiting the proliferation of activated fibroblasts and inhibiting the differentiation of the activated fibroblasts into myofibroblasts. In addition, the prophylactic and / or therapeutic agent for an inflammatory pulmonary disease according to the present invention is appropriately usable as a prophylactic and / or preventive agent for COVID-19 too.

Description

[Technical field]

[0001] The present invention relates to a preventive and / or therapeutic agent for inflammatory lung diseases, which comprises as an active ingredient an antibody or antibody fragment having antigen-binding activity against the heterodimer of S100A8 protein (also simply referred to as "S100A8") and S100A9 protein (also simply referred to as "S100A9").

[0002] This application claims priority to Japanese Patent Application No. 2019-197222, which is incorporated herein by reference. [Background technology]

[0003] S100 proteins are calcium-binding proteins with two EF-hands that are expressed in a cell type-specific manner, and 20 subfamilies have been identified to date. S100A8 (MRP8, calgranulin A) is one of the calcium-binding protein S100 family, and is usually co-expressed with S100A9 (MRP14, calgranulin B). S100A8 / A9 (calprotectin), a heterodimer of S100A8 and S100A9, accumulates in body fluids during inflammation and is thought to be involved in the development of chronic inflammatory diseases in humans, such as rheumatoid arthritis (RA), cystic fibrosis, Crohn's disease, ulcerative colitis, allergic dermatitis, and infections.

[0004] S100A8 / A9 is secreted from the lungs, for example, and has the function of attracting distant cancer cells and creating an immunosuppressive environment in the lungs suitable for the establishment and proliferation of cancer cells. Receptors of S100A8 / A9 are known to include EMMPRIN, NPTNα (Neuroplastin-α), NPTNβ, MCAM (M-cell adhesion molecule), and ALCAM (Activated leukocyte cell adhesion molecule). Among the receptors of S100A8 / A9, a method for screening chronic inflammation inhibitors or cancer metastasis inhibitors by binding inhibition focusing on EMMPRIN has been reported (Patent Document 1). Patent Document 1 shows that EMMPRIN is particularly a receptor for S100A9, and discloses that as a result of screening, Artemisia princeps extract, Angelica acutiloba extract, Lamium oryzae extract, etc. inhibit the binding of EMMPRIN to S100A9. Among the receptors of S100A8 / A9, a screening method for cell proliferation inhibition by binding inhibition focusing on NPTN has been reported (Patent Document 2). Patent Document 2 discloses that as a result of screening, mugwort extract, licorice extract, carrot extract, etc. inhibit the binding of NPTN and S100A8. It has been reported that compounds considered to be S100 inhibitors are useful for the treatment of cancer, autoimmune diseases, inflammatory diseases, neurodegenerative diseases, etc. (Patent Document 3). In addition, it has been reported that S100A9 is useful as a biomarker for inflammatory bowel disease (Patent Document 4).

[0005] Furthermore, RAGE (Receptor for advanced glycation end product) is also known as a receptor for S100A8 / A9 (Non-Patent Document 1). Non-Patent Document 1 reports that RAGE binds to TLR4 and RAGE on the membrane of BV-2 microglial cells, and stimulates NF-κB in BV-2 microglial cells via ERV and JNK, enhancing its activity (Non-Patent Document 1).

[0006] The number of patients suffering from pulmonary inflammatory diseases, i.e., diseases such as idiopathic interstitial pneumonia (IIP) including idiopathic pulmonary fibrosis (IPF) (hereinafter referred to as "inflammatory lung diseases"), is steadily increasing. Among idiopathic interstitial pneumonias, idiopathic pulmonary fibrosis is a disease seen worldwide, in which steroids and immunosuppressants are not effective, and the average survival time after acute exacerbation is within 2 months, resulting in an extremely poor prognosis. Two types of molecular targeted drugs (pirfenidone and nintedanib) are known as therapeutic agents for idiopathic pulmonary fibrosis (Non-Patent Documents 2 and 3), but both are symptomatic treatments and cannot be expected to suppress or improve fibrosis, and therefore cannot be considered a fundamental treatment. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] JP 2011-47932 A [Patent Document 2] JP 2014-59210 A [Patent Document 3] International Publication No. WO2015 / 177367 [Patent Document 4] JP 2016-217956 A [Non-patent literature]

[0008] [Non-Patent Document 1] Li Ma et al., INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE (2017) 40: 31-38, DOI: 10.3892 / ijmm.2017.2987 [Non-Patent Document 2] Margaritopoulos et al., BMC Pulmonary Medicine (2018) 18:177; doi.org / 10.1186 / s12890-018-0736-z [Non-Patent Document 3] Lutz Wollin1 et al., European Respiratory Journal (2015); DOI: 10.1183 / 09031936.00174914 Summary of the Invention [Problem to be solved by the invention]

[0009] An objective of the present invention is to provide a drug capable of effectively preventing and / or treating inflammatory lung diseases. More specifically, an objective of the present invention is to provide a prophylactic and / or therapeutic agent for inflammatory lung diseases, which comprises, as an active ingredient, an antibody or an antibody fragment having antigen-binding activity against S100A8 and / or S100A9, which are known as inflammation-associated proteins. [Means for solving the problem]

[0010] In order to achieve the above object, the present inventors have focused on S100A8 and / or S100A9 and their receptors (EMMPRIN, NPTNβ, MCAM, ALCAM and RAGE) and conducted extensive research. As a result, they have discovered that inflammatory lung diseases can be effectively prevented and / or treated by blocking the interaction between S100A8 and / or S100A9 and their receptors, thereby completing the present invention.

[0011] That is, the present invention comprises the following. 1. A preventive and / or therapeutic agent for inflammatory lung disease, which comprises as an active ingredient an antibody or antibody fragment having antigen-binding activity against a heterodimer of S100A8 and S100A9 proteins. 2. The preventive and / or therapeutic agent for an inflammatory lung disease according to the preceding item 1, wherein the antibody or antibody fragment has an antigen-binding activity higher than that for S100A8 monomer. 3. A preventive and / or therapeutic agent for an inflammatory lung disease described in the preceding item 1 or 2, wherein the antibody or antibody fragment has antigen-binding activity to the heterodimer of S100A8 and S100A9, but has no antigen-binding activity to the S100A8 monomer and / or S100A9 monomer. 4. The preventive and / or therapeutic agent for inflammatory lung diseases according to any one of the preceding items 1 to 3, wherein the antigen-binding activity is neutralizing affinity. 5. The preventive and / or therapeutic agent for an inflammatory lung disease according to any one of the preceding items 1 to 4, wherein the antibody or antibody fragment is a monoclonal antibody or a monoclonal antibody fragment. 6. The preventive and / or therapeutic agent for an inflammatory lung disease according to the preceding item 5, wherein the subclass of the monoclonal antibody is any one selected from IgG1, IgG2, IgG3 and IgG4. 7. The antibody or antibody fragment comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3), The heavy chain variable region 1 (CDR H1) comprises any of the amino acid sequences set forth in SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16 or SEQ ID NO: 19, or the amino acid sequences set forth in SEQ ID NO: 7, 10, 13, 16 or 19, respectively, in which one or more amino acids have been deleted, added, substituted or inserted; The heavy chain variable region 2 (CDR H2) comprises any of the amino acid sequences set forth in SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17 or SEQ ID NO: 20, or the amino acid sequences set forth in SEQ ID NO: 8, 11, 14, 17 or 20, respectively, in which one or more amino acids have been deleted, added, substituted or inserted; The heavy chain variable region 3 (CDR H3) comprises any of the amino acid sequences set forth in SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18 or SEQ ID NO: 21, or the amino acid sequences set forth in SEQ ID NO: 9, 12, 15, 18 or 21, in which one or more amino acids have been deleted, added, substituted or inserted, The light chain variable region 1 (CDR L1) comprises any of the amino acid sequences set forth in SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31 or SEQ ID NO: 34, or the amino acid sequences set forth in SEQ ID NO: 22, 25, 28, 31 or 34, respectively, in which one or more amino acids have been deleted, added, substituted or inserted; The light chain variable region 2 (CDR L2) comprises any of the amino acid sequences set forth in SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32 or SEQ ID NO: 35, or the amino acid sequences set forth in SEQ ID NO: 23, 26, 29, 32 or 35, respectively, in which one or more amino acids have been deleted, added, substituted or inserted; The preventive and / or therapeutic agent for inflammatory lung disease according to any one of the preceding items 1 to 6, comprising as an active ingredient an antibody or an antibody fragment, the light chain variable region 3 (CDR L3) of which comprises any one of the amino acid sequences set forth in SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, or SEQ ID NO: 36, or an amino acid sequence obtained by deleting, adding, substituting, or inserting one or more amino acids in each of SEQ ID NOs: 24, 27, 30, 33, or 36. 8. The heavy chain variable region 1 (CDR H1) comprises either SEQ ID NO: 7 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 7; The heavy chain variable region 2 (CDR H2) comprises either SEQ ID NO: 8 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 8; The heavy chain variable region 3 (CDR H3) comprises either SEQ ID NO: 9 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 9; The light chain variable region 1 (CDR L1) comprises either SEQ ID NO: 22 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 22; The light chain variable region 2 (CDR L2) comprises either SEQ ID NO: 23 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 23; 8. The preventive and / or therapeutic agent for inflammatory lung disease according to the preceding item 7, wherein the light chain variable region 3 (CDR L3) comprises either SEQ ID NO: 24 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 24. 9. The heavy chain variable region 1 (CDR H1) comprises either SEQ ID NO: 10 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 10; The heavy chain variable region 2 (CDR H2) comprises either SEQ ID NO: 11 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 11; The heavy chain variable region 3 (CDR H3) comprises either SEQ ID NO: 12 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 12; The light chain variable region 1 (CDR L1) comprises either SEQ ID NO: 25 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 25; The light chain variable region 2 (CDR L2) comprises either SEQ ID NO: 26 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 26; 8. The prevention and / or treatment of an inflammatory lung disease according to the preceding item 7, wherein the light chain variable region 3 (CDR L3) comprises either SEQ ID NO: 27 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 27. 10. The heavy chain variable region 1 (CDR H1) comprises either SEQ ID NO: 13 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 13; The heavy chain variable region 2 (CDR H2) comprises either SEQ ID NO: 14 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 14; The heavy chain variable region 3 (CDR H3) comprises either SEQ ID NO: 15 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 15; The light chain variable region 1 (CDR L1) comprises either SEQ ID NO: 28 or the amino acid sequence of SEQ ID NO: 28 in which one or more amino acids have been deleted, added, substituted, or inserted; The light chain variable region 2 (CDR L2) comprises either SEQ ID NO: 29 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 29; 8. The preventive and / or therapeutic agent for inflammatory lung disease according to the preceding item 7, wherein the light chain variable region 3 (CDR L3) comprises either SEQ ID NO: 30 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 30. 11. The heavy chain variable region 1 (CDR H1) comprises either SEQ ID NO: 16 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 16; The heavy chain variable region 2 (CDR H2) comprises either SEQ ID NO: 17 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 17; The heavy chain variable region 3 (CDR H3) comprises either SEQ ID NO: 18 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 18; The light chain variable region 1 (CDR L1) comprises either SEQ ID NO: 31 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 31; The light chain variable region 2 (CDR L2) comprises either SEQ ID NO: 32 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 32; 8. The preventive and / or therapeutic agent for inflammatory lung diseases according to the preceding item 7, wherein the light chain variable region 3 (CDR L3) comprises either SEQ ID NO: 33 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 33. 12. The heavy chain variable region 1 (CDR H1) comprises either SEQ ID NO: 19 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 19; The heavy chain variable region 2 (CDR H2) comprises either SEQ ID NO: 20 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 20; The heavy chain variable region 3 (CDR H3) comprises either SEQ ID NO: 21 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 21; The light chain variable region 1 (CDR L1) comprises either SEQ ID NO: 34 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 34; The light chain variable region 2 (CDR L2) comprises either SEQ ID NO: 35 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 35; 8. The preventive and / or therapeutic agent for inflammatory lung diseases according to the preceding item 7, wherein the light chain variable region 3 (CDR L3) comprises either SEQ ID NO: 36 or an amino acid sequence in which one or more amino acids have been deleted, added, substituted, or inserted in the amino acid sequence shown in SEQ ID NO: 36. 13. A preventive and / or therapeutic agent for inflammatory lung diseases described in any one of the preceding items 1 to 12, characterized in that it blocks the interaction between S100A8 and / or S100A9 and their receptor RAGE, suppresses the expression of NF-κB, a transcription factor downstream of RAGE that induces the expression of inflammatory cytokines, and the proliferation of pulmonary fibroblasts, as well as suppresses the proliferation of activated fibroblasts, and further suppresses the differentiation of activated fibroblasts into myofibroblasts. 14. A prophylactic and / or therapeutic agent for inflammatory lung disease described in any of the preceding items 1 to 13, as a prophylactic and / or therapeutic agent for COVID-19. Effect of the Invention

[0012] According to the preventive and / or therapeutic agent for inflammatory lung disease of the present invention, the interaction between S100A8 and / or S100A9 and RAGE, which is one of its receptors, can be blocked, thereby effectively preventing and / or treating inflammatory lung disease. Here, RAGE is a major receptor of S100A8 / A9 in the lung, is highly expressed in alveolar epithelial cells that cause inflammatory lung disease, and is the starting point of pathology related to inflammatory lung disease. That is, the preventive and / or therapeutic agent for inflammatory lung disease of the present invention blocks the interaction between S100A8 and / or S100A9 and RAGE, which is one of its receptors, suppresses the expression of NF-κB, which is a transcription factor downstream of RAGE and induces the expression of various inflammatory cytokines, suppresses the proliferation of activated fibroblasts, and further suppresses the differentiation of activated fibroblasts into myofibroblasts. Based on the above-mentioned mechanism of action, the preventive and / or therapeutic agent for inflammatory lung disease of the present invention can effectively prevent and / or treat inflammatory lung disease. [Brief description of the drawings]

[0013] [Figure 1]1 shows the structure of an expression vector for preparing an S100A8 / A9 heterodimer as an antigen for producing the anti-S100A8 / A9 antibody of the present invention (Reference Example 1). [Diagram 2] 1 is a photograph showing the results of SDS-PAGE and CBB staining of purified S100A8 / A9 heterodimer, S100A8 monomer, and S100A9 monomer (Reference Example 1). [Diagram 3] 1 shows the results of HPLC analysis of purified S100A8 / A9 heterodimer, S100A8 monomer, and S100A9 monomer (Reference Example 1). [Figure 4] FIG. 1 shows the thermodynamic stability of purified S100A8 / A9 heterodimer, S100A8 monomer, and S100A9 monomer (Reference Example 1). [Diagram 5] 1 shows the results of confirming the neutralizing ability against S100A8 / A9 heterodimer, S100A8, or S100A9 by ELISA for 10 clones selected from hybridomas for producing anti-S100A8 / A9 antibodies (Example 1). [Figure 6] 1 shows the results of confirming the expression inhibitory effects of TNF-α, IL-6, and IL-8 for 10 clones selected from hybridomas for producing anti-S100A8 / A9 antibodies using human keratinocytes in which inflammatory cytokines are strongly induced by S100A8 / A9 (Example 2). [Figure 7] FIG. 4 shows the structure of a chimeric antibody in which a human IgG2-Fc portion is fused to the Fab domain of an anti-S100A8 / A9 monoclonal antibody (clone No. 45) (Example 4). [Figure 8] 1 shows the enhancement of mouse fibroblast proliferation by S100A8 / A9 (Example 5). [Figure 9] 1 shows the enhancement of human fibroblast proliferation by S100A8 / A9 (Example 5). [Figure 10] Fig. 6 shows the results of evaluating S100A8 / A9-dependent NF-κB signal activation in fibroblasts (Example 6). [Figure 11]FIG. 6 shows the results of evaluating the inhibition of NF-κB signaling by anti-S100A8 / A9 antibody (α-S100A8 / A9 antibody) in fibroblasts (Example 6). [Figure 12] 7 shows the results of evaluating the induction of α-SMA expression by S100A8 / A9 in human pulmonary fibroblasts and the ability of anti-S100A8 / A9 antibody (α-S100A8 / A9 antibody) to suppress S100A8 / A9-induced α-SMA expression (Example 7). [Figure 13] 7 is a diagram showing the results of evaluating the induction of α-SMA and collagen expression by S100A8 / A9 in mouse fibroblasts and the ability of anti-S100A8 / A9 antibody (α-S100A8 / A9 antibody) to suppress S100A8 / A9-induced α-SMA and collagen expression (Example 7). [Figure 14] 8 shows an experimental protocol for confirming the inhibitory effect of anti-S100A8 / A9 antibody on lung injury using a bleomycin intratracheal administration pulmonary fibrosis model (Example 8). [Figure 15] 8 is a graph showing the concentration-dependent inhibitory effect of anti-S100A8 / A9 antibody on body weight loss in a bleomycin intratracheal administration pulmonary fibrosis model (Example 8). [Figure 16] Fig. 8 is a photograph showing the results of CT scan of the lungs in a bleomycin intratracheal administration pulmonary fibrosis model in which anti-S100A8 / A9 antibody was administered (Example 8). [Figure 17] Fig. 8 is a graph showing the quantification of the area of ​​high-density lung areas in a bleomycin intratracheal administration pulmonary fibrosis model induced by administration of anti-S100A8 / A9 antibodies (Example 8). [Figure 18] 8 is a graph showing the survival rate of mice administered with anti-S100A8 / A9 antibodies in a bleomycin intratracheal administration pulmonary fibrosis model (Example 8). [Figure 19] 1 shows the inhibitory effect of anti-S100A8 / A9 antibodies on the expression of TMPRSS2 in human lung cells (Example 9). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The present invention relates to a preventive and / or therapeutic agent for inflammatory lung disease, which contains as an active ingredient an antibody or antibody fragment having antigen-binding activity against S100A8 / A9. The "antibody having antigen-binding activity against S100A8 / A9" contained in the preventive and / or therapeutic agent for inflammatory lung disease of the present invention is referred to as an "anti-S100A8 / A9 antibody", and may also be referred to as the "antibody of the present invention". In this specification, "S100A8 / A9" refers to a complex of S100A8 and S100A9, and may also be referred to as the "S100A8 / A9 heterodimer" in some cases.

[0015] In the present specification, the antibody of the present invention is an antibody prepared using S100A8 / A9 heterodimer as an antigen, and has antigen binding activity to S100A8 / A9 heterodimer. The anti-S100A8 / A9 antibody preferably has higher antigen binding activity to S100A8 / A9 heterodimer than that to S100A8 monomer. Among the anti-S100A8 / A9 antibodies, those having antigen binding activity to S100A8 and S100A9 heterodimers, and further having no antigen binding activity to S100A8 monomer and / or S100A9 monomer are more preferable. In the above, the antigen binding activity may be any antigen binding activity generally understood, and is not particularly limited, but can be exemplified by neutralizing antibody affinity. Furthermore, the anti-S100A8 / A9 antibody is preferably one that has higher neutralizing antibody affinity for the heterodimer of S100A8 and S100A9 than for the S100A8 monomer, and even more preferably one that has neutralizing antibody affinity for the heterodimer of S100A8 and S100A9 but has no neutralizing antibody affinity for the S100A8 monomer and / or S100A9 monomer.

[0016] In the present specification, the antibody of the present invention is used in the broadest sense, and includes monoclonal antibodies, polyclonal antibodies, chimeric antibodies, and multispecific antibodies, so long as they exhibit the antigen-binding activity described above. The antibody of the present invention may contain a heavy chain variable region (VH-CDR) and / or a light chain variable region (VL-CDR) or a fragment thereof. The class of the antibody of the present invention refers to the type of constant domain or constant region in the heavy chain (H chain) of the antibody, and includes, for example, IgA, IgD, IgE, IgG, and IgM. The class of the antibody in the present specification is not particularly limited, but IgG is most preferred. Examples of IgG subclasses include IgG1, IgG2, IgG3, IgG4, and the like, and IgG1 or IgG2 is preferred.

[0017] In the present specification, an "antibody fragment" of an antibody having antigen-binding activity against the S100A8 / A9 heterodimer may be any antibody fragment having a portion of the antibody structure and retaining the activity of the antibody of the present invention. The structure of the antibody fragment may be a fragment of the antigen-binding site of the antibody, such as the heavy chain variable region (VH-CDR) and / or the light chain variable region (VL-CDR) or a fragment thereof. Examples of the antibody fragment include Fv, Fab, Fab', Fab'-SH, F(ab')2, or a combination thereof.

[0018] The antibodies of the invention may be human, humanized, or chimeric. A human antibody refers to an antibody with an amino acid sequence that corresponds to the amino acid sequence of an antibody produced by a human or human cell, or an antibody derived from a human antibody repertoire or other non-human source that uses human antibody coding sequences.

[0019] The amino acid sequence of the VH-CDR and / or VL-CDR contained in the antibody of the present invention may include, for example, the amino acid sequence specified by the following SEQ ID NO:. For example, the heavy chain variable region 1 (CDR H1) may include any of the amino acid sequences shown in SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19. The heavy chain variable region 2 (CDR H2) may include any of the amino acid sequences shown in SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20. The heavy chain variable region 3 (CDR H3) may include any of the amino acid sequences shown in SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, or SEQ ID NO: 21. For example, the light chain variable region 1 (CDR L1) may include any of the amino acid sequences shown in SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, or SEQ ID NO: 34. The light chain variable region 2 (CDR L2) region may include any of the amino acid sequences shown in SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, or SEQ ID NO: 35. Light chain variable region 3 (CDR L3) may contain any of the amino acid sequences shown in SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, or SEQ ID NO: 36. The amino acid sequence information of each of the above regions is also within the scope of the present invention. In addition to the above amino acid sequences, anti-S100A8 / A9 antibodies or antibody fragments containing these amino acid sequences, even if one or more amino acids are substituted, deleted, added, or inserted, are also within the scope of the present invention as long as they exhibit antigen-binding activity to the S100A8 / A9 heterodimer.

[0020] The antibody or antibody fragment of the present invention can be produced according to a conventional method using the above-mentioned S100A8 / A9 heterodimer antigen.

[0021] When the antibody of the present invention is a monoclonal antibody, a mammal such as a mouse or a rat is immunized with the above-mentioned S100A8 / A9 heterodimer antigen, lymphocytes are collected from the animal, and then fused with myeloma cells in a conventional manner to prepare hybridomas, which can produce anti-S100A8 / A9 antibodies. The immunization of a mammal can be performed in a conventional manner. For example, an animal can be immunized using a mixture of the above-mentioned S100A8 / A9 heterodimer antigen and an adjuvant as an immunogen. The adjuvant is not particularly limited, but examples thereof include Freund's complete adjuvant and Freund's incomplete adjuvant. The method of administration of the immunogen during immunization may be any method known per se, such as subcutaneous injection, intraperitoneal injection, intravenous injection, or intramuscular injection, with subcutaneous injection or intraperitoneal injection being preferred. The immunization may be performed once or multiple times at appropriate intervals, preferably multiple times at intervals of 1 to 5 weeks. The culture supernatant of the hybridoma prepared above can be examined for its binding to the S100A8 / A9 heterodimer by ELISA or the like, and the antibody-producing hybridoma can be repeatedly cloned to obtain the desired monoclonal antibody-producing cell. A method known per se can be used to prepare a humanized antibody.

[0022] Total RNA can be purified from hybridoma cells producing antibodies according to a standard method, and then cDNA can be synthesized. From the obtained cDNA, full-length heavy chain (H chain) and light chain (L chain) antibody genes can be amplified by PCR using the respective primers to obtain the respective gene fragments. The obtained gene fragments can be ligated to an expression vector to clone the antibody genes. The amino acid sequences of the H chain and L chain of the antibodies can be determined by confirming the base sequence of the plasmid vector encoding them. Based on the obtained amino acid sequence and base sequence information, the antibody may be produced by a genetic recombination technique or a synthetic method. When producing an antibody by a genetic recombination technique, it can be produced, for example, by the method described in International Publication No. WO2017 / 061354.

[0023] When preparing an antibody by a genetic recombination technique, for example, genetic information encoding each amino acid that specifies CDR H1, CDR H2, CDR H3, CDR L1, CDR L2, and CDR L3 can be used. Specific amino acid sequences include, for example, any of the amino acid sequences shown in SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19 for CDR H1. Specific amino acid sequences include any of the amino acid sequences shown in SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20 for CDR H2. Specific amino acid sequences include any of the amino acid sequences shown in SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, or SEQ ID NO: 21 for CDR H1. For example, any of the amino acid sequences shown in SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, or SEQ ID NO: 34 for CDR L2. Specific amino acid sequences include any of the amino acid sequences shown in SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, or SEQ ID NO: 35 for CDR L3. Specific amino acid sequences include any of the amino acid sequences shown in SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, or SEQ ID NO: 36 for CDR L3. The present invention also encompasses nucleotide sequence information encoding each amino acid specifying the above-specified CDR H1, CDR H2, CDR H3, CDR L1, CDR L2, and CDR L3, and nucleotide sequence information of the complementary strand thereof. In addition to the above-specified nucleotide sequence information, the scope of the present invention also encompasses nucleotide sequence information in which one or more nucleotides have been substituted, deleted, added, or inserted, as long as the nucleotide sequence enables the preparation of the anti-S100A8 / A9 antibody of the present invention.

[0024] Methods for screening the antibody of the present invention and methods for confirming the antibody evaluation will be specifically explained in the Reference Examples, Examples, Experimental Examples and the like described below, but for example, the following method can also be applied.

[0025] From the above antibody-producing hybridomas, hybridomas expressing multiple types of S100A8 / A9 neutralizing antibody candidates can be adapted to serum-free culture and prepared in large quantities for in vitro and in vivo experiments. The culture supernatant of each clone can be collected and the antibodies can be purified. The antibodies can be purified by any method known per se or any method to be developed in the future. For example, the antibodies can be collected by affinity chromatography, specifically affinity purification using Protein A / G is common, and columns suitable for each animal species and antibody subclass can be used. The purity of the purified antibodies can be tested by any method known per se, for example, CBB staining.

[0026] For evaluation of the antibody or antibody fragment of the present invention, S100A8 / A9-adsorptive decoy protein preparations (exEMMPRIN-Fc, exNPTNβ-Fc, exMCAM-Fc, exRAGE-Fc, exALCAM-Fc), which are receptors for S100A8 / A9, can be prepared appropriately.

[0027] In the present specification, the term "inflammatory lung disease" refers to inflammatory lung diseases in general, such as idiopathic / chronic inflammatory lung disease, bronchial asthma, and interstitial pneumonia, which can be prevented and / or treated by the preventive and / or therapeutic agent for inflammatory lung disease of the present invention. Examples of such diseases include idiopathic interstitial pneumonia (IIP: idiopathic organizing pneumonia, including nonspecific interstitial pneumonia (NSIP)), including idiopathic pulmonary fibrosis (IPF), idiopathic nonspecific interstitial pneumonia, chronic obstructive pulmonary disease (COPD), hypersensitivity pneumonitis, and COVID-19. Among the inflammatory lung diseases, for example, COPD and bronchial asthma have been rapidly increasing in recent years, and according to recent statistical data, it is estimated that 3 to 6% of the total population of Japan suffers from bronchial asthma and 8.5% suffers from COPD. The impact of inflammatory lung diseases on human health life expectancy is large, and the loss to socio-economy and medical finances is immeasurable. In the pathology of such inflammatory lung diseases, the differentiation of activated fibroblasts into myofibroblasts and the accompanying overexpression, enhancement and deposition of collagen and extracellular matrix components are thought to lead to the worsening of pulmonary fibrosis. The preventive and / or therapeutic agent for inflammatory lung diseases of the present invention can effectively prevent and / or treat the inflammatory lung diseases based on the mechanism of action described below.

[0028] The preventive and / or therapeutic agent for inflammatory lung disease of the present invention may be administered locally or systemically. The antibody used in the preventive and / or therapeutic agent for inflammatory lung disease of the present invention may be used in combination with other antibodies other than the antibody of the present invention having pharma- ceutically acceptable purity, optionally together with pharma- ceutically acceptable carriers, excipients, and stabilizers. It is also optional to make it into a lyophilized preparation or a water-soluble form for storage. When the preventive and / or therapeutic agent for inflammatory lung disease of the present invention is in the form of parenteral administration, it may contain pharma- ceutically acceptable, sterile, aqueous or non-aqueous solutions, diluents, suspensions, and emulsions. Examples of non-aqueous diluents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic ester compositions such as ethyl oleate, which are suitable for injection. Aqueous carriers may include water, alcoholic aqueous solutions, emulsions, suspensions, saline, and buffered media. Parenteral carriers may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, Ringer's lactate, and bound oil. The intravenous carrier may contain, for example, fluid replenishers, nutrients, and electrolytes (e.g., based on Ringer's dextrose). The preventive and / or therapeutic agent for inflammatory lung disease of the present invention may further contain preservatives and other additives, such as antimicrobial compounds, antioxidants, chelating agents, and inert gases. As for the components other than the antibody of the present invention as the active ingredient in the preventive and / or therapeutic agent for inflammatory lung disease of the present invention described above, one or more of them may be used in appropriate combination.

[0029] The preventive and / or therapeutic agent for inflammatory lung diseases of the present invention may contain, as necessary, one or more physiologically active compounds, preferably those having complementary activities that do not adversely affect each other, and may be used in combination with one or more anti-inflammatory agents known per se or anti-inflammatory agents to be developed in the future, as well as other drugs that can reduce side effects, for example.

[0030] The preventive and / or therapeutic agent for inflammatory lung disease of the present invention contains a therapeutically effective amount of an anti-S100A8 / A9 antibody. The therapeutically effective amount refers to an amount effective for achieving a desired therapeutic result at a required dose and for a required period of time. The therapeutically effective amount may be determined taking into consideration the disease state, age, sex, and weight of an individual, and the efficacy of the drug in inducing a desired response in an individual.

[0031] The preventive and / or therapeutic agent for inflammatory lung disease of the present invention is used in a single or divided dose, usually every 24, 12, 8, 6, 4 or 2 hours, or in any combination, and is administered at least once on the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, 30th, 31st, 32nd, 33rd, 34th, 35th, 36th, 37th, 38th, 39th or 40th day, or at least once on the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th or 20th week, or in any combination thereof, at a dose of about 0.1 to 100 mg / day. An amount of antibody in the range of mg / kg body weight, for example 0.5, 0.9, 1.0, 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg / kg body weight can be used as a daily dose. EXAMPLES

[0032] The results of experiments conducted to complete the present invention are shown below as reference examples, and the present invention is explained in more detail in examples. However, the present invention is not limited to these, and various applications are possible within the scope of the technical concept of the present invention.

[0033] (Reference Example 1) Preparation of S100A8 / A9 heterodimer for producing anti-S100A8 / A9 antibody In this reference example, the preparation of S100A8 / A9 heterodimer as an antigen for the production of anti-S100A8 / A9 antibodies shown in the following examples is described. The S100A8 / A9 heterodimer was produced in E. coli using an expression vector (see FIG. 1) in which full-length S100A8 and full-length S100A9 were incorporated into pET21, and purified (see Futami J. et al., Biochem Biophys Rep., 19; 6: 94-100, (2016)). For comparative example, full-length S100A8 or full-length S100A9 was incorporated into pET21, and produced in E. coli by the same method as above, and purified (see Futami J. et al. (2016)).

[0034] The purified S100A8 / A9 heterodimer and the S100A8 and S100A9 monomers as comparative examples were subjected to SDS-PAGE and stained with CBB, and the results are shown in FIG. 2. It was confirmed that the S100A8 / A9 heterodimer had almost the same amount of S100A8 and S100A9, and was purified to a high degree of purity. Furthermore, the S100A8 / A9 heterodimer was analyzed by HPLC. As a result, when the structures of S100A8, S100A9, and S100A8 / A9 were compared, only S100A8 / A9 was found to have no monomer, and most of the structure was a dimer (see FIG. 3). On the other hand, S100A8 and S100A9 prepared as comparative examples were mixtures of monomer and dimer (see FIG. 3).

[0035] In FIG. 4, the naturally occurring S100A8 / A9 heterodimer (simply abbreviated as "A8-A9 heterodimer") is thermodynamically stable, but since S100A8 (simply abbreviated as "A8") and S100A9 (simply abbreviated as "A9") each form a homodimer, it is difficult to prepare a stable S100A8 / A9 heterodimer even if S100A8 and S100A9 are mixed. The S100A8 / A9 heterodimer prepared by the method of this Reference Example is highly stable and can be used as the S100A8 / A9 heterodimer antigen prepared in the Examples described below.

[0036] (Example 1) Preparation of anti-S100A8 / A9 monoclonal antibody In this example, the preparation of anti-S100A8 / A9 monoclonal antibodies used in the following Examples and Experimental Examples will be described. The anti-S100A8 / A9 monoclonal antibodies in this example were prepared using the S100A8 / A9 heterodimer prepared in the above (Reference Example 1) as an antigen.

[0037] (1) Generation of hybridomas The anti-S100A8 / A9 monoclonal antibody of this example was produced using the S100A8 / A9 heterodimer prepared in the above (Reference Example 1) as an antigen, and using the monoclonal antibody contract service, Genostaff (Nihon Genetics). Mice (BALB / c) were used as the immunized animals, and Titer-MAX was used as an adjuvant for antigen immunization. According to the conventional method, the spleen of the immunized animal was fused with mouse myeloma cells (P3U1) using polyethylene glycol (PEG1500) to produce hybridomas, and 160 clones were obtained.

[0038] (2) Hybridoma cloning and antibody production From the 160 hybridoma clones obtained above, S100A8 / A9 heterodimer, S100A8 or S100A9 was immobilized and ELISA screening was performed to select 10 clones shown in Figure 5. The selected hybridomas expressing S100A8 / A9 neutralizing antibody candidates ("α-S100A8 / A9 antibody" shown in Figure 5) were adapted to serum-free culture and prepared in large quantities for in vitro and in vivo experiments. The culture supernatant of each clone was collected and purified using a Protein G column, and several milligrams of protein were prepared for each clone. A purity test was performed using CBB staining, and no bands other than the target protein were detected, confirming that highly purified antibodies had been prepared.

[0039] (3) Reactivity of monoclonal antibodies The reactivity and subclass of the 10 clones selected in (2) above to the S100A8 / A9 heterodimer, S100A8 or S100A9 were confirmed, and the results are shown in Table 1. [Table 1]

[0040] (Example 2) Screening for neutralizing antibodies In this example, the effect of monoclonal antibodies produced from the 160 hybridoma clones prepared and selected in Example 1 on the production amount of S100A8 / A9-induced inflammatory cytokines was confirmed. Using human keratinocytes in which inflammatory cytokines are strongly induced by S100A8 / A9, the inhibitory effect of each antibody on the S100A8 / A9 signal was evaluated using the mRNA expression amount of inflammatory cytokines as an index. Specifically, 30 ng / mL purified S100A8 / A9 and each anti-S100A8 / A9 monoclonal antibody purified from 1 mL of hybridoma culture supernatant of 160 clones using a Protein G column were added to keratinocytes (Normal Human Keratinocytes: NHK), and the cells were collected after 3 hours of culture at 37°C, and the mRNA expression amounts of TNF-α, IL-6, and IL-8 were analyzed by real-time quantitative PCR (qPCR).

[0041] Real-time quantitative PCR (qPCR) analysis was performed using a LightCycler rapid thermal cycler system (ABI 7900HT; Applied Biosystems). Measurements were performed using forward (Fwd) and reverse (Rev) primers consisting of the following nucleotide sequences. For TNFα measurement Fwd:GACAAGCCTGTAGCCCATGT (sequence number 1) Rev:TCTCAGCTCCACGCCATT (SEQ ID NO:2) For IL-6 measurement Fwd: CTTCCCTGCCCCAGTACC (SEQ ID NO: 3) Rev:CTGAAGAGGTGAGTGGCTGTC (SEQ ID NO: 4) For IL-8 measurement Fwd:AGACAGCAGAGCACACAAGC (SEQ ID NO: 5) Rev: AGGAAGGCTGCCAAGAGAG (SEQ ID NO: 6)

[0042] As a result of the above, the measurement results of S100A8 / A9 (abbreviated simply as "A8 / A9")-induced inflammatory cytokines (TNF-α, IL-6, and IL-8) in the presence of the selected 10 clones (clone Nos.: 26, 42, 45, 85, 108, 213, 219, 235, 258, and 260) are shown in Figure 6. From the results, five antibodies with particularly high inhibitory power were selected (one antibody reacting with S100A8 (abbreviated simply as "A8"), two antibodies reacting with S100A9 (abbreviated simply as "A9"), and two antibodies reacting only with the S100A8 / A9 complex (abbreviated simply as "A8 / A9"). In addition, "α-S100A8 / A9 antibody" in Figure 6 refers to anti-S100A8 / A9 monoclonal antibody.

[0043] (Example 3) Amino acid sequences of the variable regions of selected antibodies The sequences of the heavy and light chain variable regions of five anti-S100A8 / A9 monoclonal antibodies (clone Nos. 45, 85, 235, 258 and 260) selected by the above screening were analyzed. VH-CDR Clone No. 45: CDR H1: SYWMQ (SEQ ID NO: 7) Clone No. 45: CDR H2: AIYPGDGDTRDTQKFKG (SEQ ID NO: 8) Clone No. 45: CDR H3: MAGYNYDNDY (SEQ ID NO: 9) Clone No. 85: CDR H1: SGYNWH (SEQ ID NO: 10) Clone No. 85: CDR H2: YIQYSGSTNYNPSLKS (SEQ ID NO: 11) Clone No. 85: CDR H3: ALRYDYSWFAY (SEQ ID NO: 12) Clone No. 235: CDR H1: NFWMN (SEQ ID NO: 13) Clone No. 235: CDR H2: QIYPGKSDTNYNGKFKG (SEQ ID NO: 14) Clone No. 235: CDR H3: WGAYYKYGGSYFDY (SEQ ID NO: 15) Clone No. 258: CDR H1: TASMGVS (SEQ ID NO: 16) Clone No. 258: CDR H2: HIYWDDDKRYNPSLKS (SEQ ID NO: 17) Clone No. 258: CDR H3: RPLGYFDV (SEQ ID NO: 18) Clone No. 260: CDR H1: NYGVH (SEQ ID NO: 19) Clone No. 260: CDR H2: VVWAGGSTNYNSALMS (SEQ ID NO: 20) Clone No. 260: CDR H3: ARDYYGYDGYFGA (SEQ ID NO: 21) VL-CDR Clone No. 45: CDR L1: KASQDINKYIA (SEQ ID NO: 22) Clone No. 45: CDR L2: YTSTLQP (SEQ ID NO: 23) Clone No. 45: CDR L3: LQYDNLRT (SEQ ID NO: 24) Clone No. 85: CDR L1: KASQDVSTAVA (SEQ ID NO: 25) Clone No. 85: CDR L2: SASYRYT (SEQ ID NO: 26) Clone No. 85: CDR L3: QQHYSTPLT (SEQ ID NO: 27) Clone No. 235: CDR L1: SASQGISNYLN (SEQ ID NO: 28) Clone No. 235: CDR L2: YTSSLHS (SEQ ID NO: 29) Clone No. 235: CDR L3: QQYSKFPYT (SEQ ID NO: 30) Clone No. 258: CDR L1: KASQDINNYIS (SEQ ID NO: 31) Clone No. 258: CDR L2: YTSTLQP (SEQ ID NO: 32) Clone No. 258: CDR L3: LQYDNLLWT (SEQ ID NO: 33) Clone No. 260: CDR L1: KASQDINSYLT (SEQ ID NO: 34) Clone No. 260: CDR L2: RANRLVD (SEQ ID NO: 35) Clone No. 260: CDR L3: LQYDEFPLT (SEQ ID NO: 36)

[0044] (Example 4) Preparation of anti-S100A8 / A9 chimeric antibody In this example, a chimeric antibody was produced by fusing a human IgG2-Fc portion to the Fab domain of an anti-S100A8 / A9 monoclonal antibody (clone No. 45). The sequences and CDRs of the variable regions of the heavy and light chains of the anti-S100A8 / A9 monoclonal antibody (clone No. 45) were analyzed, and a stable expression vector for CHO cells incorporating a sequence recombined with the variable region of human IgG2 was produced. The gene for the human IgG2-Fc portion was combined and transduced into CHO cells to produce a stable anti-S100A8 / A9 chimeric antibody (see FIG. 7). The antibody was produced by the method described in International Publication No. WO2017 / 061354.

[0045] (Example 5) Enhancement of fibroblast proliferation by S100A8 / A9 One of the causes of pulmonary fibrosis is abnormal proliferation of fibroblasts. Therefore, we investigated S100A8 / A9-dependent proliferation of fibroblasts. We confirmed the proliferation enhancement caused by the addition of S100A8 / A9 in mouse embryo fibroblasts (MEFs) derived from B6 mice (wild type: WT) and B6 mice in which RAGE, the main receptor of S100A8 / A9 in the lungs, was knocked out (RAGE- / -) by EdU (5-ethynyl-2'-deoxyuridine) staining (see Figure 8). We also confirmed the proliferation enhancement caused by the addition of S100A8 / A9 in human fetal normal lung tissue-derived fibroblasts (Human Lung Fibroblasts) MRC-5 cells by EdU staining (see Figure 9). Specifically, we confirmed the following method. First, we cultured fibroblasts in GIBCO 100% fetal bovine serum (FBS)-containing medium. (R)Fibroblast cells were cultured in DMEM / F-12 (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) medium and added to 6-well plates at 2 × 10 5 Cells were seeded at 1000 cells / well. After 24 hours of culture, the medium was replaced with serum-free medium. After another 24 hours of culture, the medium was replaced with 0.5% FBS-containing medium and various concentrations of S100A8 / A9 were added. After another 5 hours of culture, EdU was added, and after 1 hour, EdU-stained cells were observed under a microscope. As shown in Figures 8 and 9, the addition of S100A8 / A9 enhanced proliferation up to an S100A8 / A9 concentration of 100 ng / mL, and the proliferation rate was reduced at 1000 ng / mL.

[0046] These results confirmed that S100A8 / A9 acts like a growth factor on fibroblasts. However, no increase in proliferation was observed in cells derived from RAGE knockout B6 mice (RAGE- / -). This suggests that S100A8 / A9 promotes cell proliferation via RAGE, a receptor on fibroblasts.

[0047] (Example 6) Evaluation of S100A8 / A9-dependent NF-κB signal activation in fibroblasts and NF-κB signal inhibition by anti-S100A8 / A9 antibodies NF-κB, a transcription factor downstream of the S100A8 / A9 receptor RAGE, is activated to induce the expression of various inflammatory cytokines. To evaluate S100A8 / A9-dependent activation of NF-κB signaling in fibroblasts, the interaction between NF-κB and a biotin-labeled NF-κB-binding DNA probe was detected using a gel shift assay (electrophoretic mobility shift assay: EMSA). Next, the effect of anti-S100A8 / A9 antibodies on S100A8 / A9-induced NF-κB was confirmed by the same gel shift assay.

[0048] Specifically, this was confirmed by the following method. (R)5 × 10 fibroblasts from B6 mice (WT) cultured in DMEM / F-12 medium were placed in a 10 cm dish. 5 After 24 hours, the medium was replaced with serum-free medium. After 6 hours of culture, the medium was replaced with 0.5% FBS-containing medium, and control buffer (PBS) or 100 ng / mL S100A8 / A9 was added. After 0, 1, 6, 24, and 48 hours, the cells were washed with PBS and collected. The cells were suspended in 100 μL of Thermo Scientific M-PER (Mammalian Protein Extraction Reagent) to prepare cell lysates. Biotin-labeled NF-κB binding DNA probe (NF-κB consensus binding motif 5'-agttgaGGGGACTTTCCcaggc-3' (SEQ ID NO: 37)) was mixed with the cell lysate and incubated on ice for 30 minutes, followed by native gel electrophoresis (Native-PAGE). The gel was transferred to a nitrocellulose membrane, cross-linked by UV irradiation, blocked, reacted with Avidin-HRP, and detected by chemiluminescence. As a result, it was confirmed that NF-κB activity was induced in an S100A8 / A9-dependent manner, and that the activity reached a maximum 6 hours after addition (see FIG. 10).

[0049] Next, a gel shift assay was performed using fetal fibroblasts (MEFs) derived from B6 mice (WT) and RAGE knockout B6 mice (RAGE- / -) and fibroblasts (MRC-5) derived from human fetal normal lung tissue to confirm the effect of anti-S100A8 / A9 antibodies on NF-κB induced by S100A8 / A9. (R) 5 × 10 mouse fibroblasts cultured in DMEM / F-12 medium 5 1.5 × 10 MRC-5 cells 5Each of the cells was seeded in a 10 cm petri dish, and after 24 hours, the medium was replaced with serum-free medium. After 6 hours of culture, the medium was replaced with 0.5% FBS-containing medium, and control buffer, 100 ng / mL S100A8 / A9, 1 μg / mL IgG (control), or 1 μg / mL anti-S100A8 / A9 antibody (α-S100A8 / A9 antibody) was added in the combinations shown in Figure 11, and the cells were further cultured for 6 hours, after which the cell lysate was collected. Next, an experiment was performed in the same manner as above. As a result, in B6 mouse (WT) fetal fibroblasts (MEF) and human fetal normal lung tissue-derived fibroblast MRC-5 cells, NF-κB activity was observed in the system without anti-S100A8 / A9 antibody, but NF-κB activity was suppressed in the system with anti-S100A8 / A9 antibody (see Figure 11). In fetal fibroblasts (MEFs) derived from RAGE knockout B6 mice (RAGE- / -), it was confirmed that the NF-κB signal was slightly activated by stimulation with the S100A8 / A9 complex. Incidentally, the slight activation of the NF-κB signal was thought to be due to receptors other than RAGE (EMMPRIN, NPTNβ, MCAM, and ALCAM, which the inventors identified as S100A8 / A9 receptors). The activation of the NF-κB signal was completely suppressed by anti-S100A8 / A9 antibodies.

[0050] In addition, the anti-S100A8 / A9 antibody is clearly indicated as α-S100A8 / A9 antibody in Figure 11. α-S100A8 / A9 antibody means anti-S100A8 / A9 monoclonal antibody (clone No. 45), and IgG (control) means mouse IgG isotype control. The same applies to α-S100A8 / A9 antibody and IgG (control) in each figure shown in the following Examples.

[0051] Example 7: Evaluation of induction of α-SMA and collagen expression by S100A8 / A9 in fibroblasts and ability of anti-S100A8 / A9 antibodies to inhibit S100A8 / A9-induced α-SMA and collagen expression In the pathology of pulmonary fibrosis, differentiation of activated fibroblasts into myofibroblasts induces excessive deposition of collagen and extracellular matrix components, which exacerbates pulmonary fibrosis. Nintedanib, which is approved as a treatment for idiopathic pulmonary fibrosis (IPF), inhibits fibroblast proliferation and differentiation into myofibroblasts. We therefore confirmed that S100A8 / A9 is a risk factor for inducing differentiation of fibroblasts into myofibroblasts by measuring the expression of α-SMA (α-smooth muscle actin), a marker of myofibroblasts, and confirmed the effect of anti-S100A8 / A9 antibodies on α-SMA expression.

[0052] Specifically, this was confirmed by the following method. (R) 5 × 10 fibroblasts (MRC-5) derived from human fetal normal lung tissue cultured in DMEM / F-12 medium 4 , and 3 × 10 fetal fibroblasts from B6 mice (WT) and RAGE knockout B6 mice (RAGE− / −), respectively. 5 The cells were seeded in 10 cm petri dishes, and after 24 hours, the medium was replaced with serum-free medium. After further culturing for 6 hours, the medium was replaced with 0.5% FBS-containing medium, and control buffer, 100 ng / mL S100A8 / A9, 1 μg / mL IgG (control), or 1 μg / mL anti-S100A8 / A9 antibody was added in the combinations shown in Figures 12 and 13, and cell lysates were collected after 48 hours.

[0053] Western blotting was performed on the collected cell lysate to detect proteins. For fibroblasts (MRC-5) derived from human fetal normal lung tissue, proteins were detected using anti-α-SMA monoclonal antibody and anti-Tubulin antibody as a control. In MRC-5 cells, S100A8 / A9 strongly induced the expression of α-SMA, and the increase in expression was significantly suppressed by co-culture with anti-S100A8 / A9 antibody (see Figure 12). For fetal fibroblasts derived from B6 mice (WT) and RAGE knockout B6 mice (RAGE- / -), proteins were detected using anti-α-SMA monoclonal antibody, a biotin-labeled probe that specifically binds to collagen chains denatured by collagenase or mechanical damage to connective tissue, and anti-Tubulin antibody as a control.

[0054] In fetal fibroblasts derived from B6 mice (WT), S100A8 / A9 strongly induced the expression of α-SMA and collagen. The increase in expression of α-SMA and collagen induced by S100A8 / A9 was significantly suppressed by co-culture with anti-S100A8 / A9 antibody (see Figure 13). On the other hand, in fetal fibroblasts derived from RAGE knockout B6 mice (RAGE- / -), no increase in the expression of α-SMA and collagen was observed by S100A8 / A9. This suggests that S100A8 / A9 induces the expression of α-SMA and collagen via RAGE, a receptor on fibroblasts.

[0055] From the above, it was confirmed that S100A8 / A9 is a risk factor that induces differentiation of fibroblasts into myofibroblasts. Furthermore, the inhibitory effect of anti-S100A8 / A9 antibodies on the expression of α-SMA and collagen, which are markers of myofibroblasts, was confirmed (see Figures 12 and 13). These results suggest that anti-S100A8 / A9 antibodies have a preventive effect against pulmonary fibrosis.

[0056] Example 8: Inhibitory effect of anti-S100A8 / A9 antibody on lung injury in a pulmonary fibrosis model treated with intratracheal administration of bleomycin The lung injury suppression effect of anti-S100A8 / A9 antibody in a bleomycin-induced pulmonary fibrosis model was confirmed. According to the protocol shown in Figure 14, 50 μl of PBS containing 1.0 mg / kg of bleomycin per mouse body weight was administered into the trachea of ​​seven C57BL / 6J females (8 weeks old) in each group to prepare lung injury model mice. One to two hours after bleomycin administration, PBS buffer (control group: 0 μg) or 200 μg and 500 μg of anti-S100A8 / A9 antibody was administered into the tail vein.

[0057] When changes in the body weight of lung injury model mice were observed 7, 14, and 21 days after bleomycin administration, a significant suppression effect on mouse weight loss was observed in the anti-S100A8 / A9 antibody 500 μg administration group compared to the control group on days 7 and 14. On day 21, a significant suppression effect on mouse weight loss was observed in both the anti-S100A8 / A9 antibody 200 μg administration group and the anti-S100A8 / A9 antibody 500 μg administration group compared to the control group (FIG. 15).

[0058] Furthermore, the lung injury suppression effect of anti-S100A8 / A9 antibody was confirmed by CT scan on the 21st day after bleomycin administration. Representative CT scan images are shown in FIG. 16. Also, a graph quantified by imaging of high density areas (white areas in the lung tissue of the CT scan image) in the CT scan image is shown in FIG. 17. A significant suppression effect was observed on lung tissue injury and fibrosis on the 21st day after bleomycin administration in the group administered 500 μg of anti-S100A8 / A9 antibody. Furthermore, the survival rate of mice in this experiment is shown in FIG. 18. No dead mice were confirmed in the group administered 500 μg of anti-S100A8 / A9 antibody, but 5 out of 7 mice died in the group not administered the antibody. The number in the "Number at risk" column in the lower part of FIG. 18 indicates the number of surviving mice.

[0059] As described above, the anti-S100A8 / A9 antibody also exhibited excellent therapeutic effects against pulmonary fibrosis in an in vivo system using an intratracheal administration pulmonary fibrosis model.

[0060] (Example 9) Inhibitory effect of anti-S100A8 / A9 antibody on TMPRSS2 expression in human lung cells As shown in Example 8, anti-S100A8 / A9 antibodies have been found to have excellent therapeutic effects against pulmonary fibrosis. Subsequently, while investigating further pharmacological effects of anti-S100A8 / A9 antibodies, the present inventors focused on the fact that TMPRSS2, one of the host proteases expressed in respiratory epithelium, is one of the important proteins in SARS-CoV-2 infection, and investigated the effect of anti-S100A8 / A9 antibodies on TMPRSS2 expression. That is, using human lung cells, S100A8 / A9 protein-dependent changes in TMPRSS2 expression and the effect of anti-S100A8 / A9 antibodies on TMPRSS2 expression were investigated using anti-S100A8 / A9 monoclonal antibody (clone No. 45) as the anti-S100A8 / A9 antibody.

[0061] That is, normal parts of lung tissues excised during human lung cancer surgery were cut into pieces with a diameter of about 3 mm, and treated with collagenase in serum-free medium at 4°C for 24 hours to disperse lung tissue-derived cells. The cells thus obtained were suspended in serum-free medium, and then 1 μg / mL purified S100A8 / A9 and 10 μg / mL anti-S100A8 / A9 antibody (clone No. 45) or 10 μg / mL control IgG were added, and the cells were collected after culturing at 37°C for 6 hours, and RNA was extracted and real-time quantitative PCR (qPCR) analysis was performed for TMPRESS2 (Figure 19). The real-time quantitative PCR (qPCR) analysis was performed using StepOnePlus Realtime PCR (Applied Biosystems) and forward (Fwd) and reverse (Rev) primers consisting of the following base sequences.

[0062] Primer sequence for TMPRSS2 measurement Fwd: GATGACAGCGGATCCACCAG (SEQ ID NO: 38) Rev: CCGCAGGCTATACAGCGTAA (SEQ ID NO: 39)

[0063] As a result, it was found that TMPRSS2 activates SARS-CoV-2 that binds to the ACE2 receptor present on the cell surface, enhancing the rate of invasion into the cell (cleavage activation of the Spike protein of the viral outer membrane). Next, the inventors focused on the expression of TMPRSS2 in human lung cells and analyzed its mRNA expression, revealing that S100A8 / A9 significantly induced the expression of TMPRSS2 in human lung cells, and that anti-S100A8 / A9 antibodies significantly suppressed the induced expression.

[0064] Based on the above findings, it was suggested that anti-S100A8 / A9 antibodies may be useful in the treatment of COVID-19, not only for suppressing the cytokine storm induced by the SARS-CoV-2 virus, but also for protecting against SARS-CoV-2 infection by suppressing TMPRSS2 expression. [Industrial Applicability]

[0065] As described above, the preventive and / or therapeutic agent for inflammatory lung disease of the present invention can effectively prevent and / or treat inflammatory lung disease by blocking the interaction between S100A8 / A9, whose expression increases with inflammatory lung disease, and its receptor, RAGE, which is highly expressed in alveolar epithelial cells that are the starting point of the pathology, and multiple S100A8 / A9 receptors expressed in pulmonary fibroblasts, thereby suppressing the release of inflammatory cytokines from alveolar epithelial cells and the proliferation of pulmonary fibroblasts, and further suppressing the differentiation of activated fibroblasts into myofibroblasts. In addition, the preventive and / or therapeutic agent for inflammatory lung disease of the present invention can also be suitably used as a preventive agent and / or treatment for COVID-19. The industrial usefulness of the present invention, which has such a remarkable action and effect, is immeasurable.

Claims

1. An agent for inhibiting TMPRSS2 expression, comprising as an active ingredient an antibody or antigen-binding fragment thereof that blocks the interaction between the receptor for a heterodimer of S100A8 and S100A9 proteins and the heterodimer, and has affinity for the heterodimer, the affinity being higher than the affinity for S100A8 monomers and / or S100A9 monomers.

2. The agent described in claim 1, characterized in that the TMPRSS2 expression inhibitor has one or more effects selected from an NF-κβ signal inhibitory effect, an inhibitory effect on fibroblast proliferation, an inhibitory effect on fibroblast proliferation, and an inhibitory effect on the differentiation of fibroblasts into myofibroblasts, as well as a TMPRSS2 expression inhibitory effect.

3. The agent according to claim 1 or 2, wherein the antibody or antigen-binding fragment thereof has neutralizing ability against the heterodimer of S100A8 and S100A9, but has no affinity for S100A8 monomer and / or S100A9 monomer.

4. The agent according to any one of claims 1 to 3, wherein the receptor for the heterodimer of S100A8 and S100A9 is any one or more selected from EMMPRIN, NPTNβ, MCAM, ALCAM and RAGE.

5. The agent according to any one of claims 1 to 4, wherein the antibody or antigen-binding fragment thereof is a monoclonal antibody or an antigen-binding fragment thereof.

6. The subclass of the monoclonal antibody is IgG 1 , IgG 2 , IgG 3 and IgG 4 The agent according to claim 5 , which is any one selected from the following.

7. The antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3); Heavy chain variable region 1 (CDR H1) comprises the amino acid sequence shown in SEQ ID NO:7; The heavy chain variable region 2 (CDR H2) comprises the amino acid sequence shown in SEQ ID NO:8, The heavy chain variable region 3 (CDR H3) comprises the amino acid sequence shown in SEQ ID NO:9, the light chain variable region 1 (CDR L1) comprises the amino acid sequence shown in SEQ ID NO: 22; The light chain variable region 2 (CDR L2) comprises the amino acid sequence shown in SEQ ID NO: 23, The agent according to any one of claims 1 to 6, wherein the light chain variable region 3 (CDR L3) comprises the amino acid sequence shown in SEQ ID NO:

24.

8. The antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3); heavy chain variable region 1 (CDR H1) comprises the amino acid sequence shown in SEQ ID NO: 10; The heavy chain variable region 2 (CDR H2) comprises the amino acid sequence shown in SEQ ID NO: 11; The heavy chain variable region 3 (CDR H3) comprises the amino acid sequence shown in SEQ ID NO: 12; light chain variable region 1 (CDR L1) comprises the amino acid sequence shown in SEQ ID NO: 25; The light chain variable region 2 (CDR L2) comprises the amino acid sequence shown in SEQ ID NO: 26; The agent according to any one of claims 1 to 6, wherein the light chain variable region 3 (CDR L3) comprises the amino acid sequence shown in SEQ ID NO:

27.

9. The antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3); Heavy chain variable region 1 (CDR H1) comprises the amino acid sequence shown in SEQ ID NO: 13; The heavy chain variable region 2 (CDR H2) comprises the amino acid sequence shown in SEQ ID NO: 14; The heavy chain variable region 3 (CDR H3) comprises the amino acid sequence shown in SEQ ID NO: 15; the light chain variable region 1 (CDR L1) comprises the amino acid sequence shown in SEQ ID NO:28; The light chain variable region 2 (CDR L2) comprises the amino acid sequence shown in SEQ ID NO:29, The agent according to any one of claims 1 to 6, wherein the light chain variable region 3 (CDR L3) comprises the amino acid sequence shown in SEQ ID NO:

30.

10. The antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3); Heavy chain variable region 1 (CDR H1) comprises the amino acid sequence shown in SEQ ID NO: 16; The heavy chain variable region 2 (CDR H2) comprises the amino acid sequence shown in SEQ ID NO: 17; The heavy chain variable region 3 (CDR H3) comprises the amino acid sequence shown in SEQ ID NO: 18; the light chain variable region 1 (CDR L1) comprises the amino acid sequence shown in SEQ ID NO: 31; The light chain variable region 2 (CDR L2) comprises the amino acid sequence shown in SEQ ID NO: 32; The agent according to any one of claims 1 to 6, wherein the light chain variable region 3 (CDR L3) comprises the amino acid sequence shown in SEQ ID NO:

33.

11. The antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising heavy chain variable region 1 (CDR H1), heavy chain variable region 2 (CDR H2) and heavy chain variable region 3 (CDR H3), and a light chain variable region comprising light chain variable region 1 (CDR L1), light chain variable region 2 (CDR L2) and light chain variable region 3 (CDR L3); heavy chain variable region 1 (CDR H1) comprises the amino acid sequence shown in SEQ ID NO: 19; heavy chain variable region 2 (CDR H2) comprises the amino acid sequence shown in SEQ ID NO: 20; The heavy chain variable region 3 (CDR H3) comprises the amino acid sequence shown in SEQ ID NO: 21; the light chain variable region 1 (CDR L1) comprises the amino acid sequence shown in SEQ ID NO: 34; The light chain variable region 2 (CDR L2) comprises the amino acid sequence shown in SEQ ID NO: 35; The agent according to any one of claims 1 to 6, wherein the light chain variable region 3 (CDR L3) comprises the amino acid sequence shown in SEQ ID NO:

36.

12. The agent according to any one of claims 1 to 11, characterized in that it blocks the interaction between S100A8 and S100A9 and their receptor RAGE, suppresses the expression of NF-κB, which is a transcription factor downstream of RAGE and induces the expression of inflammatory cytokines, and the proliferation of pulmonary fibroblasts, as well as suppresses the proliferation of activated fibroblasts, and further suppresses the differentiation of activated fibroblasts into myofibroblasts.

13. An agent described in any of claims 1 to 12 as a preventive and / or therapeutic agent for inflammatory lung disease or COVID-19.

Images