Long-acting coagulation factor and method for producing same

Abstract

It provides a method for achieving an extension of the half-life of FVIIa while preserving the biological activity of this protein and ensuring that the modification does not induce significant immunogenicity. [Solution] Polypeptides and polynucleotides encoding the same are disclosed, which include at least one carboxy-terminal peptide (CTP) of chorionic gonadotropin linked to the carboxy-terminus but not the amino-terminus of a coagulation factor. Also disclosed are pharmaceutical compositions and formulations comprising the disclosed polypeptides and polynucleotides, and methods for using and making the same.

Description

[Technical field]

[0001] Disclosed are polypeptides and polynucleotides encoding same that comprise at least one carboxy terminal peptide (CTP) of chorionic gonadotropin linked to the carboxy terminus of a coagulation factor. Pharmaceutical compositions and formulations that comprise the disclosed polypeptides and polynucleotides, as well as methods of using and making the same, are also disclosed. [Background technology]

[0002] The development of clotting factor replacement therapy has transformed the lives of many hemophiliacs. Hemophilia is a group of inherited genetic disorders that impair the body's ability to control blood clotting, or coagulation. Hemophiliacs do not produce sufficient amounts of factor VIII or factor IX proteins, which are necessary for effective blood clotting. In severe hemophiliacs, even minor injuries can result in blood loss that lasts for days or weeks, never heal completely, and can result in debilitating, permanent damage to joints and other organs and premature death.

[0003] Hemophilia is an inherited, X-linked bleeding disorder caused by the deficiency or absence of key factors in the coagulation cascade. In hemophilia patients, thrombin generation and fibrin clot formation are severely impaired, resulting in spontaneous bleeding episodes, most commonly in joints and internal organs, and excessive bleeding after surgery or trauma. Frequent bleeding in hemophilia patients can also cause joint swelling, joint damage, extreme deformity, frequent infections, and reduced mobility (Mayo Clinic). Hemophilia A is caused by defective or absent factor VIII expression, and hemophilia B is caused by defective or absent factor IX expression.

[0004] Hemophilia B results in a deficiency in the procoagulant activity of FIX. Patients with hemophilia B have spontaneous soft tissue bleeding and recurrent hemarthrosis, which often leads to crippling arthropathy. Current treatment for these patients includes intravenous administration of recombinant FIX. However, the expense of FIX and its relatively rapid clearance from the circulation make the development of long-acting FIX a challenging task. Commercially available FVIII and FIX have led to improved control of life-threatening bleeding episodes. Many patients receive prophylactic treatment, thereby reducing the risk of bleeding and associated complications. However, a significant proportion (10-30%) of patients develop inhibitory antibodies against exogenously administered FVIII and FIX. Administration of a bypass product, FVIIa, may induce homeostasis and provide an effective treatment for patients with inhibitory antibodies.

[0005] Recombinant FVIIa (NovoSeven®) is commercially available and was approved in 1996 for the treatment of bleeding episodes in hemophilia patients with inhibitors. However, rFVIIa is rapidly eliminated with a terminal half-life of 2.5 hours. As a result, patients usually require multiple frequent infusions (2-3 doses administered at 2-3 hour intervals) to achieve adequate homeostasis after mild to moderate bleeding. This has led to great interest in the development of a long-acting form of FVIIa that would extend the period of hemostatic activity after a single dose and allow for a much lower dosing frequency. Long-acting FVIIa would also increase the feasibility of long-term prophylactic therapy.

[0006] Various techniques have been developed to extend the half-life of FVIIa. However, there remains a need to achieve this extension of the half-life of the protein while preserving the biological activity of the protein and ensuring that the modification does not induce significant immunogenicity. The present invention addresses this need by modifying FVIIa to extend its half-life and biological activity by conjugating gonadotropin carboxy-terminal peptide (CTP) to FVIIa. Summary of the Invention [Means for solving the problem]

[0007] In one aspect, the present invention provides a CTP-modified polypeptide consisting of coagulation factor VII and three chorionic gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of said coagulation factor, said polypeptide not containing a signal peptide. In another aspect, the present invention provides a CTP-modified polypeptide, wherein the coagulation factor is activated FVII (FVIIa). In another aspect, the sequence of the CTP-modified coagulation factor is set forth in SEQ ID NO: 46.

[0008] In another embodiment, activated FVIIa-CTP 3 The CTP-modified polypeptide comprising comprises a light chain and a heavy chain linked by a disulfide bond. In another embodiment, separation of the light chain and the heavy chain by SDS-PAGE gel occurs under denaturing conditions, and the light chain migrates at about 25 kDa molecular weight and the heavy chain migrates at about 60 kDa molecular weight.

[0009] In one aspect, the invention provides a pharmaceutical formulation comprising a buffer, an amino acid, which in another embodiment is glycine, a tonicity agent, and a CTP-modified polypeptide consisting of coagulation factor VII and three chorionic gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of said coagulation factor, wherein the polypeptide does not contain a signal peptide. In another aspect, the buffer comprises 20 mM citrate. In another aspect, the tonicity agent is 150 mM sodium chloride. In another aspect, the formulation is a liquid formulation. In another aspect, the formulation is at a pH of about 6.4.

[0010] In another embodiment, the present invention provides a formulation comprising 20 mM citrate, 13.3 mM glycine, 150 mM sodium chloride, and a pH of about 6.4.

[0011] In another aspect, the present invention provides a pharmaceutical formulation, wherein the coagulation factor is activated FVII (FVIIa). In another embodiment, the sequence of the CTP-modified coagulation factor is as set forth in SEQ ID NO: 46. In another aspect, the pharmaceutical formulation comprising the polypeptide is administered daily, every other day, every third day, once a week, twice a week, or once every other week, or any combination thereof. In another aspect, the administration of the pharmaceutical formulation is intravenous or subcutaneous.

[0012] In another aspect, the invention provides a pharmaceutical composition comprising a CTP-modified polypeptide described herein and a pharma- ceutically acceptable carrier.

[0013] In another aspect, the present invention provides a pharmaceutical composition comprising the pharmaceutical formulation described herein.

[0014] In one aspect, the present invention provides a method for extending the biological half-life of coagulation factor VII (FVII), comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII coagulation factor, thereby extending the biological half-life of the coagulation factor, wherein the activated form of the coagulation factor does not contain a signal peptide. In another aspect, the coagulation factor is activated FVII (FVIIa). In another aspect, the sequence of the activated CTP-modified coagulation factor is as set forth in SEQ ID NO: 46.

[0015] In one aspect, the present invention provides a method for increasing the area under the curve (AUC) of coagulation factor VII (FVII), comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII coagulation factor, thereby increasing the AUC of the coagulation factor, wherein the activated form of the coagulation factor does not contain a signal peptide. In another aspect, the coagulation factor is activated FVII (FVIIa). In another aspect, the sequence of the activated CTP-modified coagulation factor is as set forth in SEQ ID NO: 46.

[0016] In one aspect, the present invention provides a method for reducing the frequency of administration of coagulation factor VIIa (FVII), comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII coagulation factor, thereby reducing the frequency of administration of the coagulation factor, wherein the activated form of the coagulation factor does not contain a signal peptide. In another aspect, the sequence of the activated CTP-modified coagulation factor is as set forth in SEQ ID NO:46.

[0017] In one aspect, the present invention provides a method of preventing or treating a blood clotting disorder or abnormality in a subject, the method comprising the step of administering to the subject an activated CTP-modified coagulation factor polypeptide, thereby preventing or treating a blood clotting disorder or abnormality in said subject, wherein said coagulation factor is FVIIa-CTP. 3 In another embodiment, the disorder is hemophilia. In another embodiment, the hemophilia includes hemophilia A or hemophilia B with inhibitors. In another embodiment, administration is via a subcutaneous route. In another embodiment, administration is via an intravenous route.

[0018] In another aspect, the invention provides a method for reducing a bleeding episode.

[0019] Other features and advantages of the present invention will become apparent from the following detailed description, examples, and drawings. However, it should be understood that while the detailed description and specific examples indicate preferred embodiments of the disclosure, various changes and modifications within the spirit and scope of the disclosure will be apparent to those skilled in the art from this detailed description, and therefore, they are given by way of illustration only. [Brief description of the drawings]

[0020] The patent or patent application file contains at least one color drawing. Copies of any patent or patent application publication containing such color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and for a fee.

[0021] [Figure 1](FIG. 1A) Bar graph showing limiting dilution harvest cells transfected and selected with FIX-CTP and FIX-CTP-CTP variants in the presence of 5 μg / ml vitamin K3. FIX levels were quantified using a human FIX ELISA kit (Affinity Biologicals, Cat. No. FIX-AG RUO). Calculated protein concentrations (μg / ml) are the average of two independent experiments. (FIG. 1B) SDS-PAGE gel micrograph of FIX antibody recognition and anti-FIX antibody recognition in Western blot. Lane 1 of FIG. 1B was loaded with a sample containing recombinant FIX, lane 2 of FIG. 1B was loaded with a sample containing FIX-CTP harvest. Lane 3 of FIG. 1B was loaded with a sample containing FIX-(CTP)2 harvest. (FIG. 1C) SDS-PAGE gel micrograph of FIX antibody recognition. FIG. 1C shows anti-γ-carboxylated antibody recognition in Western blot. Lane 1 in Figure 1C was loaded with a sample containing recombinant FIX. Lane 2 in Figure 1C was loaded with a sample containing FIX-CTP harvest. Lane 3 in Figure 1C was loaded with a sample containing FIX-(CTP)2 harvest. [Diagram 2] Graph showing FIX-CTP and FIX-(CTP)2 harvests showing comparable chromogenic activity (measured by EC50 concentration) compared to rhFIX (American Diagnostics). [Diagram 3] 1 is a graph showing the PK profiles of rhFIX, harvest of FIX-CTP-CTP, and harvest of FIX-CTP. [Figure 4] 1 is a bar graph showing the levels of FIX antigen in FIX-CTP harvest and FIX-CTP-CTP harvest and FIX-CTP-CTP purified proteins as determined using a human FIX ELISA kit (Affinity Biologicals, Cat. No. FIX-AG RUO). Calculated protein concentrations (μg / ml) are the average of two independent experiments. [Diagram 5](FIG. 5A) SDS-PAGE gel micrograph of FIX antibody recognition and Coomassie blue staining. Lane 1 was loaded with a sample containing FIX-(CTP)2. Lane 2 was loaded with a sample containing unbound FIX-(CTP)2. Lane 3 was loaded with a sample containing a concentrated eluate of FIX-(CTP)2. (FIG. 5B) SDS-PAGE gel micrograph of FIX antibody recognition and anti-FIX antibody recognition in Western blot. Lane 1 was loaded with a sample containing FIX-(CTP)2. Lane 2 was loaded with a sample containing unbound FIX-(CTP)2. Lane 3 was loaded with a sample containing a concentrated eluate of FIX-(CTP)2. (FIG. 5C) SDS-PAGE gel micrograph of FIX antibody recognition and anti-γ-carboxylated antibody recognition in Western blot. Lane 1 was loaded with a sample containing FIX-(CTP)2. Lane 2 was loaded with a sample containing unbound FIX-(CTP)2, and lane 3 was loaded with a sample containing a concentrated eluate of FIX-(CTP)2. [Figure 6] Graph showing FIX-(CTP)2 chromogenic activity (sample concentration / OD) compared to human normal pooled plasma and rhFIX (American Diagnostics). [Figure 7] 1 is a graph showing the PK profiles of purified FIX-CTP-CTP, rhFIX, harvest of FIX-CTP-CTP, and harvest of FIX-CTP. [Figure 8](FIG. 8A) Western blot of anti-CTP and anti-γ-carboxylated antibodies of FIX fused to 3, 4 or 5 CTPs. FIX-CTP3, FIX-CTP4 and FIX-CTP5 harvests were loaded on a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot with anti-CTP polyclonal antibody (Adar Biotech Production). (FIG. 8B) Western blot of anti-CTP and anti-γ-carboxylated antibodies of FIX fused to 3, 4 or 5 CTPs. FIX-CTP3, FIX-CTP4 and FIX-CTP5 harvests were loaded on a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot with anti-Gla antibody (American Diagnostica). [Figure 9] Coomassie blue detection of FIX-CTP3, FIX-CTP4, and FIX-CTP5 is shown. After the purification process utilizing Jacalin columns (immunoaffinity purification of glycosylated proteins), FIX-CTP3, FIX-CTP4, and FIX-CTP5 were loaded onto a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE was stained with Coomassie blue dye for sample detection. [Figure 10] Figure 1 shows FIX chromogenic activity. Comparative evaluation of the in vitro potency of fully purified (HA column) FIX-CTP3, FIX-CTP4 and FIX-CTP5 versus pooled human normal plasma was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221802). All samples were serially diluted and potency was assessed by comparing dose-response curves against a reference preparation consisting of normal human plasma. [Figure 11]A comparison of the pharmacokinetic (PK) profiles of FIX-CTP3, FIX-CTP4 and FIX-CTP5 is shown. FIX concentrations in plasma samples were quantified using a Human FIX Elisa kit (Affinity Biologicals). Pharmacokinetic profiles were calculated, which are the average of three animals at each time point. Terminal half-lives were calculated using PK Solutions 2.0 software. [Figure 12-1](FIG. 12A) SDS-PAGE analysis of FIX-CTP3-Coomassie stained SDS-PAGE. FIX-CTP3 γ-carboxylated enriched protein, rhFIX and rFIXa (activated FIX) were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE Coomassie analysis was performed by staining the gel with Coomassie Blue reagent (800 ng of protein). (FIG. 12B) SDS-PAGE analysis of FIX-CTP3-Coomassie stained SDS-PAGE. FIX-CTP3 γ-carboxylated enriched protein, rhFIX and rFIXa (activated FIX) were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). Western immunoblot was performed with anti-human FIX polyclonal antibody using 100 ng of protein. (FIG. 12C) SDS-PAGE analysis of FIX-CTP3-Coomassie stained SDS-PAGE. FIX-CTP3 γ-carboxylated enriched protein, rhFIX and rFIXa (activated FIX) were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). Western immunoblots were performed with anti-human γ-carboxylated monoclonal antibody (American Diagnostics Catalog No. 499,3570) using 100 ng of protein. (FIG. 12D) SDS-PAGE analysis of FIX-CTP3-Coomassie stained SDS-PAGE. FIX-CTP3 γ-carboxylated enriched protein, rhFIX and rFIXa (activated FIX) were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). Western immunoblots were performed with anti-FIX propeptide polyclonal antibody using 100 ng of protein. [Figure 12-2](FIG. 12E) SDS-PAGE analysis of FIX-CTP3 - Coomassie stained SDS-PAGE. FIX-CTP3 γ-carboxylated enriched protein, rhFIX and rFIXa (activated FIX) were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). Western immunoblots were performed with anti-CTP polyclonal antibody using 100 ng of protein. [Figure 13] FIX-CTP3 chromogenic activity is shown. Comparative evaluation of the in vitro potency of FIX-CTP3 harvest and FIX-CTP3 γ-carboxylated enriched protein versus pooled human normal plasma was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221802). FIX-CTP3 harvest and protein were serially diluted and their potency was assessed by comparing dose-response curves to a reference preparation consisting of normal human plasma. [Figure 14] Clotting time comparison. An in vitro aPTT (activated partial thrombin time assay) was performed to compare the clotting activity of FIX-CTP3 to BeneFIX. The protein was serially diluted and spiked into human FIX-depleted plasma and clotting times were assessed. [Figure 15] A comparison of the PK profiles of FIX-CTP3 is shown. FIX concentrations were quantified using human FIX ELISA kits (Affinity Biologicals, Cat. No. FIX-AG RUO). Pharmacokinetic profiles were calculated for each protein, which is the average of three animals at each time point. [Figure 16](FIG. 16A) In parallel with PK sampling, citrated plasma samples from FIX-deficient animals administered FIX-CTP3 were assessed for their clotting activity by aPTT assay, which was converted to % activity. The % activity at each collection time point was calculated as clotting time at that time point / clotting time of normal pooled mouse plasma x 100. (FIG. 16B) In parallel with PK sampling, citrated plasma samples from FIX-deficient animals administered BeneFIX® were assessed for their clotting activity by aPTT assay, which was converted to % activity. The % activity at each collection time point was calculated as clotting time at that time point / clotting time of normal pooled mouse plasma x 100. [Figure 17-1] (FIG. 17A) First challenge bleeding parameters are shown. FIX-deficient mice were administered a single intravenous injection of 100 IU / Kg of BeneFIX® or rFIX-CTP3. The tail vein was slightly clipped 48 hours after administration to assess tail vein bleeding time (TVBT). A second bleeding challenge was performed 15 minutes after homeostasis was reached and the same parameters were measured. (FIG. 17B) First bleeding challenge parameters are shown. FIX-deficient mice were administered a single intravenous injection of 100 IU / Kg of BeneFIX® or rFIX-CTP3. The tail vein was slightly clipped 48 hours after administration to assess tail vein bleeding time (TVBT). A second bleeding challenge was performed 15 minutes after homeostasis was reached and the same parameters were measured. [Figure 17-2](FIG. 17C) First challenge bleeding parameters are shown. FIX-deficient mice were administered a single intravenous injection of 100 IU / Kg of BeneFIX® or rFIX-CTP3. The tail vein was slightly clipped 48 hours after administration to assess bleeding intensity (hemoglobin OD). A second bleeding challenge was performed 15 minutes after homeostasis was reached and the same parameters were measured. (FIG. 17D) First challenge bleeding parameters are shown. FIX-deficient mice were administered a single intravenous injection of 100 IU / Kg of BeneFIX® or rFIX-CTP3. The tail vein was slightly clipped 48 hours after administration to assess bleeding intensity (hemoglobin OD). A second bleeding challenge was performed 15 minutes after homeostasis was reached and the same parameters were measured. [Figure 18-1] (FIG. 18A) Second challenge bleeding parameters are shown. Once the first bleed stopped naturally or manually as described in the legend to FIG. 19, a second bleeding challenge was performed 15 minutes after the first and time was re-measured. (FIG. 18B) Second challenge bleeding parameters are shown. Once the first bleed stopped naturally or manually as described in the legend to FIG. 19, a second bleeding challenge was performed 15 minutes after the first and time was re-measured. [Figure 18-2] (FIG. 18C) Second challenge bleeding parameters are shown. Once the first bleeding as described in the legend to FIG. 19 had stopped naturally or manually, a second bleeding challenge was performed 15 minutes after the first, and bleeding intensity was remeasured. (FIG. 18D) Second challenge bleeding parameters are shown. Once the first bleeding as described in the legend to FIG. 19 had stopped naturally or manually, a second bleeding challenge was performed 15 minutes after the first, and bleeding intensity was remeasured. [Figure 19] (Figure 19A) rFVII-CTP constructs (Figure 19B) rFVII-CTP-CTP constructs (Figure 19C) rFIX-CTP constructs (Figure 19D) rFIX-CTP-CTP constructs. [Figure 20-1](FIG. 20A) Bar graph showing limiting dilution harvested clonal cells transfected and selected with FVII-CTP mutants in the presence of 5 μg / ml Vitamin K3. FVII levels were quantified using FVII ELISA (AssayPro). [Figure 20-2] (FIG. 20B) Bar graph showing limiting dilution harvested cells transfected and selected with FVII-CTP mutants in the presence of 5 μg Vitamin K3. FVII activity was quantified using a FVII chromogenic activity assay (AssayPro). (FIG. 20C) Bar graph showing limiting dilution harvested cells transfected and selected with FVII-CTP mutants in the presence of 5 μg Vitamin K3. FVII specific activity was calculated for each type by dividing the activity value by the harvest FVII concentration. [Figure 20-3] (Figure 20D) Graph showing PK profiles of FVII, FVII-CTP-CTP, and harvest of FVII-CTP. [Figure 21](FIG. 21A) Western blot of FVII fused with 3, 4 and 5 CTPs detected with anti-FVII, anti-CTP and anti-γ-carboxylated antibodies. Harvested FVII-CTP3, FVII-CTP4 and FVII-CTP5 were loaded on 12% Tris-glycine gel (expedeon) with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed with anti-FVII by Western immunoblot. (FIG. 21B) Western blot of FVII fused with 3, 4 and 5 CTPs detected with anti-FVII, anti-CTP and anti-γ-carboxylated antibodies. Harvested FVII-CTP3, FVII-CTP4 and FVII-CTP5 were loaded on 12% Tris-glycine gel (expedeon) with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot using anti-CTP polyclonal antibody (Adar Biotech Production). (FIG. 21C) Western blot of FVII fused with 3, 4 and 5 CTPs detected with anti-FVII, anti-CTP and anti-γ-carboxylated antibodies. Harvested FVII-CTP3, FVII-CTP4 and FVII-CTP5 were loaded on 12% Tris-glycine gel (expedeon) with Precision plus dual color protein marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot using anti-Gla antibody (American Diagnostica). [Figure 22] Figure 1 shows FVII activity-chromogenic activity. Comparative evaluation of the in vitro potency of HA purified (highly gamma-carboxylated fraction) FVII-CTP3, FVII-CTP4, and FVII-CTP5 against pooled normal human plasma was performed using a commercial chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221304). All samples were serially diluted and potency was assessed by comparing dose-response curves against a reference preparation consisting of normal human plasma. [Diagram 23]The first comparison of pharmacokinetic (PK) profiles of FVII3, 4 and 5CTP is shown. FVII-CTP3, FVII-CTP4 and FVII-CTP5 (groups A, B and C, respectively) were administered at a dose of 250 μg / kg body weight by a single intravenous injection to Sprague Dawley rats (6 rats per treatment). Blood samples were collected from the retro-orbital site from three rats at alternating times of 0.083, 0.5, 2, 5, 8, 24, 48, 72 and 96 hours after administration. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis. FVII-CTP5 showed a superior profile compared to the two other types. [Figure 24] A second comparison of the PK profiles of CTPs of FVII3, 4 and 5 is shown. FVII-CTP3, FVII-CTP4 and FVII-CTP5 after FVII selection and HA purification process (groups A, B and C, respectively) were administered to Sprague Dawley rats (3 rats per substance) at a dose of 29.45 μg / kg body weight by single intravenous injection. Blood samples were drawn from the retro-orbital site at 0.083, 0.5, 2, 8, 24, 48 and 72 hours after administration. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis. [Diagram 25] (FIG. 25A) Schematic diagram of FVII-CTP3 purification process. Batch 31 was made for PK / PD study. (FIG. 25B) Schematic diagram of FVII-CTP3 purification process. Batch 38 was made for viability study. [Figure 26-1](Figure 26A) SDS-PAGE and Western blot of the final FVII and FVIIa. 10 μg (Batch 31) or 5 μg (Batch 38) were loaded per lane of Coomassie stained SDS-PAGE. 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. All three antibodies detect FVII. (Figure 26B) SDS-PAGE and Western blot of the final FVII and FVIIa. 10 μg (Batch 31) or 5 μg (Batch 38) were loaded per lane of Coomassie stained SDS-PAGE. 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. (Figure 26C) SDS-PAGE and Western blot of the final FVII and FVIIa. 10 μg (batch 31) or 5 μg (batch 38) were loaded per lane of Coomassie stained SDS-PAGE: 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. (Figure 26D) SDS-PAGE and Western blot of final FVII and FVIIa are shown. 10 μg (batch 31) or 5 μg (batch 38) were loaded per lane of Coomassie stained SDS-PAGE: 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. [Figure 26-2](Figure 26E) SDS-PAGE and Western blot of final FVII and FVIIa. 10 μg (batch 31) or 5 μg (batch 38) were loaded in each lane of Coomassie stained SDS-PAGE. 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. (Figure 26F) SDS-PAGE and Western blot of final FVII and FVIIa. 1 μg of protein was loaded in each lane of the Western blot. 1. FVII-CTP3 polypeptide, 2. heavy chain (with 3xCTP), 3. light chain. All three antibodies detect FVII. FVIIa light chain is detected with α-FVII. (Figure 26G) SDS-PAGE and Western blot of final FVII and FVIIa. 1 μg of protein was loaded in each lane of the Western blot. 1. FVII-CTP3 polypeptide, 2. heavy chain (containing 3xCTP), 3. light chain. All three antibodies detect FVII. FVIIa heavy chain is detected by α-CTP. (Figure 26H) SDS-PAGE and Western blot of final FVII and FVIIa are shown. 1 μg of protein was loaded in each lane of the Western blot. 1. FVII-CTP3 polypeptide, 2. heavy chain (containing 3xCTP), 3. light chain. All three antibodies detect FVII. FVIIa heavy chain is detected by α-Gla. [Figure 27] This shows that the chromogenic activity of FVII-CTP3 was enhanced as a result of purification on a ceramic hydroxyapatite (HA) column. Comparative evaluation of the in vitro potency of FVII-CTP3 harvest in process fractions and purified FVII-CTP3 versus pooled human normal plasma was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221304). FVII-CTP3 harvest and protein were serially diluted and their potency was assessed by comparing dose-response curves to a reference preparation of normal human plasma. [Figure 28]Figure 1 shows the PK profile of FVIIa-CTP3 vs. NovoSeven® in FVIII-deficient mice. FVIIa-CTP3 was generated after FVII selection, HA purification process and activation. FVIIa-CTP3 or NovoSeven® was administered to FVIII- / - hemophilic mice by a single intravenous injection. Blood samples were collected from the retro-orbital site at 0.083, 0.5, 2, 8, 24, 48 and 72 hours after administration. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis, and the PK profile was confirmed based on FVIIa clotting activity using a STACLOT commercial kit. [Figure 29](Figure 29A) FVIIa-CTP3 was generated after FVII selection, HA purification process and activation. FVIIa-CTP3 or NovoSeven® was administered to FVIII- / - hemophilic mice by a single intravenous injection. Blood samples were collected from the retro-orbital site at 0.083, 0.5, 2, 8, 24, 48 and 72 hours after administration. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis. Thrombin generation parameters were evaluated during the PK experiment, including maximum to peak. (Figure 29B) FVIIa-CTP3 was generated after FVII selection, HA purification process and activation. FVIIa-CTP3 or NovoSeven® was administered to FVIII- / - hemophilic mice by a single intravenous injection. Blood samples were collected from the retro-orbital site at 0.083, 0.5, 2, 8, 24, 48, and 72 hours after dosing. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis. Thrombin generation parameters were evaluated during the PK study, including the amount of thrombin for each time point. (Figure 29C) FVIIa-CTP3 was generated after FVII selection, HA purification process, and activation. FVIIa-CTP3 or NovoSeven® was administered to FVIII- / - hemophilic mice in a single intravenous injection. Blood samples were collected from the retro-orbital site at 0.083, 0.5, 2, 8, 24, 48, and 72 hours after dosing. Citrated plasma (0.38%) was prepared immediately after sampling and stored at -20°C until analysis. Thrombin generation parameters were assessed during the PK studies and parameters including thrombin generation rate were evaluated. [Diagram 30](FIG. 30A) Hemophilic mouse survival curve after tail vein transection (TVT). TVT was performed 15 min after administration. Mouse survival was observed for 24 h after TVT and recorded hourly for the first 12 h and after 24 h. Control group data (vehicle) is the sum of three experiments with five mice per experiment. (FIG. 30B) Hemophilic mouse survival curve after tail vein transection (TVT). TVT was performed 24 h after SC administration. Mouse survival was observed for 24 h after TVT and recorded hourly for the first 12 h and after 24 h. Control group data (vehicle) is the sum of three experiments with five mice per experiment. (FIG. 30C) Hemophilic mouse survival curve after tail vein transection (TVT). TVT was performed 48 h after administration. Mice survival was monitored for 24 hours after TVT, recorded hourly for the first 12 hours and after 24 hours. Control data (vehicle) are the sum of three experiments with five mice per experiment. (Figure 30D) Summary of mice survival recorded 24 hours after TVT. [Figure 31-1] (FIG. 31A) Immunoblots of FVII-3CTP and FVII-5CTP blotted against GLA (FIG. 31B) Immunoblots of FVII-3CTP and FVII-5CTP blotted against FVII. [Figure 31-2] (FIG. 31C) Immunoblots of FVII-3CTP and FVII-5CTP blotted against CTP. [Diagram 32] PK profiles from selection and HA column purification (FVIIS vs. FVII HA)-comparison of FVII3 and 5CTP. [Diagram 33] PK Profiles - Comparison of CTP of FVII 3 and 5 - Second Study (IV vs SC). [Diagram 34] Figure 1 shows survival curves of hemophilic mice after tail vein transection (TVT) following SC administration. TVT was performed 12 hours after administration. Mouse survival was observed for 24 hours after TVT and recorded hourly for the first 12 hours and after 24 hours. [Diagram 35](Figure 35A) PK profile of MOD-5014 vs. NovoSeven® after IV administration. (Figure 35B) PK profile of MOD-5014 vs. NovoSeven® after SC administration. [Diagram 36] Figure 1 shows the PK profiles of MOD-5014 (clone 61 #75, #81) versus NovoSeven® after a single SC administration. [Figure 37] This shows that warfarin increases PT and aPTT values. SD rats were orally administered 10mg / Kg warfarin and blood samples were taken at the indicated time points. Plasma was prepared and PT and aPTT values ​​were measured. [Figure 38] Acute effects of IV injection of MOD-5014 and NovoSeven® on warfarin-treated rats. [Figure 39] 1 shows the response of warfarin-treated rats to a wide range of MOD-5014 and NovoSeven® doses 24 hours after injection. [Diagram 40] It is shown that by 48 hours after administration, MOD-5014 restores PT values ​​to normal, while the effect of NovoSeven® is no longer present after 24 hours. [Diagram 41] Figure 2 shows that IV injection of MOD-5014 shortens bleeding times in warfarin-treated rats compared to NovoSeven® after 24 and 48 hours. [Diagram 42] It is shown that MOD-5014 is able to restore PT values ​​to normal by 48 hours after administration, whereas the effect of NovoSeven® is no longer present after 24 hours. [Diagram 43] It demonstrates superiority over NovoSeven® by keeping blood loss at low levels over the 48 hour period following dosing. [Diagram 44] Tissue factor pathway inhibitor (TFPI) has been shown to inhibit MOD-5014 and NovoSeven® in a similar dose-dependent manner. [Diagram 45]Antithrombin III was shown to inhibit MOD-5014 and NovoSeven® in a similar manner. [Figure 46] 1 shows the results of factor X activation by MOD-5014 and NovoSeven®, which show similar results. [Figure 47] 1 shows factor X activation by MOD-5014 and NovoSeven® present at 0.6 ng / ml in the presence of TFPI (20 μg / ml to 0.002 ng / ml). [Figure 48] 1 shows factor X activation by MOD-5014 and NovoSeven® present at 4.0 ng / ml in the presence of TFPI (20 μg / ml to 0.002 ng / ml). [Figure 49] Factor X activation in the presence of TFPI and heparin was demonstrated, where MOD-5014 and NovoSeven® showed similar activation. [Figure 50] Factor X activation in the presence of antithrombin III was demonstrated, where MOD-5014 and NovoSeven® showed similar activation. [Figure 51] We demonstrate factor X activation by MOD-5014 and NovoSeven® in the presence of heparin, where a similar, moderate inhibition was observed. [Figure 52] 1 shows similar factor X activation by MOD-5014 and NovoSeven® in the presence of antithrombin and heparin. [Diagram 53] FIG. 1 shows the MOD-5014 thrombin generation profile compared to commercial NovoSeven® at high phospholipid (PL) concentrations. [Figure 54] FIG. 1 shows MOD-5014 peak thrombin generation profile compared to commercial NovoSeven® at low phospholipid (PL) concentrations. [Figure 55](FIG. 55A-B) Thromboelastography results for MOD-5014 and NovoSeven®, both of which reduced clotting time and increased the rate of clot formation. [Figure 56] NovoSeven® Thrombin Generation (TG) Results After Recalcification (Experiment #1) [Figure 57] MOD-5014 thrombin generation (TG) results after recalcification (Experiment #1) [Figure 58] Overlay analysis of MOD-5014 (PRO) TG results against NovoSeven® (NS) results at similar concentrations. (A) Results at 1.25 μg / ml. (B) Results at 5 μg / ml. (C) Results at 15 μg / ml. (D) Results at 2.5 μg / ml. (E) Results at 10 μg / ml. (Experiment #1) [Figure 59] Overlay analysis of MOD-5014 (PRO) TG results against NovoSeven® (NS) results at different concentrations. (A) shows results at 1.25 μg / ml NS and 2.5 μg / ml PRO. (B) shows results at 5 μg / ml NS and 10 μg / ml PRO. (C) shows results at 2.5 μg / ml NS and 5 μg / ml PRO. (D) shows results at 10 μg / ml NS and 15 μg / ml PRO. (Experiment #1) [Figure 60] Figure 1 shows NovoSeven® (NS) thrombin generation (TG) results after recalcification for different concentrations of NS. (Experiment #2) [Figure 61] Shown are PRO thrombin generation (TG) results after recalcification for different concentrations of MOD-5014 (PRO). (Experiment #2) [Figure 62]Overlay analysis of MOD-5014 (PRO) TG results against NovoSeven® (NS) results at similar concentrations. (A) Results at 1.25 μg / ml. (B) Results at 5 μg / ml. (C) Results at 15 μg / ml. (D) Results at 2.5 μg / ml. (E) Results at 10 μg / ml. (Experiment #2) [Figure 63] Overlay analysis of MOD-5014 (PRO) TG results against NovoSeven® (NS) results at different concentrations. (A) shows results at 1.25 μg / ml NS and 2.5 μg / ml PRO. (B) shows results at 5 μg / ml NS and 10 μg / ml PRO. (C) shows results at 2.5 μg / ml NS and 5 μg / ml PRO. (D) shows results at 10 μg / ml NS and 15 μg / ml PRO. (Experiment #2) [Figure 64] Shown are data for TG with NovoSeven® after recalcification at low TF concentration. (Experiment #1) [Figure 65] Shown are data for TG with MOD-5014 after recalcification at low TF concentrations (Experiment #1). [Figure 66] Overlay analysis of MOD-5014 (PRO) results against NovoSeven® (NS) results after recalcification with low TF at similar concentrations. (A) Results at 1.25 μg / ml. (B) Results at 5 μg / ml. (C) Results at 15 μg / ml. (D) Results at 2.5 μg / ml. (E) Results at 10 μg / ml. (Experiment #1) [Figure 67] Shown are data for TG with NovoSeven® after recalcification at low TF concentration. (Experiment #2) [Figure 68] Shown are data for MOD-5014-induced TG after recalcification at low TF concentrations (Experiment #2). [Figure 69]Overlay analysis of MOD-5014 (PRO) results against NovoSeven® (NS) results after recalcification with low TF at similar concentrations. (A) Results at 1.25 μg / ml. (B) Results at 5 μg / ml. (C) Results at 15 μg / ml. (D) Results at 2.5 μg / ml. (E) Results at 10 μg / ml. (Experiment #2) [Figure 70] Overlay analysis of MOD-5014 (PRO) results against NovoSeven® (NS) results after recalcification with low TF at different concentrations. (A) shows results at 1.25 μg / ml NS and 5 μg / ml PRO. (B) shows results at 5 μg / ml NS and 15 μg / ml PRO. (C) shows results at 2.5 μg / ml NS and 10 μg / ml PRO. (Experiment #2) [Figure 71] Figure 1 shows complete thrombin generation by FVIII compared to results with NovoSeven® and MOD-5014 in the presence and absence of low TF. [Figure 72] Overlay analysis of thrombin generation by FVIII in the presence and absence of low TF. [Figure 73] Overlay analysis of MOD-5014 (PRO; 1.25 μg / kg) TG results against NovoSeven® (NS; 1.25 μg / kg) TG results at increasing concentrations of TF. (Experiment #1) [Figure 74] Overlay analysis of MOD-5014 (PRO; 1.25 μg / kg) TG results against NovoSeven® (NS; 1.25 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #1) [Figure 75]Overlay analysis of MOD-5014 (PRO; 2.5 μg / kg) TG results against NovoSeven® (NS; 2.5 μg / kg) TG results at increasing concentrations of TF. (Experiment #1) [Figure 76] Overlay analysis of MOD-5014 (PRO; 2.5 μg / kg) results against NovoSeven® (NS; 2.5 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #1) [Figure 77] Overlay analysis of MOD-5014 (PRO; 5 μg / kg) results against NovoSeven® (NS; 5 μg / kg) TG results at increasing concentrations of TF. (Experiment #1) [Figure 78] Overlay analysis of MOD-5014 (PRO; 5 μg / kg) results against NovoSeven® (NS; 5 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #1) [Figure 79] Figure 1 shows the dose-dependent TG response with increasing concentrations of TF in the presence of NovoSeven® (NS). (A) Results with 1.25 μg / kg NS. (B) Results with 5 μg / kg NS. (C) Results with 2.5 μg / kg NS. (Experiment #1) [Figure 80] Dose-dependent TG response with increasing concentrations of TF in the presence of MOD-5014 (PRO). (A) Results with 1.25 μg / kg PRO. (B) Results with 5 μg / kg PRO. (C) Results with 2.5 μg / kg PRO. (Experiment #1) [Figure 81]Overlay analysis of MOD-5014 (PRO; 10 μg / kg) TG results versus NovoSeven® (NS; 10 μg / kg) TG results at increasing concentrations of TF. (Experiment #2) [Figure 82] Overlay analysis of MOD-5014 (PRO; 2.5 μg / kg) TG results versus NovoSeven® (NS; 2.5 μg / kg) TG results at increasing concentrations of TF. (Experiment #2) [Figure 83] Overlay analysis of MOD-5014 (PRO; 5 μg / kg) results against NovoSeven® (NS; 5 μg / kg) TG results at increasing concentrations of TF. (Experiment #2) [Figure 84] Dose-dependent TG response with increasing concentrations of TF in the presence of NovoSeven® (NS). (A) Results with 2.5 μg / ml NS. (B) Results with 10 μg / ml NS. (C) Results with 5 μg / ml NS. (Experiment #2) [Figure 85] Dose-dependent TG response with increasing concentrations of TF in the presence of MOD-5014 (PRO). (A) Results with 2.5 μg / ml PRO. (B) Results with 10 μg / ml PRO. (C) Results with 5 μg / ml PRO. (Experiment #2) [Figure 86] Overlay analysis of MOD-5014 (PRO; 10 μg / kg) results against NovoSeven® (NS; 10 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #2) [Figure 87]Overlay analysis of MD-5014 (PRO; 2.5 μg / kg) TG results against NovoSeven® (NS; 2.5 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #2) [Figure 88] Overlay analysis of MOD-5014 (PRO; 5 μg / kg) TG results against NovoSeven® (NS; 5 μg / kg) TG results with increasing concentrations of TF. (A) Results with 0 pM TF. (B) Results with 1 pM TF. (C) Results with 5 pM TF. (D) Results with 0.5 pM TF. (E) Results with 2.5 pM TF. (Experiment #2) [Figure 89] 1 shows a graph of WBCT of dog blood after spiking with MOD-5014. [Figure 90] A schematic diagram of a two-compartment pharmacokinetic model is shown. [Figure 91] 1 is a graph of mean plasma MOD-5014 concentrations versus time following IV infusion in dogs. [Figure 92] 1 is a graph of mean plasma MOD-5014 activity versus time following IV infusion in dogs. [Figure 93] 93 shows comparative data on MOD-5014 plasma concentrations and activity following IV infusion of 50 μg / kg in dogs, Figure 93(A) shows the results for dog P14 and Figure 93(B) shows the results for dog N06. [Figure 94-1] 94 shows comparative data on MOD-5014 plasma concentrations and activity following IV infusion of 200 μg / kg in dogs, Figure 94(A) shows the results for dog Blondie and Figure 94(B) shows the results for dog Josie. [Figure 94-2] FIG. 94(C) shows the results for dog N06, and FIG. 94(D) shows the results for dog P14. [Figure 95]95 shows comparative data on MOD-5014 plasma concentrations and activity following IV infusion of 400 μg / kg in dogs, Figure 95(A) shows the results for dog Blondie and Figure 95(B) shows the results for dog Josie. [Figure 96]

[00136] Figure 96 shows comparative data on MOD-5014 plasma concentrations and activity following IV infusion of 600 μg / kg in dogs. Figure 96(A) shows the results for dog N05 and Figure 96(B) shows the results for dog Joanie. [Figure 97-1] Figure 97 shows a plot of plasma MOD-5014 concentration versus time. The dots show observed plasma concentrations and the line shows the terminal slope used to calculate T1 / 2. Figure 97(A) shows the results for dog N06 after more than 30 hours, and Figure 97(B) shows the results for dog P14 after more than 30 hours. [Figure 97-2] FIG. 97(C) shows the results for dog Blondie after about 50 hours, and FIG. 97(D) shows the results for dog Josie after about 50 hours. [Figure 97-3] FIG. 97(E) shows the results for dog N06 after approximately 100 hours, and FIG. 97(F) shows the results for dog P14 after approximately 100 hours. [Figure 97-4] FIG. 97(G) shows the results for dog Blondie after approximately 100 hours, and FIG. 97(H) shows the results for dog Josie after approximately 100 hours. [Figure 97-5] FIG. 97(I) shows the results for dog Joanie after approximately 100 hours, and FIG. 97(J) shows the results for dog N05 after approximately 100 hours. [Figure 98-1] Figure 98 shows a plot of MOD-5014 activity in plasma versus time. The dots indicate observed plasma concentrations and the line indicates the terminal slope used to calculate T1 / 2. Figure 98(A) shows the results for dog N06 after more than 30 hours, and Figure 98(B) shows the results for dog P14 after more than 30 hours. [Figure 98-2] FIG. 98(C) shows the results for dog Blondie after approximately 50 hours, and FIG. 98(D) shows the results for dog Josie after approximately 50 hours. [Figure 98-3]FIG. 98(E) shows the results for dog N06 after approximately 50 hours, and FIG. 98(F) shows the results for dog P14 after approximately 50 hours. [Figure 98-4] FIG. 98(G) shows the results for dog Blondie after approximately 50 hours, and FIG. 98(H) shows the results for dog Josie after approximately 50 hours. [Figure 98-5] FIG. 98(I) shows the results for dog Joanie after approximately 50 hours, and FIG. 98(J) shows the results for dog N05 after approximately 50 hours. [Figure 99-1] Figure 99 shows the modeled plasma concentration results. The dots show the observed plasma concentrations and the solid lines show the concentrations predicted by the model. Figure 99(A) shows the results for dog N06 and Figure 99(B) shows the results for dog P14. [Figure 99-2] FIG. 99(C) shows the results for dog Blondie, and FIG. 99(D) shows the results for dog Josie. [Figure 99-3] FIG. 99(E) shows the results for dog N06 after approximately 100 hours, and FIG. 99(F) shows the results for dog P14 after approximately 100 hours. [Figure 99-4] FIG. 99(G) shows the results for dog Blondie after approximately 100 hours, and FIG. 99(H) shows the results for dog Josie after approximately 100 hours. [Figure 99-5] FIG. 99(I) shows the results for dog Joanie after approximately 100 hours, and FIG. 99(J) shows the results for dog N05 after approximately 100 hours. [Figure 100-1] The modeled activity results are shown. The dots show the observed plasma activity and the solid line shows the activity predicted by the model. Figure 100(A) shows the results for dog N06 after at least 32 hours, and Figure 100(B) shows the results for dog P14 after at least 32 hours. [Figure 100-2] FIG. 100(C) shows the results for dog Blondie after at least 48 hours, and FIG. 100(D) shows the results for dog Josie after at least 48 hours. [Figure 100-3] FIG. 100(E) shows the results for dog N06 after at least 48 hours, and FIG. 100(F) shows the results for dog P14 after at least 48 hours. [Figure 100-4] FIG. 100(G) shows the results for dog Blondie after at least 48 hours, and FIG. 100(H) shows the results for dog Josie after at least 48 hours. [Figure 100-5] FIG. 100(I) shows the results for dog Joanie after at least 48 hours, and FIG. 100(J) shows the results for dog N05 after at least 48 hours. [Figure 101] 1 shows dose-dependent changes in kaolin-initiated TEG kinetics following administration of 50, 200 or 400 μg / kg MOD-5014 in dog N06. (A) R-time (reaction time), (B) K-time (time for the clot to reach 20 mm from the end of R, rate of clot formation), (C) angle (tangent to the curve made when K is reached), and (D) MA (maximum amplitude). [Figure 102] 1 shows dose-dependent changes in kaolin-initiated TEG kinetics following administration of 50 and 200 μg / kg MOD-5014 in dog P-14. (A) R-time (time to reaction), (B) K-time (time for the clot to reach 20 mm from the end of R, rate of clot formation), (C) angle (tangent to the curve when K is reached), and (D) MA (maximum amplitude). [Figure 103] 1 shows dose-dependent changes in kaolin-initiated TEG kinetics following administration of 200 and 400 μg / kg MOD-5014 in Blondie dogs, with (A) R-time (reaction time), (B) K-time (time for the clot to reach 20 mm from the end of R, rate of clot formation), (C) angle (tangent to the curve made when K is reached), and (D) MA (maximum amplitude). [Figure 104] 1 shows dose-dependent changes in kaolin-initiated TEG kinetics following administration of 200 and 400 μg / kg MOD-5014 in dog Josie. (A) R-time (time to reaction), (B) K-time (time for the clot to reach 20 mm from the end of R, rate of clot formation), (C) angle (tangent to the curve made when K is reached), and (D) MA (maximum amplitude). [Figure 105]1 shows dose-dependent changes in kaolin-initiated TEG kinetics following administration of 50, 200, or 400 μg / kg MOD-5014 in dog Joanie. (A) R-time (time to reaction), (B) K-time (time for the clot to reach 20 mm from the end of R, rate of clot formation), (C) angle (tangent to the curve made when K is reached), and (D) MA (maximum amplitude). [Fig. 106] Figure 1 shows time course TEG kinetics following administration of MOD-5014 in dog N05, showing (A) R-time (reaction time), (B) K-time (time from the end of RT for the clot to reach 20 mm, rate of clot formation), (C) angle (tangent to the curve when K is reached), and (D) MA (maximum amplitude). [Figure 107] Figure 1 shows the changes in TEG characteristics following administration of 270 μg / kg rhFVIIa, showing (A) R-time (reaction time), (B) angle (tangent to the curve made when K is reached), (C) K-time (time for the clot to reach 20 mm from the end of RT, rate of clot formation), and (D) MA (maximum amplitude). [Figure 108] Representative data from an individual animal (Blondie) shows the TEG effect of MOD-5014 over time. (A) R-time (time to reaction), (B) K-time (time from the end of RT for the clot to reach 20 mm, clot formation rate), (C) angle (tangent to the curve when K is reached), (D) MA (maximum amplitude). Arrows in (B), (C) and (D) indicate TEG values ​​for MOD-5014 4 hours after administration. [Fig. 109] 1 shows a map of the pCI-dhfr-MOD-5014 plasmid. [Figure 110] Representative pooled PK-PD profiles from rat toxicity studies are shown, where the percentage change in plasma concentration (ng / ml) over time is shown as open squares and the percentage change in activity (mU / ml) over time is shown as open circles. [Figure 111] Representative pooled PK-PD profiles from monkey toxicity studies are shown, with percentage change in plasma concentration (ng / ml) over time shown as open circles and percentage change in activity (mU / ml) over time shown as open squares. [Figure 112] 1 is a graph of mean plasma MOD-5014 concentrations versus time following IV bolus administration in male cynomolgus monkeys. [Figure 113] 1 is a graph of mean MOD-5014 clotting activity versus time following IV bolus administration in male cynomolgus monkeys. [Fig. 114] 1 is a graph of a comparison of MOD-5014 plasma concentrations and coagulation activity following IV bolus injection of 1 mg / kg in male cynomolgus monkeys. [Fig. 115] 1 is a graph of a comparison of MOD-5014 plasma concentrations and coagulation activity following IV bolus injection of 7.5 mg / kg in male cynomolgus monkeys. [Fig. 116] 1 is a graph of a comparison of MOD-5014 plasma concentrations and coagulation activity following IV bolus injection of 15 mg / kg in male cynomolgus monkeys. [Figure 117-1] (FIGS. 117A-117D) Graphs of individual plasma MOD-5014 concentrations and clotting activity over time. [Figure 117-2] (FIGS. 117E-H) Graphs of individual plasma MOD-5014 concentrations and clotting activity over time. [Figure 117-3] (FIG. 117I-L) Graphs of individual plasma MOD-5014 concentrations and clotting activity over time. [Figure 117-4] (FIG. 117M-FIG. 117P) Graphs of individual plasma MOD-5014 concentrations and clotting activity over time. [Figure 117-5] (Figure 117AQ-Figure 117R) Graphs of individual plasma MOD-5014 concentrations and coagulation activity over time. [Figure 118] Graph showing mean fluorescence intensity of MOD-5014 or FVIIa treated platelets. [Figure 119] FIG. 1 is a graph showing thrombin generation in MOD-5014 or FVIIa treated platelets. [Figure 120]1 shows a comparison of substrate (Pefachrome FVIIa) cleavage activity between FVIIa (NovoSeven) and CTP-modified factor VIIa (MOD-5014). [Figure 121] 1 shows a comparison of substrate (Pefachrome FVIIa) activity between FVIIa (NovoSeven) and CTP-modified Factor VIIa (MOD-5014) when bound to tissue factor. [Figure 122] 1 shows a comparison of the production of activated factor X by FVIIa (NovoSeven) or CTP-modified FVIIa (MOD-5014) versus factor VIIa concentration. [Figure 123] 1 shows a comparison of the generation of activated factor X by FVIIa (NovoSeven) or CTP-modified FVIIa (MOD-5014) versus factor X concentration. [Figure 124] Figure 124A shows a comparison of the rate of activated factor X production by FVIIa (NovoSeven) or CTP-modified FVIIa (MOD-5014) versus lipid concentration in the absence of tissue factor (Figure 124A). Figure 124B shows a comparison of activated factor X production by FVIIa (NovoSeven) or CTP-modified FVIIa (MOD-5014) versus lipid concentration in the absence of tissue factor (Figure 124B). [Fig. 125] 1 shows a comparison of activated factor X generation between FVIIa (NovoSeven) and MOD-5014 versus factor X concentration in the absence of tissue factor. [Fig. 126] A comparison of the inhibition of substrate (Pefachrome FVIIa) cleavage by FVIIa (NovoSeven) and CTP-modified Factor VIIa (MOD-5014) is shown taking polybrene into account. [Figure 127] A comparison of inhibition of substrate (Pefachrome FXa) cleavage by FVIIa (NovoSeven) and CTP-modified Factor VIIa (MOD-5014) is shown versus TFPI concentration (Figure 127A), and versus duration of TFPI exposure of FVIIa (Figure 127B), and versus duration of TFPI exposure of MOD-5014 (Figure 127C). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] In one embodiment, the present invention provides long-acting coagulation factors and methods of making and using same. In another embodiment, the long-acting coagulation factors comprise a carboxy terminal peptide (CTP, also referred to as a CTP unit). In another embodiment, the long-acting polypeptide comprising a coagulation factor further comprises the carboxy terminal peptide (CTP) of human chorionic gonadotropin (hCG). In another embodiment, the CTP functions as a protectant against degradation of the coagulation factor. In another embodiment, the CTP is the CTP unit of the coagulation factor. max In another embodiment, the CTP increases the T max In another embodiment, the CTP extends the circulating half-life of the clotting factor. In some embodiments, the CTP enhances the potency of the clotting factor.

[0023] In another embodiment, provided herein is a method for extending the biological half-life of a coagulation factor, the method comprising the step of attaching 1-10 CTPs to the carboxy terminus of the coagulation factor, thereby extending the biological half-life of the coagulation factor. In another embodiment, provided herein is a method for extending the biological half-life of a coagulation factor, the method comprising the step of attaching 1-5 CTPs to the carboxy terminus of the coagulation factor, thereby extending the biological half-life of the coagulation factor. In another embodiment, the present invention provides a method for extending the circulating half-life of a coagulation factor. In another embodiment, the present invention provides a method for extending the half-life of a coagulation factor. In another embodiment, the present invention provides a method for extending the half-life of a coagulation factor.

[0024] In one embodiment, the present disclosure relates to a pharmaceutical composition comprising a CTP-modified coagulation factor.

[0025] In one embodiment, the present disclosure relates to a pharmaceutical formulation comprising a buffer, a tonicity agent, and a CTP-modified polypeptide consisting of a coagulation factor and three chorionic gonadotropin CTPs attached to the carboxy terminus of said coagulation factor.

[0026] In one embodiment, the disclosure relates to a formulation for weekly administration to a subject with hemophilia A or B. In another embodiment, the subject has a clotting factor deficiency. In another embodiment, the subject has acquired hemophilia. In another embodiment, the disclosure relates to a process for making a pharmaceutical formulation for weekly administration to a subject with a clotting factor deficiency or hemophilia, the process comprising: (a) modifying a coagulation factor by attaching three chorionic gonadotropin CTPs to the carboxy terminus of said coagulation factor; (b) mixing the coagulation factor modified in step (a) with said buffer and said tonicity agent at a pH of about 6.4; and (c) prefilling the formulation into a syringe.

[0027] In one embodiment, the present disclosure relates to a process for filling a formulation provided herein into a syringe, the process comprising: (a) formulating a once-weekly dosage form of the CTP-modified coagulation factor having a predetermined amount of the CTP-modified coagulation factor; and (b) loading the formulation into a syringe.

[0028] In one embodiment, a "pharmaceutical composition" or "pharmaceutical formulation" refers to a formulation of one or more active ingredients described herein with other chemical components, such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition or "pharmaceutical formulation" is to facilitate administration of a compound to an organism. In certain embodiments, a "pharmaceutical composition" or "pharmaceutical formulation" provides a drug in a pharmaceutical dosage form. In certain embodiments, a "pharmaceutical composition" or "pharmaceutical formulation" includes a sustained release technology dosage form, a transdermal patch, or any dosage form known in the art.

[0029] Coagulation factor VII (FVII) is a 444 amino acid glycoprotein (50 KDa) secreted by hepatocytes into the bloodstream as an inactive proenzyme. Upon tissue injury and exposure to circulating blood, FVII forms a complex with tissue factor (TF), which is the true receptor protein for FVII and is expressed by various cells localized in the deep layers of the blood vessel wall. The formation of this FVII-TF complex results in the activation of FVII. Activated FVII (FVIIa) initiates the extrinsic coagulation pathway by activating factors IX and X.

[0030] FVII belongs to a group of vitamin K-dependent glycoproteins associated with the coagulation system. Besides FVII, this group consists of factors IX, X, protein C and prothrombin. These proteins have a similar domain organization and are synthesized as a precursor with an N-terminal propeptide followed by the mature amino acid sequence. This propeptide contains a docking site for gamma-carboxylase, which converts glutamic acid (Glu) to gamma-carboxyglutamic acid (Gla). This domain is followed by two epidermal growth factor-like (EGF) domains, a linking site (CR) and a C-terminal serine protease domain. Prior to secretion, the FVII propeptide is cleaved to form a 406 amino acid single-chain zymogen FVII glycoprotein. After secretion, the protein can be activated to a disulfide-linked two-chain heterodimer, FVIIa, by cleavage at the CR. The plasma concentration of FVII is 10 nM, and in healthy individuals, approximately 1% circulates in the active form. In another embodiment, the CTP-modified FVII comprises occupancy of at least one O-linked glycosylation site.In another embodiment, the CTP-modified FVIIa comprises occupancy of at least one O-linked glycosylation site.

[0031] Factor IX (FIX) is a 415 amino acid (55 KDa) glycoprotein that belongs to a group of vitamin K-dependent glycoproteins associated with the coagulation system. FIX has a domain organization similar to that of factors FVII, X, protein C and prothrombin, which are synthesized as precursors with N-terminal propeptides and subsequently as mature amino acid sequences.

[0032] FIX is secreted as a single-chain molecule that undergoes complex post-transcriptional modifications, many of which are important for its biochemical and pharmacokinetic properties. Among all post-transcriptional modifications, the most important are the 12 glutamic acid residues close to the amino terminus of FIX that are gamma-carboxylated by vitamin K-dependent gamma-carboxylase. Carboxylation is necessary for the interaction of FIX with phospholipid surfaces and for optimal FIX activity. This amino-terminal propeptide serves as a recognition site for gamma-carboxylase, and thus after gamma-carboxylation, it is cleaved by a Golgi apparatus serine protease known as paired basic amino acid cleaving enzyme (PACE / furin). It has been shown that four additional post-transcriptional modifications (sulfation of tyrosine 155, phosphorylation of serine 158, O-glycosylation at Ser 63 and 61, and finally N-glycosylation at Asn 157 and 16) can occur in the Golgi apparatus but are not required for the proper activity of FIX.

[0033] FIX circulates in plasma (average concentration of 5 μg / ml) as a single-chain inactive zymogen. Upon proteolytic cleavage at two peptide bonds (Arg145 and Arg180) by one or two physiological activators, either the FVIIa-TF complex or FIXa, the activation peptide is removed and FIX is converted into a fully active enzyme consisting of a light chain and a heavy chain held together by a single disulfide bond. The N-terminal light chain contains a non-catalytic γ-carboxyglutamic acid (Gla) and two epidermal growth factor-like domains, whereas the C-terminal heavy chain contains the trypsin-like catalytic domain of the molecule. FIXa alone is characterized by poor catalytic activity. However, when complexed with FVIII, its proteolytic activity is increased up to 4-5 times greater relative to its natural substrate FX.

[0034] In another embodiment, provided herein is a method for extending the biological half-life of a coagulation factor or increasing the area under the curve (AUC) of a coagulation factor, comprising the step of attaching 1-10 CTPs to the carboxy terminus of the coagulation factor, thereby extending the biological half-life or increasing the AUC of the coagulation factor. In another embodiment, provided herein is a method for extending the biological half-life of a coagulation factor or increasing the area under the curve (AUC) of a coagulation factor, comprising the step of attaching 1-5 CTPs to the carboxy terminus of the coagulation factor, thereby extending the biological half-life or increasing the AUC of the coagulation factor. In another embodiment, provided herein is a method for extending the biological half-life of FIX or increasing the area under the curve (AUC) of FIX, comprising the step of attaching 1-5 CTPs to the carboxy terminus of FIX, thereby extending the biological half-life of FIX or increasing the AUC of FIX. In another embodiment, provided herein is a method for extending the biological half-life of FVII or FVIIa or increasing the area under the curve (AUC) of FVII or FVIIa, the method comprising the step of attaching 1 to 5 CTPs to the carboxy terminus of FVII or FVIIa, thereby extending the biological half-life or increasing the AUC of FVII or FVIIa.

[0035] In another embodiment, the present invention provides a method for increasing the biological half-life of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby increasing the biological half-life of the FIX polypeptide. In another embodiment, the present invention further provides a method for increasing the biological half-life of a factor VIIa (FVIIa) polypeptide, comprising attaching from one to up to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVIIa polypeptide, thereby increasing the biological half-life of the FVIIa polypeptide. In one embodiment, three chorionic gonadotropin carboxy-terminal peptides (CTPs) are attached to the carboxy-terminus of the FVIIa polypeptide. In another embodiment, four chorionic gonadotropin carboxy-terminal peptides (CTPs) are attached to the carboxy-terminus of the FVIIa polypeptide. In another embodiment, five chorionic gonadotropin carboxy terminal peptides (CTPs) are attached to the carboxy terminus of the FVIIa polypeptide.

[0036] In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby increasing the AUC of the FIX polypeptide. In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a factor VIIa (FVIIa) polypeptide, comprising attaching up to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVIIa polypeptide, thereby increasing the AUC of the FVIIa polypeptide. In one embodiment, three chorionic gonadotropin carboxy-terminal peptides (CTPs) are attached to the carboxy-terminus of the FVIIa polypeptide. In another embodiment, four chorionic gonadotropin carboxy-terminal peptides (CTPs) are attached to the carboxy-terminus of the FVIIa polypeptide. In another embodiment, five chorionic gonadotropin carboxy terminal peptides (CTPs) are attached to the carboxy terminus of the FVIIa polypeptide.

[0037] In another embodiment, the clotting factor of the present disclosure is a protein. In another embodiment, the clotting factor of the present disclosure is a peptide. In another embodiment, the clotting factor of the present disclosure is a polypeptide. In another embodiment, the clotting factor is an enzyme. In another embodiment, the clotting factor is a serine protease. In another embodiment, the clotting factor is a glycoprotein. In another embodiment, the clotting factor is a transglutaminase. In another embodiment, the clotting factor is an inactive zymogen. In another embodiment, the clotting factor is any clotting factor known to one of skill in the art.

[0038] In another embodiment, the clotting factor is factor VIII (FVIII). In another embodiment, the clotting factor is factor V (FV). In another embodiment, the clotting factor is factor XIII (FXIII). In another embodiment, the clotting factor is factor X (FX). In another embodiment, the clotting factor is fibrin.

[0039] In another embodiment, the clotting factor is Factor VIIa (FVIIa). In another embodiment, the clotting factor is Factor VII (FVII). In another embodiment, the clotting factor is Factor IX (FIX). In another embodiment, the clotting factor is Factor X (FX). In another embodiment, the clotting factor is Factor XIa (FXIa). In another embodiment, the clotting factor is Factor XII (FXII). In another embodiment, the clotting factor is Factor Xa (FXa). In another embodiment, the clotting factor is Factor Va (FVa). In another embodiment, the clotting factor is prothrombin. In another embodiment, the clotting factor is thrombin. In another embodiment, the clotting factor is Factor XI (FXI). In another embodiment, the clotting factor is von Willebrand factor (vWF). In another embodiment, the clotting factor is Factor VIIIa (FVIIIa). In another embodiment, the clotting factor is B-deleted domain FVIII (FVIIIBDD). In another embodiment, the clotting factor is B domain-deleted FVIII (FVIIIBDD). In another embodiment, the clotting factor is β domain-deleted FVIII (FVIIIBDD). In another embodiment, the clotting factor is factor IXa (FIXa). In another embodiment, the clotting factor is prekallikrein. In another embodiment, the clotting factor is kallikrein. In another embodiment, the clotting factor is factor XIIa (FXIIa). In another embodiment, the clotting factor is fibrinogen. In another embodiment, the clotting factor is thrombomodulin. In another embodiment, the clotting factor is factor II (FII).

[0040] In another embodiment, the clotting factor is a glycoprotein. In another embodiment, the clotting factor is a vitamin K-dependent glycoprotein. In another embodiment, the clotting factor is a vitamin K-independent glycoprotein.

[0041] In another embodiment, the clotting factor is a recombinant protein. In another embodiment, the clotting factor is a recombinant glycoprotein. In another embodiment, the clotting factor is a recombinant glycoprotein FV. In another embodiment, the clotting factor is a recombinant FVI. In another embodiment, the clotting factor is a recombinant FVII. In another embodiment, the clotting factor is a recombinant FVIII. In another embodiment, the clotting factor is a recombinant FIX. In another embodiment, the clotting factor is a recombinant FX. In another embodiment, the clotting factor is a recombinant FXI. In another embodiment, the clotting factor is a recombinant FXII. In another embodiment, the clotting factor is a recombinant FVW. In another embodiment, the clotting factor is a recombinant FII. In another embodiment, the clotting factor is a recombinant FIXa. In another embodiment, the clotting factor is a recombinant FXIa. In another embodiment, the clotting factor is a recombinant fibrin. In another embodiment, the clotting factor is a recombinant FVIIa. In another embodiment, the clotting factor is a recombinant FXa. In another embodiment, the clotting factor is a recombinant FVa. In another embodiment, the clotting factor is a recombinant prothrombin. In another embodiment, the clotting factor is recombinant thrombin. In another embodiment, the clotting factor is recombinant FVIIIa. In another embodiment, the clotting factor is recombinant prekallikrein. In another embodiment, the clotting factor is recombinant kallikrein. In another embodiment, the clotting factor is recombinant FXIIa. In another embodiment, the clotting factor is any known recombinant clotting factor. In another embodiment, the clotting factor comprising a single peptide is any known recombinant clotting factor. In another embodiment, the recombinant clotting factor does not comprise a signal peptide. In another embodiment, the activated clotting factor does not comprise a signal peptide.

[0042] In another embodiment, the coagulation factor comprises 1-10 CTP repeats attached to the C-terminus and no CTP attached to the N-terminus. In another embodiment, the coagulation factor comprises at least one CTP attached to the C-terminus and no CTP attached to the N-terminus. In another embodiment, the coagulation factor comprises 1-10 CTP repeats attached to the C-terminus and no CTP attached to the N-terminus is an engineered coagulation factor. In another embodiment, the coagulation factor comprises at least one CTP attached to the C-terminus and no CTP attached to the N-terminus is an engineered coagulation factor. In another embodiment, the coagulation factor comprises 1-10 CTP repeats attached to the C-terminus and no CTP attached to the N-terminus is a complexed coagulation factor. In another embodiment, the coagulation factor comprises at least one CTP attached to the C-terminus and no CTP attached to the N-terminus is a complexed coagulation factor.

[0043] In one embodiment, the present invention provides a CTP-modified factor IX (FIX) polypeptide consisting of a FIX polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the CTP-modified FIX polypeptide.

[0044] In another embodiment, the present invention further provides a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of a FVIIa polypeptide and five gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of said FVIIa.In another embodiment, the present invention further provides a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of a FVIIa polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of said FVIIa.

[0045] In another embodiment, the clotting factor is a clotting factor that contains a domain organization similar or identical to that of FIX, FVII, factor X, protein C, or prothrombin. In another embodiment, the clotting factor is synthesized as a precursor with an N-terminal propeptide. In another embodiment, the clotting factor, as used herein, is an inactive proenzyme form. In another embodiment, the clotting factor is produced in hepatocytes. In another embodiment, the clotting factor contains a docking site for gamma-carboxylase, which converts glutamic acid (Glu) to gamma-carboxyglutamic acid (Gla). In another embodiment, the clotting factor, as used herein, is a commercially available clotting factor.

[0046] In one embodiment, the nucleic acid sequence encoding Factor VII comprises the following nucleic acid sequence:

[0047] [ka]

[0048] In another embodiment, the amino acid sequence of Factor VII comprises the following amino acid sequence:

[0049] [ka]

[0050] In another embodiment, the amino acid sequence of Factor VII comprises the following amino acid sequence:

[0051] [ka]

[0052] In another embodiment, the nucleic acid sequence encoding Factor VII-CTP (carboxy-terminally linked) comprises the following nucleic acid sequence:

[0053] [ka]

[0054] In another embodiment, the amino acid sequence of Factor VII-CTP (carboxy-terminally attached) comprises the following amino acid sequence:

[0055] [ka]

[0056] In another embodiment, the nucleic acid sequence encoding Factor VII-CTP-CTP (linked to the carboxy terminus) comprises the following nucleic acid sequence:

[0057] [ka]

[0058] In another embodiment, the amino acid sequence of Factor VII-CTP-CTP (linked to the carboxy terminus) comprises the following amino acid sequence:

[0059] [ka]

[0060] In another embodiment, the nucleic acid sequence encoding Factor VII-CTP-CTP-CTP (linked carboxy-terminally) comprises the following nucleic acid sequence:

[0061] [ka]

[0062] In another embodiment, the amino acid sequence of Factor VII-CTP-CTP-CTP (linked at the carboxy terminus) comprises the following amino acid sequence:

[0063] [ka]

[0064] In another embodiment, amino acids 1-38 of SEQ ID NO:25 comprise a signal sequence.

[0065] In another embodiment, the amino acid sequence of Factor VII-CTP-CTP-CTP (linked to the carboxy terminus) lacking the signal peptide comprises the following amino acid sequence:

[0066] [ka]

[0067] In another embodiment, activated factor VII-CTP-CTP-CTP (attached to the carboxy terminus) (FVIIa-CTP 3 ) lacks the signal peptide and comprises the amino acid sequence set forth in SEQ ID NO: 46. 3 lacks the signal peptide and comprises a homologue of SEQ ID NO: 46. 3 In another embodiment, FVIIa-CTP lacks the signal peptide and comprises a variant of SEQ ID NO: 46. 3 is truncated between the arginine (R) at residue 152 and the isoleucine (I) at residue 153. 3 In another embodiment, the amino acid sequence of FVIIa-CTP is present as a disulfide-linked two-chain heterodimer structure containing a disulfide S-S bridge between cysteine ​​residues present on each chain. 3 In another embodiment, the amino acid sequence of FVIIa-CTP is present as a heterodimeric structure comprising a light chain and a heavy chain linked by a sulfide-SS-bond between a cysteine ​​residue present in the light chain and a cysteine ​​residue present in the heavy chain. 3 The heavy chain contains the N-terminal fragment of the amino acid sequence of FVIIa-CTP 3 In another embodiment, the cysteine ​​residue may be any cysteine ​​residue in either chain. In another embodiment, the FVIIa-CTP 3exists as a disulfide-linked two-chain heterodimer structure comprising an S-S bridge between cysteine ​​residues 135 and 262 of SEQ ID NO:46, said two chains comprising a light chain comprising amino acids 1 to 152 and a heavy chain comprising amino acids 153 to 490.

[0068] In another embodiment, the light chain migrates at about 25 kDa on SDS-PAGE under denaturing conditions. In another embodiment, the heavy chain migrates at about 50 kDa on SDS-PAGE under denaturing conditions. In another embodiment, the heavy chain migrates at about 60 kDa on SDS-PAGE under denaturing conditions.

[0069] In another embodiment, Factor VII-(CTP) 4 Nucleic acid sequences encoding (carboxy-terminally linked) include the following nucleic acid sequences:

[0070] [ka]

[0071] In another embodiment, Factor VII-(CTP) 4 The amino acid sequence of (attached to the carboxy terminus) comprises the following amino acid sequence:

[0072] [ka]

[0073] In another embodiment, Factor VII-(CTP) 5 Nucleic acid sequences encoding (carboxy-terminally linked) include the following nucleic acid sequences:

[0074] [ka]

[0075] In another embodiment, Factor VII-(CTP) 5 The amino acid sequence of (attached to the carboxy terminus) comprises the following amino acid sequence:

[0076] [ka]

[0077] In another embodiment, the nucleic acid sequence encoding Factor IX comprises the following nucleic acid sequence:

[0078] [ka]

[0079] In another embodiment, the amino acid sequence of Factor IX comprises the following amino acid sequence:

[0080] [ka]

[0081] In another embodiment, the nucleic acid sequence encoding Factor IX-CTP (carboxy-terminally linked) comprises the following nucleic acid sequence:

[0082] [ka]

[0083] In another embodiment, the amino acid sequence of Factor IX-CTP (attached to the carboxy terminus) comprises the following amino acid sequence:

[0084] [ka]

[0085] In another embodiment, the nucleic acid sequence encoding Factor IX-CTP-CTP (linked to the carboxy terminus) comprises the following nucleic acid sequence:

[0086] [ka]

[0087] In another embodiment, the amino acid sequence of Factor IX-CTP-CTP (linked to the carboxy terminus) comprises the following amino acid sequence:

[0088] [ka]

[0089] In another embodiment, Factor IX-(CTP) 3 Nucleic acid sequences encoding (carboxy-terminally linked) include the following nucleic acid sequences:

[0090] [ka]

[0091] In another embodiment, Factor IX-(CTP) 3 The amino acid sequence of (attached to the carboxy terminus) comprises the following amino acid sequence:

[0092] [ka]

[0093] In another embodiment, Factor IX-(CTP) 4 Nucleic acid sequences encoding (carboxy-terminally linked) include the following nucleic acid sequences:

[0094] [ka]

[0095] In another embodiment, Factor IX-(CTP) 4 The amino acid sequence of (attached to the carboxy terminus) comprises the following amino acid sequence:

[0096] [ka]

[0097] In another embodiment, Factor IX-(CTP) 5 Nucleic acid sequences encoding (carboxy-terminally linked) include the following nucleic acid sequences:

[0098] [ka]

[0099] In another embodiment, Factor IX-(CTP) 5 The amino acid sequence of (attached to the carboxy terminus) comprises the following amino acid sequence:

[0100] [ka]

[0101] In another embodiment, furin is added to cells expressing the clotting factor-CTP of the present disclosure. In another embodiment, furin increases the efficiency of production of the clotting factor-CTP of the present disclosure in cells. In another embodiment, furin is co-transfected with a vector comprising the coding sequence of the clotting factor-CTP of the present disclosure. In another embodiment, furin is encoded by another vector. In another embodiment, furin and the clotting factor-CTP are encoded by one vector. In another embodiment, the coding sequence of furin is inserted into pCI-DHFR. In another embodiment, the coding sequence of furin is engineered in pCI-dhfr / smaI+NotI, furin / AsisI FI+NotI.

[0102] In another embodiment, the nucleic acid sequence encoding Furin comprises the following nucleic acid sequence:

[0103] [ka]

[0104] In another embodiment, the amino acid sequence of Furin comprises the following amino acid sequence:

[0105] [ka]

[0106] In one embodiment, the term clotting factor further includes homologues of known clotting factors. In one embodiment, the homologues have clotting activity. In some embodiments, homologues according to the invention also include deletion, insertion or substitution variants, including amino acid substitutions thereof, and biologically active polypeptide fragments thereof. In one embodiment, the variants include conservative substitutions of the clotting factor, or deletions, insertions or substitutions that do not significantly alter the three-dimensional structure. In another embodiment, the deletions, insertions or substitutions do not alter the intended function of the clotting factor, which in one embodiment is bound to a specific binding partner.

[0107] In another embodiment, the disclosure includes a homolog of a clotting factor. In another embodiment, the disclosure includes a homolog of a clotting factor having clotting activity. In another embodiment, the disclosure includes a homolog of a clotting factor having a functional linkage. In another embodiment, the disclosure includes a homolog of a clotting factor described herein having clotting activity. In another embodiment, the disclosure includes a homolog of a clotting factor described herein having a functional linkage. In another embodiment, the homolog is a polypeptide that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to a clotting factor, for example, as determined using the BlastP software of the National Center of Biotechnology Information (NCBI) using default parameters.

[0108] In another embodiment, the disclosure includes a homolog of Furin. In another embodiment, the disclosure includes a homolog of Furin that maintains the desired function, which in one embodiment is cleavage of the precursor protein. In another embodiment, the homolog is a polypeptide that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to Furin, for example, as determined using the BlastP software of the National Center of Biotechnology Information (NCBI) using default parameters.

[0109] In another embodiment, provided herein is a polypeptide comprising a clotting factor and one to ten gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and one to three gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and one to five gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor having at least one CTP at its carboxy terminus.

[0110] In another embodiment, provided herein is a polypeptide consisting of a coagulation factor and one to five gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the coagulation factor.

[0111] In another embodiment, provided herein is a polypeptide consisting essentially of a coagulation factor and from 1 to 5 CTPs attached to the carboxy terminus of the coagulation factor.

[0112] It is understood that compositions, formulations and methods of the invention that include components or steps described herein may, in another embodiment, consist of those components or steps, or, in another embodiment, consist essentially of those components or steps. In some embodiments, the term "comprise" refers to the inclusion of the indicated active agent, such as a CTP-modified coagulation factor, as well as other active agents, and pharma- ceutically acceptable carriers, excipients, emollients, stabilizers, and the like, as are known in the pharmaceutical industry. In some embodiments, the term "consisting essentially of" refers to a composition whose only active ingredient is the indicated active ingredient, but may include other compounds that are for stabilizing, preserving, etc. the formulation and are not directly involved in the therapeutic effect of the indicated active ingredient. In some embodiments, the term "consisting essentially of" may refer to ingredients that facilitate the release of the active ingredient. In some embodiments, the term "consisting of" refers to a composition that includes the active ingredient and a pharma-ceutically acceptable carrier or excipient.

[0113] In one embodiment, the present invention provides a polypeptide comprising a clotting factor and two gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to three CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to four CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and two to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and 2 to 10 CTPs bound to the carboxy terminus of the coagulation factor.

[0114] In one embodiment, the present invention provides a polypeptide comprising a clotting factor and three gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to four CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and three to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and 3 to 10 CTPs attached to the carboxy terminus of the coagulation factor.

[0115] In one embodiment, the present invention provides a polypeptide comprising a clotting factor and four gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and four to ten CTPs attached to the carboxy terminus of the clotting factor.

[0116] In one embodiment, the present invention provides a polypeptide comprising a clotting factor and five gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and five to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and five to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and five to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and five to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide comprising a clotting factor and five to ten CTPs attached to the carboxy terminus of the clotting factor.

[0117] In one embodiment, the present invention provides a polypeptide comprising a coagulation factor and two gonadotropin carboxy terminal peptides (CTPs) bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to three CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to four CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to five CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to six CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to seven CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to eight CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and two to nine CTPs bound to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide consisting of a coagulation factor and 2 to 10 CTPs bound to the carboxy terminus of the coagulation factor.

[0118] In one embodiment, the present invention provides a polypeptide comprising a coagulation factor and three gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to four CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to five CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to six CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to seven CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to eight CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and three to nine CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide consisting of a coagulation factor and 3 to 10 CTPs bound to the carboxy terminus of the coagulation factor.

[0119] In one embodiment, the present invention provides a polypeptide comprising a coagulation factor and four gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to five CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to six CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to seven CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to eight CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to nine CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, the present invention provides a polypeptide comprising a coagulation factor and four to ten CTPs attached to the carboxy terminus of the coagulation factor.

[0120] In one embodiment, the present invention provides a polypeptide comprising a coagulation factor and five gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and five to six CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and five to seven CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and five to eight CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and five to nine CTPs attached to the carboxy terminus of the coagulation factor. In another embodiment, provided herein is a polypeptide comprising a coagulation factor and five to ten CTPs attached to the carboxy terminus of the coagulation factor.

[0121] In one embodiment, the invention provides herein a polypeptide consisting essentially of a clotting factor and two gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to three CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to four CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and two to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a coagulation factor and 2-9 CTPs attached to the carboxy terminus of the coagulation factor.In another embodiment, provided herein is a polypeptide consisting essentially of a coagulation factor and 2-10 CTPs attached to the carboxy terminus of the coagulation factor.

[0122] In one embodiment, the invention provides herein a polypeptide consisting essentially of a clotting factor and three gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to four CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and three to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a coagulation factor and 3 to 10 CTPs attached to the carboxy terminus of the coagulation factor.

[0123] In one embodiment, the present invention provides a polypeptide consisting essentially of a clotting factor and four gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to five CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and four to ten CTPs attached to the carboxy terminus of the clotting factor.

[0124] In one embodiment, the invention provides herein a polypeptide consisting essentially of a clotting factor and five gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and five to six CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and five to seven CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and five to eight CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and five to nine CTPs attached to the carboxy terminus of the clotting factor. In another embodiment, provided herein is a polypeptide consisting essentially of a clotting factor and five to ten CTPs attached to the carboxy terminus of the clotting factor.

[0125] In another embodiment, provided herein is a polypeptide comprising, consisting essentially of, or consisting of a coagulation factor that does not have a CTP at the amino terminus. In another embodiment, provided herein is a polypeptide comprising, consisting essentially of, or consisting of a coagulation factor that lacks a CTP at the amino terminus. In another embodiment, provided herein is a polypeptide comprising, consisting essentially of, or consisting of a coagulation factor that has at least one CTP at the carboxy terminus and does not have a CTP at the amino terminus. In another embodiment, provided herein is a polypeptide comprising, consisting essentially of, or consisting of a coagulation factor that has a number of CTPs described herein at the carboxy terminus and does not have a CTP at its amino terminus.

[0126] In another embodiment, the present invention provides a polynucleotide encoding a polypeptide as described herein above.

[0127] In another embodiment, the present invention further provides a composition comprising an expression vector comprising a polynucleotide encoding a factor IX (FIX) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FIX polypeptide.

[0128] In another embodiment, the present invention further provides a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VIIa (FVIIa) polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of said FVIIa polypeptide. In another embodiment, the present invention further provides a composition comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VIIa (VIIa) polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of said FVIIa polypeptide. In one embodiment, the CTP-modified FVIIa comprises a signal peptide. In another embodiment, the CTP-modified FVIIa does not comprise a signal peptide.

[0129] In one embodiment, the invention provides a recombinant coagulation factor as described herein above. In one embodiment, the invention provides an engineered coagulation factor, such as described above. In one embodiment, the engineered coagulation factor, such as described above, is referred to as a CTP-modified coagulation factor.

[0130] In one embodiment, the CTPs attached to the carboxy terminus of the coagulation factor are attached in tandem to the carboxy terminus.

[0131] In one embodiment, the engineered coagulation factors described herein have equivalent or improved biological activity compared to non-CTP modified coagulation factors. In another embodiment, the engineered coagulation factors described herein have equivalent or improved pharmacological endpoints compared to non-CTP modified coagulation factors. In another embodiment, the engineered coagulation factors described herein have equivalent or improved pharmacokinetics compared to non-CTP modified coagulation factors. In another embodiment, the engineered coagulation factors described herein have equivalent or improved pharmacodynamics compared to non-CTP modified coagulation factors.

[0132] In one embodiment, the present invention provides a method for preventing or treating a blood clotting disorder or abnormality. In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, comprising administering a CTP-modified clotting factor of the present invention. In another embodiment, the present invention provides a method for preventing and treating hemophilia in a subject, comprising administering a CTP-modified clotting factor of the present invention. In another embodiment, the present invention provides a method for treating hemophilia in a subject, comprising administering a CTP-modified Factor VII of the present invention.

[0133] In one embodiment, the hemophilia is hemophilia A. In another embodiment, the hemophilia is hemophilia B. In another embodiment, the method of the invention for preventing or treating blood clotting disorders or blood clotting abnormalities prevents or treats hemophilia in patients with hemophilia A or B with inhibitors to FVIII or FIX, respectively. In another embodiment, the method of the invention is for preventing or treating patients with acquired hemophilia (hemophilia without inhibitors). In another embodiment, the method of the invention for preventing or treating blood clotting disorders or blood clotting abnormalities prevents or treats hemophilia A or B without inhibitors. In another embodiment, the hemophilia is severe hemophilia. In another embodiment, the hemophilia is moderate hemophilia. In another embodiment, the hemophilia is moderate to severe hemophilia with or without inhibitors. It will be understood by those skilled in the art that the term "moderate to severe hemophilia" refers to subjects with 3% or less of FVIII or FIX.

[0134] In another embodiment, the present invention provides a method of treating hemophilia in a subject comprising administering a CTP-modified factor IX of the present invention. In one embodiment, hemophilia B is known as factor IX deficiency or Christmas disease. In one embodiment, the hemophilia is severe hemophilia, which in one embodiment refers to hemophilia in which the clotting factor level is 0-1%. In another embodiment, the hemophilia is moderate hemophilia, which in one embodiment refers to hemophilia in which the clotting factor level is 1-5%. In another embodiment, the hemophilia is mild hemophilia, which in one embodiment refers to hemophilia in which the clotting factor level is 5-50%.

[0135] In another embodiment, the present invention provides a method for preventing or treating a blood clotting disorder or abnormality in a subject, comprising administering to the subject a CTP-modified Factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby preventing or treating the blood clotting disorder or abnormality in the subject.In another embodiment, the present invention provides a method for preventing or treating a blood clotting disorder or abnormality in a subject, comprising administering to the subject a CTP-modified Factor VII (FVII) polypeptide comprising a FVII polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FVII polypeptide, thereby preventing or treating the blood clotting disorder or abnormality in the subject.

[0136] In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby preventing or treating hemophilia in the subject.In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor VIIa (FVIIa) polypeptide comprising a FVIIa polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FVIIa polypeptide, thereby preventing or treating hemophilia in the subject.

[0137] In another embodiment, the present invention provides a method for treating hemophilia in a subject, comprising administering to the subject one or more CTP-modified coagulation factors as described herein. Thus, in one embodiment, the present invention provides a method for treating hemophilia in a subject, comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FIX polypeptide, and a CTP-modified factor VIIa (FVIIa) polypeptide comprising a FVIIa polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVIIa polypeptide, thereby treating hemophilia in the subject. In one embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered simultaneously in the same composition. In another embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered simultaneously as separate compositions. In another embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered as separate compositions and at separate times.

[0138] In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide comprising a FIX or FVII polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide comprising a FIX or FVII polypeptide and four chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide comprising a FIX or FVII polypeptide and five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide comprising a FIX or FVII polypeptide and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide, thereby preventing or treating hemophilia in the subject.In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) and a CTP-modified factor VII polypeptide (comprising FIX and FVII polypeptides and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX and FVII polypeptides), thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method of preventing or treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) and a CTP-modified factor VII polypeptide (comprising FIX and FVII polypeptides and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX and FVII polypeptides), thereby preventing or treating hemophilia in the subject.

[0139] In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, comprising administering a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide (comprising a FIX or FVII polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide) subcutaneously or intravenously to the subject, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, comprising administering a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide (comprising a FIX or FVII polypeptide and four chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide) subcutaneously or intravenously to the subject, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, the method comprising administering a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide (comprising a FIX or FVII polypeptide and five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide) subcutaneously or intravenously to the subject, thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, the method comprising administering a CTP-modified factor IX (FIX) or a CTP-modified factor VII polypeptide (comprising a FIX or FVII polypeptide and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX or FVII polypeptide) subcutaneously or intravenously to the subject, thereby preventing or treating hemophilia in the subject.In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, the method comprising administering subcutaneously or intravenously to the subject a CTP-modified factor IX (FIX) and a CTP-modified factor VII polypeptide (comprising FIX and FVII polypeptides and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX and FVII polypeptides), thereby preventing or treating hemophilia in the subject. In another embodiment, the present invention provides a method for preventing or treating hemophilia in a subject, the method comprising administering subcutaneously or intravenously to the subject a CTP-modified factor IX (FIX) and a CTP-modified factor VII polypeptide (comprising FIX and FVII polypeptides and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX and FVII polypeptides), thereby preventing or treating hemophilia in the subject.

[0140] In some embodiments, provided herein is a method of preventing or treating hemophilia in a subject comprising administering to a subject a CTP-modified coagulation factor comprising three to five chorionic gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of the coagulation factor polypeptide, wherein the sequence of the CTP-modified coagulation factor is selected from the group consisting of SEQ ID NO: 25, 27, or 29. In another embodiment, the CTP-modified coagulation factor is selected from the group consisting of SEQ ID NO: 25, 27, 29, or 46. In another embodiment, the CTP-modified coagulation factor consists of SEQ ID NO: 46.

[0141] In one embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and three to five gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide. In another embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide. In another embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and five gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide.

[0142] In one embodiment, the term "three to five," when referring to gonadotropin carboxy terminal peptides (CTPs), refers to the attachment of three, four, or five CTPs to the carboxy terminus of a coagulation factor polypeptide provided herein.

[0143] In one embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and three to five gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide. In another embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide. In another embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a Factor VII (FVII) polypeptide and five gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy terminus of the FVII polypeptide.

[0144] In one embodiment, the present invention provides a method for extending the biological half-life of a Factor VII (FVII) polypeptide, comprising the step of attaching three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby extending the biological half-life of the FVII polypeptide. In another embodiment, the present invention provides a method for extending the biological half-life of a Factor VII (FVII) polypeptide, comprising the step of attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby extending the biological half-life of the FVII polypeptide. In another embodiment, the present invention provides a method for extending the biological half-life of a Factor VII (FVII) polypeptide, comprising the step of attaching five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby extending the biological half-life of the FVII polypeptide.

[0145] In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a factor VII (FVII) polypeptide, comprising attaching three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby increasing the AUC of the FVII polypeptide. In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a factor VII (FVII) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby increasing the AUC of the FVII polypeptide. In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a factor VII (FVII) polypeptide, comprising attaching five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby increasing the AUC of the FVII polypeptide.

[0146] In one embodiment, the present invention provides a method for reducing the frequency of administration of a factor VII (FVII) polypeptide, comprising the step of attaching three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the frequency of administration of the FVII polypeptide. In another embodiment, the present invention provides a method for reducing the frequency of administration of a factor VII (FVII) polypeptide, comprising the step of attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the frequency of administration of the FVII polypeptide. In another embodiment, the present invention provides a method for reducing the frequency of administration of a factor VII (FVII) polypeptide, comprising the step of attaching five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the frequency of administration of the FVII polypeptide.

[0147] In one embodiment, the present invention provides a method for reducing the clearance rate of a Factor VII (FVII) polypeptide, comprising attaching three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the clearance rate of the FVII polypeptide. In another embodiment, the present invention provides a method for reducing the clearance rate of a Factor VII (FVII) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the clearance rate of the FVII polypeptide. In another embodiment, the present invention provides a method for reducing the clearance rate of a Factor VII (FVII) polypeptide, comprising attaching five chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby reducing the clearance rate of the FVII polypeptide.

[0148] In one embodiment, the present invention provides a method for producing a CTP-modified factor VII (FVII) polypeptide, the method comprising the step of binding 3 to 5 chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby producing a CTP-modified FVII polypeptide. In another embodiment, the present invention provides a method for producing a CTP-modified factor VII (FVII) polypeptide, the method comprising the step of binding 3 chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby producing a CTP-modified FVII polypeptide. In another embodiment, the present invention provides a method for producing a CTP-modified factor VII (FVII) polypeptide, the method comprising the step of binding 5 chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVII polypeptide, thereby producing a CTP-modified FVII polypeptide.

[0149] In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified Factor VII (FVII) polypeptide comprising a FVII polypeptide and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FVII polypeptide, thereby treating hemophilia in the subject.In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified Factor VII (FVII) polypeptide comprising a FVII polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FVII polypeptide, thereby treating hemophilia in the subject. In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified Factor VII (FVII) polypeptide comprising a FVII polypeptide and five chorionic gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVII polypeptide, thereby treating hemophilia in the subject.

[0150] In another embodiment, provided herein is a method further comprising the step of attaching four chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of said FVII polypeptide.

[0151] In other embodiments, the engineered clotting factors are for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising three CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising four CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising five CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In another embodiment, clotting factor IX comprising two CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In another embodiment, clotting factor IX comprising one CTP repeat at the carboxy terminus is for the treatment of patients with hemophilia B. In other embodiments, the engineered clotting factors allow for a reduction in the number of infusions required for a patient, a reduction in the dosage required for a patient, or a combination thereof.

[0152] In one embodiment, coagulation factor IX containing three CTPs in tandem at the carboxy terminus exhibits an improved PK profile while maintaining its coagulation activity compared to FIX-CTP-CTP harvest, FIX-CTP harvest or rhFIX. In one embodiment, the elimination half-life of rFIX-CTP3 is 2.5-4 times longer than rFIX in rats and FIX-deficient mice. In one embodiment, administration of rFIX-CTP3 in FIX-deficient mice significantly extended the procoagulant effect for at least 76 hours after administration. In one embodiment, administration of rFIX-CTP3 in FIX-deficient mice produced a higher activity peak than rFIX. In another embodiment, coagulation factor IX containing two CTPs in tandem at the carboxy terminus exhibits an improved PK profile while maintaining its coagulation activity compared to FIX-CTP harvest or rhFIX. In another embodiment, coagulation factor IX, which contains two CTPs in tandem at its carboxyl terminus, exhibits a 3-fold increase in half-life and a 4.5-fold greater AUC compared to rhFIX.

[0153] In another embodiment, SC administration results in higher bioavailability of CTP-modified FVII than recombinant FVII. In another embodiment, the half-life is longer and the bioavailability (AUC SC / AUC IV) is greater after SC administration of FVIIa-CTP3 and FVIIa-CTP5 when compared to SC administration of NovoSeven®. In another embodiment, subcutaneously injected MOD-5014 and MOD-5019 show improved mouse survival compared to recombinant FVII (NovoSeven®) (see Example 8 below).

[0154] In one embodiment, MOD-5014 is FVIIa-CTP 3 (having three CTP peptides attached to the C-terminus). In one embodiment, MOD-5014 provides a long-acting clotting factor. In one embodiment, MOD-5014 provides a more sustained, prolonged blood clotting response compared to recombinant human FVIIa. (See, e.g., Example 14). The term MOD-5014 or FVIIa-CTP 3 Those skilled in the art will appreciate that the terms "C-terminal end of the CTP-modified coagulation factor, e.g., FVII-CTP, C ... 3 In the explanation of the term FVII-CTP 3 In certain cases, the inactive form of FVII-CTP 3 It will be understood that the term MOD-5014 can refer to the term FVIIa-CTP. A person skilled in the art will certainly know which form is being referred to based on the relevant details such as activity. Similarly, the term MOD-5014 can refer to the term FVIIa-CTP. 3 i.e., the activated form of the CTP-modified coagulation factor, but in certain cases the term MOD-5014 refers to the activated form of FVII or FVII-CTP. 3This nucleotide sequence can then be expressed and secreted from the cell, purified, and activated in vitro to yield the activated form of FVIIa present in the MOD-5014 molecule.

[0155] In one embodiment, inactivation of MOD-5014 by tissue factor pathway inhibitor (TFPI) is dose-dependent. In one embodiment, inactivation of MOD-5014 by TFPI shows similarity to the dose-dependent inactivation pattern of recombinant FVIIa (NovoSeven®) by TFPI. In one embodiment, MOD-5014 is inhibited by antithrombin III. In one embodiment, inhibition of MOD-5014 by antithrombin III is enhanced in the presence of heparin. In one embodiment, inhibition of MOD-5014 by antithrombin III shows similarity to the inhibition pattern of recombinant FVIIa (NovoSeven®) in the presence or absence of heparin (see Example 11 below).

[0156] In one embodiment, MOD-5014 generates thrombin in a dose-dependent manner. In one embodiment, MOD-5014 shortens the induction phase of thrombin generation. In one embodiment, MOD-5014 shortens blood clotting time. In one embodiment, MOD-5014 increases the efficiency of blood clot formation. In one embodiment, MOD-5014 shortens blood clotting time in a subject. In one embodiment, MOD-5014 increases the efficiency of blood clot formation in a subject. In one embodiment, thrombin generation by MOD-5014 is similar to that generated by recombinant FVIIa (NovoSeven®). In one embodiment, the induction phase of thrombin generation by MOD-5014 is similar to that produced by recombinant FVIIa (NovoSeven®). In one embodiment, the shortening of blood clotting time by MOD-5014 is similar to that produced by recombinant FVIIa (NovoSeven®). In one embodiment, the increase in the efficiency of blood clot formation by MOD-5014 is similar to that provided by recombinant FVIIa (NovoSeven®).

[0157] As provided herein, binding of CTP to coagulation factors, such as FVII, FVIIa and FX factors, extends the half-life of blood coagulation factors. Examples 11, 12 and 13 show that CTP binding, such as three CTPs bound to FVIIa, does not appear to affect blood coagulation activity. In one embodiment, CTP binding to FVII does not interfere with clot formation. In one embodiment, CTP binding to FVII does not interfere with increasing clot formation efficiency. In one embodiment, CTP binding to FVII does not interfere with shortening blood clotting time. In one embodiment, binding of phospholipids to FVII is maintained after binding of CTP to blood coagulation factors. In one embodiment, CTP binding to FVIIA does not interfere with clot formation. In one embodiment, CTP binding to FVIIA does not interfere with increasing clot formation efficiency. In one embodiment, CTP binding to FVIIA does not interfere with decreasing clot formation. In one embodiment, the binding of the phospholipid to FVIIA is maintained after binding of the CTP to the blood clotting factor.

[0158] In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby treating hemophilia in the subject. In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby treating hemophilia in the subject. In another embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and five chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby treating hemophilia in the subject. In another embodiment, the present invention provides a method for treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor VIIa (FVIIa) polypeptide comprising an FVIIa polypeptide and three to five chorionic gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide, thereby treating hemophilia in the subject.

[0159] In another embodiment, the present invention provides a method of treating hemophilia in a subject, comprising administering to the subject one or more CTP-modified coagulation factors as described herein. Thus, in one embodiment, the present invention provides a method of treating hemophilia in a subject, comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FIX polypeptide, and a CTP-modified factor VIIa (FVIIa) polypeptide comprising a FVIIa polypeptide and three to five chorionic gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVIIa polypeptide, thereby treating hemophilia in the subject. In one embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered simultaneously in the same composition. In another embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered simultaneously as separate compositions. In another embodiment, the CTP-modified FIX and the CTP-modified FVIIa are administered as separate compositions and at separate times.

[0160] In other embodiments, the engineered clotting factors are for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising three CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising four CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In one embodiment, clotting factor IX comprising five CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In another embodiment, clotting factor IX comprising two CTPs in tandem at the carboxy terminus is for the treatment of patients with hemophilia B. In another embodiment, clotting factor IX comprising one CTP repeat at the carboxy terminus is for the treatment of patients with hemophilia B. In other embodiments, the engineered clotting factors allow for a reduction in the number of infusions required for a patient, a reduction in the dosage required for a patient, or a combination thereof.

[0161] Example 14 shows the results of administering MOD-5014 to a large mammal (dog). Administration of MOD-5014 provided an effective and safe long-acting FVIIa for blood clotting. Treatment with MOD-5014 can be prophylactic or on-demand. In one embodiment, the invention provides a method of treating hemophilia in a subject, the method comprising administering MOD-5014 to the subject, thereby treating the hemophilia in the subject. In one embodiment, the invention provides a method of preventing excessive bleeding in a subject, the method comprising administering MOD-5014 to the subject, thereby preventing the excessive bleeding in the subject. In one embodiment, the invention provides a method of prophylactically treating hemophilia in a subject, the method comprising administering MOD-5014 to the subject, thereby prophylactically treating hemophilia in the subject.

[0162] In one embodiment, treating a subject for hemophilia with MOD-5014 comprises reducing the frequency of administration of MOD-5014 as compared to recombinant FVIIa (NovoSeven®). In one embodiment, prophylactic treatment of a subject for hemophilia with MOD-5014 comprises reducing the frequency of administration of MOD-5014 as compared to recombinant FVIIa (NovoSeven®). In one embodiment, treating a subject for hemophilia with MOD-5014 comprises reducing the frequency of administration of MOD-5014 as compared to recombinant FVIIa (NovoSeven®).

[0163] In one embodiment, coagulation factor IX containing three CTPs in tandem at the carboxy terminus exhibits an improved PK profile while maintaining its coagulation activity compared to FIX-CTP-CTP harvest, FIX-CTP harvest or rhFIX. In one embodiment, the elimination half-life of rFIX-CTP3 is 2.5-4 times longer than rFIX in rats and FIX-deficient mice. In one embodiment, administration of rFIX-CTP3 in FIX-deficient mice significantly extended the procoagulant effect for at least 76 hours after administration. In one embodiment, administration of rFIX-CTP3 in FIX-deficient mice produced a higher activity peak than rFIX. In another embodiment, coagulation factor IX containing two CTPs in tandem at the carboxy terminus exhibits an improved PK profile while maintaining its coagulation activity compared to FIX-CTP harvest or rhFIX. In another embodiment, coagulation factor IX, which contains two CTPs in tandem at its carboxyl terminus, exhibits a 3-fold increase in half-life and a 4.5-fold greater AUC compared to rhFIX.

[0164] In one embodiment, coagulation factor VII, which contains three CTPs in tandem at the carboxy terminus, maintains its coagulation activity while exhibiting an improved PK profile compared to NovoSeven® (see Table 59 and Figure 36).

[0165] In another embodiment, the terms "CTP peptide," "carboxy terminal peptide," and "CTP sequence" are used interchangeably herein. In another embodiment, the carboxy terminal peptide is full-length CTP. Each can be a separate embodiment of the disclosure.

[0166] In another embodiment, the signal peptide is attached to the amino terminus of the CTP, as described in U.S. Patent No. 7,553,940, the entirety of which is incorporated herein by reference. In another embodiment, the signal peptide is not attached to the amino terminus of the CTP.

[0167] In another embodiment, the term engineered clotting factor refers to the amino acid sequence of a mature clotting factor, hi another embodiment, the term engineered clotting factor refers to the amino acid sequence of a clotting factor including a signal sequence or signal peptide.

[0168] In another embodiment, "signal sequence" and "signal peptide" are used interchangeably herein and have exactly the same properties and meanings. In another embodiment, "sequence" may refer to a coding portion when referring to a polynucleotide molecule. In another embodiment, the engineered clotting factors comprising at least one CTP as described herein have enhanced in vivo biological activity compared to the same clotting factors not comprising at least one CTP. In one embodiment, the enhanced biological activity results from a longer half-life of the engineered clotting factor while maintaining at least some biological activity. In another embodiment, the enhanced biological activity results from an enhanced biological activity resulting from the CTP modification. In another embodiment, the enhanced biological activity results from both a longer half-life and an enhanced function of the CTP-modified clotting factor.

[0169] In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor allows for enhanced protection of the coagulation factor against degradation. In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor allows for enhanced protection against clearance. In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor allows for extended clearance time. In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor increases its Cmax. In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor increases its Tmax. In some embodiments, at least one CTP sequence at the carboxy terminus of a coagulation factor increases its Tmax. 1 / 2 Extend the period.

[0170] In another embodiment, the conjugated coagulation factors of the invention are used in the same manner as unmodified conjugated coagulation factors. In another embodiment, the conjugated coagulation factors of the invention provide increased circulating half-life and plasma residence time, reduced clearance, and increased clinical activity in vivo. In another embodiment, due to the improved properties of the conjugated coagulation factors described herein, the conjugates are administered less frequently than unmodified forms of the same coagulation factors.

[0171] In another embodiment, the reduced dosing frequency results in improved treatment regimens, which in one embodiment leads to improved patient compliance, improved treatment outcomes, and improved quality of life for patients. In another embodiment, compared to conventional coagulation factor conjugates, conjugates having the molecular weights and linker structures of the conjugates of the present invention have been shown to provide improved efficacy, improved stability, increased AUC levels, and increased circulating half-life.

[0172] In another embodiment, the present invention further provides a pharmaceutical composition or formulation comprising a CTP-modified factor IX (FIX) polypeptide consisting of a FIX polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the CTP-modified FIX polypeptide.

[0173] In another embodiment, the present invention further provides a pharmaceutical composition or formulation comprising a FVIIa polypeptide and a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of a FVIIa polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa.

[0174] In another embodiment, the present invention further provides a pharmaceutical composition or formulation comprising a FVIIa polypeptide and a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of a FVIIa polypeptide and four gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa.

[0175] In another embodiment, the present invention further provides a pharmaceutical composition or formulation comprising a FVIIa polypeptide and a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of five gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa.

[0176] In another embodiment, provided herein is a composition comprising a complexed coagulation factor as described herein. In another embodiment, provided herein is a pharmaceutical composition comprising a complexed coagulation factor as described herein. In another embodiment, provided herein is a pharmaceutical composition comprising a therapeutically effective amount of a complexed coagulation factor as described herein. In one embodiment, the therapeutically effective amount of the complexed coagulation factor will depend on factors such as the particular condition being treated, the condition of the patient being treated, and other components in the composition.

[0177] Thus, in one embodiment, the disclosure provides a pharmaceutical formulation for use in the compositions, formulations, and methods of the disclosure. In another embodiment, the disclosure provides a pharmaceutical formulation comprising a polypeptide consisting of a coagulation factor and three chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the coagulation factor. In another embodiment, the pharmaceutical formulation further comprises a buffer and a tonicity agent. In another embodiment, the buffer is 20 mM citrate and 13.3 mM glycine, and the tonicity agent is 150 mM NaCl. In another embodiment, the formulation is at a pH of about 6.4. In another embodiment, the buffer is 20 mM citrate and 13.3 mM glycine, the tonicity agent is 150 mM NaCl, and the pH is 6.4. In another embodiment, the formulation is a liquid formulation. In another embodiment, the formulation is a lyophilized formulation. In another embodiment, the liquid formulation may be formed using a lyophilized CTP-modified coagulation factor. In another embodiment, the CTP-modified coagulation factor is FVII-CTP-CTP-CTP. In another embodiment, the CTP-modified coagulation factor is FVIIa-CTP-CTP-CTP.

[0178] In another embodiment, provided herein is a once-weekly dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is a once-daily dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is an every-other-day dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is an every-third-day dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is a twice-weekly dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is a twice-weekly dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is a once-weekly dosage form comprising the pharmaceutical formulation provided herein. In another embodiment, provided herein is a biweekly (every two weeks) dosage form comprising the pharmaceutical formulation provided herein.

[0179] In another embodiment, the invention provides a formulation comprising a polypeptide consisting of a clotting factor and three to five chorionic gonadotropin carboxy terminal peptides (CTPs) attached to the carboxy terminus of said clotting factor, said polypeptide optionally consisting of a signal peptide, said formulation having increased stability. In one embodiment, the formulation is stable for at least one year. In another embodiment, the formulation is stable for at least two years.

[0180] In one embodiment, the CTP-modified coagulation factor is formulated in a liquid formulation. In another embodiment, the CTP-modified Factor VII is formulated in a liquid formulation. In another embodiment, the CTP-modified Factor VIIa is formulated in a liquid formulation. In another embodiment, the CTP-modified Factor IX is formulated in a liquid formulation. In another embodiment, the CTP-modified coagulation factor is formulated in an intranasal dosage form. In another embodiment, the CTP-modified coagulation factor is formulated in an injectable dosage form.

[0181] In another embodiment, a method of the disclosure comprises improving compliance in the use of clotting factor therapy, the method comprising providing a clotting factor modified by CTP to a subject in need thereof, thereby improving compliance in the use of a clotting factor therapeutic.

[0182] In another embodiment, the CTP-modified coagulation factor is administered to the subject once a day. In another embodiment, the polypeptide comprising the CTP-modified coagulation factor is administered to the subject once every two days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every three days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every four days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every five days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every six days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once a week. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every 7-14 days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every 10-20 days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every 5-15 days. In another embodiment, the CTP-modified coagulation factor is administered to the subject once every 15-30 days.

[0183] In one embodiment, the formulations of the present invention are formulated into a liquid formulation for injection via a syringe or pen device.

[0184] In one embodiment, the formulations provided herein also contain preservatives such as benzalkonium chloride and thimerosal, chelating agents such as sodium edetate, buffers such as phosphoric acid, citric acid and acetic acid, tonicity agents such as sodium chloride, potassium chloride, glycerin and mannitol, antioxidants such as ascorbic acid, acetylcystine, sodium metabisulfite, fragrances, viscosity modifiers such as polymers including cellulose and its derivatives, polyvinyl alcohol, and acids and bases for adjusting the pH of these aqueous compositions as needed.The compositions also contain local anesthetics, or other active substances.The compositions can be used as sprays, mists, drops, and the like.

[0185] In one embodiment, the clotting factors described herein are human clotting factors.

[0186] In another embodiment, the conjugated clotting factors described herein are useful for treating subjects suffering from a blood clotting abnormality or disorder. In another embodiment, the blood clotting abnormality or disorder is hemophilia. In another embodiment, the conjugated clotting factors described herein are useful in the prophylactic treatment of hemophilia, thus reducing the risk of bleeding and related complications. In another embodiment, the reduced risk of bleeding and related complications reduces the risk of spontaneous bleeding. In another embodiment, the reduced risk of bleeding and related complications reduces the risk of excessive bleeding. In another embodiment, the conjugated clotting factors described herein are useful for treating subjects suffering from hemophilia, while reducing the risk of developing inhibitory antibodies against the exogenously administered clotting factor. In another embodiment, the conjugated clotting factors described herein are useful for treating subjects suffering from hemophilia, thus inducing homeostasis.

[0187] In one embodiment, the CTP-modified coagulation factors of the invention have several therapeutic uses, hi another embodiment, the CTP-modified coagulation factors of the invention have several prophylactic uses.

[0188] In another embodiment, the conjugated clotting factors described herein are useful for treating subjects who have experienced excessive bleeding or bruising, or who have a long prothrombin time (PT) or partial thromboplastin time (PTT). In another embodiment, the conjugated clotting factors described herein are useful for treating subjects who have an acquired condition that causes bleeding, such as vitamin K deficiency or liver disease. In another embodiment, the conjugated clotting factors described herein are useful for treating subjects who have an acquired (due to other diseases) or inherited, mild or severe, persistent or temporary deficiency of a clotting factor. In another embodiment, the conjugated clotting factors described herein are useful for treating subjects who have hemophilia A. In another embodiment, the conjugated clotting factors described herein are useful for treating subjects who have hemophilia B. In another embodiment, the conjugated coagulation factors described herein are useful for treating subjects with chronic diseases such as liver disease or cancer, acute conditions such as disseminated intravascular coagulation (DIC) that rapidly deplete clotting factors, or acquired deficiencies due to vitamin K deficiency or treatment with vitamin K antagonists such as warfarin (vitamin K is required for the production of factors II, VII, IX, and X). In another embodiment, the conjugated coagulation factors described herein are useful for treating subjects suffering from diseases that result in coagulation imbalances, such as, but not limited to, liver disease, uremia, cancer, bone marrow disorders, exposure to snake venom, vitamin K deficiency, anticoagulant therapy, accidental ingestion of the anticoagulant warfarin, multiple transfusions (where stored blood units lose some of their clotting factors), or combinations thereof. In another embodiment, the invention provides a method of treating deep vein thrombosis in a subject, the method comprising administering a CTP-modified coagulation factor of the invention. In another embodiment, the invention provides a method of preventing uncontrolled bleeding in a subject with hemophilia, the method comprising administering a CTP-modified clotting factor of the invention.In another embodiment, the invention provides a method of preventing bleeding episodes in a subject with hemophilia, the method comprising administering a CTP-modified clotting factor of the invention.In another embodiment, the invention provides a method of controlling bleeding episodes in a subject with hemophilia B (congenital factor IX deficiency).

[0189] In one embodiment, a composition of the invention comprises a formulation as described herein. In another embodiment, a method of the invention comprises administering a formulation as described herein. In another embodiment, a method of the invention comprises administering a composition comprising a formulation as described herein.

[0190] In another embodiment, the compositions, formulations and methods of the invention are for the treatment of bleeding episodes in patients with hemophilia A or B with inhibitors against FVIII or FIX and in patients with acquired hemophilia, for the prevention of bleeding during surgical interventions or invasive procedures in patients with hemophilia A or B with inhibitors against FVIII or FIX and in patients with acquired hemophilia, for the treatment of bleeding episodes in patients with congenital FVII deficiency and for the prevention of bleeding during surgical interventions or invasive procedures in patients with congenital FVII deficiency. Acquired hemophilia is a naturally occurring autoimmune disorder in which previously normal hemostasis has led to the development of autoantibodies against clotting factors, most often FVIII. The development of autoantibodies against FVIII leads to FVIII deficiency, which results in insufficient generation of thrombin by factor IXa and factor VIIIa complexes via the intrinsic pathway of the coagulation cascade. The following conditions may be associated with acquired hemophilia A: idiopathic, pregnancy, autoimmune disorders, inflammatory bowel disease, ulcerative colitis, skin disorders (e.g., psoriasis, pemphigus), respiratory disorders (e.g., asthma, chronic obstructive pulmonary disease), allergic drug reactions, diabetes, acute hepatitis B infection, acute hepatitis C infection, malignant lesions - solid tumors (prostate, lung, colon, pancreas, stomach, bile duct, head and neck, cervix, breast, melanoma, kidney), hematological tumors. Those skilled in the art will appreciate that autoimmune disorders may include rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, temporal arteritis, Sjogren's syndrome, autoimmune hemolytic anemia, Goodpasture's syndrome, myasthenia gravis, Graves' disease, autoimmune hypothyroidism. Those skilled in the art will appreciate that allergic reactions may occur from penicillin and its derivatives, sulfamides, phenytoin, chloramphenicol, methyldopa, depo-thioxanthene, interferon alpha, fludarabine, Bacillus Calmette-Guerin (BCG) vaccination, desvenlafaxine. Those skilled in the art will appreciate that hematological malignancies may include chronic lymphocytic leukemia, non-Hodgkin's lymphoma, multiple myeloma, Waldenstrom's hypergammaglobulinemia, myelodysplastic syndrome, myelofibrosis, and erythroleukemia.Accordingly, and in one embodiment, provided herein is a method of treating acquired hemophilia in a subject, the method comprising administering to the subject any of the compositions provided herein.

[0191] In another embodiment, the compositions, formulations, and methods of the invention are for the treatment or prevention of muscle bleeding. In another embodiment, the compositions, formulations, and methods of the invention are for the treatment or prevention of joint bleeding. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of nose and gum bleeding, mucosal bleeding, bleeding into the central nervous system. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of gastrointestinal or cerebral bleeding. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of infrequent mild bleeding. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of infrequent moderate bleeding. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of frequent mild bleeding. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of frequent moderate bleeding.

[0192] In one embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of asymptomatic hemophilia. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of mild to moderate hemophilia. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of severe hemophilia.

[0193] In one embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of hemorrhage, which in one embodiment is uncontrolled bleeding, and in another embodiment is intracerebral hemorrhage. In another embodiment, the compositions, formulations, and methods of the invention provide therapeutic or prophylactic treatment of neonatal coagulation disorders, severe liver disease, high-risk surgical procedures, traumatic blood loss, bone marrow transplants, thrombocytopenia and platelet dysfunction, emergency reversal of oral anticoagulants, congenital deficiencies of factors V, VII, X, and XI, or von Willebrand's disease, which in one embodiment involves an inhibitor of von Willebrand's factor.

[0194] In one embodiment, the CTP-modified coagulation factors of the invention are for the treatment of hemophilia or a related disorder as described herein in a subject. In one embodiment, the subject is a human. In another embodiment, the subject is a human child. In another embodiment, the subject is a domesticated animal. In another embodiment, the subject is a mammal. In another embodiment, the subject is a farm animal. In another embodiment, the subject is a monkey. In another embodiment, the subject is a horse. In another embodiment, the subject is a cow. In another embodiment, the subject is a mouse. In another embodiment, the subject is a rat. In another embodiment, the subject is a dog. In another embodiment, the subject is a cat. In another embodiment, the subject is a cow, sheep, pig, horse, mouse, or deer. In one embodiment, the subject is male. In another embodiment, the subject is female. In one embodiment, the subject is a child, in another embodiment, an adolescent, in another embodiment, an adult, or in another embodiment, an older subject. In another embodiment, the subject is a pediatric subject, in another embodiment, an older subject.

[0195] In another embodiment, the [(CTP)n>1-clotting factor] described herein comprises a full-length clotting factor or active fragment thereof linked to at least one CTP unit via a peptide bond at the carboxy terminus and no CTP at the amino terminus. In another embodiment, the [(CTP)n>1-clotting factor] described herein comprises a clotting factor or active fragment thereof linked to at least one CTP unit via a peptide bond, linked to an additional CTP unit via a peptide bond and no CTP at the amino terminus. In another embodiment, a nucleic acid molecule encodes an engineered clotting factor that comprises at least one CTP attached to its C terminus and no CTP at its amino terminus.

[0196] In another embodiment, the CTP is linked to the clotting factor via a linker. In another embodiment, the bond of the linker linking the CTP sequence to the clotting factor is a covalent bond. In another embodiment, the bond of the linker linking the CTP sequence to the clotting factor is a peptide bond. In another embodiment, the bond of the linker linking the CTP sequence to the clotting factor is a substituted peptide bond. In another embodiment, the CTP sequence comprises DPRFQDSSSSKAPPPSLPSPSRLPGPSDTPIL (SEQ ID NO: 1). In another embodiment, the CTP sequence comprises SSSSKAPPPSLPSPSRLPGPSDTPILPQ (SEQ ID NO: 2). In another embodiment, the CTP sequence comprises an amino acid sequence selected from the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2.

[0197] In another embodiment, a carboxy terminal peptide (CTP) peptide of the invention comprises the amino acid sequence of amino acid positions 112-145 of human chorionic gonadotropin as set forth in SEQ ID NO: 1. In another embodiment, a CTP sequence of the invention comprises the amino acid sequence of amino acid positions 118-145 of human chorionic gonadotropin as set forth in SEQ ID NO: 2. In another embodiment, the CTP sequence also begins at any position between amino acids 112-118 of human chorionic gonadotropin and ends at position 145. In some embodiments, the peptide of this CTP sequence is 28, 29, 30, 31, 32, 33 or 34 amino acids in length and begins at position 112, 113, 114, 115, 116, 117 or 118 of the CTP amino acid sequence.

[0198] In another embodiment, the CTP peptide is a variant of chorionic gonadotropin CTP that differs from native CTP by one to five conservative amino acid substitutions as described in U.S. Pat. No. 5,712,122, which is incorporated herein by reference. In another embodiment, the CTP peptide is a variant of chorionic gonadotropin that differs from native CTP by one conservative amino acid substitution. In another embodiment, the CTP peptide is a variant of chorionic gonadotropin that differs from native CTP by two conservative amino acid substitutions. In another embodiment, the CTP peptide is a variant of chorionic gonadotropin that differs from native CTP by three conservative amino acid substitutions. In another embodiment, the CTP peptide is a variant of chorionic gonadotropin that differs from native CTP by four conservative amino acid substitutions. In another embodiment, the CTP peptide is a variant of chorionic gonadotropin that differs from native CTP by five conservative amino acid substitutions.

[0199] In another embodiment, the CTP peptide amino acid sequence of the present invention is at least 70% homologous to the naturally occurring CTP amino acid sequence or peptide thereof. In another embodiment, the CTP peptide amino acid sequence of the present invention is at least 80% homologous to the naturally occurring CTP amino acid sequence or peptide thereof. In another embodiment, the CTP peptide amino acid sequence of the present invention is at least 90% homologous to the naturally occurring CTP amino acid sequence or peptide thereof. In another embodiment, the CTP peptide amino acid sequence of the present invention is at least 95% homologous to the naturally occurring CTP amino acid sequence or peptide thereof. In another embodiment, the CTP peptide amino acid sequence of the present invention is at least 98% homologous to the naturally occurring CTP amino acid sequence or peptide thereof.

[0200] In another embodiment, the polynucleotide encoding the CTP peptide of the present invention is at least 70% homologous to the DNA sequence of native human CTP or a peptide thereof. In another embodiment, the polynucleotide encoding the CTP peptide of the present invention is at least 80% homologous to the DNA sequence of native human CTP or a peptide thereof. In another embodiment, the polynucleotide encoding the CTP peptide of the present invention is at least 90% homologous to the DNA sequence of native human CTP or a peptide thereof. In another embodiment, the polynucleotide encoding the CTP peptide of the present invention is at least 95% homologous to the DNA sequence of native human CTP or a peptide thereof. In another embodiment, the polynucleotide encoding the CTP peptide of the present invention is at least 98% homologous to the DNA sequence of native human CTP or a peptide thereof.

[0201] In one embodiment, at least one of the chorionic gonadotropin CTP amino acid sequences is truncated. In another embodiment, both of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, two of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, three of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, four of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, five of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, two or more of the chorionic gonadotropin CTP amino acid sequences are truncated. In another embodiment, all of the chorionic gonadotropin CTP amino acid sequences are truncated. In one embodiment, the truncated CTP comprises the first 10 amino acids of SEQ ID NO:3. In another embodiment, SEQ ID NO:3 comprises the amino acid (AA) sequence of SSSSKAPPPSLP.

[0202] In one embodiment, the truncated CTP comprises the first 10 amino acids of SEQ ID NO: 2. In another embodiment, SEQ ID NO: 2 comprises the amino acid (AA) sequence SSSSKAPPPSLPSPSRLPGPSDTPILPQ.

[0203] In one embodiment, the truncated CTP comprises the first 11 amino acids of SEQ ID NO:2. In one embodiment, the truncated CTP comprises the first 11 amino acids of SEQ ID NO:2. In one embodiment, the truncated CTP comprises the first 8 amino acids of SEQ ID NO:2 or SEQ ID NO:3. In one embodiment, the truncated CTP comprises the first 13 amino acids of SEQ ID NO:2. In one embodiment, the truncated CTP comprises the first 14 amino acids of SEQ ID NO:2. In one embodiment, the truncated CTP comprises the first 6 amino acids of SEQ ID NO:2 or SEQ ID NO:3. In one embodiment, the truncated CTP comprises the first 5 amino acids of SEQ ID NO:2 or SEQ ID NO:3.

[0204] In one embodiment, at least one of the chorionic gonadotropin CTP amino acid sequences is glycosylated. In another embodiment, both of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, two of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, three of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, four of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, five of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, two or more of the chorionic gonadotropin CTP amino acid sequences are glycosylated. In another embodiment, all of the chorionic gonadotropin CTP amino acid sequences are glycosylated.

[0205] In one embodiment, the CTP sequence of the present invention comprises at least one glycosylation site. In one embodiment, the CTP sequence of the present invention comprises two glycosylation sites. In one embodiment, the CTP sequence of the present invention comprises three glycosylation sites. In one embodiment, the CTP sequence of the present invention comprises four glycosylation sites. In one embodiment, one or more chorionic gonadotropin CTP amino acid sequences are fully glycosylated. In another embodiment, one or more chorionic gonadotropin CTP amino acid sequences are partially glycosylated. In one embodiment, partially glycosylated refers to one of the CTP glycosylation sites being glycosylated. In another embodiment, two of the CTP glycosylation sites are glycosylated. In another embodiment, three of the CTP glycosylation sites are glycosylated.

[0206] In some embodiments, CTP sequence modification is advantageous in that it allows for the use of low doses. In some embodiments, CTP sequence modification is advantageous in that it allows for smaller dosages. In some embodiments, CTP sequence modification is advantageous in that it allows for a safe and long-acting effect.

[0207] In some embodiments, the terms "polypeptide," "engineered coagulation factor," or "protein," as used herein, encompass natural polypeptides (degradation products, artificially synthesized polypeptides, or recombinant polypeptides) and peptidomimetics (typically artificially synthesized polypeptides), as well as peptoids and semipeptoids, which are polypeptide analogs, which in some embodiments have modifications that make the polypeptide, including the coagulation factor, more stable while in the body or more permeable into cells.

[0208] In some embodiments, modifications include, but are not limited to, C-terminal modifications, polypeptide bond modifications, such as, but not limited to, CH2-NH, CH2-S, CH2-S=O, O=C-NH, CH2-O, CH2-CH2, S=C-NH, CH=CH, or CF=CH, backbone modifications, and residue modifications.Methods for preparing peptidomimetic compounds are well known in the art and are described, for example, in Quantitative Drug Design, CA Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein.Further details on this point are provided below.

[0209] In some embodiments, the polypeptide bond (-CO-NH-) in the polypeptide is replaced. In some embodiments, the polypeptide bond is replaced by an N-methylated bond (-N(CH3)-CO-). In some embodiments, the polypeptide bond is replaced by an ester bond (-C(R)HCOOC(R)-N-). In some embodiments, the polypeptide bond is replaced by a ketomethylene bond (-CO-CH2-). In some embodiments, the polypeptide bond is replaced by an α-aza bond (-NH-N(R)-CO-), where R is any alkyl, e.g., methyl, carba bond (-CH2-NH-). In some embodiments, the polypeptide bond is replaced by a hydroxyethylene bond (-CH(OH)-CH2-). In some embodiments, the polypeptide bond is replaced by a thioamide bond (-CS-NH-). In some embodiments, the polypeptide bond is replaced by an olefinic double bond (-CH=CH-). In some embodiments, the polypeptide bond is replaced by a retroamide bond (-NH-CO-). In some embodiments, the polypeptide bonds are replaced by polypeptide derivatives (-N(R)-CH2-CO-), where R is a "normal" side chain naturally occurring on a carbon atom. In some embodiments, these modifications are present at any bond along the polypeptide chain, and in one embodiment, are present at several (2-3 bonds) at the same time.

[0210] In some embodiments, the naturally occurring aromatic amino acids of a polypeptide, such as Trp, Tyr, and Phe, are replaced with synthetic, non-naturally occurring acids, e.g., phenylglycine, TIC, naphthyleanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe, or o-methyl-Tyr. In some embodiments, the polypeptides of the invention comprise one or more modified amino acids or one or more non-amino acid monomers (e.g., fatty acids, complex carbohydrates, etc.).

[0211] In one embodiment, "amino acid" or "amino acid sequence" is understood to include the 20 naturally occurring amino acids, such as hydroxyproline, phosphoserine, and phosphothreonine, many of which are post-translationally modified in vivo, as well as other unusual amino acids, including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, norvaline, norleucine, and ornithine. In one embodiment, "amino acid" includes both D- and L-amino acids.

[0212] In some embodiments, the polypeptides of the present invention are utilized in therapeutic agents that require the polypeptide, including coagulation factors, to be in a soluble form. In some embodiments, the polypeptides of the present invention contain one or more non-natural or natural polar amino acids, including but not limited to serine and threonine, which can increase polypeptide solubility due to their hydroxyl-containing side chains.

[0213] In some embodiments, the engineered coagulation factors of the present invention are utilized in linear form, although one of skill in the art will understand that cyclized forms of the engineered coagulation factors can also be utilized if cyclization does not significantly interfere with the characteristics of the engineered coagulation factor.

[0214] In some embodiments, the engineered coagulation factors of the invention are biochemically synthesized, such as by using standard solid-phase techniques, in some embodiments, these biochemical methods include full solid-phase synthesis, partial solid-phase synthesis, fragment condensation methods, or classical solution synthesis.

[0215] In some embodiments, recombinant protein techniques are used to produce the engineered clotting factors of the invention. In some embodiments, recombinant protein techniques are used to produce relatively long polypeptides (e.g., longer than 18-25 amino acids). In some embodiments, recombinant protein techniques are used to produce large quantities of the engineered clotting factors of the invention. In some embodiments, recombinant techniques are used as described in Bitter et al. (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al. (1984) Nature 310:511-514, Takamatsu et al. (1987) EMBO J. 6:307-311, Coruzzi et al. (1984) EMBO J. 3:1671-1680 and Brogli et al. (1984) Science 224:838-843, Gurley et al. (1986) Mol. Cell. Biol. 6:559-565, and Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463, which are incorporated herein by reference in their entireties.

[0216] In another embodiment, the disclosure provides a polynucleotide molecule comprising a coding portion of a gene encoding a polypeptide comprising a clotting factor and a gonadotropin carboxy-terminal peptide attached to the carboxy-terminus of the clotting factor, as described above. In another embodiment, the disclosure provides a polynucleotide molecule consisting of a coding portion of a gene encoding a polypeptide comprising a clotting factor and a gonadotropin carboxy-terminal peptide attached to the carboxy-terminus of the clotting factor, as described above. In another embodiment, the disclosure provides a polynucleotide molecule consisting essentially of a coding portion of a gene encoding a polypeptide comprising a clotting factor and a gonadotropin carboxy-terminal peptide attached to the carboxy-terminus of the clotting factor, as described above.

[0217] In another embodiment, the disclosure provides a polynucleotide encoding a polypeptide comprising a clotting factor and three gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, as described herein above. In another embodiment, the disclosure provides a polynucleotide encoding a polypeptide consisting of a clotting factor and three gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, as described herein above. In another embodiment, the disclosure provides a polynucleotide encoding a polypeptide consisting essentially of a clotting factor and three gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, as described herein above. In one embodiment, the polynucleotide is a polynucleotide sequence. In one embodiment, the polynucleotide is a polynucleotide molecule.

[0218] In another embodiment, the present disclosure provides an expression vector comprising a polynucleotide molecule described herein. In another embodiment, the present invention provides an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a factor IX (FIX) polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FIX polypeptide. In another embodiment, the present invention provides an expression vector comprising a polynucleotide encoding a CTP-modified polypeptide consisting of a factor VIIa (FVIIa) polypeptide and three to five gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVIIa polypeptide.

[0219] In another embodiment, the disclosure provides a cell comprising an expression vector described herein. In another embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a factor IX (FIX) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FIX polypeptide. In another embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a factor VIIa (FVIIa) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVIIa polypeptide.

[0220] In another embodiment, the present disclosure provides a composition comprising an expression vector as described herein. In another embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a Factor IX (FIX) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FIX polypeptide. In another embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a Factor VIIa (FVIIa) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy-terminal peptides (CTPs) linked to the carboxy-terminus of the FVIIa polypeptide.

[0221] In another embodiment, the disclosure provides a composition comprising a cell as described herein. In another embodiment, the cell is a eukaryotic cell. In another embodiment, the cell is a prokaryotic cell.

[0222] In another embodiment, the present invention provides a method for producing a CTP-modified coagulation factor, the method comprising the step of producing a CTP-modified coagulation factor by linking 1 to 10 chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the coagulation factor. In another embodiment, the present invention provides a method for producing a CTP-modified coagulation factor, the method comprising the step of linking 1 to 10 polynucleotide sequences encoding chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of a polynucleotide sequence encoding the coagulation factor, thereby producing a CTP-modified coagulation factor. In another embodiment, the present invention provides a method for producing a CTP-modified factor IX (FIX) polypeptide, the method comprising the step of linking three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby producing a CTP-modified FIX polypeptide. In another embodiment, the present invention provides a method for producing a CTP-modified Factor VIIa (FVIIa) polypeptide, the method comprising the step of linking three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby producing a CTP-modified FVIIa polypeptide.

[0223] In another embodiment, the engineered clotting factors of the invention are synthesized using a polynucleotide molecule encoding a polypeptide of the invention. In some embodiments, the polynucleotide molecule encoding the engineered clotting factors of the invention is linked to an expression vector comprising a transcriptional control of a cis-regulatory sequence (e.g., a promoter sequence). In some embodiments, the cis-regulatory sequence is suitable for directing constitutive expression of the engineered clotting factors of the invention. In some embodiments, the cis-regulatory sequence is suitable for directing tissue-specific expression of the engineered clotting factors of the invention. In some embodiments, the cis-regulatory sequence is suitable for directing inducible expression of the engineered clotting factors of the invention.

[0224] In some embodiments, tissue-specific promoters suitable for use in the present invention include sequences that are functional in one or more particular cell populations. Examples include, but are not limited to, promoters such as albumin, which is liver-specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid-specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275], specifically promoters of T cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins [Banerji et al., (1983) Cell 33729-740], neuron-specific promoters, such as the neurofilament promoter [Byrne et al., (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreatic-specific promoters [Edlunch et al., (1985) Science 230:912-916] or mammary gland specific promoters such as whey promoters (U.S. Pat. No. 4,873,316 and European Patent Application Publication No. 264,166). Inducible promoters suitable for use in the present invention include, for example, tetracycline inducible promoters (Srour, MA, et al., 2003. Thromb. Haemost. 90:398-405).

[0225] In one embodiment, the phrase "polynucleotide molecule" refers to a single-stranded or double-stranded nucleic acid molecule, which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and / or a composite polynucleotide sequence (e.g., a combination of the above).

[0226] In one embodiment, a "complementary polynucleotide sequence" refers to a sequence resulting from reverse transcription of messenger RNA using reverse transcriptase or any other RNA-dependent DNA polymerase. In one embodiment, this sequence can be subsequently amplified in vivo or in vitro using a DNA polymerase.

[0227] In one embodiment, a "genomic polynucleotide sequence" means a sequence derived (isolated) from a chromosome, and thus corresponds to a contiguous portion of a chromosome.

[0228] In one embodiment, a "composite polynucleotide sequence" refers to a sequence that is at least partially complementary and at least partially genomic. In one embodiment, the composite sequence may include some exon sequences necessary to encode the polypeptide of the invention, and some intervening intron sequences. In one embodiment, the intron sequences may be of any source, including other genes, and typically include conserved splicing signal sequences. In one embodiment, the intron sequences include cis-acting expression control elements.

[0229] In one embodiment, after expression and secretion, the signal peptide is cleaved from the engineered precursor clotting factor resulting in a mature engineered clotting factor lacking the signal peptide.

[0230] In some embodiments, the polynucleotides of the present invention are prepared using PCR techniques or any other method or procedure known to those skilled in the art. In some embodiments, this procedure involves ligation of two different DNA sequences (see, for example, "Current Protocols in Molecular Biology", eds. Ausubel et al., John Wiley & Sons; 1992).

[0231] In one embodiment, a polynucleotide of the invention encoding an engineered coagulation factor is inserted into an expression vector (i.e., a nucleic acid construct) to allow for expression of the recombinant polypeptide. In one embodiment, an expression vector of the invention contains additional sequences that make the vector suitable for replication and integration in prokaryotes. In one embodiment, an expression vector of the invention contains additional sequences that make the vector suitable for replication and integration in eukaryotes. In one embodiment, an expression vector of the invention includes a shuttle vector that makes the vector suitable for replication and integration in both prokaryotes and eukaryotes. In some embodiments, a cloning vector includes transcription and translation initiation sequences (e.g., promoters, enhancers) and transcription and translation terminators (e.g., polyadenylation signals).

[0232] In one embodiment, a variety of prokaryotic or eukaryotic cells are used as host expression systems to express the coagulation factors of the invention. In some embodiments, these include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the protein coding sequence, yeast transformed with recombinant yeast expression vectors containing the polypeptide coding sequence, plant cell lines infected with recombinant viral expression vectors (e.g., Cauliflower Mosaic Virus, CaMV; Tobacco Mosaic Virus, TMV) or transformed with recombinant plasmid expression vectors such as Ti plasmids containing the polypeptide coding sequence.

[0233] In some embodiments, non-bacterial expression systems are used to express the coagulation factors of the invention (e.g., mammalian expression systems such as CHO cells). In one embodiment, the expression vector used to express the polynucleotides of the invention in mammalian cells is the pCI-DHFR vector, which comprises the CMV promoter and the neomycin resistance gene. The construction of the pCI-dhfr vector is described in one embodiment in Example 1.

[0234] In some embodiments, in the bacterial system of the present invention, a number of expression vectors can be advantageously selected depending on the use for the expressed polypeptide. In one embodiment, large quantities of the polypeptide are desired. In one embodiment, a vector is desired that directs high levels of expression of the protein product, perhaps as a fusion with a hydrophobic signal sequence that directs the expression product into the bacterial periplasm or into the medium where the protein product can be easily purified. In one embodiment, certain fusion proteins are engineered with specific cleavage sites to aid in the recovery of the polypeptide. In one embodiment, vectors that are amenable to such engineering include, but are not limited to, the pET series of E. coli expression vectors [Studier et al., Methods in Enzymol. 185:60-89 (1990)].

[0235] In one embodiment, a yeast expression system is used. In one embodiment, a number of vectors containing constitutive or inducible promoters can be used in yeast as disclosed in U.S. Patent Application No. 5,932,447, the entire contents of which are incorporated herein by reference. In another embodiment, a vector is used that facilitates the integration of foreign DNA sequences into yeast chromosomes.

[0236] In one embodiment, the expression vector of the invention may further comprise additional polynucleotide sequences allowing the translation of several proteins from a single mRNA, such as, for example, an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.

[0237] In some embodiments, mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (which are available from Invitrogen), pCI (which is available from Promega), pMbac, pPbac, pBK-RSV and pBK-CMV (which are available from Strategene), pTRES (which is available from Clontech) and derivatives thereof.

[0238] In some embodiments, expression vectors containing regulatory elements from eukaryotic viruses, such as retroviruses, are used in the present invention. SV40 vectors include pSVT7 and pMT2. In some embodiments, vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein-Barr virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of a protein under the direction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters that are effective for expression in eukaryotic cells.

[0239] In some embodiments, recombinant viral vectors are useful for the in vivo expression of the clotting factors of the present invention because they offer advantages such as horizontal infection and target specificity. In one embodiment, horizontal infection is inherent, for example, in the retroviral life cycle, a process in which a single infected cell produces many progeny virions that detach and infect neighboring cells. In one embodiment, the result is that a large area is rapidly infected, most of which were not initially infected with the original viral particle. In one embodiment, a viral vector is generated that cannot be transmitted externally. In one embodiment, this feature can be useful when the desired goal is to introduce a specific gene into only a limited number of target cells.

[0240] In one embodiment, various methods can be used to introduce the expression vectors of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et al. [Biotechniques 4(6):504-512, 1986] and include, for example, stable or transient gene transfer with recombinant viral vectors, lipofection, electroporation and infection. See also U.S. Patent Nos. 5,464,764 and 5,487,992, which relate to positive-negative selection methods, and are incorporated herein by reference.

[0241] In some embodiments, introduction of nucleic acids by viral infection offers several advantages over other methods, such as lipofection and electroporation, because higher gene transfer efficiencies can be obtained due to the infectious nature of viruses.

[0242] It will be appreciated that in one embodiment, the engineered coagulation factors of the present invention may also be expressed from a nucleic acid construct administered to an individual using any suitable mode of administration, as described herein above (i.e., in vivo gene therapy). In one embodiment, the nucleic acid construct is introduced into a suitable cell via a suitable gene delivery vehicle / method (gene transfer, transduction, homologous recombination, etc.), and optionally an expression system, and the modified cells are then expanded in culture and returned to the individual (i.e., ex vivo gene therapy).

[0243] In one embodiment, a plant expression vector is used. In one embodiment, expression of the polypeptide coding sequence is driven by a number of promoters. In some embodiments, viral promoters are used, such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al., Nature 310:511-514 (1984)], or the coat protein promoter for TMV [Takamatsu et al., EMBO J.6:307-311 (1987)]. In another embodiment, a plant promoter is used, such as the small subunit of RUBISCO [Coruzzi et al., EMBO J.3:1671-1680 (1984) and Brogli et al., Science 224:838-843 (1984)] or a heat shock promoter, such as soybean hspl7.5-E or hspl7.3-B [Gurley et al., Mol. Cell. Biol.6:559-565 (1986)]. In one embodiment, the construct is introduced into plant cells using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, and other techniques known to those skilled in the art.See, for example, Weissbach & Weissbach [Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463 (1988)].Other expression systems, such as insect and mammalian host cell systems, known in the art, can also be used according to the present invention.

[0244] It will be understood that, besides containing the necessary elements for the transcription and translation of the inserted coding sequence (encoding a polypeptide), the expression constructs of the present invention can also contain sequences that have been engineered to optimize the stability, production, purification, yield or activity of the expressed polypeptide.

[0245] In some embodiments, the transformed cells are cultured under effective conditions, thereby allowing expression of large amounts of the recombinant engineered coagulation factor. In some embodiments, effective culture conditions include, but are not limited to, effective media, bioreactors, temperature, pH and oxygen conditions that allow protein production. In one embodiment, effective media refers to any medium in which cells are cultured to produce the recombinant polypeptide of the invention. In some embodiments, media typically include aqueous solutions having assimilable carbon, nitrogen and phosphate sources, as well as appropriate salts, minerals, metals and other nutrients, such as vitamins. In some embodiments, the cells of the invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes and petri dishes. In some embodiments, the culture is performed at a temperature, pH and oxygen content appropriate for the recombinant cells. In some embodiments, the determination of culture conditions is within the expertise of one of ordinary skill in the art.

[0246] In some embodiments, depending on the vector and host system used for production, the resulting engineered coagulation factors of the invention remain inside the recombinant cell, are secreted into the fermentation medium, are secreted into the space between two cell membranes, such as the periplasmic space in E. coli, or are retained on the outer surface of a cellular or viral membrane.

[0247] In one embodiment, after a predetermined period of culture, harvesting of the recombinant engineered coagulation factor is performed.

[0248] In one embodiment, the phrase "recovering the recombinantly engineered coagulation factor" as used herein refers to collecting the entire fermentation medium containing the polypeptide and does not necessarily imply additional steps of separation or purification.

[0249] In one embodiment, the engineered coagulation factors of the invention are purified using a variety of standard protein purification techniques, including, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, isoelectric focusing, and differential solubilization.

[0250] In one embodiment, the expressed coding sequence may be engineered to encode an engineered clotting factor of the invention and a fused cleavable moiety to facilitate recovery. In one embodiment, the fusion protein may be designed such that the polypeptide is easily isolated by affinity chromatography (e.g., by immobilization on a column specific for the cleavable moiety). In one embodiment, a cleavage site is engineered between the engineered clotting factor and the cleavable moiety, and the polypeptide may be released from the chromatography column by treatment with an appropriate enzyme or agent that specifically cleaves the fusion protein at this site [see, e.g., Booth et al., Immunol. Lett. 19:65-70 (1988), and Gardella et al., J. Biol. Chem. 265:15854-15859 (1990)].

[0251] In one embodiment, the engineered coagulation factors of the present invention are recovered in "substantially pure" form.

[0252] In one embodiment, the phrase "substantially pure" refers to a purity that allows for efficient use of the protein in the applications described herein.

[0253] In one embodiment, the engineered coagulation factors of the present invention can also be synthesized using in vitro expression systems, hi one embodiment, in vitro synthesis methods are well known in the art and the components of such systems are commercially available.

[0254] In some embodiments, recombinant engineered coagulation factors may be synthesized and purified and their therapeutic efficacy assayed either in vivo or in vitro. In one embodiment, the binding activity of the recombinant engineered coagulation factors of the present invention may be confirmed using a variety of assays known to those of skill in the art.

[0255] In another embodiment, the engineered clotting factors of the invention may be provided individually by themselves, hi one embodiment, the engineered clotting factors of the invention may be provided to an individual as part of a pharmaceutical composition when combined with a pharma- ceutically acceptable carrier.

[0256] In another embodiment, "pharmaceutical composition" refers to a formulation of one or more active ingredients described herein with other chemical components, such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0257] In another embodiment, "active ingredient" refers to a polypeptide sequence of interest capable of explaining a biological effect.

[0258] In another embodiment, any composition of the invention, in any form, comprises at least one CTP sequence that is only bound to the carboxy-terminus of the engineered coagulation factor of interest. In one embodiment, the invention provides a mixed formulation. In one embodiment, a "mixed formulation" specifically defines a "kit of parts" in the sense that the combination partners as defined above can be administered independently or by using different fixed combinations with characteristic amounts of the combination partners, i.e., simultaneously, in parallel, separately or sequentially. In some embodiments, the parts of the kit of parts can then be administered, for example, simultaneously or chronologically alternating, i.e., at different time points and with equal or different time intervals for any part of the kit of parts. In some embodiments, the total amount of the combination partners in a fixed ratio can be administered as a mixed formulation. In one embodiment, the mixed formulation can be modified, and this can be easily done by the skilled person, to address, for example, the needs of a subpopulation of patients to be treated or the needs of a single patient, whose different needs may be due to a particular disease, severity of the disease, age, sex, or weight.

[0259] In another embodiment, the phrases "physiologically acceptable carrier" and "pharmaceutical acceptable carrier" are used interchangeably to refer to a carrier or diluent that does not cause significant irritation to an organism and does not inhibit the biological activity and properties of the administered compound. Adjuvants are included in these terms. In one embodiment, one of the components contained in the pharmaceutical acceptable carrier can be, for example, polyethylene glycol (PEG), a biocompatible polymer that has a wide range of solubility in both organic and aqueous media (Mutter et al. (1979)).

[0260] In another embodiment, "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. In one embodiment, excipients can include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

[0261] Techniques for drug formulation and administration can be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., incorporated herein by reference.

[0262] Various embodiments of dosage ranges are contemplated by the present invention. The dosage of the engineered coagulation factors of the present invention, in one embodiment, ranges from 0.005 to 100 mg / day. In another embodiment, the dosage ranges from 0.005 to 5 mg / day. In another embodiment, the dosage ranges from 0.01 to 50 mg / day. In another embodiment, the dosage ranges from 0.1 to 20 mg / day. In another embodiment, the dosage ranges from 0.1 to 10 mg / day. In another embodiment, the dosage ranges from 0.01 to 5 mg / day. In another embodiment, the dosage ranges from 0.001 to 0.01 mg / day. In another embodiment, the dosage ranges from 0.001 to 0.1 mg / day. In another embodiment, the dosage ranges from 0.1 to 5 mg / day. In another embodiment, the dosage ranges from 0.5 to 50 mg / day. In another embodiment, the dosage ranges from 0.2 to 15 mg / day. In another embodiment, the dosage is in the range of 0.8-65 mg / day. In another embodiment, the dosage is in the range of 1-50 mg / day. In another embodiment, the dosage is in the range of 5-10 mg / day. In another embodiment, the dosage is in the range of 8-15 mg / day. In another embodiment, the dosage is in the range of 10-20 mg / day. In another embodiment, the dosage is in the range of 20-40 mg / day. In another embodiment, the dosage is in the range of 60-120 mg / day. In another embodiment, the dosage is in the range of 12-40 mg / day. In another embodiment, the dosage is in the range of 40-60 mg / day. In another embodiment, the dosage is in the range of 50-100 mg / day. In another embodiment, the dosage is in the range of 1-60 mg / day. In another embodiment, the dosage is in the range of 15-25 mg / day. In another embodiment, the dosage is in the range of 5-10 mg / day. In another embodiment, the dosage is in the range of 55-65 mg / day.

[0263] In another embodiment, the dosage is in the range of 50-500 mg / day. In another embodiment, the dosage is in the range of 50-150 mg / day. In another embodiment, the dosage is in the range of 100-200 mg / day. In another embodiment, the dosage is in the range of 150-250 mg / day. In another embodiment, the dosage is in the range of 200-300 mg / day. In another embodiment, the dosage is in the range of 250-400 mg / day. In another embodiment, the dosage is in the range of 300-500 mg / day. In another embodiment, the dosage is in the range of 350-500 mg / day.

[0264] In one embodiment, the dosage is 20 mg / day. In one embodiment, the dosage is 30 mg / day. In one embodiment, the dosage is 40 mg / day. In one embodiment, the dosage is 50 mg / day. In one embodiment, the dosage is 0.01 mg / day. In another embodiment, the dosage is 0.1 mg / day. In another embodiment, the dosage is 1 mg / day. In another embodiment, the dosage is 0.530 mg / day. In another embodiment, the dosage is 0.05 mg / day. In another embodiment, the dosage is 50 mg / day. In another embodiment, the dosage is 10 mg / day. In another embodiment, the dosage is 20-70 mg / day. In another embodiment, the dosage is 5 mg / day.

[0265] In one embodiment, the dosage of the CTP-modified coagulation factor is 1-5 mg / day. In one embodiment, the dosage of the CTP-modified coagulation factor is 1-3 mg / day. In one embodiment, the dosage of the CTP-modified coagulation factor is 2 mg / day.

[0266] In another embodiment, the dosage ranges from 1 to 90 mg / day. In another embodiment, the dosage is from 1 to 90 mg / 2 days. In another embodiment, the dosage is from 1 to 90 mg / 3 days. In another embodiment, the dosage is from 1 to 90 mg / 4 days. In another embodiment, the dosage is from 1 to 90 mg / 5 days. In another embodiment, the dosage is from 1 to 90 mg / 6 days. In another embodiment, the dosage is from 1 to 90 mg / week. In another embodiment, the dosage is from 1 to 90 mg / 9 days. In another embodiment, the dosage is from 1 to 90 mg / 11 days. In another embodiment, the dosage is from 1 to 90 mg / 14 days.

[0267] In another embodiment, the dosage of the clotting factor is 10-50 mg / day. In another embodiment, the dosage is 10-50 mg / 2 days. In another embodiment, the dosage is 10-50 mg / 3 days. In another embodiment, the dosage is 10-50 mg / 4 days. In another embodiment, the dosage is 10-50 micrograms / 5 days. In another embodiment, the dosage is 10-50 mg / 6 days. In another embodiment, the dosage is 10-50 mg / week. In another embodiment, the dosage is 10-50 mg / 9 days. In another embodiment, the dosage is 10-50 mg / 11 days. In another embodiment, the dosage is 10-50 mg / 14 days.

[0268] In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is formulated in an intranasal dosage form. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is formulated in an injectable dosage form. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.0001 mg to 0.6 mg. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.001 mg to 0.005 mg. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.005 mg to 0.01 mg. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.01 mg to 0.3 mg. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.2 mg to 0.6 mg. In another embodiment, the clotting factor does not contain a CTP at its amino terminus.

[0269] In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 1 to 100 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 10 to 80 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 20 to 60 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 10 to 50 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 40 to 80 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 10 to 30 micrograms. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 30 to 60 micrograms.

[0270] In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 0.2 mg to 2 mg. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 2 mg to 6 mg. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 4 mg to 10 mg. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject in a dose ranging from 5 mg to 15 mg.

[0271] In one embodiment, the CTP-modified coagulation factor is administered to the subject at a dose ranging from 10 μg / kg to 1000 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose ranging from 25 μg / kg to 600 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose ranging from 50 μg / kg to 400 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 25 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 50 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 100 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 200 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 300 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 400 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 500 μg / kg. In another embodiment, the CTP-modified coagulation factor is administered to the subject at a dose of about 600 μg / kg.

[0272] In one embodiment, the dosage of CTP-modified FIX comprises 50% of the amount of recombinant FIX administered to a patient at the recommended dosage of recombinant FIX (e.g., BeneFIX®, Wyeth or Mononine®, CSL Behring) over the same time period. In one embodiment, the dosage of CTP-modified FVIIa comprises 50% of the amount of FVIIa administered to a patient at the recommended dosage of recombinant FVIIa (e.g., NovoSeven®) over the same time period. In one embodiment, the dosage of CTP-modified FVII comprises 50% of the amount of FVII administered to a patient at the recommended dosage of recombinant FVII over the same time period. For example, if NovoSeven® is administered to a patient pre- or post-operatively at a dose of 90 mg / kg every 2 hours (i.e., for an 85 kg patient, 7.65 mg every 2 hours, or 45.9 mg in six doses over 12 hours), the CTP-modified coagulation factor of the present invention may be administered at a dose that is 50% of the patient's 12-hour dose of recombinant FVIIa (i.e., administered in a single dose of 23 mg over 12 hours).

[0273] In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 45% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 10% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 25% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 35% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 75% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. In another embodiment, the dosage of the CTP-modified coagulation factor is such that it comprises 100% of the amount of coagulation factor administered with non-CTP-modified coagulation factors. However, even if this dosage contains the same amount of coagulation factor (e.g., FIX) as a non-CTP-modified coagulation factor, it is still advantageous to the subject in that it can be administered less frequently due to its extended half-life compared to recombinant coagulation factors.

[0274] In another embodiment, the therapeutically effective amount of the complexed coagulation factor is 50-500 IU per kg of body weight administered once daily to once weekly for FIX, or 10 μg / Kg-500 μg / Kg for FVIIa. In another embodiment, the therapeutically effective amount of the complexed coagulation factor is 150-250 IU per kg of body weight administered once daily. In another embodiment, pharmaceutical compositions comprising the complexed coagulation factor are formulated in dosage amounts effective for administration to human patients by various means.

[0275] In one embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 20-30 IU / dL in the subject. In another embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 25-50 IU / dL in the subject. In another embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 50-100 IU / dL in the subject. In another embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 100-200 IU / dL in the subject. In another embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 10-50 IU / dL in the subject. In another embodiment, FIX is administered in an amount effective to provide a circulating factor IX activity of 20-100 IU / dL in the subject.

[0276] In one embodiment, the CTP-modified coagulation factor is administered to the subject on a weekly basis. In another embodiment, the CTP-modified coagulation factor is administered to the subject twice weekly. In another embodiment, the CTP-modified coagulation factor is administered to the subject every other week (once every two weeks). In another embodiment, the CTP-modified coagulation factor is administered to the subject twice monthly. In another embodiment, the CTP-modified coagulation factor is administered to the subject once monthly. In another embodiment, the CTP-modified coagulation factor is administered to the subject on a daily basis. In another embodiment, the CTP-modified coagulation factor is administered to the subject every two days.

[0277] In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 3 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 4 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 5 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 6 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 7-14 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 10-20 days. In another embodiment, the polypeptide comprising a clotting factor and at least one CTP unit is administered to the subject once every 5-15 days. In another embodiment, a polypeptide comprising a coagulation factor and at least one CTP unit is administered to a subject once every 15 to 30 days.

[0278] In another embodiment, a method of the disclosure comprises improving compliance in the use of coagulation factor therapy, the method comprising providing to a subject in need thereof a polypeptide comprising a coagulation factor and at least one chorionic gonadotropin carboxy-terminal peptide (CTP) attached to the carboxy-terminus of the coagulation factor, thereby improving compliance in the use of coagulation factor therapy.

[0279] In another embodiment, the disclosed method includes improving compliance in patients suffering from a chronic disease requiring clotting factor therapy. In another embodiment, the disclosed method can reduce the frequency of administration of clotting factors by modifying the clotting factors with CTPs as described herein above.

[0280] In another embodiment, the invention provides a method for reducing the frequency of administration of a factor IX (FIX) polypeptide, the method comprising the step of attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby reducing the frequency of administration of the FIX polypeptide.In another embodiment, the invention provides a method for reducing the frequency of administration of a factor VIIa (FVIIa) polypeptide, the method comprising the step of attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FVIIa polypeptide, thereby reducing the frequency of administration of the FVIIa polypeptide.

[0281] In another embodiment, the term compliance includes adherence (active patient participation in treatment). In another embodiment, the disclosed method includes improving compliance in patients in need of clotting factor therapy by reducing the frequency of administration of the clotting factor. In another embodiment, the reduced frequency of administration of the clotting factor is achieved due to a CTP modification that renders the CTP-modified clotting factor more stable ... 1 / 2 In another embodiment, a reduction in the frequency of administration of the clotting factor is achieved as a result of an increase in the clearance time or a decrease in the clearance rate of the clotting factor.

[0282] In another embodiment, the invention provides a method of reducing the clearance rate of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FIX polypeptide, thereby reducing the clearance rate of the FIX polypeptide.In another embodiment, the invention provides a method of reducing the clearance rate of a factor VIIa (FVIIa) polypeptide, comprising attaching three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby reducing the clearance rate of the FVIIa polypeptide.

[0283] In another embodiment, a reduction in the frequency of administration of the clotting factor is achieved as a result of an increase in the value of the AUC of the clotting factor.

[0284] In another embodiment, provided herein is a method for reducing the administration frequency of a clotting factor, the method comprising the step of attaching 1-10 CTPs to the carboxy terminus of the clotting factor, thereby reducing the administration frequency of the clotting factor. In another embodiment, provided herein is a method for reducing the administration frequency of a clotting factor, the method comprising the step of attaching 1-5 CTPs to the carboxy terminus of the clotting factor, thereby reducing the administration frequency of the clotting factor. In another embodiment, provided herein is a method for reducing the administration frequency of a clotting factor, the method comprising the step of attaching 3 CTPs to the carboxy terminus of the clotting factor, thereby reducing the administration frequency of the clotting factor. In another embodiment, provided herein is a method for reducing the administration frequency of a clotting factor, the method comprising the step of attaching 3-5 CTPs to the carboxy terminus of the clotting factor, thereby reducing the administration frequency of the clotting factor.

[0285] In another embodiment, provided herein is a method of improving compliance in the use of clotting factor therapy, comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and one to ten chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby improving compliance in the use of clotting factor therapy. In another embodiment, provided herein is a method of improving compliance in the use of clotting factor therapy, comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and one to five chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby improving compliance in the use of clotting factor therapy. In another embodiment, provided herein is a method of improving compliance in the use of clotting factor therapy, comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby improving compliance in the use of clotting factor therapy. In another embodiment, provided herein is a method for improving compliance in the use of coagulation factor therapy, the method comprising providing to a subject in need thereof a polypeptide comprising a coagulation factor and three to five chorionic gonadotropin carboxy terminal peptides attached to the carboxy terminus of the coagulation factor, thereby improving compliance in the use of coagulation factor therapy.

[0286] In another embodiment, provided herein is a method of preventing or treating a blood clotting disorder or abnormality in a subject, the method comprising providing to the subject a polypeptide comprising a clotting factor and one to ten chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby treating the blood clotting disorder or abnormality in the subject. In another embodiment, provided herein is a method of preventing or treating a blood clotting disorder or abnormality in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and one to five chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing or treating the blood clotting disorder or abnormality in the subject. In another embodiment, provided herein is a method of preventing or treating a blood clotting disorder or abnormality in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing or treating the blood clotting disorder or abnormality in the subject. In another embodiment, provided herein is a method of preventing or treating a blood clotting disorder or abnormality in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three to five chorionic gonadotropin carboxy terminal peptides attached to the carboxy terminus of the clotting factor, thereby preventing or treating the blood clotting disorder or abnormality in the subject.

[0287] In another embodiment, provided herein is a method of preventing hemophilia in a subject, the method comprising providing to the subject a polypeptide comprising a clotting factor and one to ten chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing hemophilia in the subject. In another embodiment, provided herein is a method of preventing hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and one to five chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing hemophilia in the subject. In another embodiment, provided herein is a method of preventing hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing hemophilia in the subject. In another embodiment, provided herein is a method of preventing hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three to five chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby preventing hemophilia in the subject.

[0288] In another embodiment, the present invention shows that the compositions provided herein are unexpectedly more effectively absorbed into the bloodstream after SC administration (see Examples 7-9 herein). The ability to administer FVIIa subcutaneously acts as an advantage since it can be used for prophylactic applications. Subcutaneous injection is also much easier for patients to self-inject and is advantageous when the patient is very young and blood vessels are small and difficult to find.

[0289] In another embodiment, provided herein is a method of treating hemophilia in a subject, the method comprising providing to the subject a polypeptide comprising a clotting factor and one to ten chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby treating hemophilia in the subject. In another embodiment, provided herein is a method of treating hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and one to five chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby treating hemophilia in the subject. In another embodiment, provided herein is a method of treating hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three chorionic gonadotropin carboxy-terminal peptides attached to the carboxy-terminus of the clotting factor, thereby treating hemophilia in the subject. In another embodiment, provided herein is a method of treating hemophilia in a subject, the method comprising providing to a subject in need thereof a polypeptide comprising a clotting factor and three to five chorionic gonadotropin carboxy terminal peptides attached to the carboxy terminus of the clotting factor, thereby treating hemophilia in the subject.

[0290] In one embodiment, oral administration includes unit dosage forms including tablets, capsules, lozenges, chewable tablets, suspensions, and emulsions. Such unit dosage forms contain a safe and effective amount of the desired coagulation factor of the present disclosure, each of which, in one embodiment, is from about 0.7 or 3.5 mg to about 280 mg / 70 kg, or in another embodiment, from about 0.5 or 10 mg to about 210 mg / 70 kg. Suitable pharmaceutically acceptable carriers for the preparation of unit dosage forms for oral administration are known in the art. In some embodiments, tablets typically contain conventional pharmaceutically compatible adjuvants such as inert diluents such as calcium carbonate, sodium carbonate, mannitol, lactose, and cellulose; binders such as starch, gelatin, and sucrose; disintegrants such as starch, alginic acid, and croscarmellose; and lubricants such as magnesium stearate, stearic acid, and talc. In one embodiment, glidants such as silicon dioxide can be used to improve the flow properties of the powder mixture. In one embodiment, coloring agents such as FD&C dyes can be added for appearance.Sweeteners and flavoring agents such as aspartame, saccharin, menthol, peppermint, and fruit flavors are useful adjuvants for chewable tablets.Capsules usually contain one or more solid diluents as disclosed above.In some embodiments, the selection of carrier components depends on secondary considerations such as taste, cost, and storage stability that are not important for the purpose of the present invention, and can be easily made by those skilled in the art.

[0291] In one embodiment, the oral dosage form comprises a predetermined release profile. In one embodiment, the oral dosage form of the present invention comprises a sustained release tablet, capsule, lozenge or chewable tablet. In one embodiment, the oral dosage form of the present invention comprises a sustained release tablet, capsule, lozenge or chewable tablet. In one embodiment, the oral dosage form of the present invention comprises an immediate release tablet, capsule, lozenge or chewable tablet. In one embodiment, the oral dosage form is formulated according to the desired release profile of the pharmacologic active ingredient as known to those skilled in the art.

[0292] Oral compositions, in some embodiments, include liquid solutions, emulsions, suspensions, and the like. In some embodiments, suitable pharma- ceutically acceptable carriers for preparation of such compositions are well known in the art. In some embodiments, liquid oral compositions include about 0.001% to about 0.933%, or in other embodiments, about 0.01% to about 10% of the desired compound(s).

[0293] In some embodiments, the compositions for use in the methods of the invention comprise a solution or emulsion, which in some embodiments is an aqueous solution or emulsion containing a safe and effective amount of a compound of the invention, and optionally other compounds intended for local nasal administration. In some embodiments, the compositions contain from about 0.001% to about 10.0% (w / v) of a compound of the invention, more preferably from about 0.001% to about 2.0% of a compound of the invention, which is used for systemic delivery of the compound via nasal administration.

[0294] In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is injected into the muscle (intramuscular injection). In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is injected subcutaneously (subcutaneous injection). In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is injected into the muscle. In another embodiment, the polypeptide comprising the clotting factor and at least one CTP unit is injected into the skin. In another embodiment, the clotting factor described herein is administered by systemic administration. In another embodiment, the clotting factor described herein is administered by intravenous injection. In another embodiment, administration may be parenteral, pulmonary, oral, topical, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, intranasal, intraocular, ocular, epidural, buccal, rectal, transmucosal, intestinal or parenteral delivery, including intramedullary injection, and intrathecal or direct intraventricular administration.

[0295] In another embodiment, the formulation is administered in a local rather than systemic manner, for example, via injection of the formulation directly into a particular area of ​​the patient's body.

[0296] In one embodiment, the route of administration may be enteral, hi another embodiment, the route may be conjunctival, transdermal, intradermal, intraarterial, vaginal, rectal, intratumoral, pericancerum, transmucosal, intramuscular, intravascular, intraventricular, intracranial, intranasal, sublingual, or a combination thereof.

[0297] In another embodiment, the pharmaceutical compositions and pharmaceutical formulations are administered by intravenous, intraarterial or intramuscular injection of liquid preparations. In some embodiments, liquid formulations include solutions, suspensions, dispersions, emulsions, oils, and the like. In one embodiment, the pharmaceutical compositions and pharmaceutical formulations are administered intravenously and are therefore formulated in a form suitable for intravenous administration. In another embodiment, these pharmaceutical compositions and pharmaceutical formulations are administered arterially and are therefore formulated in a form suitable for arterial administration. In another embodiment, these pharmaceutical compositions and pharmaceutical formulations are administered intramuscularly and are therefore formulated in a form suitable for intramuscular administration.

[0298] In addition, in another embodiment, pharmaceutical compositions and pharmaceutical preparations are administered locally to body surface, and therefore are formulated in a form suitable for topical administration.Suitable topical preparations can include gels, ointments, creams, lotions, drops, etc.For topical administration, the compounds of the present invention are combined with additional suitable therapeutic agents, with or without pharmaceutical carriers, and prepared and applied as solutions, suspensions, or emulsions in physiologically acceptable diluents.

[0299] In one embodiment, the pharmaceutical compositions and formulations of the present invention are manufactured by processes known in the art, such as, for example, conventional mixing, dissolving, granulating, dragee-making, pulverizing, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0300] In one embodiment, pharmaceutical compositions and pharmaceutical formulations for use according to the invention are formulated in a conventional manner using one or more physiologically acceptable carriers, including pharma- ceutical acceptable excipients and auxiliaries, which facilitate processing of the active ingredient into a formulation. In one embodiment, the formulation depends on the chosen route of administration.

[0301] In one embodiment, the injection of the present disclosure is formulated as an aqueous solution.In one embodiment, the injection of the present invention is formulated in a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or physiological salt buffer.In some embodiments, for transmucosal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are known in the art.

[0302] In one embodiment, the formulations described herein are formulated for parenteral administration, for example, by bolus injection or continuous infusion.In some embodiments, the formulations for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers, with preservatives added as needed.In some embodiments, the compositions are suspensions, solutions or emulsions in oily or aqueous vehicles, and include formulating agents, for example, suspending agents, stabilizing agents and / or dispersing agents.

[0303] The compositions also include, in some embodiments, preservatives such as benzalkonium chloride and thimerosal, chelating agents such as sodium edetate, buffers such as phosphates, citrates and acetates, tonicity agents such as sodium chloride, potassium chloride, glycerin, mannitol, antioxidants such as ascorbic acid, acetylcystine, sodium metabisulfite, aromatic agents, viscosity modifiers such as polymers such as cellulose and their derivatives, and polyvinyl alcohol, and acids and bases (to adjust the pH of these aqueous compositions as needed).The compositions also include, in some embodiments, local anesthetics or other active ingredients.The compositions can be used as sprays, mists, drops, and the like.

[0304] In some embodiments, pharmaceutical compositions and pharmaceutical preparations for parenteral administration include aqueous solutions of the active preparation in water-soluble form. In addition, suspensions of active ingredients are prepared in some embodiments as oil- or water-based injection suspensions, if necessary. Suitable lipophilic solvents or vehicles include, in some embodiments, fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions include, in some embodiments, substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran. In another embodiment, the suspension also includes suitable stabilizers or agents that increase the solubility of the active ingredients, allowing the preparation of highly concentrated solutions.

[0305] In another embodiment, the active compound may be delivered in a vesicle, in particular in a liposome (Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; JE Diederichs et al., Pharm. / nd. 56 (1994) 267-275).

[0306] In another embodiment, the pharmaceutical composition delivered in a controlled release system is formulated for intravenous infusion, implantable osmotic pump, transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump is used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, a polymeric material can be used. In yet another embodiment, the controlled release system may be placed in proximity to the therapeutic target, i.e., the brain, thereby requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).

[0307] In some embodiments, the active ingredient is in powder form for constitution with a suitable vehicle, e.g., a sterile pyrogen-free water-based solution, before use. The composition is in some embodiments formulated for nebulization and inhalation administration. In another embodiment, the composition is placed in a container equipped with a means for nebulization.

[0308] In one embodiment, the preparations of the present invention are formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

[0309] In some embodiments, pharmaceutical compositions and formulations suitable for use in the context of the present invention include compositions in which the active ingredient is contained in an amount effective to achieve the intended purpose. In some embodiments, a therapeutically effective amount refers to an amount of active ingredient effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated.

[0310] In one embodiment, determination of a therapeutically effective amount is well within the capabilities of those skilled in the art.

[0311] Some examples of substances that can function as pharmaceutically acceptable carrier or its components include: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and methylcellulose; powdered tragacanth; malt, gelatin; solid lubricants such as talc, stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa oil; polyols such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers such as Tween brand emulsifiers; wetting agents such as sodium lauryl sulfate; colorants; flavorings; tableting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline; and phosphate buffer solution.The choice of pharmaceutically acceptable carriers used in combination with compound is essentially determined by the method in which compound is administered. When the compound is injected, in one embodiment, the pharma- ceutically acceptable carrier is sterile saline with a blood-compatible suspending agent, the pH of which has been adjusted to about 7.4.

[0312] Additionally, the compositions may contain binders (e.g., acacia, corn starch, gelatin, carbomer, ethylcellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methylcellulose, povidone), disintegrants (e.g., corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate), buffers of various pH and ionic strength (e.g., Tris hydrochloride, acetate, phosphate), additives such as albumin or gelatin to prevent absorption to surfaces, surfactants (e.g., Tween 20, Tween 80, Pluronic F68, bile salts), protease inhibitors, surfactants (e.g., sodium lauryl sulfate), permeation enhancers, solubilizers (e.g., glycerol, polyethylene glycerol), antioxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxyanisole), stabilizers (e.g., hydroxypropylcellulose, hydroxypropylmethylcellulose), thickeners (e.g., carbomer, colloidal silicon dioxide, ethylcellulose, guar gum), sweeteners (e.g., aspartame, citric acid), preservatives (e.g., thimerosal, benzyl alcohol, parabens), lubricants (e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate), flow aids (e.g., colloidal silicon dioxide), plasticizers (e.g., diethyl phthalate, triethyl citrate), emulsifiers (e.g., carbomer, hydroxypropylcellulose, sodium lauryl sulfate), polymer coatings (e.g., poloxamers or poloxamines), coating and film formers (e.g., ethylcellulose, acrylates, polymethacrylates) and / or adjuvants.

[0313] Typical components of carriers for syrup, elixir, emulsion and suspension can include ethanol, glycerol, propylene glycol, polyethylene glycol, liquid sucrose, sorbitol and water.For suspension, typical suspending agents can include methylcellulose, sodium carboxymethylcellulose, cellulose (e.g., Avicel™, RC-591), tragacanth and sodium alginate, and typical wetting agents can include lecithin and polyethylene oxide sorbitan (e.g., polysorbate 80).Typical preservatives can include methylparaben and sodium benzoate.In another embodiment, oral liquid composition also includes one or more components such as sweetener, flavoring and coloring agent disclosed above.

[0314] These compositions also include incorporation of the active agent in or on particulate formulations of polymeric compounds such as polylactic acid, polyglycolic acid, hydrogels, or on liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions affect the physical state, solubility, stability, in vivo release rate, and in vivo clearance rate.

[0315] Also encompassed by the disclosure are particle compositions coated with polymers (e.g., poloxamers or poloxamines) and compounds conjugated to antibodies against tissue-specific receptors, ligands or antigens, or compounds conjugated to ligands of tissue-specific receptors.

[0316] In some embodiments, the compounds are modified by water-soluble polymers such as covalently attached polyethylene glycol, copolymers of polyethylene glycol and polypropylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, or polyproline. In another embodiment, the modified compounds have a substantially longer half-life in the blood after intravenous injection than the corresponding unmodified compounds. In one embodiment, the modification increases the solubility of the compound in aqueous solution, eliminates aggregation, increases the physical and chemical stability of the compound, and significantly reduces the immunogenicity and reactivity of the compound. In another embodiment, the desired in vivo biological activity is achieved by administering such polymer-compound adducts less frequently or in lower doses than the unmodified compound.

[0317] In some embodiments, the effective amount or dosage formulation can be initially estimated from in vitro assays, In one embodiment, a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.

[0318] In one embodiment, toxicity and therapeutic efficacy of the active ingredients described herein can be determined in vitro, in cell culture, or in experimental animals by standard pharmaceutical procedures. In one embodiment, data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. In one embodiment, dosages vary depending on the dosage form used and the route of administration utilized. In one embodiment, the exact formulation, route of administration, and dosage can be selected by the individual physician in view of the patient's condition [see, for example, Fingl, et al., (1975) "The Pharmacological Basis of Therapeutics", Ch.1 p.1].

[0319] In one embodiment, depending on the severity and responsiveness of the condition to be treated, dosing may be single or multiple administrations, with a course of treatment lasting several days to several weeks, or until a cure is effected or a diminution of the disease state is achieved.

[0320] In one embodiment, the amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

[0321] In one embodiment, compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.

[0322] In another embodiment, the coagulation factors described herein are lyophilized (i.e., freeze-dried) formulations in combination with complex organic excipients and stabilizers, such as non-ionic surface active agents (i.e., surfactants), various sugars, organic polyols, and / or human serum albumin. In another embodiment, the pharmaceutical composition comprises lyophilized coagulation factors in sterile water for injection, as described. In another embodiment, the pharmaceutical composition comprises lyophilized coagulation factors in sterile PBS for injection, as described. In another embodiment, the pharmaceutical composition comprises lyophilized coagulation factors in sterile 0.9% NaCl for injection, as described.

[0323] In another embodiment, the pharmaceutical composition comprises a clotting factor as described herein and a composite carrier, such as human serum albumin, a polyol, a sugar, and an anionic surfactant stabilizing agent. In another embodiment, the pharmaceutical composition comprises a clotting factor as described herein, lactobionic acid, and an acetate / glycine buffer. In another embodiment, the pharmaceutical composition comprises a clotting factor as described herein and an amino acid that increases the solubility of the interferon composition in water, such as arginine or glutamic acid. In another embodiment, the pharmaceutical composition comprises a lyophilized clotting factor as described herein and glycine or human serum albumin (HSA), a buffer (e.g., acetate), and an isotonicity agent (e.g., NaCl). In another embodiment, the pharmaceutical composition comprises a lyophilized clotting factor as described herein and a phosphate buffer, glycine, and HSA.

[0324] In another embodiment, the pharmaceutical compositions comprising the clotting factors described herein are stabilized when in a buffer solution having a pH of about 4-7.2. In another embodiment, the pharmaceutical compositions comprising the clotting factors are placed in a buffer solution having a pH of about 4-8.5. In another embodiment, the pharmaceutical compositions comprising the clotting factors are placed in a buffer solution having a pH of about 6-7. In another embodiment, the pharmaceutical compositions comprising the clotting factors are placed in a buffer solution having a pH of about 6.5. In another embodiment, the pharmaceutical compositions comprising the clotting factors are placed in a buffer solution having a pH of about 6.4. In another embodiment, the pharmaceutical compositions comprising the clotting factors described herein are stabilized with amino acids as stabilizers, and in some cases, with salts (if the amino acid does not contain a charged side chain).

[0325] In another embodiment, the pharmaceutical compositions comprising a coagulation factor described herein are liquid compositions comprising about 0.3% to 5% by weight of an amino acid stabilizer.

[0326] In another embodiment, the pharmaceutical compositions comprising the coagulation factors described herein provide dosing accuracy and product safety. In another embodiment, the pharmaceutical compositions comprising the coagulation factors described herein provide biologically active, stable, liquid formulations for injectable use. In another embodiment, the pharmaceutical compositions comprise the coagulation factors described herein that are not lyophilized.

[0327] In another embodiment, the pharmaceutical compositions comprising the coagulation factors described herein provide liquid formulations that allow for long-term storage in a liquid state, allowing for ease of storage and transportation prior to administration.

[0328] In another embodiment, the pharmaceutical composition comprising the coagulation factor described herein comprises a solid lipid as a matrix material. In another embodiment, the injectable pharmaceutical composition comprising the coagulation factor described herein comprises a solid lipid as a matrix material. In another embodiment, the production of lipid microparticles by spray congealing is described by Speiser (Speiser and al., Pharm. Res. 8 (1991) 47-54), followed by the production of lipid nanopellets for oral administration (European Patent No. 0167825 (1990) by Speiser). In another embodiment, the lipids used (e.g., glycerides of fatty acids present in emulsions for parenteral nutrition) are well tolerated by the body.

[0329] In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a polymeric microparticle. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a nanoparticle. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a liposome. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a liquid emulsion. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a microsphere. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a lipid nanoparticle. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a lipid nanoparticle comprising an amphipathic lipid. In another embodiment, the pharmaceutical composition comprising the clotting factor described herein comprises a lipid nanoparticle comprising a drug, a lipid matrix, and a surfactant. In another embodiment, the lipid matrix has a monoglyceride content of at least 50% w / w.

[0330] In one embodiment, the composition of the present invention is provided in a pack or dispenser device, such as an FDA approved kit, containing one or more unit dosage forms containing the active ingredient. In one embodiment, the pack comprises, for example, a metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is accompanied by a notice attached to the container in a format prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects the approval by the agency of the form of the composition or its administration to humans or animals. Such notice, in one embodiment, is the labeling approved by the U.S. Food and Drug Administration for prescription drugs or an approved product insert.

[0331] It will be appreciated that in one embodiment, the coagulation factors of the present invention are provided to an individual along with an additional active agent to achieve improved therapeutic efficacy compared to treatment with each agent alone, hi another embodiment, measures (e.g., administration and selection of adjunct agents) are taken to avoid adverse side effects associated with combination therapy.

[0332] In another embodiment, the present invention further provides a CTP-modified factor VIIa (FVIIa) polypeptide consisting of a FVIIa polypeptide and five gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of said FVIIa.

[0333] In another embodiment, the present invention provides a pharmaceutical composition comprising a FVIIa polypeptide and a CTP-modified Factor VIIa (FVIIa) polypeptide consisting of five gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide.

[0334] In another embodiment, the present invention provides a polynucleotide encoding a factor VIIa (FVIIa) polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide.

[0335] In another embodiment, the present invention provides an expression vector comprising a polynucleotide encoding a Factor VIIa (FVIIa) polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide.

[0336] In another embodiment, the present invention provides a cell comprising an expression vector comprising a polynucleotide encoding a Factor VIIa (FVIIa) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide.

[0337] In another embodiment, the present invention provides a composition comprising an expression vector comprising a polynucleotide encoding a Factor VIIa (FVIIa) polypeptide and a CTP-modified polypeptide consisting of three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide.

[0338] In another embodiment, the present invention provides a method for extending the biological half-life of a Factor VIIa (FVIIa) polypeptide, the method comprising the step of linking three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby extending the biological half-life of the FVIIa polypeptide.

[0339] In another embodiment, the present invention provides a method for increasing the area under the curve (AUC) of a Factor VIIa (FVIIa) polypeptide, the method comprising the step of attaching three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby increasing the AUC of the FVIIa polypeptide.

[0340] In another embodiment, the present invention provides a method for reducing the frequency of administration of a Factor VIIa (FVIIa) polypeptide, the method comprising the step of attaching three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby reducing the frequency of administration of the FVIIa polypeptide.

[0341] In another embodiment, the present invention provides a method for reducing the clearance rate of a Factor VIIa (FVIIa) polypeptide, the method comprising the step of attaching three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby reducing the clearance rate of the FVIIa polypeptide.

[0342] In another embodiment, the present invention provides a method for producing a CTP-modified Factor VIIa (FVIIa) polypeptide, the method comprising the step of linking three chorionic gonadotropin carboxy terminal peptides (CTPs) to the carboxy terminus of the FVIIa polypeptide, thereby producing a CTP-modified FVIIa polypeptide.

[0343] In another embodiment, the present invention provides a method for treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor VIIa (FVIIa) polypeptide comprising an FVIIa polypeptide and three chorionic gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of the FVIIa polypeptide, thereby treating the hemophilia in the subject.

[0344] In one embodiment, the present invention provides a CTP-modified factor IX (FIX) polypeptide consisting of a FIX polypeptide and three gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of said CTP-modified FIX polypeptide. In another embodiment, the present invention provides a CTP-modified FIX polypeptide having a sequence as set forth in SEQ ID NO: 31. In another embodiment, the present invention provides a CTP-modified FIX polypeptide, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In another embodiment, the present invention provides a CTP-modified FIX polypeptide, wherein at least one CTP is glycosylated. In another embodiment, the present invention provides a CTP-modified FIX polypeptide, wherein at least one CTP is truncated. In another embodiment, the present invention provides a CTP-modified FIX polypeptide, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the present invention provides a CTP-modified FIX polypeptide, wherein the linker is a peptide bond.

[0345] In one embodiment, the invention provides a pharmaceutical composition comprising a CTP-modified FIX polypeptide.

[0346] In one embodiment, the present invention provides a polynucleotide encoding a CTP-modified polypeptide consisting of a factor IX (FIX) polypeptide and three gonadotropin carboxy terminal peptides (CTPs) linked to the carboxy terminus of said FIX polypeptide. In another embodiment, the present invention provides a polynucleotide as set forth in SEQ ID NO: 30. In another embodiment, the present invention provides a polynucleotide in which at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In another embodiment, the present invention provides a polynucleotide in which at least one CTP is glycosylated. In another embodiment, the present invention provides a polynucleotide in which at least one CTP is truncated. In another embodiment, the present invention provides a polynucleotide in which at least one CTP is linked to said FIX polypeptide via a linker. In another embodiment, the present invention provides a polynucleotide in which said linker is a peptide bond. An expression vector comprises the polynucleotide.

[0347] In one embodiment, the invention provides a cell comprising the expression vector.

[0348] In one embodiment, the invention provides a composition comprising an expression vector.

[0349] In one embodiment, the invention provides a method for increasing the biological half-life of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby increasing the biological half-life of the FIX polypeptide. In another embodiment, the invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. In another embodiment, the invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the invention provides a method, wherein at least one CTP is truncated. In another embodiment, the invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the invention provides a method, wherein the linker is a peptide bond.

[0350] In one embodiment, the invention provides a method for increasing the area under the curve (AUC) of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby increasing the AUC of the FIX polypeptide. In another embodiment, the invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. In another embodiment, the invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the invention provides a method, wherein at least one CTP is truncated. In another embodiment, the invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the invention provides a method, wherein the linker is a peptide bond.

[0351] In one embodiment, the invention provides a method for reducing the frequency of administration of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby reducing the frequency of administration of the FIX polypeptide. In another embodiment, the invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. In another embodiment, the invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the invention provides a method, wherein at least one CTP is truncated. In another embodiment, the invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the invention provides a method, wherein the linker is a peptide bond.

[0352] In one embodiment, the invention provides a method of reducing the clearance rate of a factor IX (FIX) polypeptide, comprising attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby reducing the clearance rate of the FIX polypeptide. In another embodiment, the invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. In another embodiment, the invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the invention provides a method, wherein at least one CTP is truncated. In another embodiment, the invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the invention provides a method, wherein at least one CTP is attached to the FVII polypeptide via a linker. In another embodiment, the invention provides a method, wherein the linker is a peptide bond.

[0353] In one embodiment, the present invention provides a method for producing a CTP-modified factor IX (FIX) polypeptide, comprising the step of attaching three chorionic gonadotropin carboxy-terminal peptides (CTPs) to the carboxy-terminus of the FIX polypeptide, thereby producing a CTP-modified FIX polypeptide. In another embodiment, the present invention provides a method, wherein the sequence of the CTP-modified FIX polypeptide is the sequence shown in SEQ ID NO: 31. In another embodiment, the present invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In another embodiment, the present invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the present invention provides a method, wherein at least one CTP is truncated. In another embodiment, the present invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the present invention provides a method, wherein the linker is a peptide bond.

[0354] In one embodiment, the present invention provides a method of treating hemophilia in a subject, the method comprising administering to the subject a CTP-modified factor IX (FIX) polypeptide comprising a FIX polypeptide and three chorionic gonadotropin carboxy-terminal peptides (CTPs) attached to the carboxy-terminus of the FIX polypeptide, thereby treating hemophilia in the subject. In another embodiment, the present invention provides a method, wherein the sequence of the CTP-modified FIX polypeptide is the sequence shown in SEQ ID NO: 31. In another embodiment, the present invention provides a method, wherein at least one CTP is encoded by an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In another embodiment, the present invention provides a method, wherein at least one CTP is glycosylated. In another embodiment, the present invention provides a method, wherein at least one CTP is truncated. In another embodiment, the present invention provides a method, wherein at least one CTP is attached to the FIX polypeptide via a linker. In another embodiment, the present invention provides a method, wherein the linker is a peptide bond.

[0355] Generally, as known in the art, the modified peptides and proteins of the present invention may be conjugated to labels, drugs, targeting agents, carriers, solid supports, etc., depending on the desired application. Labeled forms of the modified biologics may be used to track their metabolic fate, and suitable labels for this purpose include, among others, radioisotope labels, such as iodine-131, technetium-99, indium-111, etc. Labels may also be used to mediate the detection of the modified protein or peptide in an assay system, in which case enzyme labels, fluorescent labels, chromogenic labels, etc., may be used, as well as radioisotopes. The use of such labels is particularly beneficial when the peptide or protein is itself a targeting agent, such as an antibody or receptor ligand.

[0356] Similar linking techniques, as well as others, may be used to attach the modified peptides and proteins of the present disclosure to solid supports. When attached, these modified peptides and proteins may then be used as affinity reagents for the separation of desired components that exhibit specific reactions.

[0357] Finally, the modified peptides and proteins of the present disclosure may be used to generate antibodies that are specifically immunoreactive with these novel compounds. These antibodies are useful for various diagnostic and therapeutic applications, depending on the nature of the biological activity of the unmodified peptide or protein. It should be understood that the present disclosure provides antibodies that are immunoreactive with the CTP-modified FIX, FVII, or FVIIa described herein. In one embodiment, such antibodies may be used to distinguish or identify the administered CTP-modified coagulation factor from endogenous coagulation factors. In another embodiment, the antibodies may be used to identify the location of the administered CTP-modified coagulation factor.

[0358] Additional objects, advantages, and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, experimental support for each of the various embodiments and aspects of the present invention as detailed hereinabove and as claimed in the claims section below is found in the following examples.

[0359] Working Example

[0360] In general, the nomenclature used herein and the laboratory techniques used in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. These techniques are explained in detail in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, RM, ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. York (1998), the methodology presented in: U.S. Patent Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, JE, ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, NY (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan JE, ed. (1994); Stites et al.(eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", WHFreeman and Co., New See, for example, U.S. Pat. Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, MJ, ed. (1984); "Nucleic Acid "Hybridization" Hames,BD,and Higgins SJ,eds.(1985);"Transcription and Translation" Hames,BD,and Higgins SJ,eds.(1984);"Animal Cell Culture" Freshney,RI,ed.(1986);"Immobilized Cells and Enzymes" IRL Press,(1986);"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al.See, "Strategies for Protein Purification and Characterization-A Laboratory Course Manual" CSHL Press (1996), all of which are incorporated by reference. Other general references are provided throughout this specification.

[0361] Example 1 Production and utilization of coagulation factor IX

[0362] Cloning and expression of recombinant FIX molecules:

[0363] The factor IX clone was constructed in our eukaryotic expression vector pCI-neo (Promega, Cat. No. E1841). The Homo sapiens coagulation factor IX ORF clone was ordered from "OriGene" (RC219065). Primers were ordered from Sigma-Genosys.

[0364] Construct 301-1-pCI-neo-p200-11 (Factor IX-ctp x2):

[0365] Primer 101: 5' GTTTAGTGAACCGTCAGAAT 3' (SEQ ID NO: 36) Primer 103 R : 5' TTGAGGAAGATGTTCGTGTA 3' (including the SspI site of factor IX) (SEQ ID NO: 37)

[0366] The PCR reaction was performed using primers 101 and 103. R PCR amplification was performed using plasmid DNA, a cDNA clone of factor IX (OriGene" RC219065), as well as a template. PCR amplification resulted in the formation of a product of approximately 1085 bp (pcr 10) that was gel purified (a fragment containing the amino terminus of the factor IX sequence). Primer 98: 5' ATTACAGTTGTCGCAGGTGA 3' (SEQ ID NO: 38). Primer 99R :5' GCTGGAGCTAGTGAGCTTTGTTTTTTCCTT 3' (sequence number 39). Primer 100: 5' GCTCACTAGCTCCAGCAGCAAGGCC 3' (SEQ ID NO: 40). Primer 27 R :5' TTTTCACTGCATTCTAGTTGTGG 3' (sequence number 41).

[0367] Three PCR reactions were performed. The first reaction used primers 98 and 99 R and using plasmid DNA, a cDNA clone of factor IX (OriGene", RC219065) as a template. As a result of PCR amplification, a product of approximately 540 bp was formed. The second reaction contained primer 100 and primer 27 R The PCR amplification was performed using the plasmid DNA of 402-2-p72-3 (hGH-CTP-CTP) as a template. As a result of PCR amplification, a product of about 258 bp was obtained. The final reaction (PCR 3) was performed using primers 98 and 27 R , as well as a mixture of the products of the previous two reactions as template. PCR amplification resulted in a product of approximately 790 bp that was ligated into the TA cloning vector (Invitrogen, catalog K2000-01). The SspI-EcoRI fragment was isolated (TA 3-3).

[0368] Another PCR reaction (pcr12) was performed using primers 101 and 27 R and a mixture of the product of pcr 10 and the SspI-EcoRI fragment of pcr3 as template. PCR amplification resulted in a product of approximately 1700 bp (Factor IX-ctp-ctp) that was ligated (lig 180) into the TA cloning vector (Invitrogen, catalog K2000-01). An error was found in the Factor IX sequence and the fragment was replaced to form an insert of Factor IX-ctp-ctp with the correct DNA sequence.

[0369] TA-pcr3-3 was digested with SspI and XbaI and the large fragment was isolated (vector). TA180-4 was digested with SspI and XbaI and the small fragment (insert) was isolated and ligated to the isolated large fragment of TA-pcr-3-3 digested with SspI and XbaI. This new plasmid TA-183-2 was digested with SalI and NotI and the Factor IX-CTP-CTP insert was isolated (approximately 1575 bp). This fragment was inserted into the eukaryotic expression vector pCI-neo (digested with SalI and NotI) resulting in the 301-2-p200-11 clone.

[0370] Construction of pCI-dhfr-Factor IX-ctpx2(p223-4): The vector pCI-dhfr(p6-1) was digested with SmaI and NotI. Factor IX-CTP-CTP(p200-11) was digested with ASisIF.I. and NotI. The two fragments were ligated.

[0371] Construction of pCI-dhfrFactor IX-ctpx3(p225-7): The vector pCI-dhfr OXM-CTPx3(p216-4) was digested with XbaI and ApaI. Factor IX-CTP-CTP(223-4) was digested with XbaI and ApaI. The two fragments were ligated.

[0372] Construction of pCI-dhfrFactor9-ctpx3 T148A (p243-2): Plasmid p225-7 contained a threonine at position 148 because the more common form of FIX contains an alanine at this position, and the Thr was replaced with Ala using site-directed mutagenesis methods. Primer 75: ctcccagttcaattacagct (SEQ ID NO: 42). Primer 122r: ggaaaaactgcctcagcacgggtgagc (SEQ ID NO: 43) Primer 123: gtgctgaggcagtttttcctgatgtggactat (SEQ ID NO: 44) Primer 124r: caacacagtgggcagcag (SEQ ID NO: 45).

[0373] Three PCR reactions were performed. The first reaction was performed using primers 75 and 122r and plasmid DNA p225-7 as template. PCR amplification resulted in a product of approximately 692 bp, which was purified from gel. The second PCR reaction was performed using primers 123 and 124r and plasmid DNA p225-7 as template. PCR amplification resulted in a product of approximately 237 bp, which was purified from gel. The third overlap PCR reaction was performed using primers 75 and 124r and a mixture of the products of the previous two reactions as template. PCR amplification resulted in a product of approximately 910 bp. This overlap PCR product was digested with XbaI and NsiI and religated into p225-7 plasmid (digested with XbaI and NsiI) to obtain factor IX-ctpx3 T148A (designated p243-2).

[0374] Construction of FIX-4CTP (p259-4): A 3.5CTP fragment was isolated from oxym-4CTP (p254-3) by the restriction enzymes Apa1 and Xba1. A FIX+0.5CTP fragment was isolated from FIX-3CTP (p243-2) using the restriction enzymes Apa1 and Xba1. The two fragments were ligated.

[0375] Construction of FIX-5CTP (p260-18): A 4.5CTP fragment was isolated from oxym-5CTP (255-1) by the restriction enzymes Apa1 and Xba1. A FIX+0.5CTP fragment was isolated from FIX-3CTP (p243-2) using the enzymes Apa1 and Xba1. The two fragments were ligated.

[0376] Dg44 cells were seeded in 100 mm tissue culture dishes and grown to 50-60% confluency. A total of 2 μg (micrograms) of FIX cDNA was used for transfection of one 100 mm plate using FuGene reagent (Roche) in protein-free medium (Invitrogene CD Dg44). The medium was removed 48 hours after transfection and replaced with protein-free medium (Invitrogene CD Dg44) without nucleosides and in the presence of 800 μg / ml G418 (Neomycin). After 14 days, the transfected cell population was transferred into a T25 tissue culture flask and selection continued for an additional 10-14 days until the cells started to grow as stable clones. Highly expressing clones were selected. Approximately 2 × 10 7 Using cells, 1700cm 2 The cells were inoculated into 300 ml of growth medium supplemented with 5 ng / ml vitamin K3 (menadione sodium bisulfite, Sigma) in roller bottles (Corning, Corning NY). The production medium (harvest) was collected after cell viability had rapidly declined to approximately 70%. The production medium was first clarified and then concentrated approximately 20-fold and dialyzed against PBS using a flow filtration cassette (10 KDa molecular weight cut-off, Millipore Corp.).

[0377] Measurement of FIX antigen levels: Antigen levels of FIX-CTP harvests were measured using the AssayMax HumanFIX ELISA kit (AssayPro-EF1009-1). Calculated protein concentrations are the average of three different dilutions in two independent experiments (Figure 1A, Table 1).

[0378] [Table 1]

[0379] FIX SDS-PAGE-immunoblot: FIX-CTP harvest or purified rhFIX (American Diagnostics), 100 ng protein, were loaded onto a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot using anti-human FIX polyclonal and anti-human γ-carboxylated monoclonal antibodies (American Diagnostics). As previously reported, rhFIX migrated at 55 KDa, whereas FIX fused with two CTPs migrated at 75 KDa. Both variants of FIX-CTP protein were γ-carboxylated, a post-translational modification essential for FIX activity and function (Figure 1B).

[0380] Measurement of FIX chromogenic activity: A comparative evaluation of the in vitro potency of FIX-CTP harvests against rhFIX protein (American Diagnostics) was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221802). In the presence of thrombin, phospholipids, and calcium, excess FXIa activated the sampled FIX to FIXa. FIXa forms an enzyme complex with thrombin, activated FVIII:C (supplied in excess), phospholipids, and calcium to activate factor X present in the assay to FXa. This activity directly correlates with the amount of FIX, which is the limiting factor. The FXa generated is then measured by its specific activity against the FXa chromogenic substrate (pNA). The amount of pNA generated is directly proportional to the FIXa activity. rhFIX and FIX-CTP harvests were serially diluted and their potency was evaluated by comparing the dose-response curves of FIX harvests against reference preparations consisting of rhFIX or human plasma. The mean EC50 for FIX was 21 ng / ml, whereas FIX-(CTP 2 The calculated EC50 for FIX-CTP harvest was 382 ng / ml and the calculated EC50 for FIX-CTP harvest was 1644 ng / ml. 2) An approximately 15-fold decrease in enzyme activity in the harvest was observed (Figure 2).

[0381] FIX Coagulation Activity (aPTT): Activated partial thromboplastin time (aPTT) is a measure of the integrity of the intrinsic and common pathways of the coagulation cascade. aPTT is the time (in seconds) it takes plasma to clot after the addition of intrinsic pathway activators, phospholipids, and calcium. Because tissue factor is included in the protime (PT) reagent and not in the phospholipid, the aPTT reagent is called partial thromboplastin. The activators initiate the system, and then the remaining steps of the intrinsic pathway occur in the presence of phospholipid. The baseline aPTT range varies between experiments, but typically ranges from 27 to 34 seconds.

[0382] The principle of the assay was to quantify the ability of FIX-CTP harvest to restore the clotting activity of FIX-depleted human plasma by the addition of rhFIX. 300 μl of FIX-depleted human plasma was mixed with 100 μl of rhFIX or FIX-CTP harvest and serially diluted. After 60 s of incubation at 37°C, thromboplastin, CaCl 2 , and phospholipids were added to this mixture and the clotting time was measured in seconds (performed at American Medical Laboratories). Potency was assessed by comparing dose-response curves of FIX harvests to reference preparations consisting of rhFIX or human plasma. One unit of FIX activity corresponds to a concentration of FIX equal to the activity of 1 ml of normal human plasma. The aPTT results shown indicate that FIX-(CTP) 2 showed a 5.7-fold reduction in specific coagulation activity compared to rhFIX (Table 2). Furthermore, aPTT results, in addition to the chromogenic activity in vitro assay, showed that FIX-(CTP) 2These results suggest that the harvest had improved enzymatic activity relative to the FIX-CTP harvest (Table 2). Improved activity of the FIX-CTP protein could be obtained after optimizing the expression system (i.e., co-transfection with Furin and optimizing the vitamin K3 medium concentration), which was enhanced after super-transfection with Furin (data not shown).

[0383] [Table 2]

[0384] rhFIX (American Diagnostic) and FIX-CTP harvest were administered as a single intravenous injection to Sprague-Dawley rats (6 rats per substance) at a dose of 75 μg per Kg of body weight (Table 3).

[0385] [Table 3]

[0386] Blood samples were collected from three rats at alternating retro-orbital times at 0.083, 0.5, 1.5, 4, 8, 24, 48, and 72 hours post-dose. Plasma was prepared immediately after sampling and stored at -20°C until analysis. FIX concentrations were quantified by a FIX ELISA specific assay (AssayPro). Pharmacokinetic profiles were calculated for each protein and represent the average of three animals at each time point (Figure 3). Terminal half-lives were calculated using PK Solutions 2.0 software. Table 4 summarizes the FIX concentrations observed at the different sampling time points.

[0387] [Table 4]

[0388] A summary of the PK profile and terminal half-life is summarized in Table 5. FIX-CTP harvest showed improved T 1 / 2β Values ​​are shown (2-fold and 5-fold increase, respectively). For FIX administration, animal serum concentrations collected after 24 hours were below the limit of quantitation (BLQ), so further PK parameters were not calculated.

[0389] [Table 5]

[0390] In this study, we described a novel approach to extend FIX half-life while retaining therapeutic efficacy. Adding a CTP peptide to an active protein can be detrimental in that it interferes with the activity of the protein. Thus, the generation of active recombinant FIX-CTP by adding a CTP sequence to the C-terminus of FIX is unexpected.

[0391] Characterization of immunoaffinity purified FIX-CTP-CTP

[0392] FIX-CTP-CTP purification

[0393] To evaluate a protein of high quality content with increased activity (PK profile mimicking and extrapolating to the clinical setting), FIX-CTP-CTP is FIX modified with two CTP units in tandem at its carboxy terminus. FIX-CTP-CTP was purified using a matrix-bound monoclonal antibody (American Diagnostics Cat. No. 3570MX) against a gamma-carboxyglutamyl (Gla) residue present in the N-terminal region of FIX. The monoclonal antibody was bound to Sepharose CL-4B. The FIX-CTP-CTP harvest at a concentration of 88 μg / ml was dialyzed against 20 mM Tris, 150 mM NaCl, and 10 mM EDTA (pH=7.4). The loading rate was 0.5 ml / min, elution was performed with 20 mM Tris-HCl, 350 mM NaCl, and 50 mM CaCl, and the unbound fraction was recycled five times. Finally, the eluted fraction was dialyzed against PBS, removed and concentrated.

[0394] Measurement of FIX antigen levels: FIX-CTP harvest, FIX-(CTP) 2 Harvest, and FIX-(CTP) 2 Purified protein levels were measured using a Human FIX ELISA kit (Affinity Biologicals, Cat. No. FIX-AG RUO). Calculated protein concentrations (μg / ml) are the average of two independent experiments (Figure 4, Table 6).

[0395] [Table 6]

[0396] Furthermore, FIX-CTP-CTP was quantified by Bradford assay and the calculated concentration was 202 μg / ml, which is similar to that obtained by ELISA of human FIX.

[0397] SDS-PAGE blot: FIX-CTP-CTP harvest, unbound fraction and purified protein were loaded onto a 12% Tris-glycine gel using Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE Coomassie analysis was performed by staining the gel with Coomassie Blue reagent (800 ng protein). Western immunoblot was performed using 100 ng protein, anti-human FIX polyclonal antibody (Ab) and anti-human gamma-carboxylated monoclonal Ab (American Diagnostics catalogue no. 499 and catalogue no. 3570). The immunoaffinity purification method greatly enriched the FIX-CTP-CTP moiety and simultaneously reduced impurities (Figure 5).

[0398] N-Terminal Sequencing: FIX-CTP-CTP purified proteins were separated by 12% Tris-glycine SDS-PAGE and subsequently electroblotted onto PVDF membranes. Bands of interest were excised and placed onto purified Biobrene-treated glass fiber filters. N-Terminal sequence analysis was performed by Edman degradation using a pulsed liquid-phase protein sequencer equipped with a 140C HPLC micro-gradient system. N-Terminal sequencing revealed that FIX-CTP-CTP was a mixture of incomplete and complete propeptide cleavage proteins. Insufficient propeptide cleavage was shown to reduce FIX clotting activity. Co-transfection with Furin could improve the propeptide cleavage process.

[0399] Measurement of FIX chromogenic activity: A comparative evaluation of the in vitro potency of FIX-CTP-CTP purified protein against rhFIX (American Diagnostics) and pools of human normal plasma was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221802). In the presence of thrombin, phospholipids, and calcium, excess FXIa activates FIX to FIXa. FIXa forms an enzyme complex with thrombin (supplied in excess), phospholipids, and calcium activates factor X present in the assay system to FXa. This activity directly correlates with the amount of FIX, which is the limiting factor. The FXa produced was measured by its specific activity against the FXa chromogenic substrate (pNA). The amount of pNA produced was directly proportional to the FIXa activity. Potency was assessed by serial dilutions of rhFIX, human plasma, and FIX-CTP-CTP and comparison with dose-response curves (Figure 6). Mean EC of rhFIX 50 The calculated EC 50 was 505 ng / ml. An approximately 7-fold decrease in the enzymatic activity of FIX-CTP-CTP was observed for recombinant FIX and 16.5-fold decrease for pooled normal human plasma. This decreased activity could be explained by inappropriate cleavage of the N-terminal propeptide, as identified by N-terminal analysis.

[0400] FIX clotting activity (aPTT): Activated partial thromboplastin time (aPTT) is a measure of the integrity of the intrinsic and common pathways of the coagulation cascade. aPTT is the time (measured in seconds) it takes plasma to clot following the addition of intrinsic pathway activators, phospholipids, and calcium.

[0401] This assay quantified the ability of FIX-CTP-CTP protein to restore clotting activity of FIX-depleted human plasma by the addition of rhFIX. 300 μl of FIX-deficient human plasma was mixed with 100 μl of rhFIX, FIX-CTP-CTP (CTP is in tandem at the C-terminus), or normal pooled human plasma, which was further diluted. After 60 seconds of incubation at 37°C, tissue factor (TF), CaCl 2 , and phospholipids were added to the mixture. Clotting time in seconds was measured. Potency was assessed by comparing dose-response curves of FIX-CTP-CTP to reference preparations of rhFIX or human plasma. One unit of FIX was defined as the amount of FIX equivalent to the activity of 1 ml of normal human plasma.

[0402] The aPTT results showed that FIX-CTP-CTP clotting activity was only 1.4 times lower than that of normal pooled human plasma and similar to rhFIX. Together with the in vitro assay of chromogenic activity, the aPTT results suggest that FIX-CTP-CTP purification did not compromise its activity.

[0403] Pharmacokinetic activity of FIX-CTP-CTP: Purified FIX-CTP-CTP, rhFIX (American Diagnostic) and Harvest (containing FIX-CTP-CTP and FIX-CTP) were administered as a single intravenous injection at a dose of 100 μg / kg body weight to Sprague-Dawley rats (8 rats per substance) (Table 7).

[0404] [Table 7]

[0405] Blood samples were taken from alternating retro-orbital sites from four rats at 0.083, 0.5, 2, 4, 7, 10, 24, 48, and 72 hours post-dose. Citrated plasma (0.32%) was prepared immediately after sampling and stored at -20°C until analysis. FIX concentrations were quantified using a human FIX ELISA kit (Affinity Biologicals). Pharmacokinetic profiles were calculated for each protein as the average of four animals at each time point (Figure 7). Terminal half-lives were calculated using PK Solutions 2.0 software. Table 8 summarizes the observed FIX concentrations for the different sampling time points.

[0406] [Table 8]

[0407] A summary of PK parameters is shown in Table 9.

[0408] [Table 9]

[0409] FIX-CTP-CTP harvest showed an improved PK profile compared to FIX-CTP harvest. Furthermore, purified FIX-CTP-CTP showed improved PK profile compared to FIX-CTP harvest. 1 / 2β A 3-fold increase in values ​​and a 4.5-fold increase in AUC were observed compared to rhFIX.

[0410] The reduced amount of secreted FIX from the fusion of tandem CTP molecules compared to the single CTP fusion is likely due to the addition of extra CTP and not due to reduced detection by ELISA, since the calculated concentrations of Bradford-purified FIX-CTP-CTP were similar to the ELISA-calculated concentrations.

[0411] FIX-CTP-CTP clotting activity was similar to pooled human plasma. However, its in vitro chromogenic activity was considerably lower when compared to rhFIX or pooled human plasma. The chromogenic activity assay was reported as a very sensitive assay compared to the clotting assay. The reason for the decreased activity of FIX-CTP-CTP may vary. The addition of CTP may decrease the affinity of FIX for FXIa or may reduce post-transcriptional modifications (e.g., 12-10 GLA residues and propeptide cleavage). N-terminal analysis revealed that the proteolytic cleavage of FIX-CTP-CTP propeptide was not fully completed before secretion. Since this post-transcriptional modification is important for the normal enzymatic activity of the protein, co-transfection with Furin-PACE plasmid is favorable and may improve FIX-CTP-CTP activity.

[0412] Finally, a comparative PK study of FIX-CTP-CTP in rats demonstrated that fusion of two tandem CTPs to the C-terminus of FIX yielded FIX with an extended half-life.

[0413] FIX-deficient mouse model: To assess in vivo activity, FIX knockout mice are obtained and breeding colonies are established. Commercially available recombinant hFIX (BeneFIX®) or rFIX-(CTP) 2 Ten micrograms of either (FIX-CTP-CTP) was injected into the tail vein of anesthetized FIX knockout mice (22-28 g). The amount of protein injected was equal to the concentration of FIX required in normal plasma (5 μg / ml). Blood samples were collected at specific time points from the clipped tail into heparinized capillary tubes. Plasma samples were assessed for FIX levels by ELISA and potency was measured by aPTT clotting assay.

[0414] Increased efficiency of FIX propeptide cleavage: A CTP peptide cDNA was fused to the 3' end of human FIX cDNA. The corresponding rFIX and Furin expression constructs were co-transfected into Dg44 cells, and human rFIX cDNA was also co-transfected with a Furin plasmid as a control. Secretion of high levels of FIX results in the secretion of a mixture of profactors and mature FIX factors due to the limited amount of Furin protease in the cells. Co-transfection of Furin and profactor expression vectors results in increased recovery and secretion of fully processed FIX into the medium.

[0415] FIX-(CTP) 2 After co-transfection of FIX and Furin, stable clones are generated and harvests are collected for propeptide cleavage evaluation. 100 ng of protein was loaded onto a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis is performed by Western immunoblot using anti-human FIX polyclonal antibody (American Diagnostics) and anti-propeptide polyclonal antibody. As previously reported, rhFIX migrated at 55 kDa, whereas FIX fused to two CTPs migrated at 75 kDa. Both variants of FIX protein are shown to undergo proper full-length propeptide cleavage.

[0416] Proper propeptide cleavage results in FIX-(CTP) 2 To determine whether FIX-(CTP) cotransfected with furin improves enzyme activity, 2 A comparative evaluation of the colorimetric and clotting activities of the harvested samples was performed. Similar to rhFIX, FIX-(CTP) 2 A large increase in specific activity is observed.

[0417] In conclusion, the results described herein suggest that FIX-CTP-CTP can be effectively used to treat patients with hemophilia B. FIX fused to CTP constructs benefit from improved in vivo pharmacological performance, overcoming shortcomings in certain in vitro indications. This proposed treatment is advantageous over previous treatments, as it reduces the infusion rate and required dosage.

[0418] It is important to note that when albumin fusion molecule strategies are used to improve FIX half-life, recombinant FIX becomes inactive. The novel approach of the present invention leads to the design and purification of novel recombinant FIX fusion proteins that exhibit improved long-acting activity. The finding that CTP fused to FIX improves pharmacokinetic parameters was unexpected, since minor modifications did not improve the pharmacokinetics of injected FIX. The presence of highly glycosylated peptide-sialic acid residues stabilized the protein and protected it from interaction with vascular receptors without inhibiting key determinants of FIX function.

[0419] FIX-CTP has similar therapeutic efficacy to rFIX and requires less frequent dosing in patients with hemophilia B. A single injection of FIX-CTP is sufficient to control bleeding episodes and reduce the number of injections required during surgical interventions in patients with hemophilia B.

[0420] CTP technology was utilized for the development of long-acting FIX. In particular, the half-life of recombinant rFIX molecules was extended by fusing at least one human CTP to FIX. Recombinant FIX-CTP was expressed in mammalian cells and characterized in vitro and in vivo. The in vitro activity of rFIX-CTP was shown to be comparable to rFIX. Pharmacokinetic and efficacy studies in rats demonstrated the improved properties of rFIX-CTP. The results of this study indicate that it is feasible to develop rFIX molecules with similar hemostatic properties and extended half-life to the wild-type enzyme.

[0421] Example 2 Purification FIX-CTP 3 ,FIX-CTP 4 and FIX-CTP 5 Comparative evaluation of

[0422] 2.1 Purpose of the study

[0423] FIX-CTP after partial purification process 4 and FIX-CTP 5 ,FIX-CTP 3 Comparative evaluation of pharmacokinetic parameters for

[0424] 2.2 FIX-CTP 4 and FIX-CTP 5 Generating a Harvest

[0425] FIX cDNA (OriGene RC219065) fused at its C-terminus to 4-5 tandem CTP sequences was expressed in Dg44 cells using the Excelgene expression system in the presence of 10 ng / L vitamin K3 (Sigma, Mennadion). Harvested samples were collected (300 ml), filtered, and frozen.

[0426] 2.3 FIX-CTP 3 Generating a Harvest

[0427] FIX-CTP 3 was expressed in-house in CHO cells using the pCI-DHFR vector, clone 196, BR-9, in the presence of 25 ng / L Vitamin K3 (Sigma). Harvested samples were collected and filtered. All FIX-CTP samples (3, 4 and 5 CTPs) were purified on a Jacalin column only due to lack of material.

[0428] 2.4 Measurement of FIX antigen levels

[0429] FIX antigen levels were measured using a human FIX ELISA kit (Affinity Biologicals, Cat. No. FIX-AG RUO). Calculated protein concentrations are the average of four independent experiments. FIX-CTP 3 The concentrations of were slightly higher compared to the two additional cases (Table 10).

[0430] [Table 10]

[0431] 2.5 FIX-CTP Coomassie staining and immunoblotting

[0432] FIX-CTP 3 , FIX-CTP 4 , and FIX-CTP 5 Harvested samples were loaded onto 12% Tris-glycine gels using Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE analysis was performed by Western immunoblot using anti-CTP polyclonal antibody (Adar Biotech Production) or anti-Gla antibody (American Diagnostica).

[0433] As previously reported, FIX fused to three CTPs migrated at 80 kDa, whereas FIX fused to four or five CTPs migrated at 85 or 90 kDa, respectively. As expected, the FIX-CTP from Excelgene 4 and FIX-CTP 5 Harvest is a FIX-CTP generated by Prolor 3 The results showed a very low level of γ-carboxylation compared to the harvest (FIG. 8).

[0434] After the purification process using Jacalin columns (immunoaffinity purification of glycosylated proteins), FIX-CTP 3 , FIX-CTP 4 , and FIX-CTP5 was loaded onto a 12% Tris-glycine gel with Precision Plus Dual Color Protein Marker (Bio-Rad). SDS-PAGE was stained with Coomassie Blue dye for sample detection. All mutants showed fairly clean band profiles (Figure 9), suggesting improved purity.

[0435] 2.6 Measurement of FIX chromogenic activity

[0436] Fully purified (HA column) FIX-CTP 3 , FIX-CTP 4 and FIX-CTP 5 A comparative evaluation of the in vitro potency of FIX-CTP against pooled human normal plasma was performed using a commercially available chromogenic activity test kit, BIOPHEN (Hyphen BioMed 221802). All samples were serially diluted and their potency was assessed by comparing dose-response curves against a reference preparation of normal human plasma. FIX-CTP vs. Plasma 4 and FIX-CTP 5 The reduced chromogenic activity of FIX-CTP (Figure 10) could be the result of inappropriate post-transcriptional modifications of the FIX protein, such as, for example, inappropriate γ-carboxylation and propeptide cleavage, or due to the addition of a CTP cassette. 4 and FIX-CTP 5 The variation in activity (Table 11) may be caused by inadequate quantitation ability of the FIX ELISA due to CTP masking of antigenic sites.

[0437] [Table 11]

[0438] 2.7 Pharmacokinetic Studies

[0439] Jacalin purification FIX-CTP 3 , FIX-CTP 4 , and FIX-CTP 5(Groups A, B and C, respectively) ...

Claims

1. 1. A method for producing a device filled with a pharmaceutical formulation, comprising the steps of: mixing coagulation factor VII having three chorionic gonadotropin carboxy terminal peptides (CTPs) attached to its carboxy terminus with a buffer and a tonicity agent to form a formulation at a pH of 6.4-6.5, wherein the CTP-modified coagulation factor VII does not contain a signal peptide, the buffer is 20 mM citrate and 13.3 mM glycine, and the tonicity agent is 150 mM sodium chloride; and after mixing, pre-filling the formulation into a syringe or an injectable pen device.

2. 2. The method of claim 1 , The method, wherein the pharmaceutical preparation is for preventing or treating a blood clotting disorder.

3. 3. The method of claim 2, The method, wherein the blood clotting disorder is hemophilia, acquired hemophilia, FVII deficiency, congenital FVII deficiency, acquired hemophilia A, hemophilia A, hemophilia B, hemophilia A with inhibitors, hemophilia B with inhibitors, hemophilia A without inhibitors, or hemophilia B without inhibitors.

4. The method according to any one of claims 1 to 3, The method, wherein the CTP-modified coagulation factor VII is expressed from CHO cells.

5. The method according to any one of claims 1 to 4, The method, wherein the pharmaceutical formulation is a liquid formulation.

6. The method according to any one of claims 1 to 5, The method, wherein at least one of said CTPs is truncated.

7. The method according to any one of claims 1 to 6, The method, wherein the sequence of at least one of the CTPs consists of an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:

2.

8. The method according to any one of claims 1 to 7, The method, wherein at least one of said CTPs is glycosylated.

9. The method according to any one of claims 1 to 8, A method, wherein at least one of said CTPs is linked to said coagulation factor via a linker, said linker being a peptide bond.

10. The method according to any one of claims 1 to 9, The method, wherein the sequence of the CTP modified polypeptide is set forth in SEQ ID NO:

46.

11. The method according to any one of claims 1 to 10, The method, wherein the concentration of the CTP-modified coagulation factor VII is 1 mg / ml or 2.6 mg / ml.

12. The method according to any one of claims 1 to 11, The method, wherein the FVII coagulation factor comprises activated coagulation factor VII (FVIIa).

13. 13. The method of claim 12, the activated coagulation factor VII comprises a light chain and a heavy chain linked by a disulfide bond; the amino acid sequence of the heavy chain comprises the sequence of residues 153-490 of SEQ ID NO:46, and the amino acid sequence of the light chain comprises the sequence of residues 1-152 of SEQ ID NO:46; The method, wherein the disulfide bond occurs between cysteine ​​residue 135 and cysteine ​​residue 262 of SEQ ID NO:

46.

14. A device loaded with a pharmaceutical formulation, comprising: the device is a syringe or an injectable pen device; The pharmaceutical formulation comprises a buffer, an isotonicity agent, and a chorionic gonadotropin carboxy terminal peptide (CTP)-modified coagulation factor VII having three CTPs attached to its carboxy terminus; The CTP-modified coagulation factor VII does not contain a signal peptide, The buffer is 20 mM citrate and 13.3 mM glycine; The tonicity agent is 150 mM sodium chloride; The formulation has a pH of 6.4 to 6.

5.

15. 15. The device of claim 14, The device, wherein the pharmaceutical preparation is for preventing or treating a blood clotting disorder.

16. 16. The device of claim 15, The blood clotting disorder is hemophilia, acquired hemophilia, FVII deficiency, congenital FVII deficiency, acquired hemophilia A, hemophilia A, hemophilia B, hemophilia A with inhibitors, hemophilia B with inhibitors, hemophilia A without inhibitors, or hemophilia B without inhibitors.

17. A device according to any one of claims 14 to 16, The CTP-modified coagulation factor VII is expressed from CHO cells.

18. A device according to any one of claims 14 to 17, The device, wherein the pharmaceutical formulation is a liquid formulation.

19. A device according to any one of claims 14 to 18, A device, wherein at least one of the CTPs is shortened.

20. A device according to any one of claims 14 to 19, A device, wherein the sequence of at least one of the CTPs consists of an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:

2.

21. A device according to any one of claims 14 to 20, A device, wherein at least one of said CTPs is glycosylated.

22. A device according to any one of claims 14 to 21, A device, wherein at least one of the CTPs is linked to the coagulation factor via a linker, the linker being a peptide bond.

23. A device according to any one of claims 14 to 22, A device, wherein the sequence of the CTP-modified polypeptide is set forth in SEQ ID NO:

46.

24. A device according to any one of claims 14 to 23, A device, wherein the concentration of the CTP-modified coagulation factor VII is 1 mg / ml or 2.6 mg / ml.

25. A device according to any one of claims 14 to 24, The device, wherein the FVII clotting factor comprises activated clotting factor VII (FVIIa).

26. 26. The device of claim 25, the activated coagulation factor VII comprises a light chain and a heavy chain linked by a disulfide bond; the amino acid sequence of the heavy chain comprises the sequence of residues 153-490 of SEQ ID NO:46, and the amino acid sequence of the light chain comprises the sequence of residues 1-152 of SEQ ID NO:46; The disulfide bond occurs between cysteine ​​residue 135 and cysteine ​​residue 262 of SEQ ID NO:

46.

27. A device according to any one of claims 14 to 26, The pharmaceutical formulation is administered to a subject.

28. 28. The device of claim 27, The device, wherein the subject is a human adult or a human child.

29. 29. A device according to claim 27 or 28, The subject has a blood clotting disorder, a blood clotting abnormality, hemophilia, hemophilia A, hemophilia B, hemophilia A with inhibitors, hemophilia B with inhibitors.

30. A device according to any one of claims 27 to 29, The device, wherein said administration is via a subcutaneous or intravenous route.

31. A device according to any one of claims 27 to 30, comprising: The device, wherein the CTP modified polypeptide is administered daily, every other day, every third day, once a week, twice a week, or once every two weeks, or any combination thereof.

32. A device according to any one of claims 27 to 31, The administration of the CTP-modified polypeptide is at a dose ranging from 50 μg / kg to 400 μg / kg.

Images