5-(4-aminopyrrolo[2,1-F][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran derivatives as antiviral agents

Abstract

To provide a method for making an antiviral agent useful for the treatment of Pneumoviridae viral infection.SOLUTION: A method for making a compound of formula I-11 (R: hydroxyl protecting group) comprises reaction of the compound in the presence of NdCl3 and tetrabutylammonium chloride, as shown in the following formula, when R in the above formula is a benzyl group.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 977,969, filed February 18, 2020, which is incorporated by reference in its entirety. (0001.1) (Sequence Listing) This application contains a Sequence Listing that has been submitted electronically in ASCII format, and is incorporated herein by reference in its entirety. The ASCII copy, created on February 17, 2021, is named 1307-WO-PCT_SL.txt and is 1,537 bytes in size. [Background technology]

[0002] Pneumoviridae viruses are negative-sense single-stranded RNA viruses that are responsible for many common human and animal diseases. Viruses in the Pneumoviridae family include human respiratory syncytial virus (HRSV) and human metapneumovirus. Almost all children will have HRSV infection by their second birthday. HRSV is the leading cause of lower respiratory tract infections in infancy and childhood, with 0.5%-2% of infected individuals requiring hospitalization.

[0003] There is no currently available vaccine to prevent HRSV infection. The monoclonal antibody palivizumab is available for immunoprophylaxis, but its use is restricted to high-risk infants, such as those born prematurely or those with either congenital heart or lung disease, and the cost for general use is often prohibitively high. Furthermore, the nucleoside analog ribavirin is the only antiviral agent approved to treat HRSV infection, but has limited efficacy. Thus, there is a need for anti-Pneumoviridae therapeutics.

[0004] Elderly people and adults with chronic heart, lung disease, or who are immunosuppressed are also at increased risk of developing severe HRSV disease (http: / / www.cdc.gov / rsv / index.html). In particular, patients with chronic respiratory diseases such as chronic obstructive pulmonary disorder (COPD) are more likely to develop acute respiratory exacerbations. The risk is high. Acute respiratory exacerbations are a major cause of morbidity, mortality, and reduced quality of life in COPD patients (Frickmann, Eur. J. Microbiol. Immun. 2012 Sep. 2(3):176-185).

[0005] Approximately one-half to two-thirds of respiratory exacerbations in COPD patients are due to viral infections. Some common viral pathogens involved in such respiratory exacerbations include, but are not limited to, HRSV, human metapneumovirus (HMPV), and human rhinovirus (HRV). COPD patients with infectious exacerbations generally experience longer hospital stays and suffer more severe pulmonary dysfunction than patients with non-infectious exacerbations (Frickmann, Eur. J. Microbiol. Immun. 2012 Sep. 2(3):176-185). There remains a need for new antiviral agents useful in the treatment of Pneumoviridae virus infections, such as HRSV infections, that are effective and have an acceptable toxicity profile. WO 2015 / 069939, published on May 14, 2015, WO 2015 / 069939 discloses compounds useful for the treatment of infection with the movirinae virus. WO 2015 / 069939 relates, inter alia, to a compound of the following formula, or a pharma- ceutically acceptable salt thereof: [ka] During the ceremony, R 1 is H or F, R 2 is H or F, R 3 is OH or F, R 4 But, CN, C 1 ~C 4 Alkyl, C 2 ~C 4 Alkenyl, C 2 ~C 4 Alkynyl, C 3 ~C 4 Cycloalkyl, azido, halogen, or C 1 ~C 2 is haloalkyl, R 6 is OH, R 5 But H, as well as [ka] is selected from the group During the ceremony, n' is selected from 1, 2, 3, and 4; R 8 But, C 1 ~C 8 Alkyl, -OC 1 ~C 8 Alkyl, benzyl, -O-benzyl, -CH 2 -C 3 ~C 6 Cycloalkyl, -O-CH 2 -C 3 ~C 6 Cycloalkyl, and CF 3 is selected from R 9 However, phenyl, 1-naphthyl, 2-naphthyl, [ka] is selected from R 10 But H and CH 3 is selected from R 11 But H or C 1 ~C 6 alkyl, R12 But, H, C 1 ~C 8 Alkyl, benzyl, C 3 ~C 6 Cycloalkyl, and -CH 2 -C 3 ~C 6 cycloalkyl. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2015 / 069939 [Non-patent literature]

[0007] [Non-Patent Document 1] Frickmann,Eur.J.Microbiol.Immun.2012 Sep.2(3):176-185 Summary of the Invention [Means for solving the problem]

[0008] In one embodiment, the present disclosure provides a compound of formula I: [ka] or a pharma- ceutically acceptable salt thereof.

[0009] In another embodiment, the present disclosure provides a pharmaceutical formulation comprising a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier or excipient.

[0010] In another embodiment, the disclosure provides a method of treating or preventing a Pneumoviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharmaceutically acceptable salt thereof.

[0011] In another embodiment, the disclosure provides a method of treating or preventing a Picornaviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharmaceutically acceptable salt thereof.

[0012] In another embodiment, the disclosure provides a method of treating or preventing a Flaviviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharmaceutically acceptable salt thereof.

[0013] In another embodiment, the disclosure provides a method of treating or preventing a Filoviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof.

[0014] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing a Pneumoviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutical acceptable salt thereof, is used.

[0015] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing a Picornaviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutical acceptable salt thereof, is used.

[0016] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing a Flaviviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used.

[0017] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing a Filoviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutical acceptable salt thereof, is used.

[0018] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a Pneumoviridae virus infection in a human.

[0019] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a Picornaviridae virus infection in a human.

[0020] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a Flaviviridae virus infection in a human.

[0021] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a Filoviridae virus infection in a human.

[0022] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a Pneumoviridae virus infection in a human in need thereof.

[0023] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a Picornaviridae virus infection in a human in need thereof.

[0024] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a Flaviviridae virus infection in a human in need thereof.

[0025] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a Filoviridae virus infection in a human in need thereof.

[0026] In another embodiment, the disclosure provides a method for treating or preventing an exacerbation of a respiratory condition due to a viral infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, wherein the respiratory condition is chronic obstructive pulmonary disease.

[0027] In another embodiment, the disclosure provides a method for treating or preventing an exacerbation of a respiratory condition due to a viral infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, wherein the respiratory condition is asthma.

[0028] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing an exacerbation of a respiratory condition due to a viral infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used, wherein the respiratory condition is chronic obstructive pulmonary disease.

[0029] In another embodiment, the disclosure provides a method for the manufacture of a medicament for treating or preventing an exacerbation of a respiratory condition due to a viral infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used, wherein the respiratory condition is asthma.

[0030] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a worsening respiratory condition due to a viral infection in a human, wherein the respiratory condition is chronic obstructive pulmonary disease.

[0031] In another embodiment, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of an exacerbation of a respiratory condition due to a viral infection in a human, wherein the respiratory condition is asthma.

[0032] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, wherein the respiratory condition is chronic obstructive pulmonary disease.

[0033] In another embodiment, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing an exacerbation of a respiratory condition due to a viral infection in a human in need thereof, wherein the respiratory condition is asthma.

[0034] In another embodiment, the present disclosure provides a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, for use in medical therapy.

[0035] In another embodiment, the disclosure provides a method of making a compound of formula I-11: [ka] This method is (i) Compound of formula I-7: [ka] and (ii) Compound of formula I-12: [ka] NdCl 3and tetrabutylammonium chloride, where R is a hydroxyl protecting group. In some embodiments, R is a benzyl group. In some embodiments, R is a silyl protecting group. In some embodiments, R is a tert-butyldimethylsilyl (TBS) group. be.

[0036] In another embodiment, the disclosure provides a method of making a compound of formula I-6: [ka] This method is (i) Compound of formula I-7: [ka] and (ii) Compound of formula I-5: [ka] NdCl 3 and tetrabutylammonium chloride, where R is a hydroxyl protecting group. In some embodiments, R is benzyl In some embodiments, R is a silyl protecting group. In some embodiments, R is a tert-butyldimethylsilyl (TBS) group. [Brief description of the drawings]

[0037] [Figure 1] 1 shows measurements of in vitro intracellular triphosphate formation of NHBE in three donors containing compounds of formula I and 6.

[0038] [Diagram 2] 1 shows the measurement of intracellular triphosphate formation in vitro in PBMCs containing a compound of formula I and compounds 2 and 6.

[0039] [Diagram 3] 1 shows cynomolgus monkey pharmacokinetic data for the compound of formula I and compound 6. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The following description is made with the understanding that the present disclosure should be considered as an illustration of the claimed subject matter and is not intended to limit the scope of the appended claims to the specific embodiments illustrated. The headings used throughout this disclosure are for convenience only and should not be construed as limiting the scope of the claims in any way. An embodiment illustrated under any heading may be combined with an embodiment illustrated under any other heading.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. I. Overview

[0042] The present disclosure provides 2',3'-hydroxy-4'-cyano nucleoside analogs for the treatment of viral infections, such as Pneumoviridae viral infections, viral infections, and other viral infections, including, but not limited to, Picornaviridae, Flaviviridae, Filoviridae, and other viral infections. II. Definition

[0043] "Compounds of the disclosure" refer to compounds of Formula I.

[0044] "Pharmaceutically effective amount" refers to the amount of a compound of the present disclosure in a formulation or combination thereof that provides the desired therapeutic or pharmaceutical result.

[0045] A "pharmaceutically acceptable excipient" includes, but is not limited to, any adjuvant, carrier, filler, lubricant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier approved by the U.S. Food and Drug Administration as acceptable for use in humans or veterinary medicine.

[0046] As used herein, "treatment" or "treat" or "treating" refers to an approach for obtaining a beneficial or desired result. For purposes of this disclosure, a beneficial or desired result includes, but is not limited to, alleviation of symptoms and / or reduction in the severity of symptoms, and / or prevention of worsening of symptoms associated with a disease or condition. In one embodiment, "treatment" or "treating" refers to the following: a) inhibiting a disease or condition (e.g., reducing one or more symptoms resulting from a disease or condition and / or reducing the severity of a disease or condition); b) delaying or halting the onset of one or more symptoms associated with a disease or condition (e.g., stabilizing a disease or condition, slowing the worsening or progression of a disease or condition); and c) alleviating a disease or pathology, e.g., causing regression of clinical symptoms. The therapeutic effects include one or more of: improving the disease state, slowing the progression of the disease, improving quality of life, and / or prolonging survival.

[0047] "Prophylaxis" refers to preventing or slowing the progression of clinical disease in a patient suffering from a viral infection.

[0048] "Respiratory conditions" includes viral infections, allergic rhinitis, nasal bleeding, rhinorrhea, papillary rhinitis, nasal inflammation, all types of asthma, chronic obstructive pulmonary disease, and chronic pulmonary disease. COPD), chronic or acute bronchial stenosis, chronic bronchitis, small airway obstruction, pulmonary It refers to diseases or conditions such as emphysema, chronic eosinophilic pneumonia, adult respiratory distress syndrome, worsening airway hyperresponsiveness due to other drug therapy, pulmonary vascular disease (including pulmonary arterial hypertension), acute lung injury, bronchiectasis, sinusitis, allergic conjunctivitis, idiopathic pulmonary fibrosis, or atopic dermatitis, especially respiratory infections caused by asthma or allergic rhinitis or atopic dermatitis or allergic conjunctivitis.

[0049] "Respiratory deterioration" refers to deterioration induced by a viral infection. Representative viral infections include respiratory syncytial virus (RSV). , rhinovirus, and metapneumovirus.

[0050] As used herein, "therapeutically effective amount" or "effective amount" refers to an amount effective to induce a desired biological or medical response when administered to a subject to treat a disease, including an amount of a compound sufficient to effect such treatment of the disease. The effective amount varies depending on the compound, the disease and its severity, as well as the age, weight, etc., of the subject to be treated. The effective amount can include a range of amounts. As is understood in the art, an effective amount may be one or more doses, i.e., a single dose or multiple doses may be required to achieve a desired therapeutic endpoint. An effective amount can be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be administered in an effective amount when a desired or beneficial result can be or is achieved in combination with one or more other agents. The suitable dose of any co-administered compound may optionally be lowered by the combined action (e.g., additive or synergistic effects) of the compounds.

[0051] As used herein, "co-administration" refers to administration of a unit dose of a compound disclosed herein before or after administration of a unit dose of one or more additional therapeutic agents, e.g., within seconds, minutes, or hours of administration of a compound disclosed herein. For example, in some embodiments, a unit dose of a compound disclosed herein is administered first, followed within seconds or minutes by a unit dose of one or more additional therapeutic agents. Alternatively, in other embodiments, a unit dose of one or more additional therapeutic agents is administered first, followed within seconds or minutes by a unit dose of a compound disclosed herein. In some embodiments, a unit dose of a compound disclosed herein is administered first, followed hours (e.g., 1-12 hours) later by a unit dose of one or more additional therapeutic agents. In other embodiments, a unit dose of one or more additional therapeutic agents is administered first, followed within hours (e.g., 1-12 hours) later by a unit dose of a compound disclosed herein. Co-administration of a compound disclosed herein with one or more additional therapeutic agents generally refers to the simultaneous or sequential administration of a compound disclosed herein with one or more additional therapeutic agents such that a therapeutically effective amount of each agent is present in the patient's body.

[0052] Pharmaceutically acceptable salts, hydrates, solvates, tautomers, polymorphs, and prodrugs of the compounds described herein are also provided. "Pharmaceutically acceptable" or "physiologically acceptable" refers to compounds, salts, compositions, dosage forms, and other substances that are useful in preparing pharmaceutical compositions suitable for veterinary or human pharmaceutical use.

[0053] The compounds described herein can be prepared and / or formulated as pharmaceutically acceptable salts, or as free bases, if appropriate.Pharmaceutically acceptable salts are non-toxic salts of the free base form of compounds that have the desired pharmacological activity of the free base.These salts can be derived from inorganic or organic acids or bases.For example, compounds that contain basic nitrogen can be prepared as pharmaceutically acceptable salts by contacting the compounds with inorganic or organic acids. Non-limiting examples of pharma- ceutically acceptable salts include sulfate, pyrosulfate, disulfate, sulfite, bisulfite, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caproate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyrate-1,4-diol, hexyne ... Examples of suitable pharma- ceutically acceptable salts include 1,6-diacidote, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, methylsulfonate, propylsulfonate, besylate, xylenesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, gamma-hydroxybutyrate, glycolate, tartrate, and mandelate. A list of other suitable pharma-ceutically acceptable salts can be found in Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott William and Wilkins, Philadelphia, Pa., 2006.

[0054] Examples of "pharmaceutically acceptable salts" of the compounds disclosed herein also include alkali metal (e.g., sodium, potassium), alkaline earth metal (e.g., magnesium), ammonium and NX 4 + (X is C 1 ~C 4Also included are salts derived from appropriate bases, such as alkyl groups, etc. Also included are base addition salts, such as sodium or potassium salts.

[0055] Also provided are compounds described herein, or pharma- ceutically acceptable salts, isomers, or mixtures thereof, in which 1 to n hydrogen atoms bonded to a carbon atom can be replaced by a deuterium atom or D, where n is the number of hydrogen atoms in the molecule. As is known in the art, a deuterium atom is a non-radioactive isotope of a hydrogen atom. Such compounds can increase resistance to metabolism and thus can be useful for increasing the half-life of the compounds described herein, or pharma- ceutically acceptable salts, isomers, or mixtures thereof, when administered to a mammal. See, for example, Foster, "Deuterium Isotope Effects in Studies of Drug Metabolism", Trends Pharmacol.Sci., 5(12):524-527 (1984). Such compounds are synthesized by means well known in the art, for example, by using starting materials in which one or more hydrogen atoms have been replaced by deuterium.

[0056] Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, e.g., 2 H, 3 H, 11 C. 13 C. 14 C. 13 N, 15 N, 15 O. 17 O. 18 O. 31 P, 32 P, 35 S, 18 F, 36 Cl, 123 I, and 125 I. Substitution with positron emitting isotopes, e.g. 11 C. 18 F, 15 O and 13N may be useful in Positron Emission Topography (PET) studies to examine substrate receptor occupancy. Isotopically labeled compounds of formula I can generally be prepared by conventional techniques known to those skilled in the art, or by processes similar to those described in the Examples below, using the appropriate isotopically labeled reagent in place of the previously used non-labeled reagent.

[0057] The compounds of the embodiments disclosed herein, or pharma- ceutically acceptable salts thereof, may contain one or more asymmetric centers, e.g., chiral carbon and phosphorus atoms, and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be de?ned, in terms of absolute stereochemistry, as (R)- or (S)-, or for amino acids, as (D)- or (L)-. The present disclosure is meant to include all such possible isomers, as Well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or resolved using conventional techniques, e.g., chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of the racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). When compounds are represented in their chiral form, it is understood that the embodiments include, but are not limited to, the specific diastereomerically or enantiomerically enriched forms. When no chirality is specified, it is understood that the embodiments are directed to either the specific diastereomerically or enantiomerically enriched forms, or racemic or scalemic mixtures of such compounds. As used herein, a "scalemic mixture" is a mixture of stereoisomers in a ratio other than 1:1.

[0058] "Racemate" refers to a mixture of enantiomers. The mixture may contain equal or unequal amounts of each enantiomer.

[0059] "Stereoisomer" and "stereoisomers" refer to one or more It refers to a compound that has different chirality of stereocenters. Stereoisomers include enantiomers and diastereomers. A compound can exist in stereoisomeric forms when it has one or more asymmetric centers or double bonds with asymmetric substitution, and can therefore be produced as individual stereoisomers or as mixtures. Unless otherwise indicated, the present specification is intended to include individual stereoisomers as well as mixtures. Methods for determining stereochemistry and separating stereoisomers are well known in the art (see, for example, Chapter 4 of Advanced Organic Chemistry, 4th ed., J. March, John Wiley and Sons, New York, 1992).

[0060] "Tautomer" refers to alternative forms of a compound that differ in the location of a proton, such as enol-keto and imine-enamine tautomers, or the tautomeric forms of heteroaryl groups that contain ring atoms attached to both the -NH- and =N- rings, such as pyrazole, imidazole, benzimidazole, triazole, and tetrazole.

[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0062] As used herein, "solvate" refers to the result of the interaction of a solvent with a compound. Solvates of the salts of the compounds described herein are also provided. Hydrates of the compounds described herein are also provided.

[0063] As used herein, "prodrug" refers to a derivative of a drug, which upon administration to the human body is converted into an active drug by following some chemical or enzymatic pathway. III.Compound

[0064] The present disclosure relates to a compound of formula I: [ka] or a pharma- ceutically acceptable salt thereof.

[0065] In vivo metabolic products of the compounds of formula I described herein, or pharma- ceutically acceptable salts thereof, are also within the scope of the present invention, so long as such products are novel and unobvious over the prior art. Such products may result, for example, from the oxidation, reduction, hydrolysis, amidation, esterification, etc., of the administered compound, primarily through enzymatic processes. Thus, novel and unobvious compounds produced by a process comprising contacting a compound with a mammal for a period of time sufficient to yield a metabolic product thereof are included. Such products are typically radiolabeled (e.g., 14 C or 3 H) is identified by preparing a compound, administering it parenterally to animals such as rats, mice, guinea pigs, monkeys, or humans at a detectable dose (e.g., greater than about 0.5 mg / kg), allowing sufficient time for metabolism to occur (typically about 30 seconds to 30 hours), and isolating its conversion products from urine, blood, or other biological samples. These products can be easily isolated because they are labeled (others are isolated by the use of antibodies that can bind to epitopes that survive in the metabolites). Metabolite structures are determined in conventional manner, for example, by MS or NMR analysis. In general, analysis of metabolites is performed in the same manner as conventional drug metabolism studies well known to those skilled in the art. Conversion products are useful in diagnostic assays for therapeutic administration of compounds of formula I, even if they do not have their own antiviral activity unless otherwise found in vivo.

[0066] Lower EC 50 It is a desirable goal to discover compounds, or pharma- ceutically acceptable salts thereof, that have therapeutic value. 50The EC value refers to the concentration of a compound in the assay that achieves 50% of its maximum efficacy. 50 Compounds with a higher EC 50 Thus, lower compound concentrations are required for drug development to achieve similar efficacy compared to compounds with lower EC 50 is generally preferred.

[0067] Furthermore, it is desirable to find compounds, or their pharma- ceutically acceptable salts, with a high selectivity index (SI). SI is a ratio that measures the window between cytotoxicity and antiviral activity (AVA) by dividing a given AVA value into the TOX (toxicity) value (AVA / TOX). The higher the SI ratio, the more effective and safe the drug will theoretically be during in vivo treatment for a given viral infection. An ideal drug would be cytotoxic only at very high concentrations and have antiviral activity at very low concentrations, thus resulting in a high SI value (high AVA / low TOX), thereby eliminating the target virus at concentrations well below its cytotoxic concentration (Human Herpesviruses HHV-6A, HHV-6B & HHV-7 (Third Edition), Diagnosis and Clinical Management, 2014, Chapter 19, Pages 311-331).

[0068] It is also desirable to find compounds, or pharma- ceutically acceptable salts thereof, that have good physical and / or chemical stability. Increasing the overall stability of a compound can provide increased circulation time in the body. Less degradation allows a stable compound to be administered at a lower dose and still be effective. The less degradation there is, the less concern about by-products from compound degradation. Greater stability of a drug means more of the drug is available to the target cells without being metabolized.

[0069] It is further desirable to find a compound or its pharmaceutically acceptable salt with improved pharmacokinetic and / or pharmacodynamic profile and long half-life.It is advantageous for a drug to have moderate or low clearance and long half-life, because this can lead to good bioavailability and high systemic exposure.Reducing clearance and increasing the half-life time of a compound can reduce the daily dose required for efficacy, thus resulting in better efficacy and safety profile.Thus, improved pharmacokinetic and / or pharmacodynamic profile and long half-life can provide better patient compliance.

[0070] It is also desirable to develop compounds with improved solubility. Less soluble compounds are often characterized by poor adsorption and bioavailability. Low solubility compounds are also generally difficult to formulate and face development challenges that lead to increased development costs and / or time.

[0071] It is further desirable to develop prodrug compounds that can undergo selective metabolism in target cells and / or tissues. Selective metabolism in target cells / tissues ensures that active metabolites are delivered to the target cells / tissues, thereby resulting in increased efficacy. This may also lead to lower dosage requirements and side effects.

[0072] Advantageously, the compounds of formula I exhibit improved properties compared to the structurally related compounds described in WO 2015 / 069939 (hereinafter designated as compounds 1 and 2). [ka] IV. Pharmaceutical Preparations

[0073] In some embodiments, the present disclosure provides a pharmaceutical formulation comprising a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof (active ingredient), and a pharma- ceutically acceptable carrier or excipient. Also provided herein is a pharmaceutical formulation comprising a therapeutically effective amount of a compound of formula I, or a pharma- ceutically acceptable salt, solvate, and / or ester thereof, and a pharma- ceutically acceptable carrier or excipient.

[0074] The compounds of formula I described herein are formulated with conventional carriers and excipients selected in accordance with conventional practice. Tablets contain excipients, lubricants, fillers, binders, and the like. Aqueous formulations are prepared in sterile form and will generally be isotonic if intended for delivery other than by oral administration. All formulations will optionally contain excipients such as those described in the "Handbook of Pharmaceutical Excipients" (1986). Excipients may include ascorbic acid and other antioxidants, chelating agents such as EDTA, carbohydrates such as dextrin, hydroxyalkylcellulose, hydroxyalkylmethylcellulose, stearic acid, and the like. The pH of the formulations ranges from about 3 to about 11. Yes, but usually it's around 7-10.

[0075] Although it is possible for the active ingredient to be administered alone, it may be preferable to present them as pharmaceutical formulations.The formulations for both veterinary and human use comprise the active ingredient, as defined above, together with one or more acceptable carriers and optionally other therapeutic ingredients, particularly the additional therapeutic ingredients discussed herein.The carrier must be "acceptable" in the sense that it is compatible with the other ingredients of the formulation and physiologically harmless to its recipient.

[0076] The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Techniques and formulations are generally found in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, PA). Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0077] Formulations suitable for oral administration may be presented as discrete units such as capsules, cachets, or tablets each containing a predetermined amount of the active ingredient, as a powder or granules, as a solution or suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion. The active ingredient may also be administered as a bolus, electuary, or paste.

[0078] Tablets are made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared by compressing the active ingredient in a free-flowing form, such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface active agent, or dispersant, in a suitable machine. Molded tablets can be made by molding a mixture of the powdered active ingredient moistened with an inert liquid diluent in a suitable machine. Tablets can be optionally coated or scored, and are optionally formulated to provide slow or controlled release of the active ingredient therefrom.

[0079] For infections of the eye or other external tissues, e.g., mouth and skin, the formulations are preferably applied as a topical ointment or cream containing the active ingredient in an amount of, for example, 0.075-20% w / w (including in increments of 0.1% w / w, such as 0.6% w / w, 0.7% w / w, ranging from 0.1% to 20% active ingredient), preferably 0.2-15% w / w, most preferably 0.5-10% w / w. When formulated in an ointment, the active ingredient may be employed in either a paraffinic or water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base.

[0080] Optionally, the aqueous phase of the cream base may contain, for example, at least 30% w / w of a polyhydric alcohol, i.e., an alcohol having two or more hydroxyl groups, such as propylene glycol, butane 1,3-diol, mannitol, sorbitol, glycerol, and polyethylene glycol (including PEG 400), and mixtures thereof. Topical formulations may desirably contain a compound that enhances absorption or penetration of the active ingredient through the skin or other affected areas. Examples of such skin penetration enhancers include dimethyl sulfoxide and related analogues.

[0081] The oily phase of the emulsion may be constituted from known ingredients in a known manner. The phase may simply comprise an emulsifier (otherwise known as an emulsion), but desirably comprises a mixture of at least one emulsifier with a fat or oil, or with both a fat and an oil. Alternatively, a hydrophilic emulsifier is included together with a lipophilic emulsifier which acts as a stabilizer. In some embodiments, both an oil and a fat may be included. Together, the emulsifiers, with or without stabilizers, constitute the so-called emulsifying wax, which, together with the oil and fat, forms the oily dispersed phase of the cream formulation, the so-called emulsifying ointment base.

[0082] Emulsions and emulsion stabilizers suitable for use in the formulation include Tween® 60, Span® 80, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl monostearate, and sodium lauryl sulfate.

[0083] The selection of suitable oils or fats for the formulation is based on achieving the desired cosmetic properties. The cream should preferably be a non-greasy, non-staining and washable product with a suitable consistency to avoid leakage from tubes or other containers. Linear or branched, mono- or dibasic alkyl esters may be used, such as diisoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acid, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate, or a blend of branched esters known as Crodamol CAP. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and / or liquid paraffin or other mineral oils are used.

[0084] The pharmaceutical preparations herein comprise an active ingredient together with one or more pharma- ceutically acceptable carriers or excipients, and optionally other therapeutic agents. The pharmaceutical preparations containing the active ingredient may be in any form suitable for the intended method of administration. For example, when used for oral use, tablets, troches, lozenges, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, liquids, syrups or elixirs can be prepared. Compositions intended for oral use can be prepared according to any method known in the art for the manufacture of pharmaceutical compositions, and such compositions may contain one or more agents, including sweeteners, flavoring agents, coloring agents, and preservatives, to provide a palatable preparation. Tablets containing the active ingredient in a mixture with non-toxic pharma- ceutically acceptable excipients suitable for the manufacture of tablets are acceptable. These excipients may be, for example, inert diluents such as calcium or sodium carbonate, lactose, calcium or sodium phosphate; granulating and disintegrating agents such as corn starch or alginic acid; binding agents such as starch, gelatin, or acacia; and lubricants such as magnesium stearate, stearic acid, or talc. The tablets may be uncoated or may be coated by known techniques, including microencapsulation, to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be used alone or with a wax.

[0085] Formulations for oral use may also be presented as hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent, for example, calcium phosphate or kaolin, or as soft gelatin capsules in which the active ingredient is mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.

[0086] Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients include suspending agents such as carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, dispersing or wetting agents such as naturally occurring phosphatides (e.g. lecithin), alkylene oxides and fatty acids (e.g. polystearate), and the like. Examples of suitable esters include ethylene oxide and polyoxyethylene condensation products, ethylene oxide and long chain aliphatic alcohols (e.g., heptadecathyleneoxycetanol), ethylene oxide and partial esters derived from fatty acids, and hexitol anhydrides (e.g., polyoxyethylene sorbitan monooleate). The aqueous suspensions may also contain one or more preservatives, such as ethyl or n-propyl p-hydroxy-benzoates, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.

[0087] Oil suspensions can be formulated by suspending the active ingredient in vegetable oils such as peanut oil, olive oil, sesame oil or coconut oil, or in mineral oils such as liquid paraffin. Oral suspensions can contain thickening agents such as beeswax, hard paraffin or cetyl alcohol. Sweeteners and flavoring agents such as those mentioned above can be added to provide a palatable oral preparation. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.

[0088] Dispersible powders and granules suitable for preparation of an aqueous suspension by adding water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent, and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those disclosed above. Additional excipients, such as sweeteners, flavorings, and coloring agents, may also be present.

[0089] The pharmaceutical composition may also be in the form of an oil-in-water emulsion. The oil phase may be a vegetable oil, such as olive oil or peanut oil, a mineral oil, such as liquid paraffin, or a mixture thereof. Suitable emulsifiers include naturally occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids, and hexitol anhydrides, such as sorbitan monooleate, and the condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. The emulsion may also contain sweeteners and flavoring agents. Syrups and elixirs may be formulated with sweeteners, such as glycerol, sorbitol, or sucrose. Such formulations may also contain a demulcent, a preservative, a flavoring, or a coloring agent.

[0090] The pharmaceutical composition may be in the form of a sterile injectable or intravenous preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents as described above. The sterile injectable or intravenous preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1,3-butane-diol, or may be prepared as a lyophilized powder. Among the acceptable vehicles and solvents that may be used are water, Ringer's solution, and isotonic sodium chloride solution. Additionally, sterile fixed oils may conventionally be used as a solvent or suspending medium. For this purpose, any solventless fixed oil may be used, including synthetic mono- or diglycerides. Additionally, fatty acids such as oleic acid may also be used in the preparation of injectables.

[0091] The amount of active ingredient that may be combined with the carrier material to produce a single dosage form will vary depending on the host treated and the particular mode of administration. For example, a sustained release formulation intended for oral administration to humans may contain approximately 1-1000 mg of active agent compound with an appropriate and convenient amount of carrier material that may vary from about 5 to about 95% (weight:weight) of the total composition. Pharmaceutical compositions can be prepared to provide easily measurable amounts for administration. For example, an aqueous solution intended for intravenous infusion may contain about 3-500 μg of active ingredient per milliliter of solution, so that infusion of a suitable volume at a rate of about 30 mL / hour can occur.

[0092] Formulations suitable for topical administration to the eye also include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the active ingredient. The active ingredient is preferably present in a concentration of 0.5 to 20%, advantageously is present in such formulations at a concentration of 0.5 to 10%, particularly about 1.5% w / w.

[0093] Formulations suitable for topical administration in the mouth include lozenges which comprise the active ingredient in a flavored base, usually sucrose and acacia or tragacanth; pastilles which comprise the active ingredient in an inert base such as gelatin and glycerin, or sucrose and acacia, and mouthwashes which comprise the active ingredient in a suitable liquid carrier.

[0094] Formulations for rectal administration may be presented as a suppository with a suitable base comprising, for example, cocoa butter or a salicylate.

[0095] Formulations suitable for pulmonary or nasal administration have, for example, particle sizes in the range of 0.1 to 500 microns, e.g., 0.5, 1, 30, 35, etc., which are administered by inhalation through the nasal passages or by inhalation through the mouth. Suitable formulations include aqueous or oily solutions of the active ingredient. Formulations suitable for aerosol or dry powder administration can be prepared according to conventional methods and may be delivered with other therapeutic agents, such as compounds previously used in the treatment or prevention of Pneumoviridae infections, as described below.

[0096] Another embodiment provides novel, effective, safe, non-irritating, and physiologically compatible inhalable compositions comprising a compound of formula I, or a pharma- ceutically acceptable salt thereof, suitable for treating Pneumoviridae infections and possible associated bronchiolitis. Non-limiting exemplary pharma- ceutically acceptable salts are inorganic acid salts, including hydrochloride, hydrobromide, sulfate, or phosphate, which are less likely to cause pulmonary irritation. In some embodiments, the inhalable formulation is delivered to the endobronchial space in an aerosol comprising particles having a mass median aerodynamic diameter (MMAD) of about 1 to about 5 μm. In some embodiments, the compound of formula I is formulated for aerosol delivery using a nebulizer, a pressurized metered dose inhaler (pMDI), or a dry powder inhaler (DPI).

[0097] Non-limiting examples of nebulizers include atomizing, jet, ultrasonic, pressurized vibrating porous plate, or equivalent nebulizers, including those nebulizers that utilize adaptive aerosol delivery technology (Denyer, J. Aerosol medicine Pulmonary Drug Delivery 2010, 23 Supp 1, S1-S10). Jet nebulizers utilize air pressure to break liquid solutions into aerosol droplets. Ultrasonic nebulizers work by piezoelectric crystals that shear liquid into small aerosol droplets. Pressurized nebulizer systems push solutions under pressure through small pores to generate aerosol droplets. Vibrating porous plate devices use rapid vibration to shear a liquid stream into the appropriate droplet size.

[0098] In some embodiments, the formulation for nebulization is delivered to the endobronchial space in an aerosol containing particles with a MMAD of about 1 μm to about 5 μm, using a nebulizer capable of aerosolizing the formulation of the compound of formula I into particles of the required MMAD. To be optimally therapeutically effective and to avoid upper respiratory tract and systemic side effects, the majority of the aerosolized particles should not have an MMAD greater than about 5 μm. If the aerosol contains a large number of particles with an MMAD greater than 5 μm, the particles will be deposited in the upper respiratory tract, reducing the amount of drug delivered to sites of inflammation and bronchial constriction in the lower respiratory tract. If the MMAD of the aerosol is smaller than about 1 μm, the particles will tend to remain suspended in the inhaled air and subsequently be exhaled during expiration.

[0099] When formulated and delivered according to the methods herein, the aerosol formulation for nebulization delivers a therapeutically effective dose of a compound of formula I sufficient to treat Pneumoviridae infections. neumoviridae infection. The amount of drug administered must be adjusted to reflect the efficiency of delivery of a therapeutically effective dose of the compound of formula I. In some embodiments, the combination of an aqueous aerosol formulation with a nebulizer, jet, pressurized, vibrating porous plate, or ultrasonic nebulizer allows for delivery of at least about 20 to about 90%, e.g., about 70%, of the administered dose of the compound of formula I to the airways, depending on the nebulizer. In some embodiments, at least about 30 to about 50% of the active compound is delivered. In some embodiments, about 70 to about 90% of the active compound is delivered.

[0100] In another embodiment, the compound of formula I, or a pharma- ceutically acceptable salt thereof, is delivered as a dry inhalable powder. The compound is administered intrabronchially as a dry powder formulation to effectively deliver fine particles of the compound to the intrabronchial space using a dry powder or metered dose inhaler. For delivery by DPI, the compound of formula I is processed by milling, spray drying, critical fluid processing, or precipitation from solution into particles having a MMAD of primarily about 1 μm to about 5 μm. Media milling, jet milling, and spray drying devices and procedures capable of producing particle sizes with a MMAD of about 1 μm to about 5 μm are well known in the art. In one embodiment, excipients are added to the compound of formula I prior to processing into particles of the required size. In another embodiment, excipients are blended with the particles of the required size to aid in the dispersion of the drug particles, for example, by using lactose as an excipient.

[0101] Particle size measurements are performed using devices well known in the art, such as a multi-stage Anderson cascade impactor or other suitable methods, such as those specifically cited in the United States Pharmacopeia Chapter 601 as characterizing devices for metered dose and aerosols in dry powder inhalers.

[0102] In some embodiments, the compound of formula I is delivered as dry powder using a device such as a dry powder inhaler or other dry powder dispersion device.Non-limiting examples of dry powder inhalers and devices include those disclosed in U.S. Patent No. 5,458,135, U.S. Patent No. 5,740,794, U.S. Patent No. 5,775,320, U.S. Patent No. 5,785,049, U.S. Patent No. 3,906,950, U.S. Patent No. 4,013,075, U.S. Patent No. 4,069,819, U.S. Patent No. 4,995,385, U.S. Patent No. 5,522,385, U.S. Patent No. 4,668,218, U.S. Patent No. 4,667,668, U.S. Patent No. 4,805,811 and U.S. Patent No. 5,388,572.There are two main designs of dry powder inhalers. One design is a metered device where a reservoir for the drug is placed in the device and the patient adds a dose of the drug to the inhalation chamber. The second design is a factory metered device where each individual dose is manufactured in a separate container. Both systems rely on the formulation of the drug into small particles between 1 μm and about 5 μm MMAD, often with co-formulation with larger excipient particles such as, but not limited to, lactose. Drug powder is placed in the inhalation chamber (either by device metering or by breakage of a factory metered dose) and the patient's inspiratory flow accelerates the powder from the device into the oral cavity. The non-laminar flow characteristics of the powder path break up excipient-drug agglomerates and the mass of the large excipient particles causes them to be impacted at the back of the throat while the smaller drug particles are deposited deep in the lungs. In some embodiments, the compound of formula I, or a pharma- ceutically acceptable salt thereof, is delivered as a dry powder using any type of dry powder inhaler described herein, where the MMAD of the dry powder, excluding any excipients, is primarily in the range of 1 μm to about 5 μm.

[0103] In another embodiment, the compound of formula I is delivered as a dry powder using a metered dose inhaler. Non-limiting examples of metered dose inhalers and devices include those disclosed in U.S. Patent Nos. 5,261,538, 5,544,647, 5,622,163, 4,955,371, 3,565,070, 3,361306 and 6,116,234. In some embodiments, the compound of formula I, or a pharma- ceutically acceptable salt thereof, is delivered as a dry powder using a metered dose inhaler, in which case the compound of formula I is delivered as a dry powder using a metered dose inhaler. In this case, the MMAD of the dry powder, excluding any excipients, is primarily in the range of about 1 to 5 μm.

[0104] Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations, in addition to the active ingredient in such carriers as are known in the art to be appropriate.

[0105] Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.

[0106] The formulations are presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions are prepared from sterile powders, granules and tablets of the kind previously described. Exemplary unit dosage formulations are those containing a daily dose or unit daily sub-dose of active ingredient, as hereinbefore recited, or an appropriate fraction thereof.

[0107] It will be understood that in addition to the ingredients particularly mentioned above, the formulations may include other agents conventional in the art having regard to the type of formulation in question; for example, those suitable for oral administration may include flavoring agents.

[0108] There is further provided veterinary compositions comprising at least one active ingredient, as above defined, together with a veterinary carrier therefor.

[0109] A veterinary carrier may be a solid, liquid or gaseous substance that is useful for the purpose of administering the composition and is otherwise inert or acceptable in veterinary technology and compatible with the active ingredient. These veterinary compositions may be administered orally, parenterally or by any other desired route.

[0110] In some embodiments, the compounds of formula I are formulated to provide a controlled release pharmaceutical formulation ("controlled release formulation"), in which the release of the compounds of formula I is controlled and regulated to allow less frequent administration or to improve the pharmacokinetic or toxicity profile of a given active ingredient.

[0111] The effective dose of active ingredient depends at least on the nature of the condition being treated, toxicity, whether the compound is being used prophylactically (low dose) or for active viral infection, delivery method, and pharmaceutical formulation, and is determined by the clinician using conventional dose escalation studies. It can be expected to be about 0.0001 to about 100 mg / kg body weight per day, for example, about 0.01 to about 10 mg / kg body weight per day. In some embodiments, the effective dose is about 0.01 to about 5 mg / kg body weight per day, for example, typically about 0.05 to about 0.5 mg / kg body weight per day. For example, the daily candidate dose for an adult human weighing approximately 70 kg ranges from 1 mg to 1000 mg, for example, 5 mg to 500 mg, and can take the form of a single or multiple doses. V. Route of Administration

[0112] The compound of formula I (also referred to herein as active ingredient) can be administered by any suitable route. Suitable routes include oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural), etc. It will be understood that the preferred route may vary, for example, depending on the condition of the recipient.

[0113] The compounds of the present disclosure may be administered to an individual according to an effective dosing regimen for a desired period or duration, such as at least about 1 week, at least about 2 weeks, at least about 3 weeks, 1 month, at least about 2 months, at least about 3 months, at least about 6 months, or at least about 12 months or more. In one variation, the compounds are administered on a daily or intermittent schedule for as long as necessary for the life of the individual.

[0114] The dosage or frequency of administration of a compound of the present disclosure may be adjusted over the course of treatment, based on the judgment of the administering physician.

[0115] The compounds may be administered to an individual (e.g., a human) in an effective amount. In some embodiments, the compounds are administered once daily.

[0116] The compound can be administered by any useful route and means, such as oral or parenteral (e.g., intravenous) administration. A therapeutically effective amount of the compound can include from about 0.00001 mg / kg body weight per day to about 10 mg / kg body weight per day, such as from about 0.0001 mg / kg body weight per day to about 10 mg / kg body weight per day, or from about 0.001 mg / kg body weight per day to about 1 mg / kg body weight per day, or from about 0.01 mg / kg body weight per day to about 1 mg / kg body weight per day, or from about 0.05 mg / kg body weight per day to about 0.5 mg / kg body weight per day, or from about 0.3 g to about 30 mg per day, or from about 30 g to about 300 g per day.

[0117] The compounds of the present disclosure can be combined with one or more additional therapeutic agents at any dosage of the compound of the present disclosure (e.g., 1 mg to 1000 mg of compound). Therapeutically effective amounts can include from about 1 mg per dose to about 1000 mg per dose, such as from about 50 mg per dose to about 500 mg per dose, or from about 100 mg per dose to about 400 mg per dose, or from about 150 mg per dose to about 350 mg per dose, or from about 200 mg per dose to about 300 mg per dose. Other therapeutically effective amounts of the compounds of the present disclosure are about 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or about 500 mg per dose. Other therapeutically effective amounts of the compounds of the present disclosure are about 100 mg per dose, or about 125, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450, or about 500 mg per dose. A single dose can be administered hourly, daily, or weekly. For example, a single dose can be administered once every 1, 2, 3, 4, 6, 8, 12, 16 hours, or once every 24 hours. A single dose can also be administered once every 1, 2, 3, 4, 5, 6 days, or once every 7 days. A single dose can also be administered once every 1, 2, 3 weeks, or once every 4 weeks. In some embodiments, a single dose can be administered once every week. A single dose can also be administered once every month.

[0118] Other therapeutically effective amounts of a compound of the present disclosure are about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or about 100 mg per dose.

[0119] The frequency of dosing of the compounds of the present disclosure is determined by the needs of an individual patient, and can be, for example, once per day, or twice per day, or more. Administration of the compounds continues as long as necessary to treat the viral infection. For example, the compounds can be administered to a human infected with a virus for a period of 20 to 180 days, or for example, for a period of 20 to 90 days, or for example, for a period of 30 to 60 days.

[0120] Administration can be intermittent, with a period of several days or more during which the patient receives a daily dose of the compound of the present disclosure, followed by a period of several days or more during which the patient does not receive a daily dose of the compound. For example, the patient can receive a dose of the compound every other day or three times per week. As a further example, the patient can receive a dose of the compound daily for a period of 1-14 days, followed by a period of 7-21 days during which the patient does not receive a dose of the compound, followed by a subsequent period (e.g., 1-14 days) during which the patient again receives a daily dose of the compound. The alternating periods of administration of the compound followed by non-administration of the compound can be repeated as clinically required to treat the patient.

[0121] In one embodiment, a pharmaceutical composition is provided that includes a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, in combination with one or more (e.g., 1, 2, 3, 4, 1 or 2, 1-3, or 1-4) additional therapeutic agents, and a pharma- ceutically acceptable excipient.

[0122] In one embodiment, a kit is provided that includes a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, in combination with one or more (e.g., 1, 2, 3, 4, 1 or 2, 1-3, or 1-4) additional therapeutic agents.

[0123] In some embodiments, the compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is combined with one, two, three, four or more additional therapeutic agents. In some embodiments, the compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is combined with two additional therapeutic agents. In other embodiments, the compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is combined with three additional therapeutic agents. In further embodiments, the compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is combined with four additional therapeutic agents. The one, two, three, four or more additional therapeutic agents may be different therapeutic agents selected from the same class of therapeutic agents and / or may be selected from different classes of therapeutic agents.

[0124] In some embodiments, when the compounds of the present disclosure are combined with one or more additional therapeutic agents described herein, the components of the composition are administered simultaneously or as a sequential regimen. When administered sequentially, the combination may be administered in two or more administrations.

[0125] In some embodiments, compounds of the present disclosure are combined with one or more additional therapeutic agents in a unit dosage form for simultaneous administration to a patient, for example as a solid dosage form for oral administration.

[0126] In some embodiments, a compound of the present disclosure is administered with one or more additional therapeutic agents.

[0127] In order to prolong the effect of the disclosed compounds, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound depends on its rate of dissolution, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomal or microemulsion formulations that are compatible with body tissues. VI. Combination Therapy

[0128] The compounds and compositions of Formula I provided herein are also useful in combination with other active therapeutic agents for the treatment of a viral infection, such as a Pneumoviridae, Picornaviridae, Flaviviridae, or Filoviridae viral infection. Combination Therapy for the Treatment of Pneumoviridae

[0129] The compounds and compositions provided herein may also be used in combination with other active therapeutic agents. In the case of treating Pneumoviridae virus infections, preferably, the other active therapeutic agent is active against Pneumoviridae virus infections, particularly respiratory syncytial virus infections and / or metapneumovirus infections. Non-limiting examples of these other active therapeutic agents against RSV are ribavirin, palivizumab, motavizumab, RSV-IGIV (RespiGam®), MEDI-557, A-60444 (also known as RSV604), MDT-637, BMS-433771, ALN-RSV0, ALX-0171, and mixtures thereof. Other non-limiting examples of other active therapeutic agents active against respiratory syncytial virus infection include respiratory syncytial virus protein F inhibitors such as AK-0529; RV-521, ALX-521, ALX-0171, JNJ-53718678, BTA-585, and presatovir; RNA polymerase inhibitors such as lumicitabine and ALS-8112; anti-RSV G protein antibodies such as anti-G protein mAb; and viral replication inhibitors such as nitazoxanide.

[0130] In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of RSV, including, but not limited to, MVA-BN RSV, RSV-F, MEDI-8897, JNJ-64400141, DPX-RSV, SynGEM, GSK-3389245A, GSK-300389-1A, RSV-MEDI δM2-2 vaccine, VRC-RSVRGP084-00VP, Ad35-RSV-FA2, Ad26-RSV-FA2, and RSV fusion glycoprotein subunit vaccine.

[0131] Non-limiting examples of other active therapeutic agents active against metapneumovirus infection include sialidase modulators such as DAS-181, RNA polymerase inhibitors such as ALS-8112, and antibodies for the treatment of Metapneumovirus infection such as EV-046113.

[0132] In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of metapneumovirus infection, including but not limited to mRNA-1653 and rHMPV-Pa vaccines. Combination Therapy for the Treatment of Picornaviridae

[0133] The compounds and compositions provided herein can also be used in combination with other active therapeutic agents. In the case of treating Picornaviridae virus infection, preferably, the other active therapeutic agent is active against Picornaviridae virus infection, particularly against Enterovirus infection. Non-limiting examples of these other active therapeutic agents are capsid binding inhibitors such as pleconaril, BTA-798 (Vapendavir) and other compounds disclosed by Wu et al. (US Pat. No. 7,078,403) and Watson (US Pat. No. 7,166,604); fusion sialidase proteins such as DAS-181; capsid protein VP1 inhibitors such as VVX-003 and AZN-001; viral protease inhibitors such as CW-33; phosphatidylinositol 4 kinase β inhibitors such as GSK-480 and GSK-533; anti-EV71 antibodies.

[0134] In some embodiments, the other active therapeutic agent is a Pic vaccine, including but not limited to EV71 vaccine, TAK-021, and EV-D68 adeno-vector-based vaccine. The vaccine may be for the treatment or prevention of ornaviridae viral infection. Combination Therapy for Respiratory Infections

[0135] Many of the infections of Pneumoviridae and Picornaviridae viruses are respiratory infections.Therefore, additional active therapeutic agents used to treat respiratory symptoms and sequelae of infections can be used in combination with the compound of formula I.The additional agents are preferably administered orally or by direct inhalation.For example, the additional therapeutic agents combined with the compound of formula I for the treatment of viral respiratory infections include, but are not limited to, bronchodilators and corticosteroids. Glucocorticoids

[0136] Glucocorticoids, first introduced in 1950 as an asthma therapy (Carryer, Journal of Allergy, 21, 282-287, 1950), remain the most potent and consistently effective therapy for the disease, although their mechanism of action is still not fully understood (Morris, J. Allergy Clin. Immunol., 75(1 Pt)1-13, 1985). Unfortunately, oral glucocorticoid therapy is associated with undesirable side effects such as truncal obesity, hypertension, glaucoma, glucose intolerance, accelerated cataract formation, bone mineral loss, and psychological effects, all of which limit their use as long-term therapeutic agents (Goodman and Gilman, 10th edition, 2001). The solution to the systemic side effects is to deliver steroid drugs directly to the site of inflammation. To reduce the severe adverse effects of oral steroids, inhaled corticosteroids (ICS) have been developed. Compounds of Formula I Non-limiting examples of corticosteroids that may be used in combination with are dexamethasone, dexamethasone sodium phosphate, fluorometholone, fluorometholone acetate, loteprednol, loteprednol etabonate, hydrocortisone, prednisolone, fludrocortisone, triamcinolone, triamcinolone acetonide, betamethasone, beclomethasone diproprionate, methylprednisolone, fluocinolone, fluocinolone acetonide, flunisolide, fluocortin-21-butyrate, flumethasone, flumethasone pivalate, budesonide, halobetasol propionate, mometasone furoate, fluticasone, AZD-7594, ciclesonide; or a pharmaceutically acceptable salt thereof. Anti-inflammatory agents

[0137] Other anti-inflammatory agents that act via anti-inflammatory cascade mechanisms are also useful as additional therapeutic agents in combination with the compounds of formula I for the treatment of viral respiratory infections. Applying "anti-inflammatory signaling modulators" (referred to as AISTM in this document) such as phosphodiesterase inhibitors (e.g., PDE-4, PDE-5, or PDE-7 specific), transcription factor inhibitors (e.g., blocking NFκB by IKK inhibition), or kinase inhibitors (e.g., blocking P38 MAP, JNK, PI3K, EGFR, or Syk) is a logical approach to stop inflammation, since these small molecules target a limited number of common intracellular pathways, signaling pathways that are critical points for anti-inflammatory therapeutic intervention (see review by PJBarnes, 2006). These non-limiting additional therapeutic agents include 5-(2,4-difluoro-phenoxy)-1-isobutyl-1H-indazole-6-carboxylic acid (2-dimethylamino-ethyl)-amide (P38 Map kinase inhibitor ARRY-797), 3-cyclopropylmethoxy-N-(3,5-dichloro-pyridin-4-yl)-4-difluoromethoxy-benzamide (PDE-4 inhibitor Roflumilast), 4-[2-(3-cyclopentyloxy-4-methoxyphenyl)-2-phenyl-ethyl]-pyridine (PDE-4 inhibitor CDP-840), N-(3,5-dichloro-4-pyridinyl)-4-(difluoromethoxy)-8-[(methylsulfonyl)amino]-1-dibenzofurancarboxamide (PDE-4 inhibitor Oglemilast), N-(3,5-dichloro-pyridin-4-yl)-4-difluoromethoxy-benzamide (PDE-4 inhibitor Oglemilast), and N-(3,5-dichloro-pyridin-4-yl)-4-difluoromethoxy-benzamide (PDE-4 inhibitor Oglemilast). -yl)-2-[1-(4-fluorobenzyl)-5-hydroxy-1H-indol-3-yl]-2-oxo-acetamide (PDE-4 inhibitor AWD 12-281), 8-methoxy-2-trifluoromethyl-quinoline-5-carboxylic acid (3,5-dichloro-1-oxy-pyridin-4-yl)-amide (PDE-4 inhibitor Sch 351591), 4-[5-(4-fluorophenyl)-2-(4-methanesulfinyl-phenyl)-1H-imidazol-4-yl]-pyridine (P38 inhibitor SB-203850), 4-[4-(4-fluoro-phenyl)-1-(3-phenyl-propyl)-5-pyridin-4-yl-1H-imidazol-2-yl]-but-3-yn-1-ol (P38 inhibitor RWJ-67657), 4-cyano-4-(3-cyclopentyloxy-4-methoxy-phenyl)-cyclohexane carboxylic acid 2- Diethylamino-ethyl ester (cilomilast, 2-diethyl-ethyl ester prodrug of a PDE-4 inhibitor), (3-chloro-4-fluorophenyl)-[7-methoxy-6-(3-morpholin-4-yl-propoxy)-quinazolin-4-yl]-amine (gefinib, an EGFR inhibitor), and 4-(4-methyl-piperazin-1-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-benzamide (imatinib, an EGFR inhibitor). β2-adrenergic receptor agonist bronchodilators

[0138] Combinations including an inhaled β2-adrenergic receptor agonist bronchodilator, such as formoterol, albuterol, or salmeterol, with a compound of Formula I are also suitable, but non-limiting, combinations useful in treating respiratory viral infections.

[0139] Combinations of inhaled β2-adrenergic receptor agonist bronchodilators such as formoterol or salmeterol with ICS are also used to treat both bronchial constriction and inflammation (Symbicort® and Advair®, respectively). Combinations including these ICS and β2-adrenergic receptor agonist combinations with compounds of formula I are also preferred, but non-limiting, combinations useful in treating respiratory viral infections.

[0140] Other examples of β2 adrenergic receptor agonists are bedoradrine, vilanterol, indacaterol, olodaterol, tulobuterol, formoterol, avesiterol, salbutamol, arformoterol, levalbuterol, fenoterol, and TD-5471. Anticholinergic drugs

[0141] In the case of the treatment or prevention of pulmonary bronchial stenosis, anticholinergic drugs may be useful and are therefore useful as additional therapeutic agents in combination with the compounds of formula I for the treatment of viral respiratory infections. These anticholinergic drugs include, but are not limited to, muscarinic receptors (especially of the M3 subtype), which have shown therapeutic efficacy in humans for controlling cholinergic tone in COPD (Witek, 1999). 1-{4-hydroxy-1-[3,3,3-tris-(4-fluoro-phenyl)-propionyl]-pyrrolidine-2-carbonyl}-pyrrolidine-2-carboxylic acid (1-methyl-piperidin-4-ylmethyl)-amide, 3-[3-(2-diethylamino-acetoxy)-2-phenyl-propionyloxy]-8-isopropyl-8-methyl-8-azonia-bicyclo[3.2.1]octane (ipratropium-N,N-diethylglycinate) , 1-cyclohexyl-3,4-dihydro-1H-isoquinoline-2-carboxylic acid 1-aza-bicyclo[2.2.2]oct-3-yl ester (solifenacin), 2-hydroxymethyl-4-methanesulfinyl-2-phenyl-butyric acid 1-aza-bicyclo[2.2.2]oct-3-yl ester (revatropate), 2-{1-[2-(2,3-dihydro-benzofuran-5-yl)-ethyl]-pyrrolidin-3-yl}-2,2-diphenyl- Acetamide (darifenacin), 4-azepan-1-yl-2,2-diphenyl-butyramide (buzepide), 7-[3-(2-diethylamino-acetoxy)-2-phenyl-propionyloxy]-9-ethyl-9-methyl-3-oxa-9-azonia-tricyclo[3.3.1.02,4]nonane (oxitropium-N,N-diethylglycinate), 7-[2-(2-diethylamino-acetoxy)-2,2-di-thiophen-2-yl- Acetoxy]-9,9-dimethyl-3-oxa-9-azonia-tricyclo[3.3.1.02,4]nonane (tiotropium-N,N-diethylglycinate), dimethylaminoacetic acid 2-(3-diisopropylamino-1-phenyl-propyl)-4-methyl-phenyl ester (tolterodine-N,N-dimethylglycinate), 3-[4,4-bis-(4-fluoro-phenyl)-2-oxo-imidazolidin-1-yl]-1-methyl-1-(2 -oxo-2-pyridin-2-yl-ethyl)-pyrrolidinium, 1-[1-(3-fluoro-benzyl)-piperidin-4-yl]-4,4-bis-(4-fluoro-phenyl)-imidazolidin-2-one, 1-cyclooctyl-3-(3-methoxy-1-aza-bicyclo[2.2.2]oct-3-yl)-1-phenyl-prop-2-yn-1-ol, 3-[2-(2-diethylamino-acetoxy)-2,2-dithiophen-2-yl-aza-bicyclo[2.2.2]oct-3-yl]-2-phenyl-prop-2-yn-1-ol, acetoxy]-1-(3-phenoxy-propyl)-1-azonia-bicyclo[2.2.2]octane (acridinium-N,N-diethylglycinate), or (2-diethylamino-acetoxy)-di-thiophen-2-yl-acetic acid 1-methyl-1-(2-phenoxy-ethyl)-piperidin-4-yl ester, rebefenacin, glycopyrronium bromide, umeclidinium bromide, tiotropium bromide, acridinium bromide, bencycloquidium bromide. Mucolytic agents

[0142] The compounds and compositions of formula I provided herein can also be combined with mucolytic agents to treat both infection and symptoms of respiratory infection.A non-limiting example of a mucolytic agent is ambroxol.Similarly, the compounds of formula I can also be combined with expectorants to treat both infection and symptoms of respiratory infection.A non-limiting example of an expectorant is guaifenesin.

[0143] Nebulized hypertonic saline is used to improve the immediate and long-term clearance of small airways in patients with pulmonary disease (Kuzik, J. Pediatrics 2007,266). Thus, the compound of formula I may also be combined with nebulized hypertonic saline, especially when Pneumoviridae virus infection is complicated with bronchiolitis. The combination of the compound of formula I and hypertonic saline may also include any of the additional agents discussed above. In one embodiment, about 3% nebulized hypertonic saline is used. Combination therapy for the treatment of COPD

[0144] The compounds and compositions provided herein may also be used in combination with other active therapeutic agents. In the case of treating respiratory exacerbations of COPD, the other active therapeutic agents include other active agents for COPD. Non-limiting examples of these other active therapeutic agents include anti-IL5 antibodies such as benralizumab and mepolizumab; dipeptidyl peptidase I (DPP1) inhibitors such as AZD-7986 (INS-1007); DNA gyrase inhibitors / topoisomerase IV inhibitors such as ciprofloxacin hydrochloride; MDR-related protein 4 / phosphodiesterase (PDE) 3 and 4 inhibitors such as RPL-554; ivacafto CFTR stimulators such as QBW-251; MMP-9 / MMP-12 inhibitors such as RBx-10017609' adenosine A1 receptor antagonists, e.g., PBF-680; GATA3 transcription factor inhibitors such as SB-010; muscarinic receptor modulators / nicotinic acetylcholine receptor agonists such as ASM-024; MARCKS protein inhibitors such as BIO-11006; KIT tyrosine kinase / PDGF inhibitors such as masitinib inhibitors; phosphodiesterase (PDE) 4 inhibitors such as roflumilast and CHF-6001; phosphoinositide-3 kinase delta inhibitors such as nemiralisib; 5-lipoxygenase inhibitors such as TA-270; muscarinic receptor antagonists / beta2 adrenergic agonists such as vatefenterol succinate, AZD-887, and ipratropium bromide; elastase inhibitors such as TRN-157 and erdosteine; metalloproteinase-12 inhibitors such as FP-025; interleukin-18 ligand inhibitors such as tadekinig alpha; skeletal muscle troponin activators such as CK-2127107; p38 inhibitors such as acumapimod MAP kinase inhibitors; IL-17 receptor modulators such as CNTO-6785; CXCR2 chemokine antagonists such as danilixin; leukocyte elastase inhibitors such as POL-6014; epoxide hydrolase inhibitors such as GSK-2256294; HNE inhibitors such as CHF-6333; VIP agonists such as aviptadil; phosphoinositide-3 kinase delta / gamma inhibitors such as RV-1729; complement C3 inhibitors such as APL-1, and G protein-coupled receptor-44 antagonists such as AM-211.

[0145] Other non-limiting examples of active therapeutic agents include budesonide, adipocytes, nitric oxide, PUR-1800, YLP-001, LT-4001, azithromycin, Gamnex, QBKPN, sodium pyruvate, MUL-1867, mannitol, MV-130, MEDI-3506, BI-443651, VR-096, OPK-0018, TEV-48107, doxofylline, TEV-46017, OligoG-COPD-5 / 20, Stempeucel®, ZP-051, lysine acetylsalicylate.

[0146] In some embodiments, the other active therapeutic agent may be a vaccine that is active against COPD, including but not limited to MV-130 and GSK-2838497A. Combination therapy for the treatment of dengue

[0147] The compounds and compositions provided herein can also be used in combination with other active therapeutic agents.When treating Flaviviridae virus infection, preferably, the other active therapeutic agent is active against Flaviviridae virus infection, particularly against dengue infection.Non-limiting examples of these other active therapeutic agents are host cell factor modulators such as GBV-006; fenretinide ABX-220, BRM-211; α-glucosidase 1 inhibitors such as celgosivir; platelet activating factor receptor (PAFR) antagonists such as modipafant; cadherin-5 / factor Ia modulators such as FX-06; NS4B inhibitors such as JNJ-8359; viral RNA splicing modulators such as ABX-202; NS5 polymerase inhibitors; NS3 protease inhibitors; and TLR modulators.

[0148] In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of dengue, including but not limited to TetraVax-DV, Dengvaxia®, DPIV-001, TAK-003, live attenuated dengue vaccine, tetravalent dengue vaccine, tetravalent DNA vaccine, rDEN2δ30-7169, and DENV-1 PIV. Combination Therapy for the Treatment of Ebola

[0149] The compounds and compositions provided herein may also be used in combination with other active therapeutic agents. In the case of treatment of Filoviridae virus infections, preferably the other active therapeutic agent is active against Filoviridae virus infections, particularly against Marburg virus, Ebola virus, and Cueva virus infections. Non-limiting examples of these other active therapeutic agents include ribavirin, palivizumab, motavizumab, RSV-IGIV (RespiGam®), MEDI-557, A-60444, MDT-637, BMS -433771, Amiodarone, Dronedarone, Verapamil, Ebola Convalescent Plasma Convalescent Plasma, ECP), TKM-100201, BCX4430 ((2S,3S,4R,5R)-2-(4-amino-5H-pyrrolo[3,2-d]pyrimidin-7-yl)-5-(hydroxymethyl)pyrrolidine-3,4-diol), TKM-Ebola, T-705 monophosphate, T-705 diphosphate, T-705 triphosphate, FGI-106 (1-N,7-N-bis[3-(dimethylamino)propyl]-3,9-dimethylquinolino[8,7-h]quinolone-1,7-diamine), rNAPc2, OS-2966, brincidofovir, remdesivir;

[0150] RNA polymerase inhibitors such as Galidesivir, Favipiravir (also known as T-705 or Avigan), JK-05; host cell factor modulators such as GMV-006; cadherin-5 / Factor Ia modulators such as FX-06; and antibodies for the treatment of Ebola such as REGN-3470-3471-3479 and ZMapp.

[0151] Other non-limiting active therapeutic agents active against Ebola include alpha-glucosidase 1 inhibitors, cathepsin B inhibitors, CD29 antagonists, dendritic ICAM-3 binding nonintegrin 1 inhibitors, estrogen receptor antagonists, factor VII antagonists HLA class II antigen modulators, host cell factor modulators, interferon alpha ligands, neutral alpha glucosidase AB inhibitors, Niemann-Pick C1 protein inhibitors, nucleoprotein inhibitors, polymerase cofactor VP35 inhibitors, serine protease inhibitors, tissue factor inhibitors, TLR-3 agonists, viral envelope glycoprotein inhibitors, and Ebola virus entry inhibitors (NPC1 inhibitors).

[0152] In some embodiments, the other active therapeutic agent may be a vaccine for the treatment or prevention of Ebola, including, but not limited to, VRC-EBOADC076-00-VP, adenovirus-based Ebola vaccine, rVSV-EBOV, rVSVN4CT1-EBOVGP, MVA-BN Filo+Ad26-ZEBOV regimen, INO-4212, VRC-EBODNA023-00-VP, VRC-EBOADC069-00-VP, GanEvac-combi vaccine, SRC VB vector, HPIV3 / EboGP vaccine, MVA-EBOZ, Ebola recombinant glycoprotein vaccine, Vaxart adenovirus vector 5-based Ebola vaccine, FiloVax vaccine, GOVX-E301, and GOVX-E302.

[0153] The compounds and compositions provided herein also include phosphoramidate morpholino oligomers, which are synthetic antisense oligonucleotide analogs designed to interfere with the translation process by forming base-paired duplexes with specific RNA sequences. Examples of PMOs include, but are not limited to, AVI-7287, AVI-7288, AVI-7537, AVI-7539, AVI-6002, and AVI-6003.

[0154] The compounds and compositions provided herein also include parenteral fluids (including dextrose saline and lactated Ringer's solution) and nutrition, antibiotics (including metronidazole and cephalosporin antibiotics, e.g., ceftriaxone and cefuroxime) and / or antifungal prophylaxis, antipyretics and analgesics, antiemetics (such as metoclopramide) and / or antidiarrheal drugs, vitamin and mineral supplements (including vitamin K and zinc sulfate), anti-inflammatories (such as ibuprofen), analgesics, and antimalarials (including artemether and artesunate-lumefantrine combination therapy), typhoid (including quinolone antibiotics such as ciprofloxacin, macrolide antibiotics such as azithromycin, cephalosporin antibiotics such as ceftriaxone, or aminopenicillins such as ampicillin), or Filovirid, including medications for other common diseases in the patient population, such as shigellosis. It is intended to be used in conjunction with the general care provided to patients with ae virus infections. VII. Methods of Treating Viral Infections

[0155] The present disclosure provides compounds for treating a variety of diseases, such as respiratory syncytial virus (RSV), HRV, hMPV, Ebola, Zika, West Nile, Dengue, HCV, and HBV, using compounds of formula I. Pnuemoviridae

[0156] In some embodiments, the present disclosure provides a method for treating a Pneumoviridae virus infection, comprising administering a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, to an individual (e.g., a human) infected with a Pneumoviridae virus, including, but not limited to, respiratory syncytial virus (RSV) and other Pneumoviridae viruses.

[0157] In some embodiments, the present disclosure provides a method of treating a Pneumoviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof. Pneumoviridae viruses include, but are not limited to, respiratory syncytial virus and human metapneumovirus. In some embodiments, the Pneumoviridae virus infection is a respiratory syncytial virus infection. In some embodiments, the Pneumoviridae virus infection is a human metapneumovirus infection.

[0158] In some embodiments, the disclosure provides a method for the manufacture of a medicament for treating a Pneumoviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used. In some embodiments, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a Pneumoviridae virus infection in a human. In some embodiments, the Pneumoviridae virus infection is a respiratory syncytial virus infection. In some embodiments, the Pneumoviridae virus infection is a human metapneumovirus infection.

[0159] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating a Pneumoviridae virus infection in a human in need thereof. In some embodiments, the Pneumoviridae virus infection is a respiratory syncytial virus infection. In some embodiments, the Pneumoviridae virus infection is a human metapneumovirus infection.

[0160] In some embodiments, the present disclosure provides a method for treating a RSV infection, comprising administering a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, to an individual (e.g., a human) infected with a respiratory syncytial virus. Typically, the individual suffers from a chronic respiratory syncytial virus infection, although it is within the scope of the present disclosure to treat people with acute infections with RSV.

[0161] In some embodiments, a method of inhibiting RSV replication is provided that includes administering to an individual (eg, a human) a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof.

[0162] In some embodiments, the present disclosure provides a method for reducing the viral load associated with RSV infection. The present invention provides a method for treating RSV-infected individuals (e.g., humans), the method comprising administering to an individual (e.g., a human) a therapeutically effective amount of a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, wherein the therapeutically effective amount is sufficient to reduce the RSV viral load in the individual.

[0163] As described more fully herein, the compounds of the present disclosure can be administered to an individual (e.g., a human) infected with RSV along with one or more additional therapeutic agents. The additional therapeutic agents can be administered to the infected individual (e.g., a human) simultaneously with the compounds of the present disclosure, or prior to or after administration of the compounds of the present disclosure.

[0164] In some embodiments, a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is provided for use in treating or preventing a RSV infection. In some embodiments, a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is provided for the manufacture of a medicament for treating or preventing a RSV infection.

[0165] As described more fully herein, the compounds of the present disclosure can be administered to an individual (e.g., a human) infected with RSV with one or more additional therapeutic agents. Additionally, in some embodiments, when used to treat or prevent RSV, the compounds of the present disclosure can be administered with an RSV combination drug, an RSV vaccine, an RSV DNA polymerase inhibitor, an immunomodulatory agent, a toll-like receptor (TLR) modulator, an interferon alpha receptor antagonist, or an anti-inflammatory drug. Ligands, hyaluronidase inhibitors, respiratory syncytial surface antigen inhibitors, cytotoxic T-lymphocyte-associated protein 4 (ipi4) inhibitors, cyclophilin inhibitors, RSV viral entry inhibitors, antisense oligonucleotides targeting viral mRNA, short interfering RNA (SMRNA) interfering RNA (siRNA) and ddRNAi endonuclease modulators, ribonucleotide reductase inhibitors, RSV E antigen inhibitors, covalently closed circular DNA (cccDNA) inhibitors, farnesoid X receptor antagonists chemokine antagonists, RSV antibodies, CCR2 chemokine antagonists, thymosin agonists, cytokines, nucleoprotein modulators, retinoic acid-inducible gene 1 stimulators, NOD2 stimulators, phosphatidylinositol 3-kinase (PI3K) inhibitors, indoleamine-2,3-dioxygenase (IDO) pathway inhibitors, PD-1 inhibitors, PD-L1 inhibitors, recombinant ... It may be administered with one or more (e.g., 1, 2, 3, 4 or more) additional therapeutic agents selected from the group consisting of synthase alpha-1 agonists, Bruton's tyrosine kinase (BTK) inhibitors, KDM inhibitors, RSV replication inhibitors, arginase inhibitors, and other RSV drugs. Picornaviridae

[0166] In some embodiments, the present disclosure provides a method of treating a Picornaviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof. Picornaviridae viruses are enteroviruses that cause a heterogeneous group of infections, including herpangina, aseptic meningitis, common cold-like syndrome (human rhinovirus infection), non-paralytic polio-like syndrome, epidemic pleurodynia (an acute, febrile, infectious illness that typically occurs during epidemics), hand, foot and mouth disease, pediatric and adult pancreatitis, and severe myocarditis. In some embodiments, the Picornaviridae virus infection is a human rhinovirus infection.

[0167] In some embodiments, the present disclosure provides a method for the manufacture of a medicament for treating a Picornaviridae virus infection in a human in need thereof, wherein a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is used. In some embodiments, the present disclosure provides a method for the manufacture of a medicament for the treatment of a Picornaviridae virus infection in a human, wherein a compound of the present disclosure, or a pharma- ceutically acceptable salt thereof, is used. In some embodiments, the Picornaviridae viral infection is a human rhinovirus infection.

[0168] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating a Picornaviridae virus infection in a human in need thereof, in some embodiments, the Picornaviridae virus infection is a human rhinovirus infection. Flaviviridae

[0169] In some embodiments, the disclosure provides a method of treating a Flaviviridae virus infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof. Exemplary Flaviviridae viruses include, but are not limited to, Dengue, Yellow Fever, West Nile, Zika, Japanese Encephalitis Virus, Hepatitis C (Hepatitis C, HCV), and Hepatitis B (Hepatitis B, HBV). In some embodiments, the Flaviviridae virus infection is a Dengue virus infection. In some embodiments, the Flaviviridae virus infection is a Yellow Fever virus infection. In some embodiments, the Flaviviridae virus infection is a West Nile virus infection. In some embodiments, the Flaviviridae virus infection is a Zika virus infection. In some embodiments, the Flaviviridae virus infection is a Japanese Encephalitis virus infection. In some embodiments, the Flaviviridae virus infection is a Hepatitis C virus infection. In some embodiments, the Flaviviridae virus infection is a Hepatitis B virus infection.

[0170] In some embodiments, the disclosure provides a method for the manufacture of a medicament for treating a Flaviviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharmaceutically acceptable salt thereof, is used. In some embodiments, the disclosure provides the use of a compound of the disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a Flaviviridae virus infection in a human. In some embodiments, the Flaviviridae virus infection is a Dengue virus infection. In some embodiments, the Flaviviridae virus infection is a Yellow Fever virus infection. In some embodiments, the Flaviviridae virus infection is a West Nile virus infection. In some embodiments, the Flaviviridae virus infection is a Zika virus infection. In some embodiments, the Flaviviridae virus infection is a Hepatitis C virus infection. In some embodiments, the Flaviviridae virus infection is a Hepatitis B virus infection.

[0171] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating a Flaviviridae viral infection in a human in need thereof. In some embodiments, the Flaviviridae viral infection is a Dengue virus infection. In some embodiments, the Flaviviridae viral infection is a Yellow Fever virus infection. In some embodiments, the Flaviviridae viral infection is a West Nile virus infection. In some embodiments, the Flaviviridae viral infection is a Zika virus infection. In some embodiments, the Flaviviridae viral infection is a Hepatitis C virus infection. In some embodiments, the Flaviviridae viral infection is a Hepatitis B virus infection. Filoviridae

[0172] In some embodiments, the present disclosure provides a method of treating a Filoviridae virus infection in a human in need thereof, comprising administering to the human a therapeutically effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof. Representative Filoviridae viruses include, but are not limited to, Ebola and Marburg. In some embodiments, the Filoviridae virus infection is an Ebola virus infection.

[0173] In some embodiments, the disclosure provides a method for the manufacture of a medicament for treating a Filoviridae virus infection in a human in need thereof, wherein a compound of the disclosure, or a pharmaceutically acceptable salt thereof, is used. In some embodiments, the disclosure provides the use of a compound of the disclosure, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a Filoviridae virus infection in a human. In some embodiments, the Filoviridae virus infection is an Ebola virus infection.

[0174] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating a Filoviridae virus infection in a human in need thereof, in some embodiments, the Filoviridae virus infection is an Ebola virus infection. VIII. Methods for Treating or Preventing Deterioration of Respiratory Conditions Due to Viral Infections

[0175] The compounds of formula I may also be used to treat or prevent exacerbations of respiratory conditions due to viral infections in humans in need thereof.

[0176] In some embodiments, the disclosure provides a method for treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, wherein the respiratory condition is chronic obstructive pulmonary disease. In some embodiments, the viral infection is caused by administration of a respiratory syncytial virus, a rhinovirus, or a metapneumovirus.

[0177] In some embodiments, the disclosure provides a method for treating or preventing a respiratory condition exacerbated by a viral infection in a human in need thereof, the method comprising administering to the human a therapeutically effective amount of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, wherein the respiratory condition is asthma. In some embodiments, the viral infection is caused by a respiratory syncytial virus, a rhinovirus, an enterovirus, or a metapneumovirus.

[0178] In some embodiments, the disclosure provides a method for the manufacture of a medicament for treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used, wherein the respiratory condition is chronic obstructive pulmonary disease. In some embodiments, the viral infection is caused by administration of a respiratory syncytial virus, a rhinovirus, or a metapneumovirus.

[0179] In some embodiments, the disclosure provides a method for the manufacture of a medicament for treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, wherein a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, is used, wherein the respiratory condition is asthma. In some embodiments, the viral infection is caused by a respiratory syncytial virus, a rhinovirus, an enterovirus, or a metapneumovirus. This is caused by.

[0180] In some embodiments, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a respiratory condition exacerbation due to a viral infection in a human, wherein the respiratory condition is chronic obstructive pulmonary disease. In some embodiments, the viral infection is caused by administration of a respiratory syncytial virus, a rhinovirus, or a metapneumovirus.

[0181] In some embodiments, the disclosure provides the use of a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a respiratory condition exacerbation due to a viral infection in a human, wherein the respiratory condition is asthma. In some embodiments, the viral infection is caused by a respiratory syncytial virus, a rhinovirus, an enterovirus, or a metapneumovirus.

[0182] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, wherein the respiratory condition is chronic obstructive pulmonary disease. In some embodiments, the viral infection is caused by administration of a respiratory syncytial virus, a rhinovirus, or a metapneumovirus.

[0183] In some embodiments, the disclosure provides a compound of the disclosure, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a respiratory condition exacerbated by a viral infection in a human in need thereof, wherein the respiratory condition is asthma. In some embodiments, the viral infection is caused by a respiratory syncytial virus, a rhinovirus, an enterovirus, or a metapneumovirus. EXAMPLES

[0184] IX. (Examples) Abbreviation Certain abbreviations and acronyms are used in describing the experimental details. While most of these will be understood by those of skill in the art, the following table contains a list of many of these abbreviations and acronyms. [Table 1]

[0185] Compounds and intermediates can be subjected to preparative HPLC (Phenomenex Gemini 10u C18 110Å AXIA 250×21.2mm column, 30-70% acetonitrile / water gradient with 0.1% TFA). Some compounds are obtained as TFA salts after this preparative HPLC process. A. Intermediates Intermediate 1. [ka]

[0186] Reactor 1 is charged with 3-O-benzyl-4-(hydroxymethyl)-1,2-O-isopropylidene-α-D-ribofuranose (125 g, 402 mmol, 1.0 equiv). THF (625 mL, 5 vol) is charged followed by benzyl bromide (106 mL, 2.2 equiv). The jacket is set to 0° C. T int Charge NaHMDS (40 wt% in THF, 450 mL, 2.2 equiv.) in such a way that the temperature is kept below 10° C. After addition is complete, set the jacket to 15° C. and stir for 60 min. Monitor the reaction by TLC (20% ethyl acetate in 80% hexanes) and stain with ceric ammonium molybdate (CAM). Set the jacket to 5° C. Dissolve acetic acid (70 mL, 2.5 equiv.) in water (1 L, 8 vol.). T intCharge the aqueous solution to the reaction in a manner that maintains the temperature below 15°C and allow the phases to separate. Drain the lower aqueous layer to Reactor 2. Concentrate the contents of Reactor 1 by approximately 50%. Charge MTBE (1.25 L, 10 vol) to Reactor 2. Stir for 15 minutes and allow the layers to separate. Drain the lower aqueous layer and discard. Charge the contents of Reactor 2 to Reactor 1. Charge 14% brine solution (1 L, 8 vol) to Reactor 1. Stir for 15 minutes and drain the lower aqueous layer. Concentrate the organics by approximately 50%. Coevaporate the contents with methanol (3 x 8 vol). Concentrate Intermediate 1 to approximately 4 vol and use directly in the next step. Intermediate 2. [ka]

[0187] Charge Reactor 1 containing crude intermediate 1 (197 g, 402 mmol, 1 equiv) with methanol (1 L, 5 vol), 4 M HCl in dioxane (120 mL, 1.2 equiv), and concentrated sulfuric acid (1.1 mL, 0.05 equiv). Stir at ambient temperature for 2 h. Monitor the reaction by TLC (30% ethyl acetate, 70% hexanes) and CAM stain. Slowly charge 5 M KOH solution until pH>7 (100 mL, 1.25 equiv). Concentrate the reaction mixture to approximately 2 volumes. Charge ethyl acetate (1 L, 5 vol). Charge water (1 L, 5 vol). Stir for 15 min. Drain the bottom aqueous layer into Reactor 2. Charge Reactor 2 with ethyl acetate (1 L, 5 vol) and stir for 15 min. Drain and discard the bottom aqueous layer. Charge the remaining Reactor 2 contents to Reactor 1. Concentrate the contents of reactor 1 to about 3 volumes. Charge MTBE (400 mL, 2 volumes) to reactor 1. Charge sodium sulfate (400 g, 2S) and stir for 15 minutes. Filter off solids and wash cake with MTBE (200 mL, 1 volume). Charge organics to reactor 1. Concentrate to about 3 volumes. Charge THF (400 mL, 2 volumes) and concentrate to about 3 volumes. Charge THF (400 mL, 2 volumes) and concentrate to about 3 volumes to obtain intermediate 2. Approximately R of 0.1 and 0.4 in 30% ethyl acetate, 70% hexanes. f . Intermediate 3. [ka]

[0188] Reactor 1 containing crude intermediate 2 (186 g, 402 mmol) is charged with THF (1 L, 5 vol) and benzyl bromide (60 mL, 1.25 eq). The jacket is set to 5° C. int Charge NaHMDS 40 wt% (245 mL, 1.25 equiv.) in such a way that the temperature is kept below 20° C. Set the jacket to 15° C. and stir for 60 min. Monitor the progress of the reaction by TLC (30% ethyl acetate, 70% hexane) and CAM stain. Set the jacket to 0° C. Take up acetic acid (46 mL, 2 equiv.) in water (1 L, 5 vol.). T int Charge the aqueous solution to reactor 1 in such a way that the R is kept below 15° C. Set the jacket to 15° C. and agitate for 15 minutes. Allow the phases to separate and drain the lower aqueous layer into reactor 2. Charge MTBE (1 L, 5 vol) to reactor 2 and agitate for 15 minutes. Concentrate reactor 1 by approximately 50%. Allow the phases to separate in reactor 2 and drain and discard the lower aqueous layer. Charge the contents of reactor 2 to reactor 1. Charge 14% brine solution (1 L, 5 vol). Agitate for 15 minutes. Drain and discard the lower aqueous layer. Obtain crude intermediate 3 (R of approximately 0.8 in 30% ethyl acetate, 70% hexanes) f ) to approximately 1 volume and use directly in the next step. Intermediate 4. [ka]

[0189] With the jacket set at 20° C., reactor 1 containing intermediate 3 (222 g, 401 mmol) is charged with water (222 mL, 1 Vol). int Charge TFA (667 mL, 3 vol) in such a way that the temperature is kept below 30° C. Stir at 20° C. for 24 h. Monitor by TLC (30% ethyl acetate, 70% hexanes) and CAM stain. Concentrate the contents of Reactor 1 to approximately 2 volumes (remove 550 mL of solvent). Charge MTBE (1.5 L, 7 vol). Set the jacket to 10° C. T intCharge with 5 M NaOH (600 mL, 7.5 volumes) until pH > 6, in a manner that keeps the temperature below 25 °C. Add 5 wt % NaHCO 3 Charge (1.1 L, 5 vol). Stir for 15 minutes. Drain and discard the bottom aqueous layer. Charge 14% brine solution (1.1 L, 5 vol). Stir for 15 minutes. Drain and discard the bottom aqueous layer. Concentrate the MTBE layer to approximately 4.5 vol and use directly in the next step. Intermediate 4 Approximately R of 0.5 in 30% Ethyl Acetate, 70% Hexane f . Intermediate 5. [ka]

[0190] Reactor 1, set at -5°C, containing crude intermediate 4 (216 g, 401 mmol) in 4.5 volumes of MTBE, is charged with TEMPO (0.6 g, 0.01 equiv.) and KBr (4.53 g, 0.1 equiv.). 2 HPO 4 * 3H 2 Dissolve 20O (87 g, 1 eq.) in water (1.5 vol.). Charge the reactor. int Charge 8.25% bleaching solution (425 mL, 1.35 equiv.) in such a way that the temperature is kept below 10° C. (approximately 50 min.). Set the jacket to 5° C. and stir for 1 h. Monitor the reaction by TLC (30% ethyl acetate, 70% hexanes) and CAM stain. Dissolve sodium thiosulfate (30 g, 0.5 equiv.) in water (310 mL, 1.5 vol.). intCharge Reactor 1 in a manner to keep temperature below 15°C. Set jacket to 15°C. Stir for 15 minutes. Test for bleach consumption using KI strips. Drain and discard bottom aqueous layer. Charge 1S sodium sulfate and stir for 15 minutes. Filter off solids and wash cake with 1 volume of MTBE. Concentrate to an oil and purify by silica gel chromatography using 25S silica 0-50% ethyl acetate in hexanes over 45 minutes to give 3R,4S)-3,4-bis(benzyloxy)-5,5-bis((benzyloxy)methyl)dihydrofuran-2(3H)-one (Intermediate 5). 1 H NMR (400MHz, DMSO-d 6 )δ 7.40-7.24(m,18H),7.24-7.19(m,2H),4.87-4.74(m,2H),4.74-4.68(m,2H),4.61-4.39(m,6H),3.83-3.66(m,4H). Intermediate 6. [ka]

[0191] Into reactor 1, intermediate 7 (50.83 g, 195.5 mmol, 1.11 equiv.) followed by THF (5 vol.). The jacket of reactor 1 is set to 0° C. Into reactor 2, intermediate 5 (94.84 g, 176.1 mmol, 1.0 equiv.), THF (5 vol.), and 0.6 M LaCl in THF (290 mL, 170 mmol, 1 equiv.) 3 * Reactor 2 is stirred at ambient temperature for 30 minutes. Reactor 1 is charged with T int Charge TMS-Cl (25.1 mL, 197.2 mmol, 1.12 equiv.) in such a way that the T is kept below 5 °C. Stir for 15 min. Set the jacket of Reactor 1 to -10 °C and int Charge 2.0 M PhMgCl in THF (185 mL, 370 mmol, 2.1 equiv.) in such a way that the temperature is kept below 0° C. Stir for 15 min. Set the jackets of reactors 1 and 2 to −20° C. Add T intCharge 2.0 M iPrMgCl in THF (100 mL, 199 mmol, 1.13 equiv.) in such a way that the temperature is kept below -15°C. Stir at -15°C for 15 min. int Transfer the contents of Reactor 1 to Reactor 2 in a manner that maintains the temperature below -15°C. Stir at -15°C for 60 minutes. int Charge Reactor 2 with acetic acid (66 mL, 1145 mmol, 6.5 equiv) in water (5 vol) in a manner that keeps the temperature below 20° C. Set the jacket of Reactor 2 to 20° C. Stir for 15 min. Separate the layers. Charge Reactor 2 with isopropyl acetate (4 vol) and water (3 vol). Stir for 5 min. Separate the layers and wash the organics with 0.5 M HCl (2 vol). Separate the layers and wash the organics with 2×5 vol of 10 wt% KHCO 3 (aqueous). Wash the organics with 14% brine solution (5 vol). Separate the layers and dry the organics over sodium sulfate. Filter off the solids and concentrate the liquor to give intermediate 6 which is carried onto the next step. UPLC / MS R = 3.759 and 3.825 min, MS m / z = 673.33 [M+1]; UPLC / MS system: Waters Acquity H class Column: Waters Acquity BEH 1.7μM C18 2.1×50mm Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid Gradient: 2% ACN 0-0.5 min. 2% ACN-98% ACN 0.5-3.0 min. 98% ACN 3-4 min. 98% ACN-2% ACN 4-4.5 min. 2% ACN 4.5-5 min. Flow rate: 0.5mL / min Mass range: 100-1200 Alternate synthesis of intermediate 6. [ka]

[0192] Into reactor 1, intermediate 7 (5.90 g, 22.7 mmol, 1.11 equiv.) was added, followed by THF (5 vol.). The jacket of reactor 1 was set to 0° C. Into reactor 2, anhydrous NdCl 3 (5.1 g, 20.4 mmol, 1 equiv), TBACl (6.1 g, 22.1 mmol, 1.08 equiv), and THF (10 vol). Set the jacket of reactor 2 to 90° C. Distill off approximately 50% of the THF and azeotropically dry the contents. Charge Intermediate 5 (11 g, 20.4 mmol, 1.0 equiv) to reactor 2 and stir at ambient temperature for 30 minutes. Add Reactor 1 with T int Charge TMS-Cl (2.9 mL, 22.9 mmol, 1.12 equiv.) in such a way that the T is kept below 5° C. Stir for 15 min. Set the jacket of Reactor 1 to −10° C. and int Charge 2.0 M PhMgCl in THF (22.2 mL, 44.3 mmol, 2.1 equiv.) in such a way that the temperature is kept below 0° C. Stir for 15 min. Set the jackets of reactors 1 and 2 to −20° C. Add T int Charge 2.0 M iPrMgCl in THF (11.5 mL, 199 mmol, 1.13 equiv.) in such a way that the temperature is kept below -15°C. Stir at -15°C for 15 min. int Transfer the contents of Reactor 1 to Reactor 2 in a manner that maintains the temperature below -15°C. Stir at -15°C for 60 minutes. int Charge Reactor 2 with acetic acid (66 mL, 1145 mmol, 6.5 equiv) in water (5 vol) in a manner that keeps the temperature below 20° C. Set the jacket of Reactor 2 to 20° C. Stir for 15 min. Separate the layers. Charge Reactor 2 with isopropyl acetate (4 vol) and water (3 vol). Stir for 5 min. Separate the layers and wash the organics with 0.5 M HCl (2 vol). Separate the layers and wash the organics with 2×5 vol of 10 wt% KHCO 3 (aqueous). Wash the organics with 14% brine solution (5 vol). Separate the layers and dry the organics over sodium sulfate. Filter off the solids and concentrate the liquor to give intermediate 6 which is carried onto the next step. UPLC / MS R = 3.759 and 3.825 min, MS m / z = 673.33 [M+1] UPLC / MS system: Waters Acquity H class Column: Waters Acquity BEH 1.7μM C18 2.1×50mm Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid Gradient: 2% ACN 0-0.5 min. 2% ACN-98% ACN 0.5-3.0 min. 98% ACN 3-4 min. 98% ACN-2% ACN 4-4.5 min. 2% ACN 4.5-5 min. Flow rate: 0.5mL / min Mass range: 100-1200 Intermediate 8. [ka]

[0193] A reactor is charged with intermediate 6 (approximately 118 g, 176 mmol) in DCM (10 vol). The jacket is set to -20°C. Triethylsilane (73 mL, 456 mmol, 2.6 equiv.) is charged. int Charge 46.5 wt % boron trifluoride in diethyl ether (72 mL, 263.1 mmol, 1.5 equiv.) in such a way that the T is kept below -15 °C. Stir for 30 min. Set the jacket to 0 °C. int Maintain temperature below 20℃ Charge 5M NaOH (175 mL, 877 mmol, 5 vol) in a manner that allows the jacket to warm to 20° C. Charge water (10 vol). Separate the layers. Concentrate the organic layer. Back extract the aqueous layer with ethyl acetate (2×5 vol). Combine the organics and wash with 14% brine (8 vol). Dry the organics over sodium sulfate, filter and concentrate. Isolate Intermediate 8 by silica gel chromatography (50-100% ethyl acetate in hexanes). 1 H NMR (400MHz, DMSO-d 6)δ 7.83(s,1H),7.71(brs,2H),7.37-7.14(m,20H),6.83(d,J=4.5Hz,1H),6.61(d,J=4.4Hz,1H),5.47(d,J=7.0Hz, 1H),4.68(d,J=11.6Hz,1H),4.61-4.43(m,8H),4.34(d,J=4.8Hz,1H),3.81-3.64(m,3H),3.62(d,J=10.0Hz,1H). UPLC / MS R =3.919 min, MS m / z=657.32[M+1] UPLC / MS system: Waters Acquity H class Column: Waters Acquity BEH 1.7μM C18 2.1×50mm Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid Gradient: 2% ACN 0-0.5 min. 2% ACN-98% ACN 0.5-3.0 min. 98% ACN 3-4 min. 98% ACN-2% ACN 4-4.5 min. 2% ACN 4.5-5 min. Flow rate: 0.5mL / min Mass range: 100-1200 Intermediate 9. [ka]

[0194] Charge a nitrogen purged round bottom flask with intermediate 8 (21.7 g, 33 mmol, 1 equiv). Charge with THF (3 vol), 2,2-dimethoxypropane (3 vol), and pTsOH (6.6 g, 34.6 mmol, 1.05 equiv). Cool in a dry ice bath. Charge with 10% Pd / C. Evacuate and backfill with hydrogen three times. Stir at ambient temperature and pressure. Saturated NaHCO 3 (aqueous) to pH>7. Filter off the catalyst and wash the cake with methanol (2.5 vol). Partition between ethyl acetate (10 vol) and brine (10 vol). Separate the layers and dry the organics over sodium sulfate. Filter off the solids and concentrate to give intermediate 9 which is carried on to the next step. UPLC / Ms t R =2.580 min, MS m / z=477.14[M+1] UPLC / MS system: Waters Acquity H class Column: Waters Acquity BEH 1.7μM C18 2.1×50mm Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid Gradient: 2% ACN 0-0.5 min. 2% ACN-98% ACN 0.5-3.0 min. 98% ACN 3-4 min. 98% ACN-2% ACN 4-4.5 min. 2% ACN 4.5-5 min. Flow rate: 0.5mL / min Mass range: 100-1200 Intermediate 10. [ka]

[0195] A round bottom flask is charged with intermediate 9 (12.3 g, 32.7 mmol, 1 equiv), THF (10 vol), and di-tert-butyl-dicarbonate (14.4 g, 65.4 mmol, 2.0 equiv). DMAP (10.1 g, 81.7 mmol, 2.5 equiv) is charged in small portions to minimize outgassing and exotherm. Stir for 60 min to produce a mixture of mono and bis-Boc. Concentrate the reaction by approximately 50%. Charge with MTBE (10 vol) and 2.0 M HCl (3.5 vol). Separate the layers. Back extract the aqueous solution with ethyl acetate (10 vol). Combine the organics and wash with saturated NaHCO 3 (aqueous). Concentrate organics. Charge crude mixture with methanol (10 vol) followed by KOH (3.67 g, 2.0 equiv). Stir until conversion of bis-Boc to mono-Boc. Concentrate reaction. Partition between ethyl acetate (10 vol) and water (10 vol). Separate layers and concentrate. Charge crude with methanol (8 vol) followed by pTsOH (6.5 g, 34.2 mmol, 1.05 equiv). Stir at ambient temperature. 5.25% NaHCO 3Quench with (aqueous) (80 mL, 52 mmol, 1.5 equiv). Concentrate about 25% and stir overnight. Filter off the solids and wash the cake with MTBE (8 vol). Dry in a vacuum oven to give intermediate 10. 1 H NMR (400MHz, DMSO-d 6 )δ 10.45(s,1H),8.20(s,1H),7.19(d,J=4.3Hz,1H),6.95(d,J=4.7Hz,1H),5.35(d,J=5.2Hz,1H),5.06(t,J=5.7Hz ,1H),4.79-4.74(m,2H),4.45(t,J=5.8Hz,1H),3.73-3.46(m,3H),3.40-3.30(m,1H),1.50(s,12H),1.27(s,3H). UPLC / MS R =2.767 min, MS m / z=437.17[M+1] UPLC / MS system: Waters Acquity H class Column: Waters Acquity BEH 1.7μM C18 2.1×50mm Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid Gradient: 2% ACN 0-0.5 min. 2% ACN-98% ACN 0.5-3.0 min. 98% ACN 3-4 min. 98% ACN-2% ACN 4-4.5 min. 2% ACN 4.5-5 min. Flow rate: 0.5mL / min Mass range: 100-1200 Intermediate 11. (3R,4R,5R)-2-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-3,4-bis(benzyloxy)-5-((benzyloxy)methyl)tetrahydrofuran-2-ol [ka]

[0196] The product was prepared according to WO 2015 / 069939. For example, pages 43-45 of WO 2015 / 069939 provide a process for preparing this compound (identified as compound 1d in WO 2015 / 069939). Alternatively, it was prepared as follows. [ka]

[0197] Retreat curved overhead stirrer, thermocouple, and N 2 Anhydrous NdCl was added to a cylindrical reactor equipped with a bubbler. 3 (60.00g, 239mol, 1.00 equivalent), n-Bu 4 NCl (71.51 g, 239 mmol, 1.0 equiv.) and THF (900 g). The resulting mixture was heated to 100° C. with a jacket temperature of 90° C. 2 Concentrated to approximately 450 mL under a pad at ambient temperature. THF (500 g) was charged and distillation was repeated (2 times). The mixture was cooled to 22° C. and charged with intermediate 12 ((3R,4R,5R)-3,4-bis(benzyloxy)-5-((benzyloxy)methyl)dihydrofuran-2(3H)-one) (100.02 g, 239 mmol, 1.00 equiv). After 30 min, the mixture was cooled to −20° C. and held. In a separate reaction flask, iodopyrrolotriazine intermediate 7 (68.52 g, 264 mmol, 1.10 equiv) and THF (601 g) were combined and cooled to 0° C. TMSCl (28.64 g, 264 mmol, 1.10 equiv) was added slowly and after approximately 30 min, the mixture was cooled to 10° C. PhMgCl (2.0 M in THF, 270.00 g, 5.18 mmol, 2.17 equiv.) was added slowly and the mixture was stirred for about 30 min and cooled to -20 °C. i-PrMgCl (2.0 M in THF, 131.13 g, 269 mmol, 1.13 equiv.) was added slowly. After about 2 h, the Grignard reaction mixture was converted to lactone / NdCl via cannula. 3 / nBu 4NCl / THF mixture and the mixture was stirred at about 20° C. After about 16 h, a solution of acetic acid (100 g) in water (440 g) was added and the mixture was allowed to warm to 22° C. i PrOAc (331 g) was added and the layers were separated. The organic layer was diluted with 10% KHCO 3 The organic layer was concentrated to approximately 450 mL and washed with 10% NaCl(aq) (2×500 g) and 10% NaCl(aq) (500 g). i PrOAc (870 g) was charged. The organic mixture was washed with water (2×500 g) and concentrated to approximately 450 mL. i PrOAc (435 g) was charged and the mixture was concentrated to approximately 450 mL. The mixture was filtered and the residue was concentrated to 129 g of i The mixture was cooled to 0° C. and rinsed forward with PrOAc. The filtrate was concentrated to about 250 mL, MTBE (549 g) was charged, and the mixture was adjusted to 22° C. Seed crystals (0.15 g) were charged, followed by n-heptane (230 mL), and the mixture was cooled to 0° C. The solid was isolated by filtration and rinsed forward with a MTBE / n-heptane mixture (113 g / 30 g). The resulting solid was dried under vacuum at 35° C. to give intermediate 11 (yield 79% and LC purity 99.92%). Intermediate 13. (3aS,4R,6S,6aS)-6-(4-aminopyrrolo[2,1-f [1,2,4]triazin-7-yl)-4-(((tert-butyldimethylsilyl)oxy)methyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxole-4-carbonitrile [ka]

[0198] The product was prepared according to WO 2015 / 069939. For example, pages 127-138 of WO 2015 / 069939 provide a process for preparing this compound (identified as compound 14k in WO 2015 / 069939).

[0199] Alternatively, intermediate 10 was prepared as described above and then converted to intermediate 13 as described in WO 2015 / 069939 (conversion of compound 14f in WO 2015 / 069939 to compound 14k in WO 2015 / 069939 as described on pages 133-138 of WO 2015 / 069939).

[0200] Alternatively, intermediate 11 was prepared as described above and then converted to intermediate 13 as described in WO 2015 / 069939 (conversion of compound 1d in WO 2015 / 069939 to compound 14k in WO 2015 / 069939, as described on pages 45-46 and 127-138 of WO 2015 / 069939). Intermediate 14. (3aS,4R,6S,6aS)-6-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-4-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxole-4-carbonitrile [ka]

[0201] Intermediate 13 (8.41 g, 18.87 mmol) was taken up in THF (100 mL). TBAF 1.0 M in THF (28.31 mL, 28.31 mmol) was added in one portion at ambient temperature. Stirred at ambient temperature for 10 min. The reaction was determined to be complete by LCMS. The reaction mixture was quenched with water and the organics were removed under reduced pressure. The crude was partitioned between EtOAc and brine. The layers were separated and the aqueous layer was washed with EtOAc. The organics were combined and dried over sodium sulfate. The solids were filtered off and the solvent was removed under reduced pressure. The crude was purified by silica gel chromatography on a 120 g column, CH 2 Cl 2 0-10% CH 3 Purification by OH gave the product. LC / MS:t R= 0.76 min, MS m / z = 332.14 [M+1]; LC system: Thermo Accela 1250 UHPLC. MS system: Thermo LCQ Fleet; Column: Kinetex 2.6μ XB-C18 100A, 50 x 3.00 mm. Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid. Gradient: 0-2.4 min 2-100% ACN, 2.4-2.80 min 100% ACN, 2.8-2.85 min 100%-2% ACN, 2.85-3.0 min 2% ACN at 1.8 mL / min. 1 H NMR (400MHz, DMSO-d 6 )δ 7.87-7.80(m,3H),6.85(d,J=4.5Hz,1H),6.82(d,J=4.5Hz,1H),5.74(t,J=5.8Hz,1H),5.52(d,J=4.2Hz,1H ),5.24(dd,J=6.8,4.2Hz,1H),4.92(d,J=6.8Hz,1H),3.65(dd,J=6.1,1.7Hz,2H),1.61(s,3H),1.33(s,3H). Intermediate 15. (S)-Cyclohexyl 2-aminopropanoate hydrochloride [ka]

[0202] To a mixture of L-alanine (5 g, 56.12 mmol) and cyclohexanol (56 g, 561 mmol) was added TMSCl (20 mL). The resulting mixture was stirred at about 70° C. for about 15 hours, concentrated in vacuo at about 80° C., coevaporated with toluene, dissolved in hexane, and stirred at about room temperature during which a solid precipitated. The solid was collected by filtration, and the filter cake was washed several times with 5% EtOAc in hexane, and dried under high vacuum for about 15 hours to obtain the product. 1 H NMR(400MHz,chloroform-d)δ 8.76(s,3H),4.85(tt,J=8.7,3.8Hz,1H),4.17(p,J=6.5Hz,1H),1.84(dd, J=9.9,5.5Hz,2H),1.70(d,J=7.3Hz,5H),1.57-1.42(m,3H),1.32(m,3H). Intermediate 16. (2S)-Cyclohexyl 2-(((4-nitrophenoxy)(phenoxy)phosphoryl)amino)propanoate [ka]

[0203] Intermediate 15 (3.4 g, 16.37 mmol) was dissolved in methylene chloride (45 mL), cooled to -78 °C, and phenyl dichlorophosphate (2.45 mL, 16.37 mmol) was added quickly. Triethylamine (4.54 mL, 32.74 mmol) was added over 60 min at -78 °C, followed by 4-nitrophenol (2277 mg, 16.37 mmol) in one portion. Triethylamine (2.27 mL, 16.37 mmol) was added over 60 min at -78 °C. The resulting mixture was stirred at -78 °C for 2 h, diluted with methylene chloride (100 mL), washed twice with water and with brine, dried over sodium sulfate, and concentrated in vacuo. The residue was purified by silica gel column chromatography (0-20% EtOAc in hexanes) to give the product. 1 H NMR(400MHz,chloroform-d)δ 8.22(m,2H),7.46-7.30(m,4H),7.29-7.09(m,3H),4.76(m,1H),4.20-4.0 2(m,1H),3.92(m,1H),1.87-1.64(m,4H),1.54(m,2H),1.46-1.18(m,7H). 31 P NMR (162 MHz, chloroform-d) δ -2.94, -3.00. MS m / z = 449 (M+H) + . B. Compound Example 1. (2S)-Cyclohexyl 2-(((((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano Preparation of 3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)amino)propanoate (formula Ia) [ka]

[0204] A mixture of intermediate 14 (99 mg, 0.30 mmol), intermediate 16 (201 mg, 0.45 mmol), and MgCl in DMF (4 mL) was added. 2 (43 mg, 0.45 mmol) was added dropwise to N,N-diisopropylethylamine (0.13 mL, 0.75 mmol) at room temperature. The resulting mixture was stirred at room temperature for 15 h and purified by preparative HPLC (Phenominex Synergi 4u Hydro-RR 80 Å 150×30 mm column, 10-100% acetonitrile / water gradient) to give the intermediate, which was dissolved in ACN (3 mL) and c-HCl (0.1 mL) was added. The resulting mixture was stirred at 50 °C for 2 h, cooled, and purified by preparative HPLC (Phenominex Synergi 4u Hydro-RR 80 Å 150×30 mm column, 10-80% acetonitrile / water gradient) to give the product. 1 H NMR (400MHz, methanol-d4) δ 7.80(s,0.5H),7.78(s,0.5H),7.42-7.05(m,5H),6.84(m,1H),6.73(m,1H),5.50(m,1 H),4.64(m,2H),4.57-4.25(m,3H),3.86(m,1H),1.91-1.61(m,4H),1.61-1.09(m,9H). 31 P NMR (162 MHz, methanol-d4) δ 3.3. MS m / z=601 (M+H) + .

[0205] Separation of diastereomers. The products were purified by chiral preparative HPLC (Chiralpak IA, 150×4.6 mm, 70% heptane, 30% ethanol). Example 2. Preparation of cyclohexyl ((R)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate (Formula Ib) [ka]

[0206] First eluting diastereomer of Example 1: 1 H NMR (400MHz, methanol-d 4 )δ 7.78(s,1H),7.34-7.23(m,2H),7.19-7.10(m,3H),6.85(d,J=4.5Hz,1H ),6.73(d,J=4.5Hz,1H),5.51(d,J=5.0Hz,1H),4.69(td,J=8.8,4.2Hz, 1H),4.62(t,J=5.3Hz,1H),4.53-4.44(m,2H),4.36(dd,J=10.9,5.2Hz, 1H), 3.86 (dq, J=9.4, 7.1Hz, 1H), 1.85-1.62 (m, 4H), 1.58-1.20 (m, 9H). 31 P NMR (162MHz, methanol-d 4 ) δ 3.31. Example 3. Cyclohexyl ((S)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4 Preparation of (dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate (formula I) [ka]

[0207] Second eluting diastereomer of Example 1: 1 H NMR (400MHz, methanol-d 4 )δ 7.80(s,1H),7.37-7.27(m,2H),7.26-7.13(m,3H),6.84(d,J=4.5Hz,1H),6.73(d,J=4.5Hz,1H),5.49(d,J=5.0Hz,1H) ,4.71-4.56(m,2H),4.46(d,J=5.6Hz,1H),4.45-4.30(m,2H),3.97-3.77(m,1H),1.80-1.61(m,4H),1.55-1.21(m,9H). 31P NMR (162MHz, methanol-d 4 ) δ 3.31. Example 4. Synthesis of isopropyl ((((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate (Compound 3). [ka]

[0208] (2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrofuran-2-carbonitrile was prepared according to WO 2015 / 069939. For example, pages 43-54 of WO 2015 / 069939 provide a process for preparing the compound identified as Compound 1 in WO 2015 / 069939.

[0209] (2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrofuran-2-carbonitrile (0.149 g, 0.512 mmol) was taken up in anhydrous THF and concentrated. The resulting residue was placed under high vacuum for 1.5 hours. The residue was then dissolved in NMP (4 mL) and then THF (1 mL) was added. The solution was cooled in an ice bath and a 1 M solution of tert-BuMgCl in THF (0.767 mL, 0.767 mmol) was added, causing a white precipitate to form. After 5 min, the cold bath was removed and the mixture was sonicated to disperse the precipitated solids and the reaction was stirred at room temperature for 10 min. The intermediate isopropyl((4-nitrophenoxy)(phenoxy)phosphoryl)-L-alaninate (0.251 g, 0.614 mmol; WO 2011 / 123668) in THF (0.9 mL) was added. The reaction was stirred at room temperature and progress was monitored by LC / MS. After 1 h 45 min the reaction was cooled in an ice bath and quenched by the addition of glacial AcOH (0.25 mL). The ice bath was removed and stirring was continued at room temperature for 5 min. The volatiles were removed by evaporation and the product was It was isolated from the residue by HPLC. 1 H NMR (400MHz, methanol-d 4 ,asterisk( * Chemical shifts marked with ) indicate the shifts of the relevant protons present on the second isomer) δ 7.81 (s, 0.41H), 7.79 * (s,0.59H),7.36-7.12(m,5H),6.85(m,1H),6.74(m,1H),5.50(m,1H),4.97-4.85 (m,1H),4.63(m,1H),4.54-4.32(m,3H),3.85(m,1H),1.25(d,J=7.1Hz,2H),1.20 * (d,J=6.3Hz,4H),1.16(t,J=6.3Hz,3H). 31 P NMR (162MHz, methanol-d 4 )δ 3.30(s). MS m / z=561.03[M+1]. Example 5. Synthesis of (S)-isopropyl 2-(((S)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)amino)propanoate (Compound 4).

[0210] (2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrofuran-2-carbonitrile was prepared as described in Example 4.

[0211] Isopropyl ((S)-(4-nitrophenoxy)(phenoxy)phosphoryl)-L-alaninate was prepared as described in Cho et al., J. Med. Chem. 2014, 57, 1812-1825.

[0212] (2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrofuran-2-carbonitrile (50 mg, 0.172 mmol) and isopropyl((S)-(4-nitrophenoxy)(phenoxy)phosphoryl)-L-alaninate (84 mg, 0.206 mmol) were mixed in anhydrous N,N-dimethylformamide (2 mL). Magnesium chloride (36 mg, 0.378 mmol) was added in one portion. The reaction mixture was heated at 50° C. N,N-diisopropylethylamine (75 μL, 0.43 mmol) was added and the reaction was stirred at 50° C. for 4.5 hours. The reaction mixture was cooled, diluted with ethyl acetate (30 mL) and washed with 5% aqueous citric acid (10 mL) followed by brine (10 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. 2 Column chromatography (4g SiO 2 Purification by Combiflash® HP Gold Column, 0-2-5% methanol / dichloromethane) gave the product.1 H NMR (400MHz, methanol-d 4 )δ 7.79(s,1H),7.36-7.25(m,2H),7.25-7.12(m,3H),6.84(d,J=4.5Hz,1 H),6.73(d,J=4.5Hz,1H),5.49(d,J=5.1Hz,1H),4.91-4.84(m,1H),4.6 2(dd,J=5.6,5.0Hz,1H),4.47(d,J=5.6Hz,1H),4.45-4.30(m,2H),3.85(dq,J=10.0,7.1Hz,1H),1.25(d,J=7.2Hz,3H),1.15(t,J=6.4Hz,6H). 31 P NMR (162MHz, methanol-d 4 )δ 3.31. MS m / z=561.0[M+1],559.0[M-1]. Example 6. Synthesis of (2S)-pentan-3-yl 2-(((((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)amino)propanoate (Compound 5). [ka]

[0213] (S)-Pentan-3-yl 2-aminopropanoate hydrochloride. To a mixture of L-alaninate (5 g, 56.12 mmol) and 3-hydroxypentane (50 mL) was added TMSCl (20 mL). The resulting mixture was stirred at 70° C. for 15 h and concentrated on a rotary evaporator at 80° C. The resulting solid was triturated with 5% EtOAc in hexanes, filtered, washed several times with 5% EtOAc in hexanes, and dried under high vacuum overnight to give the intermediate. 1 H NMR (400 MHz, chloroform-d) δ 8.79 (s, 3H), 4.83 (p, J = 6.2 Hz, 1H), 4.19 (p, J = 6.5 Hz, 1H), 1.72 (d, J = 7.2 Hz, 3H), 1.67-1.52 (m, 4H), 0.88 (td, J = 7.5, 1.7 Hz, 6H). [ka]

[0214] (2S)-Pentan-3-yl 2-(((4-nitrophenoxy)(phenoxy)phosphoryl)amino)propanoate. (S)-Pentan-3-yl 2-aminopropanoate hydrochloride (1.00 g, 5.11 mmol) was suspended in methylene chloride (15 mL) and cooled to -78°C, and phenyl dichlorophosphate (0.76 mL, 5.11 mmol) was added quickly. Triethylamine (1.42 mL, 10.22 mmol) was added over 30 min at -78°C, and the resulting mixture was stirred at -78°C for 30 min. 4-Nitrophenol (711 mg, 5.11 mmol) was then added in one portion, followed by triethylamine (0.71 mL, 5.11 mmol) over 30 min at -78°C. The mixture was stirred at -78°C for 30 min, washed with water and brine, dried over sodium sulfate, and concentrated in vacuo. The residue was purified by silica gel column chromatography (0-20% EtOAc in hexanes) to give (2S)-pentan-3-yl 2-(((4-nitrophenoxy)(phenoxy)phosphoryl)amino)propanoate. 1 H NMR (400 MHz, chloroform-d) δ 8.22 (m, 2H), 7.46-7.30 (m, 4H), 7.31-7.14 (m, 3H), 4.78 (m, 1H), 4.27-4.04 (m, 1H), 3.98-3.77 (m, 1H), 1.72-1.45 (m, 4H), 1.42 (m, 3H), 0.84 (m, 6H). 31 P NMR (162 MHz, chloroform-d) δ -2.99, -3.06. MS m / z = 437 (M+H) + . [ka]

[0215] (2S)-Pentan-3-yl 2-(((((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3, 4-Dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)amino)propanoate. Mix intermediate 14 (66 mg, 0.30 mmol), (2S)-pentan-3-yl 2-(((4-nitrophenoxy)(phenoxy)phosphoryl)amino)propanoate (170 mg, 0.39 mmol), and MgCl in DMF (3 mL). 2 (28 mg, 0.30 mmol) was added dropwise to N,N-diisopropylethylamine (0.087 mL, 0.50 mmol) at room temperature. The resulting mixture was stirred at 60 °C for 15 h and purified by HPLC (0-100% ACN in water) to give an intermediate, which was dissolved in ACN (3 mL) and C-HCl (0.1 mL) was added. The resulting mixture was stirred at 50 °C for 2 h and purified by preparative HPLC (Phenominex Synergi 4u Purification by Hydro-RR 80 Å 150×30 mm column, 5-100% acetonitrile / water gradient) gave the product. 1 H NMR(400MHz, methanol-d4)δ 7.79(m,1H),7.36-7.07(m,5H),6.84(m,1H),6.73(m,1H),5.50(m,1H),4.76-4.59(m,2H),4. 54-4.40(m,2H),4.34(m,1H),3.89(m,1H),1.63-1.42(m,4H),1.27(m,3H),0.91-0.75(m,6H). 31 P NMR (162MHz, methanol-d4) δ 3.37, 3.29. MS m / z=589 (M+H) + . Example 7. Synthesis of 2-ethylbutyl ((S)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)alaninate (compound 6). [ka]

[0216] 2-Ethylbutyl ((S)-(4-nitrophenoxy)(phenoxy)(phosphoryl)-L-alaninate was prepared as described in WO 2016 / 069825.

[0217] To a mixture of Intermediate 14 (700 mg, 2.113 mmol), 2-ethylbutyl((S)-(4-nitrophenoxy)(phenoxy)phosphoryl)-L-alaninate (998 mg, 2.218 mmol), and magnesium chloride (302 mg, 3.169 mmol) was added tetrahydrofuran (8.5 mL) at room temperature, followed by N,N-diisopropylethylamine (0.92 mL, 5.282 mmol). The resulting mixture was stirred at 50° C. for 3 h. The reaction mixture was then concentrated under reduced pressure and the resulting residue was diluted with saturated sodium chloride solution and dichloromethane. The layers were split and the organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude residue was dissolved in SiO 2 Column chromatography (80g SiO 2 Purification was performed by Combiflash® HP Gold Column, 100% dichloromethane - 14% methanol in dichloromethane as eluent). The resulting pure material was dissolved in anhydrous acetonitrile (10 mL) and cooled in an ice bath, followed by dropwise addition of concentrated hydrochloric acid (4 mL, 48 mmol). The reaction mixture was stirred at room temperature for 1 h. After 1 h, the reaction mixture was cooled in an ice bath and diluted with water. The solution was neutralized with 3N sodium hydroxide and extracted with dichloromethane. The organic layer was separated, dried over sodium sulfate, filtered and concentrated. The resulting residue was purified by SiO 2 Column chromatography (40g SiO 2 Purification by Combiflash® HP Gold Column, 100% dichloromethane-20% methanol in dichloromethane) gave the product. 1 H NMR(400MHz, methanol-d4)δ 7.80(s,1H),7.38-7.29(m,2H),7.27-7.13(m,3H),6.84(d,J=4.5Hz,1H),6.74(d,J=4.5Hz,1H),5.49(d,J=5.0Hz,1H),4.61(t,J =5.3Hz,1H),4.49-4.29(m,3H),4.04-3.82(m,3H),1.43(dq,J=12.5,6.1Hz,1H),1.37-1.23(m,7H),0.84(td,J=7.5,1.1Hz,6H). 31 P NMR (162 MHz, acetonitrile-d3) δ 2.73. MS m / z = 603 [M+1]. Example 8. Synthesis of 2-ethylbutyl ((R)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate (compound 7). [ka]

[0218] This compound was prepared by resolution of the Sp and Rp diastereomers of Example 34 from WO 2015 / 069939. Example 34 from WO 2015 / 069939 was purified by chiral preparative SFC (Chiralpak AD-H, 30% isocratic ethanol) to compound 7 as the first eluting diastereomer of Example 34 from WO 2015 / 069939: 1 H NMR (400MHz, methanol-d 4)δ 7.78(s,1H),7.32-7.24(m,2H),7.19-7.10(m,3H),6.84(d,J=4.5Hz,1H),6.72(d,J=4.5Hz,1H),5.51(d,J=5.0Hz,1H),4.63(t ,J=5.3Hz,1H),4.54-4.43(m,2H),4.36(m,1H),4.07-3.84(m,3H),1.53-1.42(m,1H),1.38-1.24(m,7H),0.86(t,J=7.5Hz,6H). 31 P NMR (162MHz, methanol-d 4 ) δ 3.26(s). HPLC:t R = 5.068 min; HPLC system: Agilent 1290 II; Column: Phenomenex Kinetex C18, 2.6u 110A, 100 x 4.6 mm; Solvents: A: water with 0.1% TFA, B: acetonitrile with 0.1% TFA; Gradient: 2 to 98% B with an 8.5 min gradient at 1.5 mL / min. Example 9. Synthesis of ethyl ((S)-(((2R,3S,4R,5S)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-2-cyano-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-alaninate (Compound 8). Ethyl ((S)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate [ka]

[0219] L-Alanine ethyl ester-HCl (631 mg, 2.46 mL) in DCM (15 mL) To a solution of 1.5 mmol of phenylphosphorodichloridate (0.368 mL, 2.465 mmol) was added in one portion at -78 °C and triethylamine (0.68 mL, 4.93 mmol) was added dropwise over 5 min at -78 °C. The resulting mixture was stirred for 30 min after removal of the dry ice bath and then cooled to -78 °C. Pentafluorophenol (454 mg, 2.465 mmol) was added in one portion and triethylamine (0.34 mL, 2.465 mmol) was added over 5 min at -78 °C. The resulting mixture was stirred for 1 h after removal of the dry ice bath and then diluted with DCM, washed with brine, concentrated in vacuo and the resulting residue was purified by silica gel column chromatography (0-60% EtOAc in hexanes) to give a diastereomeric mixture to which diisopropyl ether (4 mL) was added. The suspension was sonicated and filtered. The filter cake was 1 H NMR showed it was a 3:1 ratio mixture. Diisopropyl ether (5 mL) was added to the filter cake and the suspension was heated at 70 °C until a clear solution. When the heating bath was removed, needle-like crystals began to form, after 10 min the mixture was filtered and the filter cake was dried under high vacuum for 30 min to give the Sp isomer.

[0220] Diastereomeric mixture: 1 H NMR (400 MHz, chloroform-d) δ 7.43-7.30 (m, 2H), 7.32-7.17 (m, 3H), 4.29-4.11 (m, 3H), 3.94 (m, 1H), 1.52-1.42 (m, 3H), 1.28 (q, J=7.0 Hz, 3H).

[0221] Sp isomer: 1 H NMR (400 MHz, acetonitrile-d3) δ 7.50-7.36 (m, 2H), 7.32-7.21 (m, 3H), 4.75 (t, J = 11.5 Hz, 1H), 4.17-3.98 (m, 3H), 1.37 (dd, J = 7.1, 1.1 Hz, 3H), 1.22 (t, J = 7.1 Hz, 3H). 31 P NMR (162 MHz, acetonitrile-d3) δ-0.51. 19F NMR (376 MHz, acetonitrile-d3) δ-155.48--155.76 (m), -162.73 (td, J = 21.3, 3.7 Hz), -165.02--165.84 (m). LCMS m / z = 440.5 (M-ethyl + H), t R = 1.57 min; LC system: Thermo Accela 1250 UHPLC; MS system: Thermo LCQ Fleet; Column: Phenomenex Kinetex 2.6μ, XB-C18 100A, 50 × 3.0 mm; Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid; Gradient: 0 min–1.8 min 2–100% acetonitrile, 1.8 min–1.85 min 100%–2% acetonitrile, 1.85 min–2.00 min 2% ACN at 1800 μl / min. [ka]

[0222] A mixture of intermediate 14 (150 mg, 0.45 mmol), ethyl ((S)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate (298 mg, 0.68 mmol), and MgCl in THF (6 mL) was added. 2 (65 mg, 0.68 mmol) was added dropwise to N,N-diisopropylethylamine (0.20 mL, 1.13 mmol). The resulting mixture was stirred at 50° C. for 2 h, cooled, diluted with EtOAc (150 mL), washed with brine (50 mL×2), dried, concentrated in vacuo, redissolved in acetonitrile (6 mL), and c-HCL (0.3 mL) was added in an ice bath. The resulting mixture was stirred in an ice bath for 1 h and at room temperature for 1 h, and saturated NaHCO 3 (2 mL) and purified by HPLC (Phenomenex Gemini-NX 10μ C18 110 Å, 250×3 0 mm column, 5-70% acetonitrile / water gradient in 25 min run) to give the product. 1H NMR(400MHz, methanol-d4)δ 7.80(s,1H),7.31(d,J=7.7Hz,2H),7.25-7.14(m,3H),6.84(d,J=4.5Hz,1H),6.7 3(d,J=4.6Hz,1H),5.49(d,J=5.1Hz,1H),4.62(t,J=5.3Hz,1H),4.46(d,J=5.6Hz, 1H),4.40(dd,J=10.9,6.2Hz,1H),4.33(dd,J=10.9,5.4Hz,1H),4.11-3.98(m,2H ),3.87(dd,J=9.9,7.1Hz,1H),1.25(dd,J=7.1,1.0Hz,3H),1.16(t,J=7.1Hz,3H). 31 P NMR (162 MHz, methanol-d4) δ 3.26. LCMS: MS m / z=547.12[M+1];t R = 0.76 min; LC system: Thermo Accela 1250 UHPLC; MS system: Thermo LCQ Fleet; Column: Phenomenex Kinetex 2.6μ, XB-C18 100A, 50×3.0 mm; Solvent: acetonitrile with 0.1% formic acid, water with 0.1% formic acid; Gradient: 0 min–1.8 min 2–100% acetonitrile, 1.8 min–1.85 min 100%–2% acetonitrile, 1.85 min–2.00 min 2% ACN at 1800 μl / min. HPLC:t R = 4.03 min; HPLC system: Agilent 1290 II; Column: Phenomenex Kinetex C18, 2.6u 110A, 100 x 4.6mm; Solvents: A: water with 0.1% TFA, B: acetonitrile with 0.1% TFA; Gradient: 2 to 98% B with an 8.5 min gradient at 1.5 mL / min. C. Biological Examples Example 10. DENV Pol IC 50

[0223] A 244-nucleotide secondary unstructured heteropolymeric RNA (sshRNA) with the sequence 5'-(UCAG)20(UCCAAG)14(UCAG)20-3' (SEQ ID NO: 1) was used as a template with 5'-CUG-3' primer in the DENV2-NS5 polymerase assay. Six two-fold dilutions of compounds starting at 200 nM were seeded into a 96-well plate without an inhibitor control. 100 nM DENV2 NS5 was preincubated for 5 min at room temperature in a reaction mixture containing 40 mM Tris-HCl (pH 7.5), 10 mM NaCl, 3 mM DTT, 0.2 units / μL RNasin Plus RNase inhibitor, 200 ng / μL sshRNA, 20 μM CUG, and 2 mM MgCl2. The enzyme mixture was added to the compound dilutions and the reaction was initiated by the addition of a mixture containing 20 μM of the three natural NTPs plus 2 μM of the analogue: a base-matched competitor natural NTP containing 1:100 α-33P-NTP. After 90 min at 30° C., 5 μL of the reaction mixture was spotted onto DE81 anion exchange paper. The paper was washed with Na 2 HPO 4 (125 mM, pH 9) for 3 times 5 min, rinsed with water and ethanol, air-dried, and exposed to a phosphorimager. Synthetic RNA was quantified using a Typhoon Trio Imager and Image Quant TL software, and reaction rates were calculated by linear regression using GraphPad Prism 5.0. IC 50 Values ​​are calculated in Prism by nonlinear regression analysis using the dose-response (variable slope) equation (four parameter logistic equation): Y=nadir+(top-nadir) / (1+10^((LogIC 50 -X) * HillSlope). Example 11. RSV RNP Preparation

[0224] The RSV ribonucleoprotein (RNP) complex was analyzed by Mason et al. (Mason, S., Lawetz, C., Gaudette, Y., Do, F., Scouten, E., Lagace, L., Simoneau, B. and Liuzzi, M. (2004) Polyadenylation-dependent screening assay for respiratory syncytial virus RNA. HEp-2 cells were prepared by a method modified from that described in (Transcriptase activity and identification of an inhibitor. Nucleic Acids Research, 32, 4758-4767). HEp-2 cells were cultured at 7.1 × 10 4 cells / cm 2 The cells were seeded at a density of 100 μg / mL and incubated at 37°C (5% CO 2 ) overnight. After attachment, cells were infected with RSV A2 (MOI=5) in 35 mL MEM+2% FBS. 20 hours post-infection, the medium was replaced with MEM+2% FBS supplemented with 2 μg / mL actinomycin D and returned to 37° C. for 1 hour. Cells were then washed once with PBS and treated with 35 mL PBS+250 μg / mL lysed lecithin for 1 minute before aspirating all liquid. Cells were harvested by dispensing in 1.2 mL of buffer A [50 mM Tris acetate (pH 8.0), 100 mM potassium acetate, 1 mM DTT and 2 μg / mL actinomycin D] and lysed by repeated passage through an 18-gauge needle (10 times). Cell lysates were placed on ice for 10 minutes and then centrifuged at 2400 g for 10 minutes at 4° C. The supernatant (S1) was removed and the pellet (P1) was resuspended in 600 μL of buffer B [10 mM TRIS acetate (pH 8.0), 10 mM potassium acetate, and 1.5 mM MgCl ] supplemented with 1% Triton® X-100. 2The pellet was disrupted by repeated passage through an 18-gauge needle (10 times) in 100 mL of 10 ... Example 12. RSV RNP Assay

[0225] The transcription reaction was carried out in 30 µL of reaction buffer [50 mM TRIS-acetate (pH 8.0), 120 mM potassium acetate, 5% glycerol, 4.5 mM MgCl 2 The mixture contained 25 μg of crude RSV RNP complex in 100 μl of 1000 μg / mL of 1000 μM ...

[0226] To determine whether the nucleotide analogs inhibited RSV RNP transcription, compounds were added using six-step serial dilutions in five-fold increments. After 90 min incubation at 30°C, the RNP reaction was stopped with 350 μL of Qiagen RLT lysis buffer and RNA was purified using the Qiagen RNeasy 96 kit. Purified RNA was denatured in RNA sample loading buffer (Sigma) for 10 min at 65°C and run on a 1.2% agarose / MOPS gel containing 2 M formaldehyde. The agarose gel was dried and exposed to a Storm phosphorimager screen and imaged using a Storm phosphorimager (GE The total radiolabeled transcripts were determined using the IC 50 ) Reduced compound concentrations were calculated by nonlinear regression analysis of two replicates. Example 13. DENV-2 moDC EC 50

[0227] Human monocyte-derived dendritic cells (moDCs) are GM- Human Mo-DC differentiation containing CSF and IL-4 (Miltenyi Biotec) The moDCs were derived from CD14+ monocytes (AllCells) cultured in medium. On day 7, moDCs were harvested by mechanical disruption, washed, and suspended in serum-free RPMI. moDCs were infected with Vero-derived Dengue 2, New Guinea strain (NGC) at MOI=0.1 for 2 hours in serum-free RPMI at 37°C with gentle agitation. Cells were washed and , and resuspended in RPMI containing 10% serum (Gibco, supplemented with sodium pyruvate, NEAA, penicillin-streptomycin). 10^5 cells were seeded in triplicate in 96-well plates and compound was dispensed at graded doses (Hewlett-Packard D300 digital dispenser). All wells were normalized to 0.25% DMSO. At 48 hours, cells were washed with 1x PBS and all supernatants were removed. Total RNA was extracted using an RNEasy 96 plate (Qiagen) and used to generate first strand cDNA using XLT cDNA 5x Supermix (QuantaBio). cDNA was used as template in Taqman qPCR duplex reactions specific for DENV2 virus and GAPDH gene expression. EC 50 Values ​​were normalized to wells containing positive controls but no compound negative controls using Prism Graphpad software. Example 14. DENV-2 Huh-7 EC 50

[0228] Huh7 (human hepatoma 7) cells were maintained in DMEM complete medium containing 10% FCS. On the day of the assay, cells were trypsinized (0.1% trypsin-EDTA), washed, and infected with serum-free DMEM with dengue serotype 2 New Guinea C (NGC) strain for 2 h at MOI=0.1 at 37°C with gentle agitation. After 2 h, cells were washed with serum-free medium and suspended in DMEM containing 10% FCS (Gibco, supplemented with sodium pyruvate, NEAA, penicillin-streptomycin). 10^5 cells were seeded in triplicate in 96-well plates and compounds were dispensed at graded doses (Hewlett-Packard D300 digital dispenser). All wells were normalized to 0.25% DMSO. At 48 h, cells were washed with 1x PBS and all supernatants were removed. Total RNA was extracted using RNEasy 96 plates (Qiagen) and used to generate first strand cDNA using XLT cDNA 5x Supermix (QuantaBio). The cDNA was used as template in Taqman qPCR duplex reactions specific for DENV2 virus and GAPDH gene expression. EC 50 Values ​​were normalized to wells containing positive controls but no compound negative controls using Prism Graphpad software. Example 15. DENV-2 Huh-7 Rep EC 50

[0229] Compounds were acoustically transferred at 200 nl per well in a 384-well plate (Greiner, Cat. No. 781091) in a dose-response format of 8 compounds (4 replicates) or 40 compounds (3 replicates). For all plates tested, valapiravir, GS-5734, and NITD008 were included as positive inhibition controls along with a negative control well of 0% inhibition, DMSO only. Following compound addition, Huh-7 cells containing DENV2 replicon constructs were harvested following standard cell culture procedures and adjusted to a concentration of 1.25E5 cells / mL in cell culture medium composed of cDMEM without genticin. 40 μL of cell stock was then added to each well for a final cell density of 5,000 cells / well. Cell and compound mixtures were incubated at 37°C / 5% CO 2 The plates were then incubated at 4°C / 5% CO for 48 hours. Prior to harvesting the cells, EnduRen live cell substrate (Promega, Cat# E6481) was prepared by suspending 3.4mg in 100μL DMSO to generate a 60mM stock solution. The stock solution was then diluted 1:200 with pre-warmed cDMEM and 10uL of this diluted solution was added to each well of a 384-well plate. The plate was then briefly centrifuged at 500rpm and placed on a plate shaker for 2 minutes. After mixing, the plate was incubated at 7°C / 5% CO before measuring luminescence on an Envision luminometer. 2 The inhibition rate of the replicon signal was The EC for each compound was calculated for each concentration tested against the 0% and 100% inhibition controls. 50 Values ​​were determined by 4-parametric nonlinear regression as the effective concentration of compound that inhibited the replicon signal by 50%. Example 16. RSV HEp-2 EC 50

[0230] Antiviral activity against RSV is determined using an infectious cytopathic cytoprotection assay in HEp-2 cells. In this assay, compounds that inhibit viral infection and / or replication produce a cytoprotective effect against virus-induced cell killing that can be quantified using cell viability reagents. The technique used herein is a novel adaptation of a method described in the published literature (Chapman et al., Antimicrob Agents Chemother. 2007, 51(9):3346-53).

[0231] HEp-2 cells are obtained from ATCC (Manassas, VI) and maintained in MEM medium supplemented with 10% fetal bovine serum and penicillin / streptomycin. Cells are passaged twice weekly and maintained at subconfluent stage. Commercial stocks of RSV strain A2 (Advanced Biotechnologies, Columbia, MD) are titrated prior to compound testing to determine the appropriate dilution of virus stock that produces the desired cytopathic effect in HEp-2 cells.

[0232] For antiviral testing, HEp-2 cells are grown to near, but not full, confluency in large cell culture flasks. Compounds to be tested are pre-diluted in DMSO in 384-well compound dilution plates in either 8 or 40 samples per plate standardized dose-response format. Three-fold serial dilution increments of each test compound are prepared in the plate and test samples are transferred to the cell culture assay 384-well plate via an acoustic transfer device (Echo, Labcyte) at 100 nL per well. Each compound dilution is transferred to a dry assay plate in single or quadruplicate samples and stored until ready for assay. Positive and negative controls are placed on opposite ends of the plate in a vertical block (one column).

[0233] Subsequently, infectious mixtures are prepared using appropriate dilutions of virus stocks previously determined by titrating cells at a density of 50,000 / mL, and 20 μL / well are added to the test plates containing compounds via automation (uFlow, Biotek). Each plate includes negative and positive controls (16 replicates each) to create 0% and 100% virus inhibition standards, respectively. After infection with RSV, plates are incubated for 4 days in a cell culture incubator at 37°C. After incubation, a cell viability reagent, Cell TiterGlo (Promega, Madison, WI), is added to the assay plates, which are briefly incubated, and luminescence readings are measured (Envision, Perkin Elmer) on all assay plates. RSV-induced cytopathic effect, percent inhibition, is determined from the level of remaining cell viability. These numbers are calculated for each test concentration relative to the 0% and 100% inhibition controls, and the EC for each compound is calculated. 50 Values ​​are determined by nonlinear regression as the concentration that inhibits RSV-induced cytopathic effect by 50%. Various potent anti-RSV tool compounds are used as positive controls for antiviral activity. Example 17. RSV NHBE EC 50

[0234] Normal human bronchial epithelial (NHBE) cells were purchased from Lonza (Walkersville, MD, Catalog No. CC-2540) and cultured in Bronchial Epithelial Growth Media (BEGM) (Lonza, Walkersville, MD, Catalog No. CC-3170). Cells were passaged 1-2 times per week to maintain <80% confluency. NHBE cells were discarded after 6 passages in culture.

[0235] To perform the RSV A2 antiviral assay, NHBE cells were seeded in 96-well plates at a density of 7,500 cells per well in BEGM and allowed to attach overnight at 37°C. After attachment, 100 μL of cell culture medium was removed and 3-fold serially diluted compounds were added using a Hewlett-Packard D300 digital dispenser. Final concentrations of DMSO were normalized to 0.05%. Following compound addition, NHBE cells were cultured at 1 × 10 4.5 Infection was performed by adding 100 μL of RSV A2 at a titer of tissue culture infectious dose / mL, followed by incubation for 4 days at 37° C. NHBE cells were then equilibrated to 25° C. and cell viability was determined by removing 100 μL of culture medium and adding 100 μL of Cell-Titer Glo viability reagent. The mixture was incubated for 10 minutes at 25° C. and the luminescent signal was quantified on an Envision luminescence plate reader. Example 18. RSV HAE EC 50

[0236] HAE cells are cultured at an air-liquid interface, with the apical side exposed to air and the basal side in contact with the medium. Prior to the experiment, HAE were removed from their agar-based shipping packaging and acclimated overnight at 37°C / 5% CO2 in 1 ml of HAE assay medium (AIR-100-MM, Mattek Corp). HAE were prepared for infection by washing the apical surface twice with 400 μL of PBS (either using a direct pipetting method or by running each transwell through a trough containing PBS) to remove the mucus layer. The PBS was drained from the apical chamber and gently tapped onto an absorbent material to remove as much PBS as possible. After washing, cells were transferred to fresh HAE maintenance medium containing 4-fold serially diluted compounds, delivered to the basolateral side of the cell monolayer and apically infected with 100 μL of a 1:600 ​​dilution of RSV A strain A2 1000× stock (AB, Columbia, MD, Cat. No. 10-124-000) in HAE assay medium for 3 hours at 37° C. in 5% CO2. The virus inoculum was removed and the apical surface of the cells was washed three times with PBS using either of the methods previously described. The cells were then cultured in the presence of compounds for 3 days at 37° C. After incubation, total RNA was extracted from HAE cells using the MagMAX-96 viral RNA isolation kit (Applied Biosystems, Foster City, CA, Cat. No. AM1836), and intracellular RSV RNA was quantified by real-time PCR. Approximately 25 ng of purified RNA was diluted with 0.9 μM RSV N forward and RSV N reverse primers, 0.2 μM RSV N probe and 1× The PCR reaction mixture contained a Taqman RNA-Ct1-step kit (Applied Biosystems, Foster City, CA, Catalog No. 4392938). RNA levels were normalized using the Taqman GAPDH control primer set (Applied Biosystems, Foster City, CA, Catalog No. 402869). Real-time PCR primers and probes used in the RSV A2 HAE antiviral assay: RSV N forward CATCCAGCAAATACACCATCCA (SEQ ID NO: 2), RSV N reverse TTCTGCACATCATAATTAGGAGTATCAA (SEQ ID NO: 3), RSV N probe FAM-CGGAGCACAGGAGAT-BHQ (SEQ ID NO: 4). Example 19. HRV16 HeLa EC 50

[0237] H1-HeLa cells, cultured in complete DMEM medium containing 10% heat-inactivated FBS and 1% penicillin / streptomycin, were seeded in 96-well plates at 3000 cells / well one day prior to compound administration and infection. Antiviral activity of each compound was measured in triplicate. Compounds were added directly to the cell cultures in serial 3-fold dilutions using an HP300 digital dispenser (Hewlett Packard, Palo Alto, CA) immediately prior to infection. Plates were transferred to BSL-2 containment and appropriate dilutions of virus stocks previously determined by titration and prepared in cell culture medium were added to the cells and serially diluted compounds. Each plate contained 6 wells of infected untreated cells and 6 wells of uninfected cells, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plates were incubated at 33°C / 5% CO 2The mixtures were incubated for 96 hours in a tissue culture incubator set at 4°C. After incubation, H1-HeLa cells were removed from the incubation and allowed to equilibrate to 25°C. Cell viability was determined by removing 100 μL of culture medium and adding 100 μL of Cell-Titer Glo Viability Reagent. The mixtures were incubated on a shaker for 10 minutes at 25°C and the luminescence signal was quantified with an Envision luminescence plate reader. The percentage of inhibition of viral infection was calculated for each concentration tested relative to 0% and 100% inhibition controls, and the EC 50 Values ​​were determined by 4-parametric nonlinear regression as the effective concentration of compound that inhibited the cytopathic effect by 50%. Example 20. HRV1A HeLa EC 50

[0238] H1-HeLa cells cultured in complete RPMI 1640 containing 10% heat-inactivated FBS and 1% penicillin / streptomycin were seeded in 96-well plates at 5000 cells / well 1 day prior to compound administration and infection. Antiviral activity of each compound was measured in triplicate. Compounds were added directly to cell cultures in serial 3-fold dilutions using an HP300 digital dispenser (Hewlett Packard, Palo Alto, CA) immediately prior to infection. Plates were transferred to BSL-2 containment and 100 μL of a 1 / 4000 dilution of HRV1a virus stock was added to each well containing cells and serially diluted compound. Each plate contained 6 wells of infected untreated cells and 6 wells of cells containing 5 μM rupintrivir, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plates were incubated at 37°C / 5% CO 2The mixtures were incubated for 96 hours in a tissue culture incubator set at 4°C. After incubation, H1-HeLa cells were removed from the incubation and allowed to equilibrate to 25°C. Cell viability was determined by removing 100 μL of culture medium and adding 100 μL of Cell-Titer Glo Viability Reagent. The mixtures were incubated on a shaker for 10 minutes at 25°C and the luminescence signal was quantified with an Envision luminescence plate reader. The percentage of inhibition of viral infection was calculated for each concentration tested relative to 0% and 100% inhibition controls, and the EC 50 Values ​​were determined by 4-parametric nonlinear regression as the effective concentration of compound that inhibited the cytopathic effect by 50%. Example 21. HRV14 HeLa EC 50

[0239] H1-HeLa cells cultured in complete RPMI 1640 containing 10% heat-inactivated FBS and 1% penicillin / streptomycin were seeded in 96-well plates at 5000 cells / well 1 day prior to compound administration and infection. Antiviral activity of each compound was measured in triplicate. Compounds were added directly to cell cultures in serial 3-fold dilutions using an HP300 digital dispenser (Hewlett Packard, Palo Alto, CA) immediately prior to infection. Plates were transferred to BSL-2 containment and 100 μL of a 1 / 4000 dilution of HRV14 virus stock was added to each well containing cells and serially diluted compound. Each plate contained 6 wells of infected untreated cells and 6 wells of cells containing 5 μM rupintrivir, which served as 0% and 100% virus inhibition controls, respectively. After infection, the test plates were incubated at 37°C / 5% CO 2The mixtures were incubated for 96 hours in a tissue culture incubator set at 4°C. After incubation, H1-HeLa cells were removed from the incubation and allowed to equilibrate to 25°C. Cell viability was determined by removing 100 μL of culture medium and adding 100 μL of Cell-Titer Glo Viability Reagent. The mixtures were incubated on a shaker for 10 minutes at 25°C and the luminescence signal was quantified with an Envision luminescence plate reader. The percentage of inhibition of viral infection was calculated for each concentration tested relative to 0% and 100% inhibition controls, and the EC 50 The values ​​are expressed as the effective concentration of the compound that inhibited the cytopathic effect by 50%. was determined by parametric nonlinear regression. Example 22. HRVc15 and HRVc25 HeLa EC 50

[0240] First, prepare HRV replicon RNA. 5ug of DNA template (HRVc15 or HRVc25) is linearized with 2µL of MluI enzyme in NEB buffer-3 in a final volume of 25µL for 3 hours at 37°C. After incubation, the linearized DNA is purified with a PCR purification column and the following in vitro transcription was performed using the following conditions: 10µL of RiboMAX Express T7 2x buffer, 1-8µL of linear DNA template (1µg), 0-7µL of nuclease-free water, 2µL of enzyme mix T7 express. Mix a final volume of 20µL and incubate at 37°C for 30 minutes. After incubation, add 1µL of RQ1 RNase-free DNase and incubate the mixture at 37°C for 15 minutes. The resulting RNA is then purified with the MegaClear kit (Gibco Life Technologies catalog number 11835-030) and eluted twice with 50 μL of elution buffer at 95° C. H1-HeLa cells, cultured in complete RPMI 1640 medium containing 10% heat-inactivated FBS and 1% penicillin / streptomycin, were seeded into T-225 flasks at a concentration of 2E6 cells / flask one day prior to transfection and incubated at 37° C. / 5% CO. 2Incubate overnight at 4°C for 10 min. On the day of transfection, trypsinize the cells following standard cell culture protocols and wash twice with PBS. After washing, resuspend the cells at a concentration of 1E7 cells / mL in PBS and store the suspension on wet ice. Use electroporation to introduce the replicon RNA into the H1-HeLa cells. Pipette a final volume of 10 μL containing 10 μg of replicon c15 or 1 μg of c25 replicon RNA, respectively, into a 4 mm electroporation cuvette. Mix the H1-HeLa cell stock by gently swirling and transfer 0.5 mL of the previously prepared cell stock into the cuvette containing the replicon RNA. Mix the combined solution by flicking. After mixing, immediately electroporate the cells using the following settings: 900V, 25uF, infinite resistance, 1 pulse. Leave the cuvette on ice for 10 minutes. After 10 min incubation, 19 mL of ambient temperature phenol red-free and antibiotic-free RPMI 1640 containing 10% heat-inactivated FBS is added per electroporation. 150 μL (4E4 cells) of electroporated cell suspension is plated per well into a 96-well clear bottom white cell culture plate and incubated for 30 min at 25° C. Compounds are dispensed using a HP300 Digital Dispenser (Hewlett Packard, Palo Alto, CA). Compounds were added directly to the cell cultures in serial 3-fold dilutions using a 500 µL ELISA kit (Alto, CA) and tested in triplicate. Following compound addition, the plates are incubated at 33°C for 48 hours. Replicon activity is then measured by the Renilla-Glo luciferase assay system. Prior to signal quantification, the plates are removed from the incubator and 50 uL is removed from each well before equilibrating to 25°C. A 1:100 dilution of Renilla-Glo substrate is prepared in buffer according to the manufacturer's protocol, and 100 uL of Renilla-Glo luciferase mix is ​​added to each well. The plates are then incubated at 25°C for 20 minutes with gentle agitation, and the luciferase signal is determined using an EnVision luciferase quantification reader with a detection setting of 0.1 seconds. Percent inhibition of replicon inhibition is calculated for each concentration tested relative to the 0% and 100% inhibition controls included in the experiment, and the EC 50 Values ​​were determined by 4-parametric nonlinear regression as the effective concentration of compound that inhibited the luciferase signal by 50%. Example 23.HCV Rep 1B and 2A EC 50 and C.C. 50

[0241] Compounds were serially diluted in 10 steps of 1:3 dilution in 384-well plates. All serial dilutions were performed in 4 replicates per compound in the same 384-well plate. 100 μM of HCV protease inhibitor ITMN-191 was added as a control for 100% inhibition of HCV replication, while 10 mM puromycin was included as a control for 100% cytotoxicity. To each well of a black polystyrene 384-well plate (Greiner Bio-one, Monroe, NC), 90 μL of cell culture medium (without Geneticin) containing 2000 suspended HCV replicon cells was added on a Biotek μFlow workstation. For compound transfer to cell culture plate, 0.4 μL of compound solution from the compound serial dilution plate was transferred to the cell culture plate on a Biotek FX workstation. The DMSO concentration in the final assay well was 0.44%. The plates were incubated at 37 °C for 3 days in 5% CO 2 and 85% humidity. The HCV replicon assay was a multiplex assay that allowed for the assessment of both cytotoxicity and anti-replicon activity from the same well. 50 The assay was performed first. The medium in the 384-well cell culture plate was aspirated and the wells were washed four times with 100 μL each of PBS using a Biotek ELX405 plate washer. A volume of 50 μL of a solution containing 400 nM calcein AM (Anaspec, Fremont, CA) in 1× PBS was added to each well of the plate on a Biotek μFlow workstation. After incubating the plate at room temperature for 30 minutes, the fluorescent signal (excitation 490 nm, emission 520 nm) was measured on a Perkin-Elmer Envision plate reader. EC 50 The assay was 50The assay was performed in the same wells. The calcein-PBS solution in the 384-well cell culture plate was aspirated with a Biotek ELX405 plate washer. A volume of 20 μL of Dual-Glo Luciferase Buffer (Promega, Madison, WI) was added to each well of the plate on a Biotek μFlow workstation. The plate was incubated at room temperature for 10 minutes. A volume of 20 μL of a solution containing a 1:100 mixture of Dual-Glo Stop&Glo Substrate (Promega, Madison, WI) and Dual-Glo Stop&Glo Buffer (Promega, Madison, WI) was added to each well of the plate on a Biotek μFlow workstation. The plate was then incubated at room temperature for 10 minutes before the luminescence signal was measured on a Perkin-Elmer Envision plate reader. Example 24. Inhibition of human mitochondrial RNA polymerase (POLRMT)

[0242] All reaction mixtures contained 50 mM Tris-HCl buffer (pH 8.0), 0.2 mg / ml BSA, 2 mM DTT, 0.05 mg / ml activated fish sperm DNA, 10 mM MgCl2, 1.3 μCi [α- 33 The reaction mixture contained [E]dTTP (3,000 Ci / mmol), and 2 μM each of dATP, dGTP, and TTP. Optimal enzyme concentrations were chosen to be in the linear range of enzyme concentration ([E]) versus activity, and reaction times were chosen to ensure that 10% of the substrate was consumed. All reactions were performed at 37°C. Inhibition of mitochondrial RNA polymerase (POLRMT) was achieved with 10 mM HEPES (pH 7.5), 20 mM NaCl, 10 mM DTT, 0.1 mg / ml BSA, and 10 mM MgCl 2The assay was performed using 20 nM POLRMT preincubated with 20 nM template plasmid (pUC18-LSP) containing the POLRMT light chain promoter region and mitochondrial transcription factor A (mtTFA) (100 nM), and mt-TFB2 (20 nM) in a buffer containing 100 nM POLRMT. The reaction was heated to 32°C and incubated with 2.5 μM each of the four natural NTPs and 1.5 μCi of [ 33 The reaction was initiated by the addition of [P]GTP. After incubation at 32°C for 30 min, the reaction was spotted onto DE81 paper before being processed for quantification. Example 25. Single nucleotide incorporation by human mitochondrial RNA polymerase (POLRMT)

[0243] MTCN buffer (50 mM MES, 25 mM Tris-HCl, 25 mM CAPS, and 50 mM NaCl, pH 7.5), 200 nM 5'- 32 P-R12 / D18, 10 mM MgCl 2 A mixture of 1 mM DTT and 376 nM POLRMT was preincubated for 1 min at 30° C. 500 μM (final) of natural NTP or NTP Reactions were initiated by the addition of analogs. At selected time points, reaction mixtures were removed and quenched with gel loading buffer containing 100 mM EDTA, 80% formamide, and bromophenol blue, and heated at 65°C for 5 min. Samples were run on 20% polyacrylamide gels (8 M urea) and product formation was quantified using a Typhoon Trio Imager and Image Quant TL software (GE Healthcare, Piscataway, NJ). The rate of single nucleotide incorporation by mt RNA pol is calculated according to the monoexponential equation: [R13] = A(1-e -kt ), where [R] represents the amount of extension product formed (in nM), t represents the reaction time, k represents the observed rate, and A represents the amplitude of the exponential function. [Table 2] All values ​​are in nM. [Table 3] All values ​​are in nM. [Table 4] All values ​​are in nM. [Table 5] All values ​​are in nM. [Table 6] All values ​​are in nM. [Table 7] All values ​​are in nM.

[0244] As seen in Tables 5-7, the compound of formula I is more potent in the RSV antiviral assays (Hep-2 and NHBE) compared to compound 1 (about 4.0 and 4.4 times more potent, respectively). The compound of formula I is also more potent against HRV (in the HRV16 HeLa, HRV1A HeLa, and HRV14 HeLa assays, respectively) compared to compound 1 (about 4.2, 51.1, and 12.8 times more potent, respectively). Similarly, the compound of formula I is more potent against dengue (in the Denv huh7 Rep assay) than compound 1 (about 25.0 times more potent).

[0245] Similarly, the compound of formula I also exhibits higher anti-RSV activity in the HAE assay relative to compound 2 (Mirabelli, C. et al J. Antimicrob. Chemother. 2018, 73, 1823-1829) (about 8.1-fold more potent). The compound of formula I is also more potent in multiple HRV antiviral assays (in HRV1A HeLa, HRV14 HeLa, and HRV15 Rep assays) compared to compound 2 (about 12.1-fold more potent in the HRV1A HeLa assay, about 2.2-fold more potent in the HRV14 HeLa assay, and about 2.3-fold more potent in the HRV15 Rep assay). The compound of formula I is even more potent in the dengue antiviral assay (about 1.9-fold more potent in the DENV huh7 Rep assay). Similarly, the compound of formula I is more potent than compound 2 in the HCV antiviral assay (approximately 3.5-fold in HCV Rep 1B and 1.4-fold in HCV Rep 2A). Example 26. RSV potency of compounds of formula I compared to structurally related compounds 3-5.

[0246] Compounds of formula I are particularly suitable for use with cyclohexyl groups of ester groups (see the structure below) * The position indicated by is a position indicated by . [ka]

[0247] The potency of the compound of formula I and compounds 3-5 (structures shown below) was measured according to the above assay. The structures of compounds 3-5 are characterized by the lack of a cyclic ring in the branched ester (structures shown below). * Except for the positions indicated by (a), the compounds are equivalent to compounds of formula I. The results of these experiments are summarized in Table 8 below. [ka] [Table 8] All values ​​are in nM.

[0248] As seen in Table 8 above, the compound of formula I is more potent in the RSV and HRV antiviral assays than compounds 3 (about 5-fold in the RSV Hep-2 assay, about 9.3-fold in the RSV NHBE assay, about 6.2-fold in the HRV16 HeLa assay, about 91.9-fold in the HRV1A HeLa assay, and about 23.2-fold in the HRV14 HeLa assay), 4 (about 3.9-fold in the RSV Hep-2 assay, about 7.1-fold in the RSV NHBE assay, and about 4.3-fold in the HRV16 HeLa assay), and 5 (about 19.8-fold in the RSV Hep-2 assay, about 10.0-fold in the RSV NHBE assay, about 13.8-fold in the HRV16 HeLa assay, about 203.1 in the HRV1A HeLa assay, and about 44.0-fold in the HRV14 HeLa assay), each of which lacks a cyclic cyclohexyl group in the branched ester. Thus, the compounds of formula I exhibit improved properties compared to compounds 3-5, which have a branched alkyl group but lack a cyclohexyl group in the ester group. Example 27. Potency of the compound of formula I compared to the compounds of formula Ia, formula Ib, and compounds 2, 6, 7, and 8.

[0249] The potency of the compound of formula I, as well as the structurally related compounds of formula Ia and formula Ib, and compounds 2, 6, 7, and 8, was determined according to the assay described above. The structures of the compounds of formula Ia, formula Ib, 6, 7, and 8 are shown below, and the results are summarized in Table 9 below. [ka] [Table 9] All values ​​are in nM.

[0250] EC in Table 9 above 50The data show that in both the RSV and HRV assays, the compound of formula I, which has an S stereochemistry at P, is significantly more potent than the compound of formula Ib, which has an R stereocenter at P. Specifically, the compound of formula I is 31.1 times more potent than the compound of formula Ib in the RSV HEp-2 assay and 5.1 times more potent in the RSV NHBE assay. Similarly, the compound of formula I is 2.9 times more potent than the compound of formula Ib in the HRV16 HeLa assay.

[0251] In contrast, the potencies of compounds 6 and 7, which differ only in stereochemistry at P (compound 6 has an S stereochemistry at P and compound 7 has an R stereochemistry), are not as different as the compounds of formula I and formula Ib. Compound 6 is 4.8-fold more potent than compound 7 in the RSV HEp-2 assay and 1.4-fold more potent in the HRV16 HeLa assay. Compound 6 is only 0.7-fold more potent than compound 7 in the RSV NHBE assay. Example 28. HEp-2 and MT-4 cytotoxicity assays

[0252] The cytotoxicity of the compounds of formula I, as well as compounds 1, 2, and 6, was determined in uninfected cells using cell viability reagents in a manner similar to that previously described for other cell types (Cihlar et al., Antimicrob Agents Chemother. 2008, 52(2):655-65). HEp-2 (1.5×103 cells / well) and MT-4 (2×103 cells / well) cells were seeded in 384-well plates and incubated with the appropriate medium containing 3-fold serially diluted compounds ranging from 15 nM to 100,000 nM. The cells were cultured at 37°C for 4-5 days. After incubation, the cells were equilibrated to 25°C and cell viability was determined by adding Cell-Titer Glo viability reagent. The mixture was incubated for 10 minutes and the luminescence signal was quantified using an Envision plate reader. Untreated cells and cells treated with 2 μM puromycin (Sigma, St. Louis, MO) served as 100% and 0% cell viability controls, respectively. Percentage of cell viability was calculated for each compound concentration tested relative to the 0% and 100% controls and CC 50 Values ​​were determined by nonlinear regression as the compound concentration that reduced cell viability by 50%. Example 29. NHBE and SAEC cytotoxicity assays

[0253] Normal human bronchial epithelial (NHBE) cells were purchased from Lonza (Walkersville, MD, catalog number CC-2540) and cultured in bronchial epithelial growth medium (BEGM) (Lonza, Walkersville, MD, catalog number CC-3170). Cells were passaged 1-2 times per week to maintain less than 80% confluency according to the manufacturer's protocol. NHBE cells were discarded after 5 passages in culture.

[0254] Human small airway epithelial cells (SAECs) were purchased from Lonza (Walkersville, MD, Catalog No. CC-2547) and grown in supplemented Small Airway Epithelial Cell Growth Medium. SAEC cells were cultured in 100% PBS (Lonza, Walkersville, MD, catalog no. CC-3118) for 12 h. Cells were passaged 1-2 times per week to maintain <80% confluency according to the manufacturer's protocol. SAEC cells were discarded after 5 passages in culture.

[0255] The 50% cytotoxic concentration (CC) of the compound of formula I, and compounds 1, 2, and 6 50 To determine viability, NHBE or SAEC cells were seeded in clear-bottom, black-walled 96-well plates at a density of 10,000 cells per well in 200 μL of BEGM or SAGM and allowed to attach overnight at 37°C. After attachment, 3-fold serially diluted compounds were added in triplicate using a Hewlett-Packard D300 digital dispenser (Hewlett Packard, Palo Alto, CA). The final concentration of DMSO was normalized to 1.0%. After compound addition, NHBE or SAEC cells were incubated at 37°C for 5 days. Cell viability was then determined by equilibrating NHBE or SAEC cells to 25°C, removing 100 μL of culture medium, and adding 100 μL of Cell-Titer Glo Viability Reagent (Promega, Madison, WI). The mixture was incubated at 25°C for 10 min, and the luminescence signal was quantified with an Envision luminescence plate reader (PerkinElmer, Waltham, MA). Viability values ​​were determined by normalization to 1.0% DMSO only control wells, with background luminescence signal subtracted. Example 30. PHH Cytotoxicity Assay

[0256] Three-fold serial dilutions of the compound of formula I, and compounds 1, 2, and 6 were prepared in duplicate in 96-well plates starting at concentrations of 50 or 100 μM. Fresh human hepatocytes were plated on a Matrigel overlay with a Geltrex overlay or on a 100% PBS containing Invitrogen ( PHH cells were sequenced in a 96-well plate format from BioIVT (Baltimore, Maryland, catalog number F / M91565) using a 96-well plate formatted donor kit (Durham, North Carolina, catalog number HMFY96). Donor profile was restricted to ages 4-65 with minimal alcohol consumption. PHH cells were cultured in a 5% CO2-free, 90% humidified room temperature culture medium after compound treatment. 2 Cells were allowed to recover for 4-24 hours in complete medium supplemented with supplements supplied by the vendor at 37°C in an incubator. Serially diluted compounds and complete medium were replaced daily for 5 days with a final volume of DMSO equal to 0.5% (130 μL / well). On day 5, medium was removed from the assay plate and cell viability was determined by the addition of 100 μL of Cell-Titer Glo Viability Reagent (Promega, Madison, WI, Cat. No. G7573) added to each well. After 5-10 minutes of incubation at room temperature, luminescence signals were quantified with a Victor luminescence plate reader (Perkin-Elmer, Waltham, MA). Example 31. PRPT cytotoxicity assay

[0257] PRPT cytotoxicity assays for the compound of formula I, and compounds 1, 2, and 6 were performed using the following compound protocols.

[0258] Cryopreserved human primary renal proximal tubule epithelial cells (PRPTEC) were obtained from LifeLine Cell Technology (Frederick, MD, catalog number FC-0013) and isolated from human kidney tissue. Cells were cultured from cryopreserved vials in RenaLife complete medium (LifeLine, Frederick, MD, catalog number LL-0025) in T75 flasks for 3-4 days, after which cells were seeded into assay plates after 90% confluence. PRPTEC cells were seeded at a density of 5 × 103 cells per well in collagen-coated 96-well plates in a final volume of 160 mL per well. The next day, compounds were added directly to the cell plates using an HP D300 dispenser (Hewlett-Packard, Palo Alto, CA) with a program starting at a concentration 200-fold lower than the compound stock concentration, and two 1:3 dilutions with a constant volume of DMSO equal to 0.5%. After 5 days of incubation, culture medium was removed and cell viability was measured by the addition of 100 mL per well of CellTiter Glo Viability Reagent (Promega, Madison, WI, catalog no. G7573), and the luminescent signal was quantified with a luminescence plate reader (Perkin-Elmer, Waltham, MA). Example 32. GALHEPG2 cytotoxicity assay

[0259] The compound of Formula I, as well as compounds 1, 2, and 6, were tested for cytotoxicity in galactose-adapted HepG2 cells (a human liver cancer cell line) in a high-throughput 384-well assay format.

[0260] Cells were diluted to 16.6K cells / mL in media (DMEM (11966), 10% FBS, 1% NEAA, 0.2% galactose, 1% pyruvate, 1% Glutamax, 1% PSG) and plated at 90uL / well into 384-well poly-D-lysine coated assay plates and placed in an incubator at 37°C and 5% CO2. Compounds were serially diluted 4 times (1:3) in 100% DMSO in 384-well plates. DMSO and 2mM puromycin were included as negative and positive controls, respectively. 24 hours after cell plating, a 384-channel pipettor was used to transfer 0.4uL from the compound plate to the assay plate. The assay plate was returned to the incubator. After 5 days, the assay plate was washed with 80uL / well of PBS before adding 20uL of Cell Titer Glo. The assay plate was read on an Envision plate reader. CC 50 Values ​​are calculated as 50% of growth, as measured by luminescence signal. CC was defined as the compound concentration that produced inhibition. 50 Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. Example 33. GALPC3 cytotoxicity assay

[0261] Compounds were tested for cytotoxicity in galactose-adapted PC3 cells (human prostate cancer cell line) in a high-throughput 384-well assay format. Cells were diluted to 16.6K cells / mL in media (DMEM (11966), 10% FBS, 1% NEAA, 0.2% galactose, 1% pyruvate, 1% Glutamax, 1% PSG) and plated at 90uL / well into 384-well poly-D-lysine coated assay plates and incubated at 37°C and 5% CO. 2The assay plates were placed in an incubator at 4°C for 12 h. Compounds were serially diluted (1:3) in 100% DMSO in 384-well plates four times. DMSO and 2 mM puromycin were included as negative and positive controls, respectively. 24 hours after cell seeding, a 384-channel pipettor was used to transfer 0.4 uL from the compound plate to the assay plate. The assay plates were returned to the incubator. After 5 days, the assay plates were washed with 80 uL / well of PBS before adding 20 uL of Cell Titer Glo. The assay plates were read on an Envision plate reader. CC 50 The CC value is defined as the compound concentration that results in 50% inhibition of growth as measured by luminescence signal. 50 Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. Example 34. Huh-7 cytotoxicity assay

[0262] Compounds were tested in a high-throughput 384-well assay format for cytotoxicity in Huh7 cells (a hepatoma cell line). Cells were diluted to 16.6K cells / mL in media (DMEM (15-018-CM), 10% FBS, 1% NEAA, 1% PSG) and seeded at 90uL / well into 384-well poly-D-lysine coated assay plates and placed in an incubator at 37°C and 5% CO2. Compounds were serially diluted 4 times (1:3) in 100% DMSO in 384-well plates. DMSO and 2mM puromycin were included as negative and positive controls, respectively. 24 hours after cell seeding, a 384-channel pipettor was used to transfer 0.4uL from the compound plate to the assay plate. The assay plate was returned to the incubator. After 5 days, the assay plate was washed with 80uL / well of PBS before adding 20uL of Cell Titer Glo. The assay plates were read on an Envision plate reader. 50 The CC value was defined as the compound concentration that resulted in 50% inhibition of growth as measured by the luminescence signal. 50Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. Example 35. MRC5 cytotoxicity assay

[0263] Compounds were tested in a high-throughput 384-well assay format for cytotoxicity in MRC5 cells (a human fetal lung fibroblast cell line). Cells were diluted to 16.6K cells / mL in media (MEM(10-010-CM), 10% FBS, 1% PSG) and plated at 90 uL / well into 384-well poly-D-lysine coated assay plates and incubated at 37° C. and 5% CO 2 The assay plates were placed in an incubator at 4°C for 24 h. Compounds were serially diluted (1:3) in 100% DMSO in 384-well plates four times. DMSO and 2 mM puromycin were included as negative and positive controls, respectively. 24 hours after cell seeding, a 384-channel pipettor was used to transfer 0.4 uL from the compound plate to the assay plate. The assay plate was returned to the incubator. After 5 days, the assay plate was washed with 80 uL / well of PBS before adding 20 uL of Cell Titer Glo. The assay plate was read on an Envision plate reader. CC 50 Values ​​are taken as the compound concentration that results in 50% inhibition of growth as measured by luminescence signal. It was defined as CC 50 Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. Example 36. Cytotoxicity assay of NRVM neonatal rat cardiomyocytes

[0264] The compounds were administered to freshly harvested neonatal rat cardiomyocytes. Cells were tested for cytotoxicity against NRVM (Neurocyte-Related Virology (NRVM)) in a high-throughput 384-well assay format. Cells were diluted to 25,000 cells / mL in media (DMEM+10% FBS+1% PSG+1% NEAA) and plated at 90ul per well in 384-well cell assay plates and incubated at 37°C and 5% CO prior to compound addition. 2 The cells were incubated overnight at 4°C for 12 hours. Compounds were prepared by serial dilution (1:3) in 100% DMSO in 384-well plates. 400 nL / well of compound was transferred to the cell assay plate via Biocel (Agilent Technologies). DMSO and 2 mM puromycin were included as negative and positive controls, respectively. After 5 days, the plates were washed once with 100 ul / well PBS in a Biotek plate washer and 20 uL of Cell Titer Glo was added to each well. The plates were incubated for 10 minutes and read on an EnVision reader (Perkin Elmer). CC 50 The CC value was defined as the compound concentration that resulted in 50% inhibition of growth as measured by the luminescence signal. 50 Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. Example 37. PBMC cytotoxicity assay

[0265] Compounds were tested for cytotoxicity in cryopreserved human PBMCs in a high-throughput 384-well assay format. Compounds were serially diluted 4 times (1:3) in 100% DMSO in 384-well plates. 310 nL of compound was transferred to the assay plate using an acoustic dispenser. DMSO and 2 mM puromycin were included as negative and positive controls, respectively. Cells were diluted to 72K cells / mL in media (RPMI+10% FBS+1% PSG+10 mM Hepes+1% pyruvate+0.1% BMe) and incubated at 37°C and 5% CO 2After leaving the plate in a 500 rpm incubator for 4 hours, 70 uL / well of the cells were pre-spotted onto the assay plate. After 5 days, 25 uL of Cell Titer Glo was added to the assay plate. 50 The CC value was defined as the compound concentration that resulted in 50% inhibition of growth as measured by the luminescence signal. 50 Values ​​were calculated in Accord (online tool) using a one-site dose-response model to generate a sigmoidal curve fit. [Table 10] All values ​​are in nM.

[0266] The above table shows that the compound of formula I exhibits a better secondary cytotoxicity profile across multiple cell lines (NHBE, SAEC, Huh-7, NRVM, PBMC, PHH, and PRPT) compared to compounds 1, 2, 6, and 8. Example 38. Plasma stability assay

[0267] For plasma stability, compounds were incubated at 2 μM in cynomolgus monkey or human plasma for up to 4 hours at 37° C. At the desired time points, aliquots from the incubations were The samples were quenched by adding 9 volumes of 100% acetonitrile supplemented with standards. After the final collection, the samples were centrifuged at 3000 g for 30 min and the supernatant was transferred to a new plate containing an equal volume of water for analysis by liquid chromatography coupled to triple quadrupole mass spectrometry (LC-MS / MS). The data (analyte vs. internal standard peak area ratios) were plotted on a semi-logarithmic scale and fitted using an exponential fit. The half-life (T 1 / 2 ) was determined assuming first-order kinetics. Example 39. Stability assay in S9 fraction

[0268] For S9 stability, compounds were incubated at 2 μM in cynomolgus monkey or human liver S9 fractions in the presence of NADPH and UDPGA (phase I and II complement factors, Sigma-Aldrich) for up to 90 min at 37° C. At the desired time points after compound addition, samples were quenched with 9 volumes of an aqueous solution containing an internal standard, 50% acetonitrile, and 25% methanol. Sample plates were centrifuged at 3000 g for 30 min, and 10 μL of the resulting solution was analyzed by LC-MS / MS. Data (analyte vs. internal standard peak area ratios) were plotted on a semi-log scale and fitted using an exponential fit. Half-lives (T 1 / 2 ) was determined assuming first-order kinetics. [Table 11]

[0269] The data in the above table show that compound of Formula I has a longer half-life (human and cynomolgus hepS9 and human and cynomolgus plasma) than compounds 2, 6, and 7. Example 40. Thermodynamic solubility assay

[0270] Thermodynamic solubility of the compounds was determined at room temperature in phosphate buffered saline solution (pH 7.4) and 10 mM hydrochloric acid (pH 2.0). An excess of solid compound was used to saturate an aqueous sample of the compound. The tubes were placed on a stirrer set at 1000 rpm and maintained under constant agitation for 4 days. After agitation, it was determined that excess solids were present in all tubes. The tubes were centrifuged at 10,000 rpm for 5 minutes to remove excess solids, and the supernatant was transferred to a new vial. Concentration analysis was determined by UPLC and quantified against an internal standard. [Table 12]

[0271] As can be seen in the table above, the compound of formula I has a higher solubility at both pH 2 and 7 than compounds 2 and 6. Example 41. Intracellular triphosphate formation of NHBE in vitro

[0272] In vitro intracellular triphosphate formation was measured for compounds of formula I and compound 6 using the following protocol. Normal human bronchial airway epithelial cells (NHBE) (250,000 cells / well) were continuously incubated with 10 μM of compound for 26 hours. At selected time points (2, 4, 6, and 26 hours), extracellular medium was removed from the wells, cells were washed twice with 2 mL of ice-cold 0.9% normal saline, and extracted into 0.5 mL of ice-cold 70% methanol with 100 nM 2-chloro-adenosine-5'-triphosphate (Sigma-Aldrich, St. Louis, MO) as an internal standard. Samples were stored overnight at -20°C to facilitate nucleotide extraction, centrifuged at 15,000 x g for 15 minutes, and the supernatant was then transferred to a clean tube for drying in a MiVac Duo concentrator (Genevac, Gardiner, NY). The dried samples were then reconstituted with mobile phase A containing 3 mM ammonium formate (pH 5.0) with 10 mM dimethylhexylamine (DMHA) in water for analysis by LC-MS / MS. The results of these experiments are shown in Figure 1. Example 42. In vitro intracellular triphosphate formation assay in PBMCs

[0273] In vitro intracellular triphosphate formation was measured for the compound of formula I, as well as compounds 2 and 6, using the following protocol. Freshly isolated PBMCs were derived from healthy donors and suspended at a concentration of 5 million cells / mL in culture medium (RPMI 1164 with L-glutamin) prior to the start of the experiment. 10 mL PBMC aliquots were transferred to 50 mL conical tubes with loosened caps and compounds were added to a final concentration of 2 μM. 1 mL aliquots were then transferred to wells of a 24-well plate per sample. The PBMC-compound mixtures were incubated at 37° C. / 5% CO with gentle agitation for 1 h. 2The PBMCs were incubated at 4°C for 2 hours. After incubation, the PBMCs were spun at 5000 RPM for 3 minutes and the supernatant was aspirated without disturbing the cell pellet. For samples undergoing immediate analysis, the samples were resuspended in pre-chilled 1x Tris-buffered saline and transferred to a 1.5 mL conical tube containing 0.5 mL of nyosil M25. An aliquot of the sample / oil was then spun at 13,000 RPM for 1 minute. After centrifugation, all the medium was aspirated from the tube without disturbing the oil layer. Water was added on top of the oil layer and the spin / aspiration process was repeated, followed by an additional water wash. After the second wash step, all the oil and water were removed and the cell pellets were flash frozen on dry ice and stored at -80°C until further processing. Samples not undergoing immediate analysis were washed twice with serum-free culture medium, resuspended in 1 mL of culture medium and stored at 37c / 5% CO until they were processed by the aforementioned protocol. 2 Each PBMC sample was treated with 500 μL of dry ice cold extraction buffer (70% methanol, containing 0.5 μM chloro-adenosine triphosphate as an internal standard). The above solution was vortexed for 5 minutes and then centrifuged at 20,000×g for 20 minutes. The supernatant was transferred to a clean 1.5 mL Eppendorf vial and loaded into a centrifugal evaporator. Once dry, the sample was reconstituted with 80 μL of mobile phase A, centrifuged at 20,000×g for 20 minutes, and the supernatant was transferred to an HPLC injection vial for analysis. A 10 μL aliquot was injected into a Sciex 6500 LC / MS / MS system. A standard calibration curve for PBMC was constructed based on pmol of compound per sample. The values ​​from each sample were then divided by the total number of cells in the sample to obtain pmol per million cells. An intracellular volume of 0.2 pL per cell was then used to derive micromolar concentrations. The results of these experiments are shown in FIG.

[0274] As seen in Figures 1 and 2, the compound of formula I exhibits equal or better in vitro intracellular NTP (nucleotide triphosphate) formation in NHBEs, but lower in PBMCs, compared to compounds 2 and / or 6. This suggests that the compound of formula I undergoes more selective metabolism in NHBEs (the target cell type) versus PBMCs, compared to compounds 2 and / or 6. Example 43. Animal Pharmacokinetic Assay

[0275] Animal PK studies for compounds of Formula I and 6 were conducted using the following compound protocol. Animals weighing 3-6 kg were used for the life portion of the study. The test article was administered intravenously to male cynomolgus monkeys by constant rate infusion over 30 minutes at 10 mg / kg body weight as an aqueous solution of 12% Captisol in water at pH 3. Plasma samples were collected at 0.25, 0.5, 1, 1.5, 2, 4, 8, and 24 hours post-dose, and PBMC samples were collected at 2 and 24 hours post-dose.

[0276] The blood sample (approximately 1 mL) was 2 Blood was collected into pre-chilled collection tubes containing EDTA and centrifuged at 4°C to separate plasma. For PBMC collection, approximately 8 mL of blood sample was collected at room temperature into CPT vacutainer tubes containing sodium heparin for isolation. For each terminal collection, animals were anesthetized and lungs were harvested while the animals were alive. Collected lungs were flash frozen in liquid nitrogen immediately after removal.

[0277] Plasma samples from the pharmacokinetic study were subjected to protein precipitation by adding acetonitrile to a final concentration of 75% containing 5-iodo-knot as an internal standard. Analytes in plasma samples were separated on a 4 μm 150 × 2 mm Synergi Max-RP column (Phenomenex, Torrance, CA) using a mobile phase containing 0.2% formic acid and a linear gradient of 2% to 100% acetonitrile over 7 min at a flow rate of 250 μL / min. Eight point standard curves were prepared with concentrations ranging from 5.1 to 5,000 nM, covered by blank plasma, and showed linearity exceeding an R value of 0.99. Separate prepared quality control samples of 120 and 3,000 nM in plasma were analyzed at the beginning and end of each sample set to ensure accuracy and precision within 20%.

[0278] Each PBMC sample was treated with 500 μL of extraction buffer containing 67 mM ethylenediamine tetraacetic acid (EDTA) in 70% methanol, using 0.5 μM chloro-adenosine triphosphate as an internal standard. The extraction buffer was chilled on dry ice. The above solution was vortexed for 5 min and then centrifuged at 20,000×g for 20 min. The supernatant was transferred to a clean 1.5 mL Eppendorf vial and loaded into a centrifugal evaporator. Once dry, the sample was reconstituted with 80 μL of 1 mM ammonium phosphate buffer (pH=7), centrifuged at 20,000×g for 20 min, and the supernatant was transferred to an HPLC injection vial for analysis. A 10 μL aliquot was injected into an API 5000 LC / MS / MS system. To calculate the intracellular concentration of metabolites, the total number of cells in each sample was determined using a total DNA counting method (Benech, et al. Peripheral Blood Mononuclear Cell Counting Using a DNA-detection-based Method. 2004 July 1;330(1):172-4). A standard calibration curve for PBMC was constructed based on pmol of compound per sample. The values ​​from each sample were then divided by the total number of cells in the sample to obtain pmol per million cells. Micromolar concentrations were then derived using an intracellular volume of 0.2 pL per cell.

[0279] Lung samples were prepared by sectioning into smaller pieces and distributing into pre-weighed 15 mL conical tubes kept on dry ice. Ice-cold extraction buffer (0.1% KOH and 67 mM ethylenediaminetetraacetic acid in 70% methanol with 0.5 μM chloro-adenosine triphosphate as an internal standard, approximately 2 mL) was added to approximately 0.5 g of each lung sample. The mixture was rapidly homogenized using an Omni-Tip TH™ with a disposable hard tissue homogenizer probe (Omni International). An aliquot of the homogenate was filtered by using a 0.2 μm 96-well polypropylene filter plate (Varian Captiva™). The filtrate was evaporated to dryness and reconstituted with an equal volume of 1 mM ammonium phosphate buffer (pH=7) before LC-MS / MS analysis.

[0280] Quantification of nucleoside triphosphates used an ion-pairing nucleotide detection LC-MS / MS method. Analytes were separated on a 2.0 x 50 mm Luna C18 column (Phenomenex, Torrance, CA) with ion-pairing buffer containing 3 mM ammonium phosphate (pH 5) with 10 mM dimethylhexylamine (DMH), and a multi-step linear gradient from 10% to 50% acetonitrile over 11 min at a flow rate of 160 μL / min. A seven-point standard curve prepared in blank matrix covered concentrations from 24.0 to 17,500 nM and had an R 2 Linearity was demonstrated with a value in excess of 0.99.

[0281] The results of these experiments are shown in FIG. 3 and the table below. [Table 13]

[0282] As can be seen, the compound of formula I exhibits higher lung NTP concentrations and lower PBMC NTP concentrations in the cynomolgus monkey PK study, indicating that the compound of formula I undergoes more selective metabolism in lung tissue versus PBMCs, as compared to compound 6.

[0283] Although the above invention has been described in some detail by way of illustration and example for clarity of understanding, those skilled in the art will appreciate that certain changes and modifications may be practiced within the scope of the appended claims. Additionally, each reference provided herein is incorporated by reference in its entirety as if each reference were individually incorporated by reference. In the event of a conflict between this application and a reference provided herein, this application shall control.

[0284] According to a preferred embodiment of the present invention, for example, the following is provided: (Section 1) A compound of formula I, [ka] or a pharma- ceutically acceptable salt thereof. (Section 2) A pharmaceutical formulation comprising a therapeutically effective amount of the compound according to the above item 1 or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier or excipient. (Section 3) A method for treating a Pneumoviridae virus infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound described in paragraph 1 above, or a pharma- ceutically acceptable salt thereof. (Section 4) Item 4. The method according to item 3, wherein the Pneumoviridae virus infection is a respiratory syncytial virus infection. (Section 5) 4. The method according to item 3 above, wherein the Pneumoviridae virus infection is a human metapneumovirus infection. (Section 6) 2. A method for treating a Picornaviridae virus infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound according to claim 1 or a pharma- ceutically acceptable salt thereof. (Section 7) 7. The method according to item 6, wherein the Picornaviridae virus infection is a human rhinovirus infection. (Section 8) A method for treating a Flaviviridae virus infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound according to paragraph 1 above, or a pharma- ceutically acceptable salt thereof. (Section 9) Item 9. The method according to item 8, wherein the Flaviviridae virus infection is a dengue virus infection. (Section 10) Item 9. The method according to item 8, wherein the Flaviviridae virus infection is a yellow fever virus infection. (Section 11) Item 9. The method according to item 8, wherein the Flaviviridae virus infection is a West Nile virus infection. (Section 12) The method according to item 8, wherein the Flaviviridae virus infection is a Zika virus infection. (Section 13) Item 9. The method according to item 8, wherein the Flaviviridae virus infection is a hepatitis C virus infection. (Section 14) Item 9. The method according to item 8, wherein the Flaviviridae virus infection is a hepatitis B virus infection. (Section 15) A method for treating a Filoviridae virus infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound according to paragraph 1 above, or a pharma- ceutically acceptable salt thereof. (Section 16) Item 16. The method according to item 15, wherein the Filoviridae virus infection is an Ebola virus infection. (Section 17) A method for producing a medicament for treating a Pneumoviridae virus infection in a human in need thereof, comprising using the compound according to item 1 or a pharma- ceutical acceptable salt thereof. (Section 18) Item 18. The method according to item 17, wherein the Pneumoviridae virus infection is a respiratory syncytial virus infection. (Section 19) Item 18. The method according to item 17, wherein the Pneumoviridae virus infection is a human metapneumovirus infection. (Section 20) 2. A method for producing a medicament for treating a Picornaviridae virus infection in a human in need thereof, comprising using the compound according to item 1 or a pharma- ceutical acceptable salt thereof. (Section 21) 21. The method according to claim 20, wherein the Picornaviridae virus infection is a human rhinovirus infection. (Section 22) 2. A method for producing a medicament for treating a Flaviviridae virus infection in a human in need thereof, comprising using a compound according to item 1 or a pharma- ceutical acceptable salt thereof. (Section 23) 23. The method according to item 22, wherein the Flaviviridae virus infection is a dengue virus infection. (Section 24) 23. The method according to item 22, wherein the Flaviviridae virus infection is a yellow fever virus infection. (Section 25) 23. The method according to item 22, wherein the Flaviviridae virus infection is a West Nile virus infection. (Section 26) 23. The method according to claim 22, wherein the Flaviviridae virus infection is a Zika virus infection. (Section 27) 23. The method according to item 22, wherein the Flaviviridae virus infection is a hepatitis C virus infection. (Section 28) 23. The method according to item 22, wherein the Flaviviridae virus infection is a hepatitis B virus infection. (Section 29) A method for producing a medicament for treating a Filoviridae virus infection in a human in need thereof, comprising using the compound according to item 1 or a pharma- ceutical acceptable salt thereof. (Section 30) 30. The method according to claim 29, wherein the Filoviridae virus infection is an Ebola virus infection. (Section 31) 2. Use of the compound according to item 1 or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment of a Pneumoviridae virus infection in humans. (Section 32) 32. The use according to item 31, wherein the Pneumoviridae viral infection is a respiratory syncytial viral infection. (Section 33) 32. The use according to item 31, wherein the Pneumoviridae viral infection is a human metapneumovirus infection. (Section 34) 2. Use of the compound according to item 1 or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment of a Picornaviridae virus infection in humans. (Section 35) 35. The use according to claim 34, wherein the Picornaviridae viral infection is a human rhinovirus infection. (Section 36) 2. Use of the compound according to item 1 or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment of a Flaviviridae virus infection in humans. (Section 37) Item 37. The use according to item 36, wherein the Flaviviridae viral infection is a dengue virus infection. (Section 38) 37. The use according to claim 36, wherein the Flaviviridae virus infection is a yellow fever virus infection. (Section 39) Item 37. The use according to item 36, wherein the Flaviviridae virus infection is a West Nile virus infection. (Section 40) 37. The use according to claim 36, wherein the Flaviviridae virus infection is a Zika virus infection. (Section 41) Item 37. The use according to item 36, wherein the Flaviviridae viral infection is a hepatitis C viral infection. (Section 42) Item 37. The use according to item 36, wherein the Flaviviridae viral infection is a hepatitis B viral infection. (Section 43) 2. Use of the compound according to item 1 or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment of a Filoviridae virus infection in humans. (Section 44) 44. The use according to claim 43, wherein the Filoviridae virus infection is an Ebola virus infection. (Section 45) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating a Pneumoviridae virus infection in a human in need thereof. (Section 46) 46. ​​The compound according to claim 45, wherein the Pneumoviridae virus infection is a respiratory syncytial virus infection. (Section 47) 46. ​​The compound according to item 45, wherein the Pneumoviridae virus infection is a human metapneumovirus infection. (Section 48) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating a Picornaviridae virus infection in a human in need thereof. (Section 49) 49. The compound according to claim 48, wherein the Picornaviridae virus infection is a human rhinovirus infection. (Section 50) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating a Flaviviridae virus infection in a human in need thereof. (Section 51) 51. The compound according to item 50, wherein the Flaviviridae virus infection is a Dengue virus infection. (Section 52) 51. The compound according to item 50, wherein the Flaviviridae virus infection is a yellow fever virus infection. (Section 53) 51. The compound according to item 50, wherein the Flaviviridae virus infection is a West Nile virus infection. (Section 54) 51. The compound according to claim 50, wherein the Flaviviridae virus infection is a Zika virus infection. (Section 55) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating a Filoviridae virus infection in a human in need thereof. (Section 56) 56. The compound according to claim 55, wherein the Filoviridae virus infection is an Ebola virus infection. (Section 57) 56. The use according to item 55, wherein the Flaviviridae viral infection is a hepatitis C viral infection. (Section 58) 56. The use according to item 55, wherein the Flaviviridae viral infection is a Hepatitis B viral infection. (Section 59) A method for treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound according to paragraph 1 above, or a pharma- ceutically acceptable salt thereof, wherein said respiratory condition is chronic obstructive pulmonary disease. (Section 60) A method for treating or preventing respiratory deterioration due to a viral infection in a human in need thereof, comprising administering to said human a therapeutically effective amount of the compound according to paragraph 1 above, or a pharma- ceutical acceptable salt thereof. Administering to said human an acceptable salt of said compound, wherein said respiratory condition is asthma. (Section 61) 61. The method according to claim 59 or 60, wherein the viral infection is caused by respiratory syncytial virus, rhinovirus, or metapneumovirus. (Section 62) Item 1. A method for producing a medicament for treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, the method comprising using the compound according to item 1 or a pharma- ceutical acceptable salt thereof, wherein the respiratory condition is chronic obstructive pulmonary disease. (Section 63) A method for producing a medicament for treating or preventing the worsening of a respiratory condition due to a viral infection in a human in need thereof, the method comprising using the compound according to item 1 or a pharma- ceutical acceptable salt thereof, wherein the respiratory condition is asthma. (Section 64) 64. The method according to claim 62 or 63, wherein the viral infection is caused by respiratory syncytial virus, rhinovirus, or metapneumovirus. (Section 65) 2. Use of the compound according to item 1 or a pharma- ceutical agent thereof for the manufacture of a medicament for the treatment or prevention in a human of a respiratory condition aggravated by a viral infection, wherein the respiratory condition is chronic obstructive pulmonary disease. (Section 66) 2. Use of the compound according to item 1 or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment or prevention in a human of an exacerbation of a respiratory condition due to a viral infection, wherein the respiratory condition is asthma. (Section 67) 67. The use according to claim 65 or 66, wherein the viral infection is caused by respiratory syncytial virus, rhinovirus, or metapneumovirus. (Section 68) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a worsening respiratory condition due to a viral infection in a human in need thereof, wherein the respiratory condition is chronic obstructive pulmonary disease. (Section 69) Item 2. The compound according to item 1, or a pharma- ceutically acceptable salt thereof, for use in treating or preventing a worsening of a respiratory condition due to a viral infection in a human in need thereof, wherein the respiratory condition is asthma. (Section 70) 70. The use according to claim 68 or 69, wherein the viral infection is caused by respiratory syncytial virus, rhinovirus, or metapneumovirus. (Section 71) A method for making a compound of formula I-11, comprising:

change

change

change

change

change

change

Claims

[Claim 1] A method of making a compound of formula I-11, comprising: 【Chemistry 44】 (i) Compound of formula I-7: 【Chemistry 45】 and (ii) Compound of formula I-12: 【Chemistry 46】 to NdCl ３ and tetrabutylammonium chloride, wherein R is a benzyl group.

Images