Feedback-Usable Synthetic Genes, Target Seed Match Cassettes, and Use Thereof

Abstract

The present invention relates to feedback-enabled synthetic genes, polynucleotide targeting cassettes, vectors, and pharmaceutical compositions, and methods of making and using same, for the purpose of providing transgene expression in target tissues that are endogenously regulatable for the treatment of disorders such as dosage-sensitive intellectual disability.

Description

Technical Field

[0001] Priority Claim This application claims the benefit of U.S. Provisional Application No. 62 / 725,126, filed Aug. 30, 2018, and U.S. Provisional Application No. 62 / 861,044, filed Jun. 13, 2019, the entire contents of each of which are incorporated herein by reference in their entirety, under 35 U.S.C. § 119(e).

[0002] Description of Electronic Filing of Sequence Listing A sequence listing in ASCII text format, submitted under 37 C.F.R. § 1.821, having a name of 5470-844WO_ST25.txt, a size of 17,375 bytes, created on Aug. 22, 2019, and submitted via EFS-Web, is provided in lieu of a paper copy. The sequence listing is hereby incorporated by reference herein for the purpose of disclosing it.

[0003] Description of Government Support This invention was made with government support under grant number 4T32HD040127-15 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0004] The present invention relates to feedback-enabled synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions, and methods of making and using the same, for the purpose of providing expression of a transgene in a target tissue capable of endogenous regulation for treating disorders such as dosage-sensitive intellectual disability.

Background Art

[0005] Several neurodevelopmental disorders characterized by intellectual disability are mediated by mutations in genes that must be tightly regulated (see Table 1). The expression of endogenous gene products is carefully regulated in both target and non-target tissues through known and unknown molecular mechanisms. There are negative consequences in current gene therapy, such as over- and under-expression of gene products from gene therapy vectors in target tissues with inappropriate or incomplete regulation. Thus, there is a need in the art for vectors with improved regulation of expression. The present invention overcomes the weaknesses in the art by providing feedback-enabled synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions for the purpose of providing expression of transgenes in target tissues capable of endogenous regulation for treating disorders such as dosage-sensitive intellectual ability disorders. SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEM

[0006] The present invention is based in part on the development of feedback-enabled synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions for the purpose of providing expression of transgenes in target tissues capable of endogenous regulation for treating disorders such as dosage-sensitive intellectual ability disorders, such as Rett syndrome (RTT). The present invention was carried out in part with support from the Rett Syndrome Research Trust.

[0007] Accordingly, one aspect of the present invention is a synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, wherein the polynucleotide further comprises one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match, and wherein the one or more nucleic acid segments are inserted within the regulatory region of the polynucleotide such that the expression of the protein or nucleic acid of interest when the synthetic gene is delivered to a cell expressing the endogenous miRNA is reduced compared to the expression of the protein or nucleic acid of interest when a synthetic gene not comprising the one or more nucleic acid segments is delivered to a cell expressing the endogenous miRNA.

[0008] A further aspect of the present invention relates to a vector and a pharmaceutical composition comprising the synthetic gene of the present invention.

[0009] Another aspect of the present invention relates to a polynucleotide target cassette for providing dose-dependent inhibitory feedback to the synthetic gene of the present invention.

[0010] A further aspect relates to a method for preparing a synthetic gene, comprising the step of inserting a polynucleotide target cassette into the regulatory region of the synthetic gene.

[0011] A further aspect of the present invention relates to a method for producing a synthetic gene, comprising the step of inserting one or more nucleic acid segments comprising a seed match and 5' and 3' flanking sequences into the regulatory region of the polynucleotide of the synthetic gene.

[0012] Another aspect of the present invention relates to a method for identifying one or more seed matches and flanking sequences to be inserted into a synthetic gene, comprising the steps of identifying the seed matches and flanking sequences and inserting the seed matches and flanking sequences into the regulatory region of the synthetic gene.

[0013] A further aspect of the invention relates to a method of delivering a synthetic gene to a subject, the method comprising administering to the subject the synthetic gene, vector, or pharmaceutical composition of the invention.

[0014] A further aspect of the invention relates to a method of treating a disease associated with aberrant expression of an endogenous gene, the method comprising administering the synthetic gene, vector, or pharmaceutical composition of the invention, thereby treating the disease.

[0015] Another aspect of the invention relates to a method of treating in a subject a disease associated with aberrant expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene, the method comprising genetically knocking down the endogenous gene in a cell of the subject and administering the synthetic gene, vector, or pharmaceutical composition of the invention, thereby treating the disease.

[0016] These and other aspects of the invention are described in more detail in the following description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figures 15A - 15C

Figure 16

Figure 17

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The present invention will be described in more detail below. This description is not intended to be an exhaustive catalog of all the ways in which the invention may be practiced or all the features that may be added to the invention. For example, features illustrated with respect to one embodiment may be incorporated within other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Further, numerous modifications and additions to the various embodiments shown herein will be apparent to those skilled in the art in light of the present disclosure. These do not depart from the invention. Accordingly, the following specification is intended to illustrate some particular embodiments of the invention and is not intended to specifically identify all permutations, combinations, and variations thereof.

[0019] Specifically intended is that, unless otherwise specified by the context, the various features of the invention described herein can be used in any combination. Further, the invention contemplates that, in some embodiments of the invention, any feature or combination of features described herein can be excluded or omitted. By way of example, if the specification describes a complex as including components A, B, and C, this is specifically intended to mean that any of A, B, or C, or combinations thereof, can be omitted and disclaimed, either singly or in any combination.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0021] Unless specifically designated otherwise, nucleotide sequences are presented herein only as single strands, in the 5' to 3' direction, from left to right. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (in the case of amino acids) by either the single-letter or three-letter codes, in accordance with both 37 C.F.R. § 1.822 and established usage.

[0022] Except where otherwise specified, standard methods known to those of ordinary skill in the art may be used for the production of recombinant and synthetic genes, polypeptides, antibodies, or antigen-binding fragments thereof, the manipulation of nucleic acid sequences, the production of transformed cells, the construction of vector constructs, and the creation and analysis of data sets. Such techniques are known to those of ordinary skill in the art. See, for example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed. (Cold Spring Harbor, N.Y., 1989), F.M. AUSUBEL et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0023] All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference in their entirety.

[0024] Definitions As used in the description of the present invention and the appended claims, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0025] As used herein, "and / or" shall be construed to mean any and all possible combinations and alternatives of one or more of the associated listed items, and the absence of combinations when interpreted as "or", and shall include the same.

[0026] "Optional" or "optionally" means that the subsequent described event or situation can or cannot occur, and the description includes both the case where the event or situation occurs and the case where it does not occur.

[0027] Furthermore, in some embodiments of the present invention, it is also contemplated that any feature or combination of features described herein can be excluded or omitted.

[0028] Furthermore, when referring to measurable values such as the amount, dosage, time, temperature, etc. of a compound or agent of the present invention, the term "about" as used herein means including a variation of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.

[0029] As used herein, the transitional phrase "consisting essentially of" is construed to include the recited materials or steps, as well as those that do not materially affect the basic and novel features of the claimed invention. Therefore, the term "consisting essentially of" as used herein should not be construed as equivalent to "comprising".

[0030] The term "consisting essentially of" (and grammatical variations thereof) as applied to a polynucleotide or polypeptide sequence of the invention means a polynucleotide or polypeptide consisting of both the recited sequence (e.g., SEQ ID NO) and up to 10 additional nucleotides or amino acids (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) on the 5' and / or 3' end or N-terminus and / or C-terminus of the recited sequence, or between the two ends (e.g., between domains), such that the function of the polynucleotide or polypeptide is not substantially altered. The up to 10 additional nucleotides or amino acids include the total number when the additional nucleotides or amino acids are added together. The term "substantially altered" as applied to a polynucleotide of the invention refers to an increase or decrease of at least about 50% or more in the ability to express the encoded polypeptide as compared to the expression level of the polynucleotide consisting of the recited sequence. The term "substantially altered" as applied to a polypeptide of the invention refers to an increase or decrease of at least about 50% or more in biological activity as compared to the biological activity of the polypeptide consisting of the recited sequence.

[0031] As used herein, the term "sequence identity" has its standard meaning in the art. As is known in the art, several different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity can be determined by, but is not limited to, the local sequence identity algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981), the sequence identity alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970), the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444 (1988), the computer implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.), preferably using the default settings, the Best Fit sequence program described by Devereux et al., Nucl. Acid Res., 12:387 (1984), or by standard techniques known in the art, including by investigation.

[0032] An example of a useful algorithm is PILEUP. PILEUP uses progressive pairwise alignments to create a multiple sequence alignment from a group of related sequences. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplified version of the progressive alignment method of Feng and Doolittle, J. Mol. Evol., 35:351 (1987), which is similar to that described by Higgins and Sharp, CABIOS, 5:151 (1989).

[0033] Another example of a useful algorithm is the BLAST algorithm described in Altschul et al., J. Mol. Biol., 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program obtained from Altschul et al., Meth. Enzymol., 266:460 (1996), blast.wustl / edu / blast / README.html. WU-BLAST-2 uses several search parameters that are preferably set to their default values. The parameters are dynamic values and are established by the program itself according to the composition of the particular sequence of interest and the composition of the particular database against which the sequence of interest is being searched. However, the values can be adjusted to increase sensitivity.

[0034] An additional useful algorithm is gapped BLAST reported by Altschul et al., Nucleic Acids Res., 25:3389 (1997).

[0035] The value of percent amino acid sequence identity is determined by dividing the number of matching identical residues by the total number of residues in the "longer" sequence in the aligned region. The "longer" sequence is the one with the most actual residues in the aligned region (gaps introduced by WU-BLAST-2 to maximize the alignment score are ignored).

[0036] In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in a candidate sequence that are identical to the nucleotides in the polynucleotides specifically disclosed herein.

[0037] Alignment may involve the introduction of gaps in the sequences to be aligned. Further, in sequences containing more or fewer nucleotides than specifically disclosed herein, in one embodiment, it will be understood that the percentage of sequence identity will be determined based on the number of identical nucleotides relative to the total number of nucleotides. Thus, for example, the sequence identity of a shorter sequence than the specifically disclosed sequences herein will, in one embodiment, be determined using the number of nucleotides in the shorter sequence. In calculating percent identity, relative weights are not assigned to various manifestations of sequence variation such as insertions, deletions, substitutions, etc.

[0038] In one embodiment, only identity is given a positive score (+1), and all forms of sequence variation including gaps are not assigned a value of "0", which eliminates the need for a weighted scale or parameters as described below for calculating sequence similarity. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues in the "shorter" sequence in the aligned region and multiplying by 100. The "longer" sequence is the one with the most actual residues in the aligned region.

[0039] As used herein, an "isolated" nucleic acid or nucleotide sequence (e.g., "isolated DNA" or "isolated RNA") means a nucleic acid or nucleotide sequence that is separated from, or substantially free of, at least some of the other components of a naturally occurring organism or virus, such as the structural components of a cell or virus, or other polypeptides or nucleic acids that are generally found associated with the nucleic acid or nucleotide sequence.

[0040] Similarly, an "isolated" polypeptide means a polypeptide that is separated from, or substantially free of, at least some of the other components of a naturally occurring organism or virus, such as the structural components of a cell or virus, or other polypeptides or nucleic acids that are generally found associated with the polypeptide.

[0041] The term "endogenous" refers to a component that is found naturally in the environment, i.e., a gene, nucleic acid, miRNA, protein, cell, or other natural component that is expressed in a subject, as distinguished from an introduced component, i.e., an "exogenous" component.

[0042] As used herein, the term "heterologous" refers to a nucleotide / polypeptide that is derived from a foreign species or, in the case of the same species, whose composition and / or genomic locus has been substantially modified from its native form by intentional human intervention.

[0043] As used herein, the term "nucleic acid" refers to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. "Nucleic acid" may optionally also contain nucleotide bases that are not naturally occurring or are modified. The terms "nucleotide sequence" or "nucleic acid sequence" refer to both the sense and antisense strands of a nucleic acid, either as individual single strands or in a duplex. The term "ribonucleic acid" (RNA) includes RNAi (inhibitory RNA), dsRNA (double-stranded RNA), siRNA (small interfering RNA), shRNA (short / small hairpin RNA), mRNA (messenger RNA), miRNA (microRNA), tRNA (transfer RNA, whether charged or discharged with the corresponding acylated amino acid), long non-coding RNA (lncRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), and cRNA (complementary RNA), and the term "deoxyribonucleic acid" (DNA) includes cDNA and genomic DNA as well as DNA-RNA hybrids.

[0044] MicroRNA is a class of non-coding small RNAs derived from primary (pri-) miRNA transcripts encoded by miRNA genes. Pri-miRNA transcripts are processed into smaller 19-24 nucleotide RNAs, which can regulate gene expression through silencing reactions mediated, for example, by translational inhibition or cleavage.

[0045] The terms "nucleic acid segment", "nucleotide sequence", or more generally "segment" will be understood by those skilled in the art as functional terms including genomic sequences, ribosomal RNA sequences, transfer RNA sequences, messenger RNA sequences, small regulatory RNAs, operon sequences, and smaller engineered nucleotide sequences that express or are adapted to express proteins, polypeptides, or peptides. Also, the nucleic acids of the present disclosure can be synthesized either completely or in part by methods known in the art. Thus, all or a portion of the nucleic acids of the present disclosure can be synthesized using codons preferred by the selected host. Preferred codons for such species can be determined, for example, from the codons most frequently used in proteins expressed in a particular host species. Other modifications of the nucleotide sequence can result in mutants having slightly altered activity.

[0046] As used herein, the term "fragment" with respect to a nucleic acid refers to a nucleic acid that is reduced in length compared to a reference nucleic acid and is identical or substantially identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference nucleic acid, and that comprises, consists essentially of, and / or consists of a nucleotide sequence of contiguous nucleotides. Such nucleic acid fragments may, where appropriate, be included in a larger polynucleotide of which they are a component. In some embodiments, a nucleic acid fragment comprises, consists essentially of, or consists of at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, or more contiguous nucleotides. In some embodiments, a nucleic acid fragment comprises, consists essentially of, or consists of less than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500 contiguous nucleotides.

[0047] As used herein with respect to a polypeptide, the term "fragment" refers to a polypeptide having a reduced length as compared to a reference polypeptide and having an amino acid sequence of contiguous amino acids that is identical or substantially identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference polypeptide, consisting essentially of, and / or consisting of, such amino acids. Such polypeptide fragments may, where appropriate, be included within a larger polypeptide of which they are a component. In some embodiments, a polypeptide fragment consists essentially of, or consists of, at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, or more contiguous amino acids. In some embodiments, a polypeptide fragment consists essentially of, or consists of, less than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500 contiguous amino acids.

[0048] As used herein with respect to a nucleic acid, the term "functional fragment" or "active fragment" refers to a nucleic acid that encodes a functional fragment of a polypeptide.

[0049] As used herein, the term "functional fragment" or "active fragment" with respect to a polypeptide refers to a polypeptide fragment that retains at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more of at least one biological activity of the full-length polypeptide (e.g., the ability to upregulate or downregulate gene expression). In some embodiments, the functional fragment actually has a higher level of at least one biological activity of the full-length polypeptide.

[0050] As used herein, the term "modified" when applied to a polynucleotide or polypeptide sequence refers to a sequence that differs from the wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.

[0051] As used herein, to "isolate" or "purify" (or grammatical equivalents) a viral vector means that the viral vector is at least partially separated from at least some of the other components in the starting material.

[0052] The terms "enhance" and "increase" refer to an increase of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, or even 15-fold of a specified parameter.

[0053] As used herein, the terms "inhibit" and "reduce" or grammatical variations thereof refer to a decrease or attenuation of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more of a specified level or activity. In certain embodiments, the inhibition or reduction results in little or essentially no detectable activity (even if present in a meaningless amount, e.g., less than about 10% or even 5%).

[0054] As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNA transcripts), and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcript may sometimes be referred to as a "transcript", and the encoded polypeptide may sometimes be referred to as a "translation product". The transcript and the encoded polypeptide may sometimes be collectively referred to as "gene products". When the polynucleotide is derived from genomic DNA, expression may include mRNA splicing in eukaryotic cells. The expression product itself, such as the resulting nucleic acid or protein, may also be referred to as "expressed". The expression product can be characterized as intracellular, extracellular, or secretory. The term "intracellular" means within the cell. The term "extracellular" means outside the cell. A substance is "secretory" by a cell when it appears extracellularly from somewhere on or within the cell on a significant scale.

[0055] As used herein, the term "synthetic gene" refers to a nucleic acid sequence that is non-naturally made by intentional human design. A synthetic gene includes, among other components, a coding region for the protein or nucleic acid of interest, and a regulatory region for the expression of the coding region. The structural and functional components of a synthetic gene can be different and / or incorporated from multiple source materials. A synthetic gene may be delivered exogenously to a subject, which will be exogenous compared to the corresponding endogenous gene. When expressed in a cell, the synthetic gene product may be referred to as a synthetic product (such as "synthetic RNA" or "synthetic polypeptide"). Under certain conditions, a synthetic gene may also be referred to as a "transgene" so as to be interchangeable.

[0056] As used herein, the terms "transgenic" and / or "transgene" refer to a nucleic acid sequence containing the functional coding region of a gene that includes one or more exogenous nucleic acids. The exogenous nucleic acids can be stably integrated into the genome such that the polynucleotide is passed on through successive cell divisions. The exogenous nucleic acids can be integrated alone into the genome as part of a recombinant expression cassette. "Transgenic" can be used to designate any substrate whose genotype has been modified by the presence of exogenous nucleic acids.

[0057] The term "feedback" refers to information encoded in a molecule that is provided to the same substrate as a result of some result, effect, or function performed by the substrate. The substrate can be any type of micro- or macro-molecule, including but not limited to a gene, or a transcriptional or translational product of a gene such as RNA and protein. The term "feedback loop" refers to a loop of molecules that perform a function, effect, and / or result, such that information about that function, effect, and / or result is returned to a receiving source. For example, the function, effect, and / or result of the expression of a gene (e.g., MECP2) can result in feedback through the binding of an miRNA to the mRNA derived from that gene when the function, effect, and / or result of the expression of that gene causes the expression. A feedback loop can be inhibitory / negative (i.e., suppressing further continuation of a function, effect, and / or result) or positive (enhancing continuation). A substrate that can receive feedback is said to be "feedback-capable". Feedback whose strength of inhibition and / or enhancement is variable depending on the expression level and / or function of the nucleic acid or transcriptional or translational product of a gene is called "dose-dependent" feedback and / or "dose-dependent feedback loop".

[0058] The terms "polypeptide", "peptide", and "protein" may be used interchangeably and refer to polymers of amino acids of any length. The terms "nucleic acid", "nucleic acid sequence", and "polynucleotide" may be used interchangeably and refer to polymers of nucleotides of any length. As used herein, the terms "nucleotide sequence", "polynucleotide", "nucleic acid sequence", "nucleic acid molecule", and "nucleic acid fragment" refer to RNA, DNA, or a polymer of RNA, and single-stranded or double-stranded DNA optionally containing synthetic, non-natural, and / or modified nucleotide bases.

[0059] As used herein, the terms "gene of interest", "nucleic acid of interest", and / or "protein of interest" refer to a gene / nucleic acid / protein desired under specific contextual conditions.

[0060] The term "regulatory element" refers to a genetic factor that controls some aspect of the expression of a nucleic acid sequence. For example, a promoter is a regulatory element that promotes the initiation of transcription of an operably linked coding region. Other regulatory elements include splicing signals, polyadenylation signals, termination signals, and the like. The region in a nucleic acid sequence or polynucleotide in which one or more regulatory elements are found is referred to as the "regulatory region".

[0061] As used herein, the term coding region refers to a polynucleotide, such as a portion of a gene, that encodes a polypeptide.

[0062] As used herein with respect to nucleic acids, the term "operably linked" refers to a functional linkage between two or more nucleic acids. For example, a promoter sequence may be described as being "operably linked" to a heterologous nucleic acid sequence because the promoter sequence initiates and / or mediates the transcription of the heterologous nucleic acid sequence. In some embodiments, operably linked nucleic acid sequences are adjacent and / or in the same reading frame.

[0063] As used herein, the term "binding site" refers to any general structural feature that serves as the location of a bond between components. As applied to a nucleic acid or polynucleotide, the term "binding site" can refer to a nucleotide sequence within a particular motif of primary, secondary, or tertiary structure that provides a binding position for an interacting molecule, which may include, but is not limited to, other nucleic acids or proteins. As applied to a peptide, polypeptide, or protein, the term "binding site" can refer to an amino acid sequence within a particular motif of primary, secondary, tertiary, or quaternary structure that provides a binding position for an interacting molecule, which may include, but is not limited to, other nucleic acids or proteins.

[0064] As used herein, the term "seed match" specifically refers to a subset of nucleotides within a longer endogenous mRNA sequence that has been empirically identified, validated, or putatively predicted to be a relevant target nucleotide sequence for the recognition and complementary binding of a miRNA species by the corresponding mRNA containing said seed match. The terms "seed" or "seed region" refer to a subset of nucleotides within a longer endogenous miRNA sequence that has been empirically identified, validated, or putatively predicted to be a relevant nucleotide sequence for the recognition and complementary binding of a target seed match of an mRNA species by said miRNA species. Generally, the seed match of an mRNA is encoded within its respective 3 dash (3’) untranslated region (3’UTR), but may be present at other locations. A "validated" or "empirically identified" seed match is defined as those seed matches currently known in the art and those to be identified in the future. A "putative" or "predicted" seed match is defined as a seed match not yet empirically known or defined.

[0065] The terms "5'-flanking sequence" and / or "3'-flanking sequence" refer to a subset of nucleotides in a sequence found immediately adjacent (i.e., "flanking") to a specified sequence (e.g., a seed match) on either end (i.e., the 5'-flanking end and / or the 3'-flanking end) of a target sequence within a source sequence. In some cases, the 5'-flanking sequence may provide additional Watson-Crick (WC) complementary binding to a matching miRNA. Together, the 5'- and 3'-flanking sequences can contribute to the spacing between seed matches, which can promote cooperative repression by allowing two or more miRNAs to bind to adjacent seed matches (Grimson et al., 2007). The 5'- and 3'-flanking sequences can also provide a high % adenylate-uridylate (AU) nucleotide context that is correlated with an effective seed match (Grimson et al., 2007).

[0066] The term "3'UTR" refers to the section of an mRNA that directly follows the translation termination codon. Generally, an mRNA molecule is transcribed from a DNA sequence and later translated into a peptide, polypeptide, or protein. Some regions of the mRNA molecule sequence, including the 5' cap, 5' untranslated region (5'UTR), 3'UTR, and polyadenylation (polyA) tail, are not translated into protein. Generally, the 3'UTR contains regulatory regions that can affect gene expression after transcription.

[0067] As used herein, the term "gene dosage sensitivity" or "dosage sensitivity" disorder refers to a disease or disorder in which the onset, presentation, progression, symptoms, phenotype, and other related phenomena are caused by and vary in accordance with the relative functional expression levels of the nucleic acid (e.g., gene) or transcript or translation product of the gene (e.g., RNA species or protein) involved in the onset, presentation, progression, symptoms, phenotype, or other related phenomena of the disease or disorder. For example, a disorder may be described as dosage sensitive if its phenotype varies with different expression levels of a particular gene. As another example, a disorder may also be called dosage sensitive if the gene has been mutated to produce a protein with reduced or enhanced function that affects the onset, presentation, progression, symptoms, phenotype, or other related phenomena of the disorder.

[0068] As used herein, the term "intellectual disability" refers to a group of diseases, disorders, or physical impairments that affect the "intellectual ability" of a subject, including the intellectual functions, mental abilities, cognitive abilities, and / or adaptive functions of the subject's neurodevelopment, i.e., the abilities to reason, plan, think, and communicate. The term "intellectual disability" may be used interchangeably with "intellectual disorder". Other general symptoms that may be presented with intellectual disability include, but are not limited to, speech abnormalities, epileptic seizures, microcephaly, hypotonia, teeth grinding, and / or stereotypy. An intellectual disability in which the onset, presentation, progression, symptoms, phenotype, or other related phenomena vary may be called a "dosage-sensitive intellectual disability", and its causative gene may be called a "dosage-sensitive gene mediating intellectual ability".

[0069] As used herein, the terms "target tissue" and "off-target tissue" refer to the body regions, organs, tissues, structures, and / or cells of a subject in which a designated nucleic acid or protein of interest is expressed. "Target tissue" refers to the regions, organs, tissues, structures, and / or cells of a subject in which an endogenous nucleic acid or protein of interest is expressed under typical healthy and / or disease states. "Off-target tissue" refers to the regions, organs, tissues, structures, and / or cells of a subject in which an endogenous nucleic acid or protein of interest is not expressed under typical healthy and / or disease states.

[0070] "Vector" refers to a compound used as a vehicle to carry foreign genetic material into another cell where it can be replicated and / or expressed. A cloning vector containing foreign nucleic acid is called a recombinant vector. Examples of nucleic acid vectors are plasmids, viral vectors, cosmids, expression cassettes, and artificial chromosomes. Recombinant vectors typically contain an origin of replication, a multiple cloning site, and a selectable marker. A nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the "backbone" of the vector. The purpose of a vector that transfers genetic information to another cell is typically to isolate, propagate, or express the insert in the target cell. An expression vector (expression construct or expression cassette) is for the expression of an exogenous gene in a target cell and generally has a promoter sequence that drives the expression of the exogenous gene. The insertion of a vector into a target cell is called transformation or transfection in bacteria and eukaryotic cells, while the insertion of a viral vector is often called transduction. Also, the term "vector" can generally be used to describe, but is not limited to, things such as transformed cells or nanoparticles that serve to carry foreign genetic material into another cell.

[0071] "Pharmaceutically acceptable" means a material that is not toxic or otherwise undesirable, i.e., a material that can be administered to a subject without causing any undesirable biological effects.

[0072] As used herein, the term "polynucleotide target cassette" refers to a nucleotide sequence and / or nucleotide cassette that includes one or more pre-determined seed matches and 5' and 3' flanking sequences adjacent to each seed match. A polynucleotide target cassette can be designed by appropriately selecting seed matches to protect against an overexpression phenotype that is shared by multiple disorders having distinct genetic etiologies but a common target tissue when the cassette is inserted into a target gene. A polynucleotide target cassette can include any number of seed matches and 5' and 3' flanking sequences.

[0073] The terms "treating," "treatment," and "treatment of" (or grammatically equivalent terms) mean that the severity of a subject's condition is reduced or at least partially improved or remitted, and / or that some alleviation, mitigation, or reduction of at least one clinical symptom is achieved, and / or that there is a delay in the progression of the condition and / or a prevention or delay in the onset of a disease or disorder.

[0074] As used herein, the terms "prevent," "prevents," and "prevention" (and their grammatical equivalents) refer to a delay in the onset of a disease or disorder or a reduction in symptoms upon the onset of a disease or disorder. These terms do not imply the complete elimination of a disease and encompass any type of prophylactic treatment that reduces the incidence of a condition or delays the onset and / or progression of a condition.

[0075] As used herein, a "therapeutically effective" amount is an amount sufficient to provide some improvement or benefit to a subject. In other words, a "therapeutically effective" amount is an amount that results in some alleviation, mitigation, reduction, or stabilization of at least one clinical symptom in a subject. One of ordinary skill in the art will understand that the therapeutic effect need not be complete or curative so long as some benefit is provided to the subject.

[0076] As used herein, an "effective for prevention" amount is an amount sufficient to prevent and / or delay the onset of a disease, disorder, and / or clinical symptom in a subject, and / or to reduce and / or delay the severity of the onset of a disease, disorder, and / or clinical symptom in a subject, as compared to what would occur in the absence of the method of the present invention. One of ordinary skill in the art will understand that the level of prevention need not be complete, so long as some benefit is provided to the subject.

[0077] The terms "administering" and "administration" with respect to a synthetic gene, expression cassette, vector, plasmid, viral vector, transformed cell, nanoparticle, or pharmaceutical composition include any route by which a compound is introduced or delivered to a subject to perform its intended function. Administration can be effected by any suitable route, including oral, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, intracisternal, intrathecal, intraventricular, or subcutaneous), or topical. Administration includes self-administration and administration by another.

[0078] Synthetic gene The present invention relates to feedback-usable synthetic genes, polynucleotide target cassettes, vectors, and pharmaceutical compositions for the purpose of providing expression of an introduced gene capable of endogenous regulation in a target tissue for treating disorders such as dosage-sensitive intellectual disability.

[0079] Accordingly, one aspect of the present invention is a synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, wherein the polynucleotide further comprises one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match, and wherein the one or more nucleic acid segments are inserted within the regulatory region of the polynucleotide such that expression of the protein or nucleic acid of interest when the synthetic gene is delivered to a cell expressing an endogenous miRNA is reduced compared to expression of the protein or nucleic acid of interest when a synthetic gene not comprising the one or more nucleic acid segments is delivered to a cell expressing an endogenous miRNA.

[0080] In some embodiments, the coding region encoding the nucleic acid or protein of interest comprises the coding region of a gene, such as a gene associated with an intellectual ability gene dosage sensitivity disorder or a coding region of an active fragment of a gene. Genes associated with intellectual ability gene dosage sensitivity disorders include, but are not limited to, TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, FOXG1, AKT3, SLC6A1, or an active fragment thereof. In some embodiments, the coding region encoding the protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof.

[0081] The seed match can be of any nucleotide sequence length, generally about 3 to about 10 nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, or any range therein. In some embodiments, the seed match of the present invention is about 5 to about 10 nucleotides in length. In some embodiments, the seed match of the present invention is about 6 to about 8 nucleotides in length.

[0082] The synthetic gene of the present invention may contain one or more seed matches and 5' and 3' flanking sequences. In some embodiments, the synthetic gene contains at least two seed matches, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, or any range therein. In some embodiments, the synthetic gene contains three or more seed matches. In some embodiments, the synthetic gene contains three or more seed matches. In some embodiments, the synthetic gene contains 3 to 8 seed matches. In some embodiments, some or all of the seed matches are in the 3'UTR.

[0083] The 5' and / or 3' flanking nucleotide sequences can be of any length, generally about 1 to about 30 nucleotides, at the 5' and / or 3' ends of a specified sequence (e.g., a seed match). In some embodiments, the flanking nucleotide sequences of the invention are about 9 to about 13 nucleotides at the 5' and / or 3' ends of a specified sequence (e.g., a seed match). In some embodiments, the flanking nucleotide sequence is about 11 nucleotides at the 5' and / or 3' ends of a specified sequence (e.g., a seed match). Thus, in some embodiments of the invention, the total number of nucleotides in the 5' and 3' flanking sequences of a specified sequence (e.g., a seed match) is about 7 to about 40 nucleotides, e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides, or any range therein. In some embodiments, the total number of nucleotides in the 5' and 3' flanking sequences of a specified sequence (e.g., a seed match) is about 20 to about 25 nucleotides. In some embodiments, the total number of nucleotides in the 5' and 3' flanking sequences of a specified sequence (e.g., a seed match) is about 22 nucleotides. In some embodiments, each seed match is separated from the next most proximal seed match by the 3' and 5' flanking sequences therebetween. Thus, in some embodiments of the invention, at least two seed matches are separated by about 7 to about 40 nucleotides. In some embodiments, at least two seed matches are separated by about 20 to about 25 nucleotides. In some embodiments, at least two seed matches are separated by about 22 nucleotides.

[0084] The seed match and 5' and 3' flanking sequences of the present invention can bind to one or more miRNAs. In some embodiments, the seed match and 5' and 3' flanking sequences bind to one or more miRNAs, including miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p / 98-5p, miR-29-3p, miR-338-3p, miR-98-5p, miR-7-5p, miR-494-3p, or any combination thereof. Furthermore, without wishing to be bound by theory, it is conceptually possible that as yet unidentified miRNAs may contribute to the MeCP2 feedback loop. Any miRNA containing a seed sequence that permits Watson-Crick (WC) base pairing between a specific miRNA seed and the miRNA seed match in the target panel may help mediate the endogenous regulation of the nucleic acid or protein of interest, i.e., the product of the coding region encoding the nucleic acid or protein of interest. Thus, in some embodiments, the seed match and 5' and 3' flanking sequences bind to one or more miRNAs that include a seed sequence that permits WC base pairing between the miRNA seed sequence and the seed match of the present invention. In some embodiments, the seed match and 5' and 3' flanking sequences bind to the miRNAs miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the seed match and 5' and 3' flanking sequences bind to the miRNAs miR-690, miR-451a, and let-7-5p. In some embodiments, the seed match and 5' and 3' flanking sequences do not bind to the miRNAs miR-22, miR-19, miR-132, and / or miR-124.In some embodiments, the seed match and the flanking 5' and 3' sequences adjacent to the seed match are the nucleotide sequence of SEQ ID NO: 1, which contains the seed matches of miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p, or is at least 70% identical thereto, for example, contains nucleotides that are at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, consists essentially of, or consists of. The seed match is underlined. SEQ ID NO: 1. "Reg2" target seed match and 5' and 3' flanking sequences 5’CTGTTCTAGCCC CCAAAGA GTTTTCTGTGCTTGCTTTTGAA ACTTGAA GTCTTGAAAACCAAAGACATAG ATGTGAA AATTTTAGGCAGTGTAAGCTGAT AGCACAA GTTCTGGCGACTCACAATTATG CTGTGAA TTTTACAAAAAGAAGCAGTAAT CTACCTCA GCCGATAAC-3’

[0085] In some embodiments, the seed match and the flanking 5' and 3' sequences adjacent to the seed match are the nucleotide sequence of SEQ ID NO: 2, which contains the seed matches of miR-451a, let-7-5p, and miR-690, or is at least 70% identical thereto, for example, contains nucleotides that are at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, consists essentially of, or consists of. The seed match is underlined. SEQ ID NO: 2. "Reg1" target seed match and 5' and 3' flanking sequences 5’ATAAGGGCAGA AACGGTT CACATTCCATTCTGCCCCGGAC CTACCTC CCTCCCTCTCCTTATCAAACCC TAGCCTT GCTTGTTAAAT-3’

[0086] In some embodiments, the invention includes a vector comprising a synthetic gene. The vector can be any suitable means for delivering a polynucleotide to a cell. In some embodiments, the vector is a plasmid, viral vector, expression cassette, transformed cell, or nanoparticle.

[0087] In certain embodiments, the invention provides a pharmaceutical composition comprising the synthetic gene or vector of the invention in a pharmaceutically acceptable carrier. In some embodiments, the invention provides a pharmaceutical composition comprising the synthetic gene or vector of the invention in a pharmaceutically acceptable carrier and optionally including other medicinal agents, pharmaceuticals, stabilizers, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier is typically a liquid. For other administration methods, the carrier can be either solid or liquid. For inhalation administration, the carrier is for respiratory use and preferably in the form of solid or liquid particles.

[0088] In certain embodiments, the invention provides a polynucleotide target cassette for providing dose-dependent inhibitory feedback to a synthetic gene, the cassette comprising one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match. The polynucleotide target cassette is used to generate a synthetic gene via insertion of the cassette into a regulatory region of the polynucleotide of the synthetic gene, thereby conferring on the synthetic gene the ability to provide dose-dependent inhibitory feedback in which an miRNA capable of binding to the provided seed match in the polynucleotide target cassette can regulate the expression of the synthetic gene.

[0089] The polynucleotide target cassette can include any number of seed matches and 5' and 3' flanking sequences. In some embodiments, the polynucleotide includes at least two seed matches as well as 5' and 3' flanking sequences, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, or any range therein. In some embodiments, the polynucleotide target cassette includes three or more seed matches and 5' and 3' flanking sequences. In some embodiments, the polynucleotide target cassette includes 3 to 8 seed matches and 5' and 3' flanking sequences. In some embodiments, the polynucleotide target cassette includes a seed match and 5' and 3' flanking sequences that bind to one or more miRNAs that can aid in mediating exogenous regulation of a target nucleic acid or protein of interest, i.e., the product of the coding region encoding the nucleic acid or protein of interest, wherein the one or more miRNAs include a seed sequence that permits WC base pairing between the miRNA seed sequence and the seed match. In some embodiments, the polynucleotide target cassette includes a seed match and 5' and 3' flanking sequences that bind to one or more miRNAs selected from miR-690, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p, or any combination thereof. In some embodiments, the polynucleotide target cassette includes a seed match and 5' and 3' flanking sequences that bind to the miRNAs miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the polynucleotide target cassette includes a seed match and 5' and 3' flanking sequences that bind to the miRNAs miR-690, miR-451a, and let-7-5p. In some embodiments, the polynucleotide target cassette includes a seed match that is about 5 to about 10 nucleotides in length. In some embodiments, the polynucleotide target cassette includes a seed match that is about 6 to about 8 nucleotides in length.In some embodiments, the polynucleotide target cassette comprises 5' and 3' flanking sequences adjacent to the seed match, each having a length of about 9 to about 13 nucleotides. In some embodiments, the polynucleotide target cassette comprises 5' and 3' flanking sequences adjacent to the seed match, each having a length of about 11 nucleotides. In some embodiments, the polynucleotide target cassette comprises a seed match and 5' and 3' flanking sequences adjacent to the seed match, comprising nucleotides that are at least 70% identical to the nucleotide sequence of SEQ ID NO: 1, for example, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, consisting essentially of, or consisting of. In some embodiments, the polynucleotide target cassette comprises a seed match and 5' and 3' flanking sequences adjacent to the seed match, comprising nucleotides that are at least 70% identical to the nucleotide sequence of SEQ ID NO: 2, for example, at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, consisting essentially of, or consisting of.

[0090] Method for producing a synthetic gene The present invention further provides a method for producing a synthetic gene that exhibits dose-dependent inhibitory feedback. In one embodiment, the present invention provides a method for preparing a synthetic gene comprising a polynucleotide encoding a protein or nucleic acid of interest and one or more regulatory regions, the method comprising inserting the polynucleotide target cassette of the present invention into the regulatory region of the synthetic gene.

[0091] In some embodiments, the present invention provides a method of inserting a nucleic acid segment into a regulatory region of a synthetic gene. In some embodiments, the present invention provides a method of inserting a seed match known to bind or newly identified to bind to a target miRNA into a regulatory region of a polynucleotide of a synthetic gene. In some embodiments, the present invention provides a method of preparing a synthetic gene by inserting a polynucleotide target cassette into a regulatory region of a polynucleotide of a synthetic gene, thereby conferring on the synthetic gene the ability of dose-dependent inhibitory feedback in which a miRNA capable of binding to a provided seed match within the polynucleotide target cassette can regulate the expression of the synthetic gene. In some embodiments, the present invention provides a method of making a synthetic gene comprising inserting one or more nucleic acid segments comprising a seed match and 5' and 3' flanking sequences into a regulatory region of a polynucleotide of the synthetic gene. In some embodiments, the method can include removing one or more endogenous seed matches found within the regulatory region of the polynucleotide of the synthetic gene.

[0092] In some embodiments, the seed match and 5' and 3' flanking sequences inserted into the synthetic gene can bind to miRNAs expressed in target and / or off-target tissues, thereby conferring on the synthetic gene the feedback usability to inhibit the expression of the synthetic gene in off-target tissues and provide endogenous regulation of the synthetic gene in target tissues. In some embodiments, the synthetic gene of the present invention excludes a seed match and 5' and 3' flanking sequences from miRNAs expressed in off-target tissues. In some embodiments, the synthetic gene of the present invention excludes the seed match and 5' and 3' flanking sequences of miRNAs miR-22, miR-19, miR-132, and / or miR124.

[0093] In another embodiment, the present invention provides a method for generating a synthetic gene, comprising: screening for miRNAs with increased expression when a protein or nucleic acid of interest is expressed in a cell, as compared to when the protein or nucleic acid of interest is not expressed; identifying seed matches and flanking regions for one or more miRNAs with increased expression; preparing a nucleic acid segment comprising the seed match and flanking regions to be inserted into the regulatory region of the polynucleotide; and inserting one or more of the nucleic acid segments comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match into the regulatory region of a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions.

[0094] In some embodiments of the method of making a synthetic gene, the coding region encoding the protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, SLC6A1, FOXG1, AKT3, or an active fragment thereof. Active fragments include, but are not limited to, ΔN, ΔNC, and / or ΔNIC active MeCP2 fragments, which account for 88%, 52%, and 32% of full-length MeCP2, respectively, but retain the conserved functionality of methyl CpG binding and the nuclear receptor corepressor / silencing mediator for interaction of retinoic acid and thyroid hormone receptor (NCoR / SMRT) with DNA to enable physical connection with the NCoR / SMRT complex. These active fragments are cleavage fragments of the full-length MeCP2 protein, and as described in Tillotson et al. (Tillotson et al., 2017, Nature, 550(7676):398-401), the disclosure of which is incorporated herein by reference, ΔN contains a deletion of residues 13-71 on the N-terminal side of the methyl CpG binding domain (MBD, residues 72-173) of the full-length MeCP2 isoform e2, ΔNC additionally contains a deletion of residues 313-484 on the N-terminal side of the NCoR-SMRT interaction domain (NID, residues 272-312), and ΔNIC additionally replaces the intervening amino acids between the MBD and NID domains with a nuclear localization signal from the SV40 virus connected by a short flexible linker. The active fragment of MeCP2 used for the treatment of RTT is derived from the e1 isoform of MeCP2. The amino acid numbering described herein is based on the MeCP2 e2 isoform amino acid sequence by convention.

[0095] In some embodiments, the coding region encoding the protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof. In some embodiments, one or more nucleic acid segments bind to one or more miRNAs selected from the group consisting of miR-690, miR-124-3p, miR-451a, miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p / 98-5p, and miR-494-3p. In some embodiments, the seed match as well as the 5' and 3' flanking sequences bind to miRNAs miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p. In some embodiments, the seed match as well as the 5' and 3' flanking sequences bind to miRNAs miR-690, miR-451a, and let-7-5p.

[0096] In another aspect, the present invention provides a method for identifying one or more seed matches of miRNAs and 5' and 3' flanking sequences whose expression is increased when a protein or nucleic acid of interest is expressed in a cell as compared to when the protein or nucleic acid of interest is not expressed in the cell, and inserting the seed match and the 5' and 3' flanking sequences into a regulatory region of a synthetic gene comprising a polynucleotide comprising a coding region encoding the protein or nucleic acid of interest and one or more regulatory regions. In some embodiments, the method for identifying one or more seed matches of miRNAs and 5' and 3' flanking sequences to be inserted into a synthetic gene further comprises expressing the protein or nucleic acid of interest in a cell, collecting miRNAs from the cell, and calculating the expression levels of the miRNAs when the protein or nucleic acid of interest is expressed in the cell as compared to when the protein or nucleic acid of interest is not expressed in the cell, thereby creating a nucleic acid dataset of the miRNAs. In some embodiments, the identification method can include screening a nucleic acid dataset (e.g., an existing dataset) for miRNAs whose expression is increased when the protein or nucleic acid of interest is expressed in the cell as compared to when the protein or nucleic acid of interest is not expressed in the cell, and / or identifying miRNAs whose expression is increased when the protein or nucleic acid of interest is expressed in the cell as compared to when the protein or nucleic acid of interest is not expressed in the cell, and / or screening a nucleic acid dataset for validated or putative seed matches and 5' and 3' flanking sequences.

[0097] As used herein, the term "dataset" refers to information obtained from experiments or computer analyses, i.e., a collection of related sets of data, including but not limited to any type of data including nucleic acid sequences or amino acid sequences. A dataset can be screened and / or searched in other ways for specific data of interest depending on the variable parameters defined by each particular dataset. In some embodiments, the dataset is a nucleic acid dataset, i.e., a dataset containing nucleic acid sequences. In some embodiments, the dataset is a 3'UTR dataset.

[0098] In some embodiments, the protein or nucleic acid of interest is a transcriptional or translational product of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, SLC6A1, FOXG1, AKT3, MECP2, or an active fragment thereof. In some embodiments, the protein or nucleic acid of interest is a transcriptional or translational product of the gene MECP2 or an active fragment thereof.

[0099] Methods of using synthetic genes In another aspect of the invention, there is provided a method of delivering a synthetic gene, comprising administering to a subject the synthetic gene, vector, and / or pharmaceutical composition of the invention, thereby delivering the synthetic gene to the subject.

[0100] In a further aspect of the invention, there is provided a method of treating a disease associated with abnormal expression of an endogenous gene in a target tissue, or expression of a mutant protein encoded by an endogenous gene in a target tissue, comprising administering a synthetic gene, vector, and / or pharmaceutical composition of the invention that encodes a protein or nucleic acid of interest encoded by an endogenous gene, thereby treating the disease. In some embodiments, the invention can be administered to a target tissue. In some embodiments, the invention can be administered to target and off-target tissues, thereby inhibiting expression of the synthetic gene in the off-target tissue and intrinsically regulating expression of the synthetic gene in the target tissue.

[0101] In some embodiments, a method of treating a disease may further comprise genetically knocking down and / or knocking out an endogenous gene encoding a protein or nucleic acid of interest in a subject. In some embodiments, the endogenous gene encoding the protein or nucleic acid of interest is MECP2. Genetically knocking down or “knocking down” an endogenous gene, or knocking out or “knocking out” an endogenous gene, includes, but is not limited to, using RNAi, transcription activator-like effectors and nucleases (TALE and TALEN), or clustered regularly interspaced short palindromic repeats (CRISPR-cas9) methods to introduce a matching shRNA, TALE or TALEN, or CRISPR / cas9 expression vector into a subject, tissue, and / or cell expressing the endogenous gene, thereby removing or reducing the expression of the endogenous nucleic acid or protein of interest as compared to the expression of the endogenous nucleic acid or protein in the absence of RNAi, TALE, TALEN, or CRISPR / cas9 treatment, and can be performed using any technique or method currently known or later identified in the art. These techniques and others are reviewed in Boettcher and McManus, 2015, Mol. Cell, 58(4):575-585, and U.S. Patent Nos. 7,195,916 to Qin et al., 8,440,431 to Voytas et al., 8,889,356 to Zhang, 8,871,445 to Cong et al., and 10,000,772 to Doudna et al., each of which is incorporated herein by reference in its entirety.

[0102] In a further embodiment of the present invention, there is provided a method for treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by the endogenous gene in a subject, comprising the steps of genetically knocking down the endogenous gene in the target cells and administering a synthetic gene, vector, or pharmaceutical composition of the present invention encoding the protein or nucleic acid of interest encoded by the endogenous gene, thereby treating the disease.

[0103] The terms "patient", "subject", "individual", etc. are used interchangeably herein and refer to any animal or its cells that are amenable to the methods described herein, regardless of in vitro or in situ. In a preferred embodiment, the patient, subject, or individual is a mammal. In some embodiments, the mammal is a mouse, rat, guinea pig, non-human primate, dog, cat, or livestock (e.g., horse, cow, pig, goat, sheep). In some embodiments, the patient, subject, or individual is a human. In some embodiments, the patient, subject, or individual is at risk of an intellectual ability gene dosage sensitivity disorder. In some embodiments, the patient, subject, or individual is at risk of Rett syndrome. As a further option, the subject can be an experimental animal and / or an animal model of a disease.

[0104] A further aspect of the present invention relates to a method for treating a disorder associated with abnormal expression of a nucleic acid or protein of interest in a subject in need thereof, comprising the step of delivering a therapeutically effective amount of a synthetic gene, vector, and / or pharmaceutical composition of the present invention to the subject, thereby treating the disorder associated with abnormal expression of the nucleic acid or protein of interest in the subject.

[0105] In some embodiments, the nucleic acid or protein of interest is associated with an intellectual ability gene dosage sensitivity disorder. Examples of nucleic acids or proteins of interest associated with intellectual ability gene dosage sensitivity disorders include, but are not limited to, TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, FOXG1, AKT3, SLC6A1, MECP2, or any active fragment thereof.

[0106] Examples of intellectual ability gene dosage sensitivity disorders include, but are not limited to, Rett syndrome, MeCP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, reverse Sotos syndrome, alpha thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt-Hopkins syndrome, Moebius-Wilson syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Dews syndrome, SLC6A1 duplication, and trisomy 18. In some embodiments, the nucleic acid or protein of interest is MECP2 or any active fragment thereof, and the intellectual ability gene dosage sensitivity disorder associated with MECP2 is Rett syndrome and / or MeCP2 duplication syndrome.

[0107] In certain embodiments, the synthetic gene, vector, and / or pharmaceutical composition are delivered to a subject, for example, systemically (e.g., intravenously) or directly to the central nervous system of the subject (e.g., into the cerebrospinal fluid by intrathecal, intracisternal, or intraventricular injection). In some embodiments, the synthetic gene, vector, and / or pharmaceutical composition are delivered by a delivery route selected from enteral, parenteral, intrathecal, intracisternal, intracerebral, intraventricular, intranasal, intra-aural, intra-ocular, peri-ocular, intra-rectal, intramuscular, intraperitoneal, intravenous, oral, sublingual, subcutaneous, and transdermal. In some embodiments, the synthetic gene, vector, and / or pharmaceutical composition are delivered intravenously. In some embodiments, the synthetic gene, vector, and / or pharmaceutical composition are delivered intravenously, intracisternally, intrathecally, and / or intraventricularly and are delivered directly to the cerebrospinal fluid (``intra-CSF'').

[0108] One aspect of the invention is a method of transferring a synthetic gene into cells in vitro. The synthetic gene and / or vector of the invention can be introduced into cells in an appropriate amount. In embodiments of viral vectors, the viral vector can be introduced into cells at an appropriate multiplicity of infection according to standard transduction methods suitable for specific target cells. The titer of the viral vector or capsid to be administered may vary depending on the type and number of target cells and the specific viral vector or capsid, and can be determined by one of ordinary skill in the art without undue experimentation. In certain embodiments, at least about 10 2 infectious units, more preferably at least about 10 2 、10 3 、10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、or 10 13 infectious units are introduced into the cells.

[0109] Cells into which the synthetic gene and / or vector of the present invention, such as a viral vector, can be introduced include, but are not limited to, nerve cells (cells of the peripheral and central nervous systems, particularly including brain cells such as neurons, oligodendrocytes, glial cells, astrocytes, etc.), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g., intestinal and airway epithelial cells), skeletal muscle cells (including myoblasts, myotubes, and myofibrils), diaphragm muscle cells, dendritic cells, pancreatic cells (including islet cells), hepatocytes, cells of the gastrointestinal tract (including smooth muscle cells and epithelial cells), heart cells (including cardiomyocytes), bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, joint cells (including, e.g., cartilage, meniscus, synovium, and bone marrow), germ cells, and the like. Alternatively, the cells can be any progenitor cells. As a further alternative, the cells can be stem cells (e.g., neural stem cells, liver stem cells). Further, as described above, the cells can be of any species origin.

[0110] The synthetic gene and vector of the present invention, such as a viral vector, can be introduced into cells in vitro for the purpose of administering to a subject with modified cells. In certain embodiments, cells are removed from a subject, the synthetic gene and / or vector of the present invention, such as a viral vector, is introduced therein, and then the cells are returned to the subject. Methods of removing cells from a subject for ex vivo treatment and then introducing and returning them into the subject are known in the art (see, e.g., U.S. Patent No. 5,399,346). Alternatively, the synthetic gene and / or vector of the present invention, such as a viral vector, is introduced into cells from another subject, cultured cells, or cells from any other suitable source, and the cells are administered to a subject in need thereof.

[0111] Suitable cells for ex vivo gene therapy are as described above. The dosage of cells to be administered to a subject varies depending on the age, condition, and species of the subject, the type of cells, the nucleic acid expressed by the cells, the mode of administration, and the like. Typically, at least about 10 per dose2 ~about 10 8 or about 10 3 ~about 10 6 administer about 10 to about 10 cells in a pharmaceutically acceptable carrier. In certain embodiments, the cells transduced with the vector are administered to a subject, in an effective amount, in combination with a pharmaceutical carrier.

[0112] Human subjects include, for example, neonates, infants, juveniles, and adults because the subject is at risk for or is thought to be at risk for a disorder, including those described herein, or would benefit from delivery of a synthetic gene, including those described herein. Optionally, the subject is "in need of" the methods of the invention.

[0113] In certain embodiments, the synthetic gene of the invention is administered to a subject in need thereof as early as possible during the life of the subject, e.g., immediately upon diagnosis of abnormal expression or activity of the nucleic acid or protein of interest in the subject. In some embodiments, the synthetic gene is administered to a neonatal subject, e.g., after identification of abnormal expression or activity of the nucleic acid or protein of interest by neonatal screening. In some embodiments, the synthetic gene is administered to a fetus in utero, e.g., after identification of abnormal expression or activity by prenatal screening. In some embodiments, the synthetic gene is administered to a subject upon occurrence of symptoms associated with abnormal expression or activity of the nucleic acid or protein of interest in the subject, or immediately upon suspicion or diagnosis of having abnormal expression or activity of the nucleic acid or protein of interest. In some embodiments, the synthetic gene is administered to a subject prior to occurrence of symptoms associated with abnormal expression or activity of the nucleic acid or protein of interest in the subject, e.g., to a subject suspected or diagnosed with having abnormal expression or activity but not yet showing symptoms.

[0114] A further aspect of the invention is a method of delivering a synthetic gene, vector, and / or pharmaceutical composition of the invention, e.g., a synthetic gene of the invention, to a subject. In certain embodiments, the method includes a method of delivering a synthetic gene to an animal subject, the method including administering an effective amount of the synthetic gene according to the invention to the animal subject. Administration of the synthetic gene of the invention to a human or animal subject in need thereof can be by any means known in the art. Optionally, the synthetic gene and / or vector is delivered in an effective dosage in a pharmaceutically acceptable carrier.

[0115] The dosage of the vector to be administered to a subject depends on the mode of administration, the disease or condition to be treated, the condition of the individual subject, the particular viral vector, and the nucleic acid to be delivered, and can be determined in a routine manner. In embodiments of viral vectors, exemplary dosages to achieve a therapeutic effect are at least about 10 2 、10 3 、10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、10 3 、10 14 、10 15 、10 16 transduction units or more viral titer. The dosage and viral titer transduction units can be calculated as vector or viral genome (vg).

[0116] In certain embodiments, multiple administrations (e.g., 2, 3, 4, or more administrations) can be used to achieve the desired level of gene expression over periods of various intervals, e.g., once daily, once weekly, once monthly, once yearly, etc.

[0117] Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intrauterine (or intraovarian), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), local (e.g., to both the skin and mucosal surfaces including the airway surface, and transdermal administration), intralymphatic, etc., and also direct injection into a tissue or organ (e.g., into the liver, skeletal muscle, cardiac muscle, diaphragm muscle, or brain). Administration can also be to a tumor (e.g., into or near the tumor or lymph node). The most appropriate route in any given case depends on the nature and severity of the condition being treated, as well as the nature of the particular vector being used.

[0118] In some embodiments, the vector is administered to the CNS, the peripheral nervous system, or both.

[0119] In some embodiments, the vector is administered directly to the CNS, such as the brain or spinal cord. Direct administration can result in a high specificity of transduction of CNS cells, such that for example at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art for directly administering a vector to the CNS can be used. The vector can be introduced into the spinal cord, brain stem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (including the cerebrum, cortex, basal ganglia, hippocampus, amygdala, including the striatum, occipital lobe, temporal lobe, parietal lobe, and frontal lobe), limbic system, neocortex, striatum, cerebrum, and inferior colliculus. The vector can also be administered to various regions of the eye, such as the retina, cornea, or optic nerve. The vector can be delivered into the cerebrospinal fluid (e.g., by lumbar puncture) for a more dispersed administration of the vector.

[0120] Delivery vectors can be administered to the desired regions of the CNS by any route known in the art, including, but not limited to, delivery into the subarachnoid space, into the brain, into the ventricles, intranasally, into the ear, into the eye (e.g., intravitreally, subretinally, into the anterior chamber), and around the eye (e.g., in the sub-Tenon's space), or any combination thereof.

[0121] Delivery vectors can be administered in a manner that results in a more widespread transduction of tissues, including the CNS, the peripheral nervous system, and / or other tissues.

[0122] Typically, the vector is administered in a liquid formulation by direct injection (e.g., stereotactic injection) into the desired region or compartment in the CNS and / or other tissues. In some embodiments, the vector can be delivered via a reservoir and / or a pump. In other embodiments, the vector can be provided by topical application to the desired region or by intranasal administration of an aerosol formulation. Administration into the eye or ear can be by topical application of droplets. As a further alternative, the vector can be administered as a solid sustained-release formulation. For example, the sustained release of parvovirus and AAV vectors is described in International Publication WO01 / 91803.

[0123] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, as solid forms suitable for solution or suspension in a liquid prior to injection, or as emulsions. Alternatively, the vector can be administered in a non-systemic, local manner, e.g., in a depot or sustained-release formulation. Further, viral vectors can be delivered dried into surgically implantable matrices such as bone graft substitutes, sutures, stents, etc. (e.g., as described in U.S. Patent No. 7,201,898).

[0124] Pharmaceutical compositions suitable for oral administration can be presented in separate units such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of the present invention as a powder or granules, as a solution or suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil emulsion. Oral delivery can be effected by complexing the viral vector of the present invention with a carrier that can withstand degradation by digestive enzymes in the intestine of an animal. Examples of such carriers include plastic capsules or tablets known in the art. Such formulations are prepared by any suitable pharmaceutical method, which includes the step of associating the composition with a suitable carrier (which may contain one or more accessory ingredients as described above). Generally, pharmaceutical compositions according to embodiments of the present invention are prepared by uniformly and carefully mixing the composition with a liquid or finely divided solid carrier or both, and then, if necessary, shaping the resulting mixture. For example, tablets can be prepared by compressing or molding a powder or granules containing the composition, optionally together with one or more accessory ingredients. Compressed tablets are prepared by compressing, in a suitable machine, a composition in a free-flowing form such as a powder or granules optionally mixed with a binder, a lubricant, an inert diluent, and / or a surfactant / dispersing agent. Molded tablets are produced by molding a powdered compound moistened with an inert liquid binder in a suitable machine.

[0125] Pharmaceutical compositions suitable for buccal (sublingual) administration include lozenges containing the composition of the present invention in a flavored base, usually sucrose and acacia or tragacanth, and pastilles containing the composition in an inert base such as gelatin and glycerin or sucrose and acacia.

[0126] Pharmaceutical compositions suitable for parenteral administration can include sterile aqueous and non-aqueous injection solutions of the compositions of the present invention, and the preparations are optionally isotonic with the blood of the intended recipient. These preparations can contain antioxidants, buffers, bacteriostats, and solutes to render the composition isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions, and emulsions can include suspending and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic esters for injection such as ethyl oleate. Aqueous carriers include water, alcoholic solutions / aqueous solutions, emulsions, or suspensions, including physiological saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include liquid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), etc. For example, preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, and inert gases may also be present.

[0127] The composition can be presented in unit / dose or multiple-dose containers, for example, in sealed ampoules and vials, and can be stored in a lyophilized state that requires only the addition of a sterile liquid carrier, for example, physiological saline or water for injection, immediately prior to use.

[0128] Immediate injection solutions and suspensions can be prepared from the sterile powders, granules, and tablets of the types already described. For example, it is possible to provide a stable sterile composition for injection of the present invention in a unit dosage form in a sealed container. The composition can be provided in the form of a lyophilizate that can be reconstituted in a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be a composition of the present invention from about 1 μg to about 10 grams. If the composition is substantially water-insoluble, a sufficient amount of a physiologically acceptable emulsifier can be included in an amount sufficient to emulsify the composition in an aqueous carrier. One such useful emulsifier is phosphatidylcholine.

[0129] Pharmaceutical compositions suitable for rectal administration can be presented as unit dosage suppositories. These can be prepared by mixing the composition with one or more conventional solid carriers such as, for example, cocoa butter, and then shaping the resulting mixture.

[0130] The pharmaceutical compositions of the present invention suitable for topical application to the skin can take the form of ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils. Carriers that can be used include, but are not limited to, petrolatum, lanolin, polyethylene glycol, alcohol, transdermal enhancers, and combinations of two or more thereof. In some embodiments, for example, topical delivery can be effected by mixing the pharmaceutical composition of the present invention with a lipophilic reagent (such as DMSO) that can pass into the skin.

[0131] Pharmaceutical compositions suitable for transdermal administration can be in the form of discrete patches adapted to remain in intimate contact with the epidermis of a subject for an extended period of time. Compositions suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Pharm.Res., 3:318 (1986)), and typically take the form of an optionally buffered aqueous solution of the composition of the present invention. Suitable formulations can include citric acid or bis / tris buffer (pH 6) or ethanol / water.

[0132] The vectors disclosed herein can be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respiratory particles consisting of the vector that the subject inhales. The respiratory particles can be liquid or solid. An aerosol of liquid particles containing the viral vector can be generated by any suitable means, such as using a pressure-driven aerosol nebulizer or an ultrasonic nebulizer known to those skilled in the art. See, for example, U.S. Patent No. 4,501,729. Similarly, an aerosol of solid particles containing the vector can be generated by techniques known in the pharmaceutical art using any solid particle pharmaceutical aerosol generator.

[0133] The present invention has been described thus far and will be described in more detail in the following examples, which are included herein for illustrative purposes only and are not intended to limit the present invention.

Example

[0134]

Example

[0135] Identification of miRNAs Upregulated by MECP2 Expression To identify endogenous miRNAs upregulated by supra-physiological MeCP2 expression, RNA from the cerebellum and medulla of mice treated with a toxic dose of the MECP2 vector was screened. Mecp2+ / y and Mecp2- / y mice were treated with saline or 1×10 12Either AAV9 / MeP426-hMECP2-myc-RDH1pA of the vector genome (vg) was injected into the cisterna magna (postnatal day 28 [PND28], injection volume of 10 μL, n = 2 mice / treatment). Two weeks after treatment, the mice were euthanized with a lethal dose of tribromoethanol. The cerebellum and brainstem were dissected, frozen on dry ice, and immediately transferred to -80°C for storage. Total RNA was purified from the thawed cerebellum and brainstem (combined) using the Qiagen miRNAeasy Mini Kit. The purified RNA was stored at -80°C and later shipped on dry ice to LC Sciences for screening (microarray part number MRA-1002, miRBase version 21).

[0136] Raw data were processed by LC Sciences according to its technical bulletin (Sciences, L. MicroRNA Microarray Data Analysis). The small sample size used in the pilot study precluded the identification of positive hits based only on statistically significant differences between treatment groups. Therefore, to improve statistical power, the data were summed for all three MECP2(+) groups (i.e., Mecp2- / y mice treated with virus and Mecp2+ / y mice treated with saline and virus) before calculating statistical significance. Among the 10 moderately to highly expressed miRNAs that were elevated in MECP2(+) mice, one miRNA (miR-494-3p) has a target within the endogenous MECP2 3’UTR (targetscan.org, Agarwal et al., 2015, Elife, (4), mouse and human), suggesting that a negative feedback loop mediated by MeCP2 and miR-494-3p may exist in vivo. Furthermore, normalized signal intensity demonstrated a compelling trend between increased miR-494-3p expression and exogenous MeCP2 expression in both Mecp2+ / y and Mecp2- / y mice.

Example

[0137] Identification of additional miRNAs upregulated by MeCP2 expression Three miRNA targets in the MeP426-hMECP2-myc-RDH1pA viral genome (i.e., miR-22-3p, miR-19-3p, and miR-132-3p) were replaced with the target sequence of miR-494-3p (Sinnett et al., 2017, Mol. Ther. Methods Clin. Dev., (5):106-115; Gadalla et al., 2017, Mol. Ther. Methods Clin. Dev., (5):180-190). Subsequently, the modified viral genome was packaged into AAV9 and stereotaxically injected into mosaic MECP2-EGFP-fusion / null females. Transgene expression was slightly decreased compared to that observed in adjacent null cells in response to MeCP2-EGFP expression (Figure 8).

Example

[0138] Large-scale screening of upregulated miRNAs To address the limitations of the pilot study described above, a large-scale screening was completed. More specifically, additional control groups were added, more mice were treated, and brain regions were dissected finely (not combined) prior to RNA purification. Mecp2+ / y and Mecp2− / y mice were injected with saline, 1×10 12 vg of AAV9 / MeP426-hMECP2-myc-RDH1Pa, or 1×10 12Either vg of AAV9 / CBH-EGFP was injected into the large cistern (PND P28 - P35, injection volume of 10 μL, n = 3 mice / treatment). Two to three weeks after the treatment, the mice were euthanized with a lethal dose of tribromoethanol. The cervical spinal cord, cerebellum, and brainstem were dissected, frozen on dry ice, and immediately transferred to -80°C for storage. Subsequently, total RNA was purified from the thawed tissues using the Qiagen miRNAeasy Mini Kit. Brain regions were not combined before RNA purification. The RNA was stored at -80°C and later shipped on dry ice to LC Sciences for screening (microarray part number MRA-1002, miRBase version 21).

[0139] Raw data were processed by LC Sciences according to its technical bulletin. miRNAs that were significantly upregulated in correlation with endogenous MeCP2, AAV9 / MECP2, or AAV9 / EGFP treatment were identified (Figures 2 - 7). The mean expression levels of mmu-let-7e-5p, mmu-miR-451a, and mmu-miR-690 increased most frequently in correlation with exogenous and endogenous MeCP2 across tissue types in Mecp2+ / y and Mecp2- / y mice and least frequently in correlation with AAV9 / EGFP.

[0140] Analysis of the pooled treatment groups (MECP2(−) vs. MECP2(+)) revealed additional miRNAs that were significantly upregulated by MeCP2 expression in at least one tissue type (Figure 9). For miR-690, there was a significant difference between MECP2(−) and (+) groups in the cervical spinal cord and between KO and WT mice treated with saline in the medulla. For miR-451a, there was a significant difference between MECP2(−) and (+) groups in the medulla and between KO and WT mice treated with saline in the cervical spinal cord. For let-7e-5p, there was a significant difference between MECP2(−) and (+) groups in the cervical spinal cord and also between KO and WT mice treated with saline in the cervical spinal cord. Let-7e-5p could be a reasonable target in the cerebellum considering the relative expression levels obscuring significance and potential outlier data points. These three targets (miR-690, miR-451a, and let-7e-5p) were added to MeP426-ΔNIC-RDH1pA. For miR-124-3p, it was lower in the pooled MECP2(+) group in the cervical spinal cord and was consistent with previous analyses in the cervical spinal cord of KO and WT mice treated with saline. Despite this inverse relationship, its relatively high expression throughout the brain could mean that this target could be reasonable for capping expression regardless of the injection route. For miR-132-3p, it was found to be upregulated in the medulla only in the pooled analysis. miR-124-3p and miR-132-3p are published targets in RDH1pA. miR-9-5p, miR-26b-5p, miR-23a-3p, miR-218-5p, and miR-27a-3p are part of the universal panel (let-7e-5p too). For miR-9-5p and miR-27a-3p, they were upregulated in the cervical spinal cord only in the pooled analysis. For miR-26b-5p, there was a significant difference between MECP2(−) and (+) groups in the cervical spinal cord and also between KO and WT mice treated with saline in the cervical spinal cord.Most of the miRNAs in Figure 9 are normally expressed at levels higher than miR-494-3p, suggesting that the new panel design may result in more robust inhibition of transgene expression.

[0141] Two miRNA target panels were designed using data from the screening. As further described in Example 4, the first panel binds to miRNAs whose expression levels increase in correlation with in vivo MeCP2 expression. The second panel design is described below.

[0142] RNA samples from mice treated with saline and virus were screened to identify MeCP2-driven miRNAs expressed in the central nervous system (CNS). Inserting the targets of these miRNAs into the 3’UTR of the MECP2 viral genome enables the use of the endogenous RNA interference mechanism to attenuate the toxic overexpression of exogenous MeCP2 in vivo (Figure 1). Two miRNA target panels were designed using data from recent screenings. The first panel binds to miRNAs whose expression levels increase in correlation with in vivo MeCP2 expression. The second panel design includes targets justified by both literature and experimental data. Importantly, the targets in this second panel are conserved in the 3’UTRs of many dosage-sensitive genes that mediate intellectual ability. Thus, this panel may be ideal for testing in mouse models of Rett syndrome (RTT) and other neurodevelopmental disorders and may mediate improved feedback regulation of transgenes in a therapeutic setting.

[0143] The complete panel sequences are listed below. Seed matches are underlined. Every other seed match and flanking sequence section is italicized. Binding site key (in 5’-3’ order): miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, let-7-5p: 5’CTGTTCTAGCCC CCAAAGAGTTTTCTGTGCTTGCTTTTGAA ACTTGAA GTCTTGAAAACCAAAGACATAG ATGTGAA AATTTTAGGCAGTGTAAGCTGAT AGCACAA GTTCTGGCGACTCACAATTATG CTGTGAA TTTTACAAAAAGAAGCAGTAAT CTACCTCA GCCGATAAC-3’(SEQ ID NO: 1)

[0144] Some neurodevelopmental disorders characterized by intellectual disability are mediated by mutations in genes that must be tightly regulated (see Table 1). Similarities between the 3’UTRs of these genes suggest that there may be an in vivo inhibitory mechanism to help protect the brain from intellectual disability induced by overexpression, regardless of the genetic etiology (see Table 2).

[0145] JPEG0007682538000001.jpg83153

[0146] Deletions and reciprocal duplications that mediate similar phenotypes (e.g., intellectual disability, speech abnormalities, seizures, microcephaly, and / or autism) include, but are not limited to, those listed in Table 1. The severe phenotypes of these duplication disorders justify the need for a widely applicable miRNA target panel to regulate the expression of transgenes after gene therapy.

[0147] References describing human and animal models of deletions or mutation disorders in Table 1: TCF4 (Agarwal, 2015, Dean L., 2012, Medical Genetics Summaries, Bethesda, Maryland, Sweetser et al., 1993, GeneReviews((R)), Seattle, Washington, de Winter et al., 2016, Orphanet J. Rare Dis., 11:37), MECP2 (Leonard et al., 2017, Nat. Rev. Neurol., 13(1):37 - 51, Chahil and Bollu, 2018, StatPearls: Treasure Island, Florida, Seltzer and Paciorkowski, 2014, Am. J. Med. Genet. C. Semin. Med. Genet., 166C(2):140 - 155, Fuertes - Gonzales et al., 2011, Med. Oral Patol. Oral Cir. Bucal., 16(1):e37 - 41), UBE3A (Dagli et al., 1993, GeneReviews((R)): Seattle, Washington, Pelc et al., 2008, Neuropsychiatr. Dis. Treat., 4(3):577 - 584, Pelc et al., 2008, Sleep Med., 9(4):434 - 441), DYRK1A (Luco et al., 2016, BMC Med. Genet., 17:15), MEF2C (Vrecar et al., 2017, J. Pediatr. Genet., 6(3):129 - 141), NSD1 (Tatton - Brown et al., 1993, GeneReviews((R)): Seattle, Washington), ATRX (Stevenson R.E., 1993, GeneReviews((R)): Seattle, Washington, Bouazzi et al., 2016, Indian J. Med. Res., 143(1):43 - 48), RPS6KA3 (Miyata et al., 2018, Brain Dev., 40(7):566 - 569, Morino et al., 2016, Medicine(Baltimore), 95(31):e4468, Touraine et al., 2002, Eur. J. Pediatr., 161(4): 179 - 187, Tos et al., 2015, Genet. Couns., 26(1): 47 - 52), MBD5 (Talkowski et al., 2011, Am. J. Hum. Genet., 89(4): 551 - 563), ZEB2 (Hegarty et al., 2015, Prog. Neurobiol., 132: 81 - 95).

[0148] References describing overexpression (monogenic or polygenic) human and animal models in Table 1: Trisomy 18 (Roberts et al., 2016, Clin. Anat., 29(5):628 - 632, de Queiroz et al., 2007, J. Dent. Child (Chic), 74(1):67 - 72), MeCP2 duplication syndrome (Miguet et al., 2018, J. Med. Genet., 55(6):359 - 371), Dup15Q (Finucane et al., 1993, GeneReviews((R)): Seattle, WA, Copping et al., 2017, Hum. Mol. Genet., 26(20):3995 - 4010, Wegiel et al., 2012, J. Neuropathol. Exp. Neurol., 71(5):382 - 397), Down syndrome (Duchon and Herault, 2016, Front. Behav. Neurosci., 10:104, Kent and Vorperian, 2013, J. Speech Lang. Hear. Res., 56(1):178 - 210, Araujo et al., 2015, Epilepsy Behav., 53:120 - 125, Guedj et al., 2012, Neurobiol. Dis., 46(1):190 - 203, Carter et al., 2008, Neuroreport, 19(6):653 - 656), dup5Q14.3 (Cesaretti et al., 2016, Am. J. Med. Genet. A, 170A(5):1352 - 1357), inverse Sotos syndrome (Rosenfeld et al., 2013, Mol. Syndromol., 3(6):247 - 254), Xq13.2q21.1 (Lugtenberg et al., 2009, Am. J. Med. Genet. A, 149A(4):760 - 766, Berube et al., 2002, Hum. Mol. Genet., 11(3):253 - 261), Xp22.12 (Matsumoto et al., 2013, J. Hum. Genet., 58(11):755 - 757, Tejada et al., 2011, Pediatrics, 128(4):e1029 - 1033), 2q23.1 duplication (Mullegama et al., 2014, Eur. J. Hum. Genet., 22(1):57 - 63), 2q22.Triple duplication (Yuan et al., 2015, Mol. Cytogenet., 8:99).

[0149] JPEG0007682538000002.jpg101153

[0150] The complete list of targets in the endogenous 3’UTR can be found at targetscan.org. In each of the cells in Table 2, enumerate the Context ++ percentile scores for two species (human / mouse). High scores indicate targets with favorable genomic context. The synthetic panel includes targets of miRNAs predicted to bind to many of the endogenous 3’UTRs listed above. Of the six selected targets, four targets should bind to miRNAs (miR-9-5p, miR-26b-5p, miR-27-3p, and let-7-5p) that demonstrated increased expression correlated with MeCP2 expression (see HTS data in Figure 9). Additionally, correlations between MeCP2 expression and let-7 (Urdinguio et al., 2010, Epigenetics, 5(7):656-663; Wu et al., 2010, Proc. Natl. Acad. Sci. U.S.A., 107(42):18161-18166), between TCF4 expression and miR-218 (Hassan et al., 2012, J. Biol. Chem., 287(50):42084-42092), and between miR-23a-3 and MEF2C expression have been published (Kalsotra et al., 2014, Cell Rep., 6(2):336-345). Unpublished HTS data demonstrated a tendency for increased miR-23a-3p expression and MeCP2 expression in the cervical spinal cord. Other targets were excluded for the following reasons: (1) the target has a modest effect on transgene expression (i.e., miR-494-3p, see Figure 8), (2) the target does not appear in the UTRs examined above (i.e., miR-451a), (3) the corresponding miRNA is upregulated in correlation with AAV9 / EGFP (i.e., miR-30c-5p), or (4) the target already exists as a component of the synthetic distal MECP2 pA in the published MECP2 viral genome (i.e., miR-124-3p) (Sinnett et al., 2017, Gadalla et al., 2017). X indicates that no target exists in either the human or mouse 3’UTR. Boxes containing -- / -- indicate that the target is present only in either the human ( / --) or mouse (-- / ) 3’UTR. The remaining targets appear in both species.Targets with 5' flanking sequences that are similar or identical across species are indicated by the # symbol. Targets without conserved 5' flanking sequences are indicated by the β symbol. Targets (and their flanking sequences) outlined in bold were selected for the synthetic panel. Finally, targets of miR-29-3p, miR-338-3p, miR-98-5p, and miR-7-5p may also be candidates for inclusion in the universal target panel because the binding sites for these miRNAs are present in many of the genes listed above (see targetscan.org) and an increase in the expression of these miRNAs was observed to correlate with MeCP2 expression.

[0151] JPEG0007682538000003.jpg209153 JPEG0007682538000004.jpg215153 JPEG0007682538000005.jpg89153

[0152] The targets that appear in the human 3’UTR and their flanking sequences are shown next to each gene in Table 3. The sequences selected for the synthetic panel are listed next to “vg” (viral genome). When two or more targets for a given miRNA were present in the human 3’UTR, the target sequences that were conserved across species were selected and listed in the above table. The following parameters were considered when selecting the 5’ flanking sequences for the synthetic panel: (1) obligate Watson-Crick (WC) base pairing with preferential pairing at messenger RNA (mRNA) nucleotides 13–16 (M13–M16) (predicted by Targetscan) (Grimson et al., 2007, Mol. Cell, 27(1):91–105), (2) conservation of the 5’ flanking sequences across species (see Table 2), (3) context++ percentile scores listed on Targetscan, and (4) sequence complexity (commercial gene synthesis requires a %GC content of 35% or more for the entire synthetic panel). For each of the selected 5’ flanking sequences, the 3’ flanking sequence from the same UTR was selected for insertion into the target panel. (3) One mutation (fluorescent pen and bold) was introduced to create a T1A anchor to promote mRNA-argonaute interaction (Schirle et al., 2015, Elife, (4), Schirle et al., 2014, Science, 346(6209):608–613). Due to sequence similarity in the miRNA sequences, the target of let-7e-5p can also bind to other let-7 miRNAs. let-7a-5p, let-7b-5p, and let-7g-5p showed increased expression in MECP2(+) cervical spinal cord tissue in the total data analysis. let-7c-5p, let-7d-5p, and let-7g-5p, Mecp2 - / yIn mice, an increase in expression was shown after treatment with the MECP2 virus. Furthermore, the let-7e-5p target can bind to miR-98-5p, whose expression level increased in the aggregate data analysis of cervical spinal cord tissue. The T1A anchor is underlined in the target column. T9A / Us, which is thought to be optimized for the conformation of the Argonaute interaction, is underlined in the 5' flanking sequence column (Lewis et al., 2005, Cell, 120(1):15-20).

[0153] Compare with Table 2. As shown in Table 4, the 3'UTRs of housekeeping genes have some of the targets examined. The display in Table 4 follows that described in Table 2. Thus, the conservation of targets among genes mediating intellectual ability can be physiologically significant. The complete list of targets in the endogenous 3'UTR can be found at targetscan.org. For each cell in Table 4, the context++ percentile scores are listed for two species (human / mouse). High scores indicate targets with favorable genomic context. ACTB, beta-actin; ATF1, activating transcription factor 1; DAD1, defender against cell death 1; DARS, aspartyl-tRNA synthetase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSPA4, heat shock protein family A (Hsp70) member 4; MRPL9, mitochondrial ribosomal protein L9; POLR1C, RNA polymerase I and III subunit C; PRKAG1, protein kinase AMP-activated non-catalytic subunit gamma 1; RPL5, ribosomal protein L5.

[0154] JPEG0007682538000006.jpg196153

Example

[0155] Development of RTT-specific constructs. Additional constructs were developed to be specific for RTT and are referred to herein as "reg1". The targets in this array correspond to miRNAs that have been shown to be upregulated in correlation with MeCP2 expression in high-throughput screening of brain and spinal cord RNA.

[0156] The sequence of reg1 is as follows. The seed matches are underlined. Every other seed match and section of flanking sequence are shown in italics. Binding site key (in 5'-3' order): miR-451a, let-7-5p, miR-690. 5’ATAAGGGCAGA AACGGTT CACATTCCATTCTGCCCCGGAC CTACCTC CCTCCCTCTCCTTATCAAACCC TAGCCTT GCTTGTTAAAT-3’(SEQ ID NO: 2)

[0157] As shown in Figure 10, Reg1 was tested in WT mice, and tightly regulated total MeCP2 expression was shown in WT Purkinje cells. Purkinje cells are located near the site of injection in the large cistern and are vulnerable to overphysiological transgene expression. The corrected total cellular fluorescence (anti-MeCP2 signal) for each nucleus was normalized to that of the average MeCP2 signal for myc(-) Purkinje nuclei. The averages presented for each mouse in panel A of Figure 10 represent the normalized MeCP2 signal averaged across all myc(+) nuclei quantified for the designated host. Iterative averaging across cells within the Z stack, followed by iterative averaging across Z stacks within one mouse, similarly resulted in a significant decrease in total MeCP2 expression (Gadalla et al., 2017, relative to that observed for the open control AAV9 / MeP426-miniMECP2-myc-RDH1pA). As shown in panels A and B of Figure 10, the average total MeCP2 expression (mini + endogenous full-length) in transduced Purkinje cells was 5× that of non-transduced Purkinje cells. The positive control panel for neuronal knockdown (featuring three targets of miR-124-3p) decreased overexpression by half (p = 0.06). The reg1 cassette also decreased overexpression by half (p = 0.02). Panel C of Figure 10 shows a histogram of total MeCP2 intensity, which exemplifies that reg1 narrows the distribution of total MeCP2 intensity, which is an indicator of tighter regulation. Since the local transduction efficiency varies across the entire cerebellum, the average total MeCP2 intensity of transduced Purkinje cells versus local transduction efficiency was plotted in panel D of Figure 10, and each data point represents the average intensity and transduction efficiency of Purkinje cells within a single Z stack. The trend line connects Z stacks from one mouse. The reg1 cassette restricted total MeCP2 expression even in regions of the cerebellum with high transduction efficiency. In contrast, the negative control panel permitted total MeCP2 expression well above physiological levels in regions with high local transduction efficiency. Panel E of Figure 10 shows that the reg1 cassette permitted transgene expression in NeuN+ cells.In contrast, the positive control for the neuronal knockdown decreased the percentage of NeuN+ cells. Similarly, Figure 11 shows preliminary data that reg1 decreased the expression of the liver transgene after intracisternal administration of AAV9 / mini-MECP2-reg1 in heterozygous mosaic female mice.

Example

[0158] Generalized panel design strategy and experimental research Figure 12 summarizes the strategy for designing the RTT-specific panel "reg1" and the widely applicable panel (referred to as "reg2" or "UNIVT" elsewhere). Panel A of Figure 12 shows the microRNA expression data originally used to design the RTT-specific target panel for safely regulating exogenous MeCP2 expression in vivo. As shown in Panel B of Figure 12, the same expression data provided the selection criteria for processing the UTR data set for the purpose of designing reg2. Through the steps illustrated in Panels C - G of Figure 12, a list of 2491 human targets was narrowed down to the 6 conserved targets that are currently featured in reg2. Five of these targets are predicted to bind to MeCP2-driven miRNAs (see Table 1). Since the let-7 target base pairs with many let-7 miRNA seeds, the reg2 panel has the potential to bind up to 11 miRNAs. Table 5 shows a non-limiting list of potential miRNAs that can bind to the miRNA seeds included in Reg1 and / or Reg2.

[0159] JPEG0007682538000007.jpg124153

[0160] Identify the correlation between endogenous MeCP2 expression, exogenous MeCP2 expression, and / or total (endogenous and exogenous) MeCP2 expression with miRNA expression. Further, it is conceptually possible that there are as yet unidentified miRNAs that may contribute to the MeCP2 feedback loop. Any miRNA containing a seed sequence that permits Watson-Crick (WC) base pairing between the miRNA seed and the miRNA target panel may assist in mediating the regulation of exogenous MeCP2.

[0161] Further experiments were conducted using both the RTT-specific construct of reg1 and the widely applicable construct of reg2. Figure 13 shows that reg2 decreases the expression level of the transgene in vivo in the WT brain after PHP.B-mediated mini-MECP2 gene transfer. Figure 14 shows the reg2-dependent inhibition of mini-MeCP2 expression in Purkinje cells within a representative cerebellar tile scan. On the left side of Figure 13, the arrows indicate myc(+) Purkinje neurons in several cerebellar lobes of mice treated with the control vector. In mice treated with reg2, most Purkinje cells were myc(-). On the right side of Figure 13, the arrows indicate mini-MeCP2 expression limited to the vestibulocerebellar region. Since mice treated with reg2 had a broad Purkinje cell layer that was either 0% myc(+) or 100% myc(+) (limited to the vestibulocerebellar region), quantitative analysis of total MeCP2 expression in adjacent myc(+) and myc(-) Purkinje cells was not recommended.

[0162] Figures 15A - 15C show that reg2 permits widespread but tightly controlled expression in multiple brain regions. Since the anti - myc immunofluorescence signals of many myc(+) cells were just above the detection limit, the percentage of myc(+) cells shown in Figure 15A for mice treated with reg2 was most likely an underestimation of the actual percentage of transduced cells. Among the three regions examined, the hippocampus demonstrated the most dramatic decrease in % myc(+) cells (mice treated with reg2 versus control). Figure 15B shows representative images of the thalamus, hippocampus, and medulla. Figure 15C shows that Reg2 enhanced apparent neurotropism in the thalamus. Figure 16 shows that reg2 can also improve the regulation of mini - MeCP2 in the liver.

[0163] As shown in Figure 17, a pre - survival study was conducted in KO mice treated with saline and virus. Mice were injected intracranially at 4 - 5 weeks of age. Although reg2 had a strong inhibitory effect on the expression of the transgene, reg2 did not appear to attenuate the median survival - time extension mediated by PHP.B / miniMECP2 (1E11 vg / mouse). Furthermore, reg2 treatment resulted in fewer early deaths. The number of surviving mice in each cohort is shown. Table 6 shows the percentage of treated KO mice that maintained normal hind - limb function throughout their lifespan. KO mice treated with the regulated vector are more likely to maintain a normal hind - limb phenotype throughout their lifespan (versus the unregulated vector).

[0164] JPEG0007682538000008.jpg30153

[0165] The foregoing examples are illustrative of the invention and should not be construed as limiting it. Although the invention has been described in detail with reference to preferred embodiments, modifications and variations exist within the scope and spirit of the invention as described and defined in the following claims.

Claims

**Claim 1** A synthetic gene comprising a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, wherein the polynucleotide further comprises one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match, wherein the one or more nucleic acid segments are inserted within the regulatory region of the polynucleotide such that expression of the protein or nucleic acid of interest when the synthetic gene is delivered to a cell expressing an endogenous miRNA is reduced compared to expression of the protein or nucleic acid of interest when a synthetic gene not comprising the one or more nucleic acid segments is delivered to a cell expressing an endogenous miRNA, wherein the seed match and the 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p which are miRNAs, or wherein the seed match and the 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p which are miRNAs, wherein the coding region encoding the protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, or an active fragment thereof, A synthetic gene. **Claim 2** The synthetic gene according to claim 1, wherein the coding region encoding the protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof. **Claim 3** The synthetic gene according to claim 1 or 2, wherein the seed match and the 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p which are miRNAs. **Claim 4** The synthetic gene according to claim 1 or 2, wherein the seed match and the 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p which are miRNAs. **Claim 5** The synthetic gene according to any one of claims 1 to 4, wherein the seed match has a length of 5 to 10 nucleotides.

6. The synthetic gene according to any one of claims 1 to 4, wherein the seed match has a length of 6 to 8 nucleotides.

7. The synthetic gene according to any one of claims 1 to 4, wherein the 5' and 3' flanking sequences adjacent to the seed match each have a length of 9 to 13 nucleotides.

8. The synthetic gene according to any one of claims 1 to 4, wherein the 5' and 3' flanking sequences adjacent to the seed match each have a length of 11 nucleotides.

9. The synthetic gene according to any one of claims 1 to 4, wherein the polynucleotide contains at least two seed matches, and the seed matches are separated by 7 to 40 nucleotides.

10. The synthetic gene according to claim 9, wherein the at least two seed matches are separated by 20 to 25 nucleotides.

11. The synthetic gene according to claim 10, wherein the at least two seed matches are separated by 22 nucleotides.

12. The synthetic gene according to any one of claims 9 to 11, wherein the polynucleotide contains 3 to 8 seed matches.

13. The synthetic gene according to any one of claims 1 to 3, wherein the seed match and the 5' and 3' flanking sequences adjacent to the seed match contain the nucleotide sequence of SEQ ID NO:

1.

14. The synthetic gene according to claim 1, 2, or 4, wherein the seed match and the 5' and 3' flanking sequences adjacent to the seed match contain the nucleotide sequence of SEQ ID NO:

2.

15. A vector comprising the synthetic gene according to any one of claims 1 to 14.

16. The vector according to claim 15, which is a plasmid, viral vector, expression cassette, transformed cell, or nanoparticle.

17. A pharmaceutical composition comprising the synthetic gene according to any one of claims 1 to 14, or the vector according to claim 15 or 16, and a pharmaceutically acceptable carrier.

18. A polynucleotide target cassette for providing dose-dependent inhibitory feedback to a synthetic gene, comprising one or more nucleic acid segments including a coding region encoding a protein or nucleic acid of interest, and a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to said seed match, wherein said seed match and 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p which are miRNAs, or said seed match and 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p which are miRNAs, wherein the coding region encoding the protein or nucleic acid of interest comprises a coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, or an active fragment thereof, a polynucleotide target cassette. **Claim 19** The polynucleotide target cassette according to claim 18, wherein said seed match and 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p which are miRNAs. **Claim 20** The polynucleotide target cassette according to claim 18, wherein said seed match and 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p which are miRNAs. **Claim 21** The polynucleotide target cassette according to any one of claims 18 to 20, wherein said seed match is 5 to 10 nucleotides in length. **Claim 22** The polynucleotide target cassette according to any one of claims 18 to 20, wherein said seed match is 6 to 8 nucleotides in length. **Claim 23** The polynucleotide target cassette according to any one of claims 18 to 22, wherein the 5' and 3' flanking sequences adjacent to said seed match are each 9 to 13 nucleotides in length. **Claim 24** The polynucleotide target cassette according to any one of claims 18 to 22, wherein the 5' and 3' flanking sequences adjacent to the seed match are each 11 nucleotides in length.

25. The polynucleotide target cassette according to claim 18 or 19, wherein the seed match and the 5' and 3' flanking sequences adjacent to the seed match comprise the nucleotide sequence of SEQ ID NO:

1.

26. The polynucleotide target cassette according to claim 18 or 20, wherein the seed match and the 5' and 3' flanking sequences adjacent to the seed match comprise the nucleotide sequence of SEQ ID NO:

2.

27. A method for preparing a synthetic gene comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, the method comprising inserting the polynucleotide target cassette according to any one of claims 18 to 26 into the regulatory region of the synthetic gene.

28. A method for producing a synthetic gene according to any one of claims 1 to 14, the method comprising inserting one or more nucleic acid segments each comprising a seed match identified as a binding site for an endogenous miRNA and 5' and 3' flanking sequences adjacent to the seed match into the regulatory region of a polynucleotide comprising a coding region encoding a protein or nucleic acid of interest and one or more regulatory regions, wherein the seed match and the 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p which are miRNAs, or the seed match and the 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p which are miRNAs, wherein the coding region encoding the protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, or an active fragment thereof. Method.

29. The method according to claim 28, wherein the coding region encoding the protein or nucleic acid of interest comprises the coding region of the gene MECP2 or an active fragment thereof.

30. The method according to claim 28 or 29, wherein the seed match and the 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p, which are miRNAs.

31. The method according to claim 28 or 29, wherein the seed match and the 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p, which are miRNAs.

32. A step of screening for miRNAs with increased expression when the protein or nucleic acid of interest is expressed in a cell as compared to when the protein or nucleic acid of interest is not expressed, a step of identifying the seed match and the 5' and 3' flanking sequences of one or more miRNAs with increased expression, a step of preparing a nucleic acid segment comprising the seed match and the 5' and 3' flanking sequences to be inserted into the regulatory region of the polynucleotide The method according to claim 28, further comprising.

33. A step of identifying the seed match and the 5' and 3' flanking sequences of one or more miRNAs with increased expression when the protein or nucleic acid of interest is expressed in a cell as compared to when the protein or nucleic acid of interest is not expressed, a step of inserting the seed match and the 5' and 3' flanking sequences into the regulatory region of a synthetic gene comprising a polynucleotide comprising a coding region encoding the protein or nucleic acid of interest and one or more regulatory regions, A method for identifying one or more seed matches and 5' and 3' flanking sequences to be inserted into a synthetic gene, comprising the seed match and the 5' and 3' flanking sequences bind to miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p, which are miRNAs, or the seed match and the 5' and 3' flanking sequences bind to miR-690, miR-451a, and let-7-5p, which are miRNAs, The coding region encoding the protein or nucleic acid of interest comprises the coding region of a gene selected from TCF4, UBE3A, DYRK1A, MEF2C, NSD1, ZEB2, MBD5, RPS6KA3, ATRX, MECP2, or an active fragment thereof. Method. **Claim 34** The method according to claim 33, further comprising screening a nucleic acid dataset for validated or putative seed matches and 5' and 3' flanking sequences. **Claim 35** The method according to claim 33 or 34, further comprising identifying miRNAs with increased expression when the protein or nucleic acid of interest is expressed in the cell as compared to when it is not expressed in the cell. **Claim 36** The method according to any one of claims 33 to 35, further comprising screening a nucleic acid dataset for miRNAs with increased expression when the protein or nucleic acid of interest is expressed in the cell as compared to when it is not expressed in the cell. **Claim 37** The step of expressing the protein or nucleic acid of interest in a cell, the step of collecting miRNAs from the cell, calculating the expression level of the miRNAs when the protein or nucleic acid of interest is expressed in the cell as compared to when it is not expressed in the cell, thereby creating a nucleic acid dataset of the miRNAs The method according to any one of claims 33 to 36, further comprising. **Claim 38** The method according to any one of claims 34, 36, or 37, wherein the nucleic acid dataset is a 3'UTR dataset. **Claim 39** The method according to any one of claims 33 to 38, wherein the protein or nucleic acid of interest is a transcript or translation product of the gene MECP2 or an active fragment thereof. **Claim 40** The synthetic gene according to any one of claims 1 to 14, the vector according to claim 15 or 16, or the pharmaceutical composition according to claim 17 for delivery to a subject. **Claim 41** For use in a method of treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene in a subject, the synthetic gene according to any one of claims 1 to 14, the vector according to claim 15 or 16, or the pharmaceutical composition according to claim 17.

42. The synthetic gene, vector or pharmaceutical composition according to claim 40 or 41, wherein the subject is a human.

43. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 42, wherein the subject has or is at risk of having a genetic dosage sensitivity disorder of intellectual ability.

44. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 42, wherein the subject has or is at risk of having a disorder selected from the group consisting of Rett syndrome, MeCP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, reverse Sotos syndrome, alpha thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt-Hopkins syndrome, Moebius-Wilson syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Duane syndrome, SLC6A1 duplication, and trisomy 18.

45. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 44, wherein the subject has or is at risk of having Rett syndrome or MeCP2 duplication syndrome.

46. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 45, wherein the synthetic gene, vector or pharmaceutical composition is delivered by a delivery route selected from the group consisting of enteral, parenteral, intrathecal, intracisternal, intracerebral, intraventricular, intranasal, intra-aural, intraocular, periocular, intrarectal, intramuscular, intraperitoneal, intravenous, oral, sublingual, subcutaneous, and transdermal.

47. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 45, wherein the synthetic gene is delivered intravenously.

48. The synthetic gene, vector or pharmaceutical composition according to any one of claims 40 to 45, wherein the synthetic gene is delivered into the CSF.

49. The synthetic gene, vector or pharmaceutical composition according to claim 41, wherein the use further comprises the step of genetically knocking down an endogenous gene encoding a target protein or nucleic acid in a subject.

50. The synthetic gene, vector or pharmaceutical composition according to claim 49, wherein the endogenous gene is MECP2.

51. For use in a method of treating a disease associated with abnormal expression of an endogenous gene or expression of a mutant protein encoded by an endogenous gene in a subject, a synthetic gene according to any one of claims 1 to 14, encoding a target protein or nucleic acid encoded by the endogenous gene, a vector according to claim 15 or 16, or a pharmaceutical composition according to claim 17, wherein the method further comprises the step of genetically knocking down the endogenous gene in the cells of the subject. Synthetic gene, vector or pharmaceutical composition.

52. The synthetic gene, vector or pharmaceutical composition according to claim 51, wherein the disease is Rett syndrome, MECP2 duplication syndrome, Angelman syndrome, dup15Q, DYRK1A haploinsufficiency, Down syndrome, MEF2C haploinsufficiency syndrome, dup5Q14.3, Sotos syndrome, reverse Sotos syndrome, alpha thalassemia X-linked intellectual disability syndrome, Xq13.2q21.1 duplication, Coffin-Lowry syndrome, Xp22.12 duplication, Pitt-Hopkins syndrome, Moebius-Wilson syndrome, 2q22.3 triplication, 2q23.1 duplication, 2q23.1 microdeletion, FOXG1 syndrome, West syndrome, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, AKT3 duplication, Duchenne syndrome, SLC6A1 duplication, and / or trisomy 18.

Images