Gene expression enhancer and photosynthesis activator

Abstract

Disclosed is an agent for increasing the expression of a stress response gene in a plant, the agent containing a humic acid.

Description

Technical Field

[0001] The present invention relates to an agent for increasing the expression of stress-responsive genes and a method for imparting stress tolerance to plants. The present invention also relates to an agent for increasing the expression of genes involved in nitrogen metabolism. The present invention further relates to a photosynthesis activator and a method for activating photosynthesis in plants.

Background Art

[0002] Plants are sensitive to various stresses such as drought, salt, diseases, pests, and temperature. Means for improving the stress response of plants have been studied. For example, Patent Document 1 discloses a method of contacting a plant with a composition containing an agriculturally acceptable complex mixture of dissolved organic substances characterized by a partially corroded natural organic substance. Further, in Patent Document 1, such a composition is characterized as being unique and chemically and biologically different from fulvic acid and humic acid.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0004] One of the problems of the present invention is to provide a means for improving the stress response of plants. More specifically, one of the problems of the present invention is to provide an agent for increasing the expression of stress-responsive genes.

Means for Solving the Problems

[0005] The inventors of the present invention conducted intensive studies to solve the above problems, and found that humic acid increases the expression of stress response genes in plants. Further, as the inventors conducted further studies, they also found that humic acid increases the expression of genes involved in nitrogen metabolism in plants, and that humic acid improves the photosynthesis rate, thus completing the present invention.

[0006] That is, the present invention relates to the following [1] to

[20] . [1] An expression enhancer for stress response genes in plants containing humic acid. [2] The expression enhancer according to [1] above, wherein the humic acid is derived from lignite. [3] The expression enhancer according to [1] or [2] above, having a melanic index of 2.0 or more. [4] The expression enhancer according to any one of [1] to [3] above, wherein the stress response gene is a response gene to salt stress. [5] The expression enhancer according to any one of [1] to [3] above, wherein the stress response gene is a gene encoding a molecular chaperone. [6] The expression enhancer according to any one of [1] to [3] above, wherein the stress response gene is a gene encoding one or more proteins selected from the group consisting of DnaJ and WRKY. [7] A method for conferring stress tolerance to plants, comprising applying humic acid to the plants. [8] The method according to [7] above, wherein the humic acid is derived from lignite. [9] The method according to [7] or [8] above, having a melanic index of 2.0 or more.

[10] The method according to any one of [7] to [9] above, wherein the stress tolerance is salt stress tolerance.

[11] An expression enhancer for genes involved in nitrogen metabolism in plants containing humic acid.

[12] The expression enhancer according to

[11] above, wherein the humic acid is derived from lignite.

[13] The expression enhancer according to

[11] or

[12] above, having a melanic index of 2.0 or more.

[14] The expression promoter according to any one of

[11] to

[13] , wherein the gene involved in nitrogen metabolism is a gene encoding nitrate reductase.

[15] A photosynthesis activator containing humic acid.

[16] The photosynthesis activator according to

[15] , wherein the humic acid is derived from lignite.

[17] The photosynthesis activator according to

[15] or

[16] , wherein the melanic index is 2.0 or more.

[18] A method for activating photosynthesis of a plant, which includes applying humic acid to the plant.

[19] The method according to

[18] , wherein the humic acid is derived from lignite.

[20] The method according to

[18] or

[19] , wherein the melanic index is 2.0 or more.

Effect of the Invention

[0007] When humic acid is applied to a plant, the expression of stress response genes in the plant increases, and stress tolerance is imparted to the plant. When humic acid is applied to a plant, the expression of genes involved in nitrogen metabolism in the plant increases, and the growth of the plant is promoted. When humic acid is applied to a plant, the photosynthesis rate in the plant increases, and the photosynthesis of the plant is activated.

Brief Description of the Drawings

[0008]

Figure 1

Figure 2

Figure 3

Modes for Carrying Out the Invention

[0009] The plant stress response gene expression enhancer according to one embodiment of the present invention contains humic acid. The humic acid contains one or more kinds selected from the group consisting of humic acid and humate. Examples of the humic acid include natural humic acids produced naturally such as peat and weathered coal, artificial humic acids artificially produced by nitric acid oxidation of lignite, etc., and humates obtained by neutralizing natural humic acids or artificial humic acids with alkaline substances such as sodium, potassium, ammonia, calcium, and magnesium. Examples of the humic acid include humic acid, nitrophumic acid, ammonium humate, calcium humate, magnesium humate, ammonium nitrophumate, calcium nitrophumate, and magnesium nitrophumate.

[0010] The humic acid may be a humic acid extract. The humic acid extract refers to an extract obtained by extracting nitric acid oxides of young coals such as lignite and brown coal in the pH range of 5 to 8, preferably an extract obtained in the pH range of 5 to 7. The humic acid extract is obtained, for example, by subjecting a nitric acid oxide of young coal (hereinafter referred to as a crude humic acid) obtained by oxidatively decomposing young coal with nitric acid, an inorganic compound containing at least one monovalent or divalent alkali selected from potassium hydroxide, sodium hydroxide, ammonium hydroxide, magnesium hydroxide, and calcium hydroxide, and water to stirring at 40 to 90 ° C for 0.5 to 1 hour, and then performing a solid-liquid separation step to obtain a liquid substance. The inorganic compound is added to water so as to be in the pH range of 5 to 8. The production method of the humic acid extract is described in Japanese Patent No. 6231059. From the viewpoint of the effect of increasing the expression of the stress response gene, a humic acid extract derived from lignite is preferable.

[0011] Preferably, the above-mentioned humic acid has a melanic index (MI) of 2.0 or more. The MI is an index used for classifying humic acids and is the ratio (A450 / A520) of the absorbances at wavelengths 450 nm and 520 nm of the absorption spectrum of a sodium hydroxide extract. (Koichi Kumada, Chemistry of Soil Organic Matter, 2nd Edition, The Chemical Society of Japan Press (1981), Sadahiro Yamamoto et al., "Simple Estimation of Humic Acid Type by Melanic Index", Journal of Japanese Society of Soil Science and Plant Nutrition, Vol. 71, No. 1, pp. 82-85 (2000)).

[0012] More specifically, MI is calculated by the following method. The sample is pulverized into a 250-μm undersize using a mortar and a 250-μm sieve. Approximately 10 g of this is taken and precisely weighed into a weighing bin with a known mass. This weighing bin is left in a dryer maintained at a temperature of 105°C for about 12 hours, and then, after returning to room temperature in a desiccator, it is precisely weighed again. The mass reduction is regarded as moisture, and the moisture content of the sample is determined. Next, into a 50-ml centrifuge tube, 0.10 g of the above 250-μm undersize equivalent to the dry mass and 45 ml of a 0.5 mol / L sodium hydroxide aqueous solution are placed, shaken at a speed of 250 rpm at room temperature (20°C) for about 1 hour, and then centrifuged at 3,000×g for about 10 minutes. The supernatant is filtered through a No. 5C filter paper manufactured by Advantec. The absorbance at 450 nm and the absorbance at 520 nm of the filtrate are measured using distilled water as a blank. In this case, if the absorbance at 450 nm shows 1.0 or more, a 0.1 mol / L sodium hydroxide aqueous solution is added to adjust the absorbance to 0.8 or more and less than 1.0, and then the absorbance at 520 nm is measured. The ratio of (absorbance at 450 nm / absorbance at 520 nm) is calculated and taken as MI.

[0013] The upper limit value of MI is not particularly limited, but it can be 5.0 or less. Also, the numerical range of MI is preferably 2.0 to 4.5, more preferably 2.0 to 4.0.

[0014] The total organic carbon (TOC) concentration of the humic acid extract is preferably 5,000 mg / L or more. The TOC concentration of the humic acid extract is preferably 60,000 mg / L or less. The TOC concentration of the humic acid extract is more preferably 10,000 to 50,000 mg / L.

[0015] The method for measuring the TOC concentration of the extract is defined as follows. The supernatant obtained by centrifuging the extract of the crude humic acid at 3,000×g is the value measured by the combustion catalytic oxidation method using a total organic carbon meter (TOC-L manufactured by Shimadzu Corporation). When it contains non-humic substances such as urea, which are fertilizer components, the separated substances (humic acid and fulvic acid fractions) according to the International Humic Substances Society method (Fujioka, Humic Substances Research Vol3, P1-9) are quantified by the above method to measure the TOC concentration of the extract.

[0016] The plants targeted by the expression enhancer of the stress response gene of plants according to this embodiment may be seed plants, fern plants or moss plants, and the seed plants may be gymnosperms or angiosperms, and the angiosperms may be monocotyledonous plants or dicotyledonous plants. In addition, seed plants also include plants that reproduce without forming seeds, for example, vegetatively propagated plants that reproduce by bulbs or tubers. From a commercial perspective, it is preferable to target vegetables and flowers.

[0017] Examples of such plants include, specifically, plants belonging to the families Brassicaceae, Solanaceae, Asteraceae, Cucurbitaceae, Apiaceae, Poaceae, Rosaceae, Liliaceae, Orchidaceae, Amaryllidaceae, Primulaceae, Fabaceae, Alliaceae, Polygonaceae, Convolvulaceae, Urticaceae, Vitaceae, Rutaceae, Anacardiaceae, Theaceae, Oleaceae, Malvaceae, Musaceae, Zingiberaceae, Rubiaceae, Bromeliaceae, etc. Examples of Brassicaceae plants include Komatsuna, Pakchoi, Turnip, Cauliflower, Cabbage, Radish, Chinese Cabbage, Broccoli, etc. Examples of Solanaceae plants include Tomato, Tobacco, Chili Pepper, Potato, Pepper, Eggplant, Paprika, Bell Pepper, etc. Examples of Asteraceae plants include Lettuce, Artichoke, Burdock, Shungiku, Chrysanthemum, Sunflower, etc. Examples of Cucurbitaceae plants include Pumpkin, Cucumber, Watermelon, Melon, etc. Examples of Apiaceae plants include Celery, Celeriac, Carrot, Parsley, etc. Examples of Poaceae plants include Rice, Barley, Wheat, Sugarcane, Maize, etc. Examples of Rosaceae plants include Strawberry, Rose, Apple, Pear, Peach, Loquat, Almond, etc. Examples of Liliaceae plants include Asparagus, Tulip, Lily, etc. Examples of Orchidaceae plants include Orchid, Cymbidium, etc. Examples of Amaryllidaceae plants include Lycoris radiata, etc. Examples of Primulaceae plants include Cyclamen, etc. Examples of Fabaceae plants include Soybean, Kidney Bean, Adzuki Bean, etc. Examples of Alliaceae plants include Welsh Onion, Garlic Chives, Galangal, Garlic, etc. Examples of Polygonaceae plants include Buckwheat, etc. Examples of Convolvulaceae plants include Sweet Potato, etc. Examples of Urticaceae plants include Spinach, Sugar Beet, etc. Examples of Vitaceae plants include Grape, etc. Examples of Rutaceae plants include Mandarin Orange, Lemon, Orange, etc. Examples of Anacardiaceae plants include Persimmon, etc. Examples of Theaceae plants include Tea, etc. Examples of Oleaceae plants include Olive, Jasmine, etc. Examples of Malvaceae plants include Cotton, Cocoa, Okra, etc. Examples of Musaceae plants include Banana, etc. Examples of Zingiberaceae plants include Ginger, etc. Examples of Rubiaceae plants include Coffee Tree, etc. Examples of Bromeliaceae plants include Pineapple, Ananas, etc.

[0018] A stress-responsive gene is a gene whose expression is induced when a plant is subjected to stress. Examples of stress-responsive genes include genes encoding molecular chaperones such as DnaJ, HSP, and chaperonin, WRKY, universal stress protein, aquaporin, pathogenesis-related protein, and plant defensin. The present embodiment is useful for a stress-responsive gene encoding one or more proteins selected from the group consisting of DnaJ and WRKY. A molecular chaperone (sometimes also referred to as a chaperone) is a protein that has a function of repairing, for example, a protein with an incorrect three-dimensional structure and plays an important role in protein quality control. An example of a molecular chaperone useful in the present embodiment is DnaJ. WRKY refers to a family of plant transcription factors that regulate many processes in plants, including responses to biotic and abiotic stresses, immunity, plant defense, aging, and seed dormancy and germination.

[0019] In a plant under a stress environment, the expression (transcription and / or translation) of stress-responsive genes is induced. When the plant stress-responsive gene expression enhancer according to the present embodiment is applied to such a plant, the expression of the stress-responsive gene is increased as compared with the case where it is not applied, and the expression level is 1.1 times or more, preferably 1.5 times or more, of the expression level (transcription level and / or translation level) when the plant stress-responsive gene expression enhancer is not applied.

[0020] A method for imparting stress tolerance to a plant according to an embodiment of the present invention includes applying humic acid to the plant. The stress tolerance includes drought tolerance, salt tolerance, disease tolerance, pest tolerance, low temperature tolerance, high temperature tolerance, etc., and preferably salt tolerance. The site for applying humic acid is not particularly limited and can be the rhizosphere. The application amount and application period of humic acid are not particularly limited. In the case of soil application, the total organic carbon concentration is 0.1 to 5000 mg / L, 1 to 12 times a month. In the case of hydroponic cultivation, the total organic carbon concentration is 0.1 to 5000 mg / L, 1 to 12 times a month. In the case of foliar application, the total organic carbon concentration is 0.1 to 5000 mg / L, 1 to 12 times a month.

[0021] An expression promoter for a gene involved in nitrogen metabolism of a plant according to an embodiment of the present invention contains humic acid. Humic acid and the target plant, etc. are as described above.

[0022] The gene involved in nitrogen metabolism is a gene encoding a protein involved in the reaction of converting nitrogen or a nitrogen compound into another nitrogen compound, and examples include genes encoding nitrate reductase (NR), nitrate ion transporter (Nrt), etc.

[0023] When an expression promoter for a gene involved in nitrogen metabolism of a plant according to an embodiment of the present invention is applied to a plant, the expression of the gene involved in nitrogen metabolism increases compared to the case where it is not applied, and the expression level is 1.1 times or more, preferably 1.5 times or more, of the expression level (transcription amount and / or translation amount) when the expression promoter for the gene involved in nitrogen metabolism is not applied.

[0024] A photosynthesis activator according to an embodiment of the present invention contains humic acid. Humic acid and the target plant, etc. are as described above.

[0025] When the photosynthesis activator according to this embodiment is applied to a plant, photosynthesis is activated compared to the case where it is not applied, and the photosynthesis rate is 1.1 times or more, preferably 1.3 times or more, of the photosynthesis rate when it is not applied.

[0026] A method for activating photosynthesis of a plant according to an embodiment of the present invention includes applying humic acid to the plant. The application site, application amount, and application period of humic acid are as described above. When humic acid is applied to a plant, the photosynthesis of the plant is activated, and combined with the increase in the expression of genes involved in nitrogen metabolism, the growth of the plant is promoted.

Example

[0027] Test Example 1: Cultivation of tomatoes under salt stress 1. Tomato (Micro-Tom) seeds were taken out of the refrigerator and left standing at room temperature (about 25°C) overnight. 2. A moistened paper towel was placed in a plastic petri dish, and tomato seeds were sown thereon at intervals of about 1 cm. Then, it was left standing in an incubator. 3. Four days after sowing, the germinated tomatoes were transplanted into rock wool (Grodan), arranged in a tray, and then OAT A formulation (OAT Agrio Co., Ltd.; total nitrogen 260 ppm, P 2 O 5 120 ppm, K 2 O 405 ppm) was applied. 4. One week after transplantation, in the group to which humic acid was applied, the OAT A formulation with a TOC concentration of 8 ppm was applied to acclimatize to humic acid. For those to which humic acid was not applied, only the OAT A formulation was applied. 5. One week after humic acid acclimatization, the plants were transferred to plastic containers for each test plot, and a salt stress test was conducted. The test conditions are as described in the "Test Plot" below. 6. The medium was changed once a week from the start of the salt stress test. 7. For the growth survey, the maximum leaf length (cm), number of flowers (pieces), SPAD, and main stem length (cm) were measured. SPAD (chlorophyll content contained in the leaves) was measured using a SPAD-502Plus manufactured by Konica Minolta.

[0028] All cultivations were carried out in an incubator (Tokyo Rika Kikai Co., Ltd.; FLI-2010H-LED). The incubation conditions are as follows. Day length: 16 hours Temperature: 25°C, 16 hours / 20°C, 8 hours

[0029] Test area Regarding the salt stress test, the NaCl concentration was adjusted to 0, 50 mM or 100 mM, and the test was carried out with no humic acid application or with humic acid (TOC concentration 15 or 60 ppm) application. Regarding the gene expression analysis and photosynthetic rate measurement test, the test was carried out with no humic acid application or with humic acid (TOC concentration 60 ppm) application.

[0030] Humic acid The humic acid used was a humic acid extract derived from lignite. According to the method described in Japanese Patent No. 6231059, TOC and MI were adjusted by adjusting the amount of nitric acid added during the production of the humic acid extract. The humic acids used were Product 1 (humic acid extract derived from lignite, TOC 35000 ppm, MI 2.0 or more) and Product 2 (humic acid extract derived from lignite, TOC 20000 ppm, MI 4.0).

[0031] By applying humic acid, the maximum leaf length, number of flowers, SPAD, and main stem length could be increased, and it was confirmed that the growth of tomatoes was promoted and the salt stress tolerance was improved. As an example, the results when Product 1 was applied to a TOC concentration of 15 ppm and cultivated for 5 weeks under salt stress conditions with an NaCl concentration of 100 mM are shown in the following table.

[0032] [Table 1]

[0033] Test Example 2: Microarray analysis

[0034] Gene expression analysis The extraction of transcripts was carried out as follows. 1. After applying humic acid for 24 hours, the leaves were pinched off with tweezers and quickly frozen in liquid nitrogen. 2. The leaves of frozen tomatoes were crushed with beads to extract the transcription products. Crushing was performed using Precellys Evolution (Bertin technologies) and MN Bead Tubes Type G (Takara Bio Inc.). 3. The transcription products were purified using the RNeasy Plant Mini Kit (Plant version) (Kanto Chemical Co., Inc.). At that time, contamination of DNA in the transcription products was confirmed by measuring Abs260 / Abs280 and the like. 4. The obtained transcription products were subjected to reverse transcription reaction (ReverTra Ace (registered trademark) qPCR RT Master Mix with gDNA Remover; Toyobo Co., Ltd.) to synthesize cDNA and perform gene expression analysis.

[0035] Microarray analysis was performed as follows. 1. Analysis using the Tomato Gene Expression Microarray (Agilent Technologies) was carried out by Takara Bio Inc. 2. The data were analyzed using the Subio Platform of Subio Inc. Genes with more than a two-fold expression variation compared to non-application of humic acid were determined to be genes affected by humic acid in terms of expression.

[0036] Figure 1 is a figure showing the gene expression in the leaves of tomatoes when humic acid was applied compared to the gene expression in the leaves of tomatoes when humic acid was not applied. An increase in the expression of genes encoding DnaJ and WRKY, which are stress response genes, was confirmed.

[0037] Test Example 3: Quantitative PCR Analysis Quantitative PCR analysis was performed as follows. 1. When the ACT2 gene is used as a housekeeping gene, the expression of the gene encoding DnaJ, which is a gene encoding a molecular chaperone, increased in the microarray, and since the growth became vigorous, it was considered that nitrogen metabolism became active. Therefore, the expression of the gene encoding NR involved in nitrate reduction was investigated. The ACT2 gene refers to a type of actin gene. The equipment used was QuantStudio 3 (Applied Biosystems), and the reagent used was KOD SYBR (registered trademark) qPCR Mix (Toyobo Co., Ltd.). Also, the sequences of the primers used are shown below.

[0038] ACT2 cattgtgctcagtggtggttc (SEQ ID NO: 1) tctgctggaaggtgctaagtg (SEQ ID NO: 2) DnaJ ctacgatccaggagatcaag (SEQ ID NO: 3) gacgtgtccttctgatcaat (SEQ ID NO: 4) NR cgtaggccgtactttcaagc (SEQ ID NO: 5) catcgtcatcctcgtcttca (SEQ ID NO: 6)

[0039] Figure 2 is a diagram showing the expression of the gene encoding DnaJ (DnaJ / ActII) in tomato leaves when humic acid was not applied and when it was applied. By applying humic acid, the expression of the gene encoding DnaJ increased 2.0-fold. Figure 3 is a diagram showing the expression of the gene encoding NR (NR / ActII) in tomato leaves when humic acid was not applied and when it was applied. By applying humic acid, the expression of the gene encoding NR increased 2.5-fold.

[0040] Test Example 4: Photosynthetic rate analysis Since the application of humic acid resulted in vigorous growth, it was presumed that photosynthesis was active, and the photosynthesis rate was measured at the third and fourth weeks of cultivation. By applying humic acid, an increase in the photosynthesis rate was confirmed. As an example, the results when Product 2 was applied are shown in the following table. Photosynthesis transpiration measurement and chlorophyll fluorescence measurement were carried out. For photosynthesis transpiration measurement, a plant photosynthesis comprehensive analysis system (manufactured by LiCor, LI-6800) was used to measure the transpiration rate, photosynthesis rate, and stomatal conductance. The transpiration rate is the rate at which water generated by the photosynthesis reaction is transpired from the leaves. The transpiration rate increases as the photosynthesis reaction proceeds well. Stomatal conductance is a value that serves as an index of the aperture of stomata for taking in carbon dioxide into the leaf. The larger the stomatal conductance, the easier it is to take in carbon dioxide into the leaf, and the more likely the photosynthesis reaction is to proceed well. done. For chlorophyll fluorescence measurement, a plant photosynthesis comprehensive analysis system (manufactured by LiCor, LI-6800) was used to measure the effective quantum yield, electron transfer rate, and non-photochemical quenching. Non-photochemical quenching (NPQ) is one of the photoprotection mechanisms and is an index indicating the mechanism of dissipating excess absorbed irradiation as heat. A small value of non-photochemical quenching indicates that light can be sufficiently utilized without highly expressing heat dissipation, and that the photosynthesis efficiency and plant growth of the plant are large. By applying humic acid, it was confirmed that the transpiration rate, photosynthesis rate, stomatal conductance, effective quantum yield, and electron transfer rate increased, the value of non-photochemical quenching decreased, and the photosynthesis efficiency and plant growth were large.

[0041]

Table 2

Claims

**Claim 1** An agent for increasing the expression of a gene encoding a plant nitrate reductase containing humic acid. **Claim 2** The expression increasing agent according to claim 1, wherein the humic acid is derived from lignite. **Claim 3** The expression increasing agent according to claim 1 or 2, wherein the melanic index is 2.0 or more.

Images