Oligonucleotides for tissue-specific APOE regulation

Oligonucleotide compounds targeting ApoE expression in the CNS provide a potent approach to inhibit neurodegenerative disease progression by effectively reducing ApoE gene expression, addressing the limited treatment options for neurodegenerative diseases.

JP7687685B2Active Publication Date: 2025-06-03UNIV OF MASSACHUSETTS
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
JP2021555491
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-12-20
Filing Date
2020-03-13
Publication Date
2025-06-03
Estimated Expiration
2040-03-13

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative diseases such as Alzheimer's and amyotrophic lateral sclerosis (ALS) are limited, and abnormal cholesterol transport mediated by apolipoprotein E (ApoE) is a key pathway associated with disease progression, necessitating effective regulation of ApoE expression in the central nervous system (CNS).

Method used

Development of oligonucleotide compounds, including RNA molecules with complementary regions specifically designed to target ApoE expression, which can inhibit ApoE gene expression in CNS tissues, thereby reducing neurodegenerative progression.

Benefits of technology

The oligonucleotide compounds demonstrate potent silencing activity against ApoE expression, effectively reducing ApoE gene mRNA levels in the hippocampus and spinal cord, and inhibiting neurodegenerative processes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007687685000043
    Figure 0007687685000043
  • Figure 0007687685000044
    Figure 0007687685000044
  • Figure 0007687685000045
    Figure 0007687685000045
Patent Text Reader

Abstract

The present disclosure relates to novel ApoE target sequences. Novel oligonucleotides for treating neurodegenerative and amyloid-related diseases are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] (Cross - Reference to Related Applications) This application claims priority to U.S. Provisional Patent Application 62 / 819,189, filed Mar. 15, 2019, U.S. Provisional Patent Application 62 / 864,797, filed Jun. 21, 2019, and U.S. Provisional Patent Application 62 / 951,441, filed Dec. 20, 2019, the entire contents of each of which are hereby incorporated by reference herein.

[0002] (Statement Regarding Federally Sponsored Research or Development) This invention was made with government support under Grant No. NS104022 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] (Field of the Invention) This disclosure relates to novel apolipoprotein E (ApoE) target sequences, novel branched oligonucleotides, and novel methods of treating and preventing neurodegeneration.

Background Art

[0004] Patients with neurodegenerative diseases, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), have limited treatment options. Abnormal cholesterol transport has been consistently associated with neurodegeneration and the worsening of clinical symptoms in AD and ALS, which has become a particularly interesting pathway as a target for gene therapy.

[0005] Apolipoprotein E (ApoE) promotes cholesterol transport in systemic circulation and the central nervous system (CNS). In human plasma and the CNS, the total levels of ApoE and specific ApoE isoforms (i.e., E2, E3, E4) are associated with the onset and progression of AD and ALS. Furthermore, the total levels of ApoE in the CNS have been found to be a precursor of neurodegenerative progression.

[0006] In mice, overall reduction of ApoE reduces the pathological features of neurodegeneration, indicating that non-selective regulation of ApoE can be a treatment approach for neurodegenerative diseases. A notable feature of the presented compounds is that almost complete, although not complete, regulation of ApoE may be required to obtain a measurable effect on neurodegeneration. Therefore, substances capable of CNS-regulating ApoE expression are urgently needed in the art.

Summary of the Invention

[0007] The present disclosure provides oligonucleotide compounds that exhibit potent and effective silencing activity against ApoE expression. In certain embodiments, the oligonucleotides of the present disclosure can inhibit in central nervous system (CNS) tissues.

[0008] In one aspect, the present disclosure provides an RNA molecule comprising a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', such as an RNA molecule 15 to 50 bases in length (e.g., 15 to 40 bases in length, e.g., an RNA molecule 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases in length).

[0009] In some embodiments, the RNA molecule comprises a complementary region substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0010] In some embodiments, the RNA molecule comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0011] In some embodiments, the RNA molecule comprises a dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a substantially complementary complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0012] In some embodiments, the RNA molecule comprises a length of 15 to 25 base pairs.

[0013] In some embodiments, the complementary region is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. For example, the complementary region can be complementary to a segment of 10 to 30 consecutive nucleotides of GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA or UGGACCCUAGUUUAAUAAAGAUUCACCAAG (e.g., a segment of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA or UGGACCCUAGUUUAAUAAAGAUUCACCAAG).

[0014] In some embodiments, the complementary region comprises three or fewer mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0015] In some embodiments, the complementary region is completely complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0016] In some embodiments, the dsRNA has blunt ends.

[0017] In some embodiments, the dsRNA comprises at least one single-stranded nucleotide overhang.

[0018] In some embodiments, the dsRNA comprises naturally occurring nucleotides.

[0019] In some embodiments, the dsRNA comprises at least one modified nucleotide.

[0020] In some embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, or a terminal nucleotide conjugated to a cholesteryl derivative or a didodecylamidate group.

[0021] In some embodiments, the modified nucleotide comprises a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, a abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide comprising a non-natural base.

[0022] In some embodiments, the dsRNA comprises at least one 2'-O-methyl modified nucleotide and at least one nucleotide comprising a 5' phosphorothioate group.

[0023] In some embodiments, the dsRNA is at least 75% chemically modified. In some embodiments, the dsRNA is at least 80% chemically modified. In some embodiments, the dsRNA is completely chemically modified.

[0024] In some embodiments, the dsRNA comprises a cholesterol moiety.

[0025] In some embodiments, the RNA molecule comprises a 5' end, a 3' end, and has complementarity to a target, wherein (1) the RNA molecule alternately comprises 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) the nucleotides at positions 1 to 2 to 1 to 7 from the 3' end are linked to adjacent nucleotides via phosphorothioate linkages.

[0026] In some embodiments, the dsRNA has a 5' end and a 3' end, has complementarity to a target, and comprises a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide alternately comprises 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages.

[0027] In some embodiments, the RNA molecule comprises a 5' end and a 3' end, has complementarity to a target, wherein (1) the RNA molecule comprises a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) the nucleotides at positions 1 to 2 to 1 to 7 from the 3' end are linked to adjacent nucleotides via phosphorothioate linkages; and (5) the nucleotides at positions 1 to 2 from the 5' end are linked to each other via phosphorothioate linkages.

[0028] In some embodiments, the dsRNA has a 5' end and a 3' end, has complementarity to a target, and comprises a first oligonucleotide and a second oligonucleotide, wherein: (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages.

[0029] In some embodiments, a hydrophobic molecule is attached to the 3' end of the second oligonucleotide.

[0030] In some embodiments, the linkage between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol.

[0031] In some embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to the adjacent nucleotides via phosphorothioate bonds.

[0032] In some embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to the adjacent ribonucleotides via phosphorothioate bonds.

[0033] In one aspect, the present disclosure provides a pharmaceutical composition for inhibiting the expression of apolipoprotein E (ApoE) gene in an organism, the pharmaceutical composition comprising the above dsRNA and a pharmaceutically acceptable carrier.

[0034] In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 50%. In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 90%.

[0035] In one aspect, the present disclosure is a method for inhibiting the expression of the ApoE gene in a cell, comprising: (a) introducing the above double-stranded ribonucleic acid (dsRNA) into the cell; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ApoE gene, thereby providing a method for inhibiting the expression of the ApoE gene in the cell.

[0036] In one aspect, the present disclosure provides a method for treating or managing a neurodegenerative disease, the method comprising administering a therapeutically effective amount of the above dsRNA to a patient in need of such treatment or management.

[0037] In some embodiments, the dsRNA is administered to the patient's brain. In some embodiments, the dsRNA is locally administered to the brain or cerebrospinal fluid, for example, by intracerebroventricular (ICV) injection. In other embodiments, the dsRNA is administered intravenously and can be delivered to the brain by passing through the blood-brain barrier (BBB).

[0038] In some embodiments, administration of the dsRNA causes reduction of ApoE gene mRNA in the hippocampus. In some embodiments, administration of the dsRNA causes reduction of ApoE gene mRNA in the spinal cord.

[0039] In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 50%.

[0040] In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 90%.

[0041] In one aspect, the present disclosure provides a vector that inhibits the expression of the ApoE gene intracellularly, comprising a regulatory sequence operably linked to a nucleotide sequence encoding an RNA molecule that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', wherein the RNA molecule comprises a length of 10-35 bases, and wherein the RNA molecule inhibits the expression of the ApoE gene by at least 50% when contacting a cell that expresses the ApoE gene.

[0042] In some embodiments, the RNA molecule inhibits the expression of the ApoE gene by at least 90%.

[0043] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0044] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0045] In one aspect, the present disclosure provides a cell comprising the above vector.

[0046] In one aspect, the present disclosure provides an RNA molecule 15 to 35 bases in length comprising a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', wherein the RNA molecule targets the open reading frame (ORF) or 3' untranslated region of the ApoE gene mRNA.

[0047] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0048] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0049] In one aspect, the present disclosure provides a branched (e.g., di-branched) RNA compound comprising two or more RNA molecules each 15 to 35 bases in length, wherein the RNA compound further comprises a complementary region that is substantially complementary to ApoE mRNA, and wherein the two RNA molecules are covalently linked to each other (e.g., by one or more moieties independently selected from linkers, spacers, and branch points).

[0050] In some embodiments, the RNA molecule comprises a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0051] In some embodiments, the RNA molecule comprises a complementary region that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0052] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0053] In some embodiments, the RNA molecule comprises an antisense molecule or a gapmer molecule.

[0054] In some embodiments, the antisense molecule comprises an antisense oligonucleotide.

[0055] In some embodiments, the antisense molecule enhances the degradation of the complementary region.

[0056] In some embodiments, the degradation comprises nuclease degradation.

[0057] In some embodiments, the nuclease degradation is mediated by RNase H.

[0058] In one aspect, provided is a branched oligonucleotide compound comprising two or more nucleic acids, for example, two or more nucleic acids each having a length of 15 to 40 bases.

[0059] Each nucleic acid independently includes a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and

[0060] the two or more nucleic acids are linked to each other by one or more moieties including a linker, a spacer, or a branch point.

[0061] In some embodiments, each nucleic acid independently includes a complementary region that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0062] In some embodiments, each nucleic acid includes a length of 15 to 25 base pairs.

[0063] In some embodiments, each nucleic acid includes single-stranded (ss) RNA or double-stranded (ds) RNA. In some embodiments, each nucleic acid includes dsRNA containing a sense strand and an antisense strand, wherein each antisense strand independently includes a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In some embodiments, each complementary region is independently complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0064] In some embodiments, each complementary region independently contains three or fewer mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0065] In some embodiments, each complementary region is completely complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0066] In some embodiments, each dsRNA independently contains at least one modified nucleotide.

[0067] In some embodiments, the modified nucleotide includes a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, or a terminal nucleotide conjugated to a cholesteryl derivative or a bisdecylamide group of dodecanoic acid.

[0068] In some embodiments, the modified nucleotide includes a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, a abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing an unnatural base.

[0069] In some embodiments, the two or more nucleic acids are each an RNA molecule having complementarity to a target, including a 5' end and a 3' end, wherein (1) the RNA molecule alternately includes 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) The nucleotides at positions 1 to 7 starting from the 3'-end at positions 1 to 2 are linked to the adjacent nucleotides via phosphorothioate linkages.

[0070] In some embodiments, each nucleic acid has a 5'-end and a 3'-end, has complementarity to a target, and is a dsRNA comprising a first oligonucleotide and a second oligonucleotide, wherein (1) The first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) A part of the first oligonucleotide is complementary to a part of the second oligonucleotide; (3) The second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) The nucleotides at positions 2 and 14 from the 3'-end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages.

[0071] In some embodiments, each of the two or more nucleic acids comprises an RNA molecule, wherein the RNA molecule comprises a 5'-end and a 3'-end, has complementarity to a target, wherein (1) The RNA molecule comprises a region of three consecutive 2'-fluoro-ribonucleotides; (2) The nucleotides at positions 2 and 14 from the 5'-end are not 2'-methoxy-ribonucleotides; (3) The nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) The nucleotides at positions 1 to 7 starting from the 3'-end at positions 1 to 2 are linked to the adjacent nucleotides via phosphorothioate linkages; and (5) The nucleotides at positions 1 to 2 from the 5'-end are linked to each other via phosphorothioate bonds.

[0072] In one aspect, the present disclosure provides a compound of formula (I):

Chemical formula

Table 1

[0073] In one embodiment, the antisense strand

Chemical formula

[0074] In some embodiments, the compound has the formula (II):

Chemical formula

[0075] In some embodiments, the compound has the formula (III):

Chemical formula

[0076] In some embodiments, the compound has the formula (IV): [ka] [In the formula, X is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - indicates a phosphodiester internucleoside linkage; = indicates a phosphorothioate internucleoside linkage; and --- indicates a base-pairing interaction or mismatch each occurrence alone.] It has the structure:

[0077] In some embodiments, the compound has the formula (V): [ka] [In the formula, X is, independently at each occurrence, a nucleotide that contains a 2'-deoxy-2'-fluoro modification; X, independently for each occurrence, is a nucleotide containing a 2'-O-methyl modification; Y is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y, independently for each occurrence, is a nucleotide containing a 2'-O-methyl modification. It has the structure:

[0078] In some embodiments, the moiety L has the structure L1: [ka] It is.

[0079] In some embodiments, when L is structure L1, R is R3 and n is 2.

[0080] In some embodiments, L is structure L2:

Chemical formula

[0081] In some embodiments, when L is structure L2, R is R3 and n is 2.

[0082] In one aspect, the present disclosure provides a formula (VI):

Chemical formula

[0083] In some embodiments, each cNA independently comprises 15 to 25 consecutive nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides) of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0084] In some embodiments, each cNA independently comprises 15 to 21 consecutive nucleotides (e.g., 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides) of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0085] In some embodiments, each cNA comprises 15 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3. In some embodiments, each comprises 16 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3.

[0086] In some embodiments, the delivery system has a structure selected from formulas (VI-1) to (VI-9): [Table 2] having.

[0087] In some embodiments, each cNA independently comprises chemically modified nucleotides.

[0088] In some embodiments, the delivery system further comprises n therapeutic nucleic acids (NAs), wherein each NA hybridizes to at least one cNA.

[0089] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides. In some embodiments, each NA independently comprises 16 to 30 consecutive nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides). In some embodiments, each NA independently comprises 18 to 24 consecutive nucleotides (e.g., 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides).

[0090] In some embodiments, each NA independently comprises 16 to 21 consecutive nucleotides.

[0091] In some embodiments, each NA comprises 20 consecutive nucleotides. In some embodiments, each NA comprises 21 consecutive nucleotides.

[0092] In some embodiments, each cNA comprises 15 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and each NA comprises 20 consecutive nucleotides.

[0093] In some embodiments, each cNA comprises 16 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and each NA comprises 21 consecutive nucleotides.

[0094] In some embodiments, each NA comprises an overhang of at least two nucleotides. The nucleotides of the overhang may be linked via phosphorothioate linkages.

[0095] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagomiR, miRNA, gapmer, mixmer, and guide RNA.

[0096] In one aspect, the present disclosure provides a pharmaceutical composition for inhibiting the expression of apolipoprotein E (ApoE) gene in an organism, the pharmaceutical composition comprising one of the above compounds or systems, and a pharmaceutically acceptable carrier.

[0097] In some embodiments, the compound or system inhibits the expression of the ApoE gene by at least 50%.

[0098] In some embodiments, the compound or system inhibits the expression of the ApoE gene by at least 90%.

[0099] In one aspect, the present disclosure provides a method for inhibiting the expression of the ApoE gene in a cell, comprising: (a) introducing one of the above compounds or systems into the cell; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ApoE gene, thereby inhibiting the expression of the ApoE gene in the cell.

[0100] In one aspect, the present disclosure provides a method for treating or managing a neurodegenerative disease, comprising administering a therapeutically effective amount of one of the above compounds or systems to a patient in need of such treatment or management.

[0101] In some embodiments, the compound or system is administered to the patient's brain.

[0102] In some embodiments, the dsRNA is administered to the patient's brain. In some embodiments, the dsRNA is locally administered to the brain or cerebrospinal fluid, for example, by intracerebroventricular (ICV) injection. In other embodiments, the dsRNA is administered intravenously and can be delivered to the brain by crossing the blood-brain barrier (BBB).

[0103] In some embodiments, administration of the compound or system causes a reduction of ApoE gene mRNA in the hippocampus.

[0104] In some embodiments, administration of the compound or system causes a reduction of ApoE gene mRNA in the spinal cord.

[0105] In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 50%.

[0106] In some embodiments, the dsRNA inhibits the expression of the ApoE gene by at least 90%.

[0107] In one aspect, provided is a branched oligonucleotide compound comprising two or more nucleic acids, for example, two or more nucleic acids each having a length of 15 to 40 bases (e.g., a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases), wherein each nucleic acid comprises a complementary region that is substantially complementary to ApoE mRNA, and wherein the two nucleic acids are covalently linked to each other (e.g., by one or more moieties including a linker, spacer, or branch point).

[0108] In some embodiments, each nucleic acid independently comprises a complementary region that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0109] In some embodiments, each nucleic acid independently comprises a complementary region that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0110] In some embodiments, each nucleic acid independently comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0111] In some embodiments, each nucleic acid independently comprises an antisense molecule or a gapmer molecule.

[0112] In one aspect, a method of treating or managing an amyloid-related disease, comprising administering to a patient having or diagnosed as being at risk of developing the disease a therapeutically effective amount of one of the above compounds or systems is provided.

[0113] In some embodiments, the disease is selected from the group consisting of Alzheimer's disease, cerebral amyloid angiopathy, mild cognitive impairment, moderate cognitive impairment, and combinations thereof.

[0114] In some embodiments, the compound or system is administered to the patient's brain, for example, by intracerebroventricular injection.

[0115] In non-limiting embodiments, administration of a compound or system inhibits, delays, prevents, or reduces cognitive decline. In non-limiting embodiments, administration of a compound or system inhibits, delays, prevents, or reduces the formation of beta amyloid plaques. In exemplary embodiments, administration of a compound or system inhibits, delays, prevents, or reduces neurodegeneration.

[0116] In a further aspect, a method of treating or managing Alzheimer's disease, comprising administering to a patient having the disease or diagnosed as being at risk of developing the disease a therapeutically effective amount of a branched oligonucleotide compound comprising two or more nucleic acids, for example, each nucleic acid having a length of 15 to 40 bases (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases), wherein each nucleic acid comprises a complementary region substantially complementary to ApoE mRNA, and wherein the two nucleic acids are covalently linked to each other (e.g., by one or more moieties including a linker, spacer, or branch point). A method is provided.

[0117] In some embodiments, each nucleic acid of the branched oligonucleotide compound independently comprises a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, each nucleic acid of the branched oligonucleotide independently comprises a complementary region substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0118] In some embodiments, each nucleic acid comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0119] In a further embodiment, each nucleic acid comprises an antisense molecule or a gapmer molecule.

[0120] In some embodiments, the branched oligonucleotide is administered to the brain of a patient, for example, by intracerebroventricular injection.

[0121] In a non-limiting embodiment, administration of the branched oligonucleotide inhibits, delays, prevents or reduces cognitive decline. In a further non-limiting embodiment, administration of the compound or system inhibits, delays, prevents or reduces the formation of beta-amyloid plaques. In an exemplary embodiment, administration of the branched oligonucleotide inhibits, delays, prevents or reduces neurodegeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0122] The foregoing and other features and advantages of the invention will be more fully understood from the following detailed description of the exemplary embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one color drawing. Copies of this patent or patent application publication with color drawing(s) will be provided in the United States upon request and payment of the necessary fee.

[0123] Figures 1A - 1C show the identification of novel target sequences that demonstrate silencing in both mRNA and protein-based mouse cell models.

[0124]

Figure 1A

[0125]

Figure 1B

[0126]

Figure 1C

[0127] Figures 2A-2B show the identification of novel target sequences that exhibit mRNA silencing in an mRNA-based human cell model.

[0128]

Figure 2A

[0129]

Figure 2B

[0130] Figures 3A-3B show oligonucleotides targeting ApoE.

[0131]

Figure 3A

[0132]

Figure 3B

[0133] Figures 4A-4C show mRNA and protein expression silencing in the whole brain of mice one month after injection of CNS-siRNA ApoE Figure 4A shows mRNA silencing in all regions of the brain one month after injection.

[0134]

Figure 4A

[0135]

Figure 4B

[0136]

Figure 4C

[0137] Figures 5A - 5B show that CNS - siRNA ApoE silences ApoE protein in the hippocampus at low doses.

[0138]

Figure 5A

[0139]

Figure 5B

[0140] Figures 6A - 6B show that CNS - siRNA ApoE silences the entire spinal cord at low doses.

[0141]

Figure 6A

[0142]

Figure 6B

[0143] Figures 7A - 7B show that brain - specific (non - hepatic) silencing of ApoE with CNS - siRNA ApoE is possible at low doses.

[0144]

Figure 7A

[0145]

Figure 7B

[0146] Figures 8A-8C show that GalNAc-siRNA ApoE silences protein expression in the liver but does not affect brain proteins.

[0147]

Figure 8A

[0148]

Figure 8B

[0149]

Figure 8C

[0150] Figures 9A-9B show that reducing ApoE in the liver increases serum cholesterol, but silencing only CNS-ApoE does not increase serum cholesterol.

[0151]

Figure 9A

[0152]

Figure 9B

[0153] Figures 10A-10B show that CNS and systemic ApoE represent two different protein pools.

[0154]

Figure 10A

[0155]

Figure 10B

[0156]

Figure 11

[0157]

Figure 12

[0158]

Figure 13

[0159]

Figure 14

[0160] Figures 15A - 15B show the synthesis of branched oligonucleotides using alternative chemical routes.

Figure 15A

Figure 15B

[0161]

Figure 16

[0162]

Figure 17

[0163]

Figure 18

[0164]

Figure 19

[0165] Figures 20A to 20C show the branched oligonucleotide of the present invention (Figure 20A) formed by annealing three oligonucleotides. The longer linking oligonucleotide may include a cleavable region in the form of unmodified RNA, DNA or UNA; (Figure 20B) an asymmetric branched oligonucleotide having 3' and 5' linkages to the aforementioned linker or spacer. This can apply to the 3' and 5' ends of the sense or antisense strand, or a combination thereof; (Figure 20C) a branched oligonucleotide consisting of three separate strands. The long double-sense strand can be synthesized with 3'-phosphoramidite and 5'-phosphoramidite enabling 3'-3' or 5'-5' adjacent ends.

[0166]

Figure 21

[0167]

Figure 22

[0168]

Figure 23

[0169]

Figure 24

[0170]

Figure 25

[0171]

Figure 26

[0172]

Figure 27

[0173]

Figure 28

[0174]

Figure 29

[0175]

Figure 30

[0176]

Figure 31

[0177]

Figure 32

[0178]

Figure 33

[0179]

Figure 34

[0180]

Figure 35

[0181]

Figure 36

[0182]

Figure 37

[0183]

Figure 38

[0184]

Figure 39

[0185]

Figure 40

[0186]

Figure 41

[0187]

Figure 42

[0188]

Figure 43

[0189] Figures 44A - 44C show the identification of novel target sequences for mRNA silencing in an mRNA - based human cell model.

Figure 44A

Figure 44B

Figure 44C

[0190]

Figure 45

[0191]

Figure 46

[0192]

Figure 47

[0193]

Figure 48

[0194]

Figure 49

[0195]

Figure 50

[0196] (Detailed description of certain exemplary embodiments) Novel ApoE target sequences are provided. Also provided are novel interfering RNA molecules, such as siRNA, that target the novel ApoE target sequences of the present invention.

[0197] Unless otherwise indicated, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein is well known and commonly used in the art. Unless otherwise indicated, the methods and techniques provided herein are performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. Enzyme reactions and purification techniques are performed according to the manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with analytical chemistry, organic synthetic chemistry, medicinal chemistry, and their assays and techniques described herein are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceuticals, formulations, delivery, and patient treatment.

[0198] Unless otherwise defined herein, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. In the case of any potential ambiguity, the definitions provided herein shall prevail over dictionary or external definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise stated. The use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0199] To facilitate a better understanding of the present invention, certain terms are first defined.

[0200] The term "nucleoside" means a molecule in which a purine or pyrimidine base is covalently bonded to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Further exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine (also referred to as "rare" nucleosides). The term "nucleotide" means a nucleoside having one or more phosphate groups joined to the sugar moiety by an ester bond. Exemplary nucleotides include nucleoside monophosphate, diphosphate, and triphosphate. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and mean a polymer of nucleotides joined completely by phosphodiester or phosphorothioate bonds between 5' and 3' carbon atoms.

[0201] The terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" mean a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides). DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA may be modified post-transcriptionally. Also, DNA and RNA can be synthesized chemically. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or double-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is a single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated when ribosomes bind to the mRNA during protein synthesis.

[0202] As used herein, the term "small interfering RNA" ("siRNA") (also referred to in the art as "short interfering RNA") means an RNA (or RNA analog) containing about 10 to 50 nucleotides (or nucleotide analogs) that can direct or mediate RNA interference. Preferably, the siRNA contains about 15 to 30 nucleotides or nucleotide analogs, more preferably about 16 to 25 nucleotides (or nucleotide analogs), even more preferably about 18 to 23 nucleotides (or nucleotide analogs), and even more preferably about 19 to 22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs). The term "short" siRNA means an siRNA containing about 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term "long" siRNA means an siRNA containing about 24 to 25 nucleotides, e.g., 23, 24, 25, or 26 nucleotides. Short siRNAs may, in some cases, contain less than 19 nucleotides, e.g., 16, 17, or 18 nucleotides, provided that such shorter siRNAs retain the ability to mediate RNAi. Similarly, long siRNAs may, in some cases, contain more than 26 nucleotides, provided that long siRNAs retain the ability to mediate RNAi without further processing (e.g., enzymatic processing) into shorter siRNAs.

[0203] The term "nucleotide analog" or "modified nucleotide" or "modified nucleotide" means a non-standard nucleotide, including unnatural ribonucleotides or deoxyribonucleotides. Exemplary nucleotide analogs retain the ability of a nucleotide analog to perform its intended function despite being modified at any position to modify a particular chemical property of the nucleotide. Examples of positions of nucleotides that can be derivatized include the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, 5-propynyluridine, 5-propenyluridine, etc.; the 6-position, such as 6-(2-amino)propyluridine; the 8-position of adenosine and / or guanosine, such as 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Also included in nucleotide analogs are deazanucleotides, such as 7-deaza-adenosine; O- and N-modified (e.g., alkylated, such as N6-methyladenosine, or otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs as described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0204] Nucleotide analogs can also include modifications to the sugar moiety of the nucleotide. For example, the 2'OH-group may be replaced by a group selected from the group consisting of H, OR, R, F, Cl, Br, I, SH, SR, NH 2 , NHR, NR 2 , or COOR, where R is substituted or unsubstituted C 1 -C 6 -alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications are those described in U.S. Patents 5,858,988 and 6,291,438.

[0205] The phosphate group of a nucleotide can also be modified, for example, by substituting one or more oxygens of the phosphate group with sulfur (e.g., phosphorothioate), or by making other substitutions that allow the nucleotide to perform its intended function, as described, for example, in Eckstein, Anti-sense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Anti-sense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Anti-sense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Anti-sense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Patent 5,684,143. The specific modifications described above (e.g., phosphate group modifications) preferably reduce the hydrolysis rate of polynucleotides containing the analog, for example, in vivo or in vitro.

[0206] The term "oligonucleotide" means a short polymer of nucleotides and / or nucleotide analogs. An "RNA analog" means a polynucleotide (e.g., a chemically synthesized polynucleotide) that has at least one modified or altered nucleotide compared to the corresponding unmodified or unmodified RNA, but retains the same or similar properties or functions as the corresponding unmodified or unmodified RNA. As described above, oligonucleotides may be linked by bonds such that the hydrolysis rate of the RNA analog is lower compared to an RNA molecule having phosphodiester bonds. For example, the analog nucleotides can include methylenediol, ethylenediol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoramidate, and / or phosphorothioate bonds. Preferred RNA analogs include sugar- and / or backbone-modified ribonucleotides and / or deoxyribonucleotides. Such modifications or alterations can further include, for example, adding non-nucleotide material to the ends of the RNA or internally (to one or more nucleotides of the RNA). The RNA analog need only be sufficiently similar to natural RNA to have the ability to mediate RNA interference.

[0207] As used herein, the term "RNA interference" ("RNAi") means the selective intracellular degradation of RNA. RNAi occurs naturally in cells to remove foreign RNA (e.g., viral RNA). Natural RNAi proceeds via fragments cleaved from free dsRNA that direct the degradative mechanism to other similar RNA sequences. Alternatively, RNAi can be initiated by humans, for example, to silence the expression of a target gene.

[0208] An RNAi agent, such as an RNA silencing agent, has a strand that is a "sequence that is sufficiently complementary to the target mRNA sequence to direct target-specific RNA interference (RNAi)", and that strand has a sequence sufficient to induce the destruction of the target mRNA by the RNAi mechanism or process.

[0209] As used herein, the term "isolated RNA" (e.g., "isolated siRNA" or "isolated siRNA precursor") means an RNA molecule that, when produced by recombinant techniques, is substantially free of other cellular material or culture medium, and when chemically synthesized, is substantially free of chemical precursors or other chemicals.

[0210] As used herein, the term "RNA silencing" means a sequence-specific regulatory mechanism mediated by an RNA molecule (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression) that results in the inhibition or "silencing" of the expression of the corresponding protein-coding gene. RNA silencing has been observed in many organisms such as plants, animals, and fungi.

[0211] As used herein, the term "discriminatory RNA silencing" means, for example, the ability of an RNA molecule to substantially inhibit the expression of a "first" or "target" polynucleotide sequence but not substantially inhibit the expression of a "second" or "non-target" polynucleotide sequence when both polynucleotide sequences are present in the same cell. In certain embodiments, the target polynucleotide sequence corresponds to a target gene, while the non-target polynucleotide sequence corresponds to a non-target gene. In other embodiments, the target polynucleotide sequence corresponds to a target allele, while the non-target polynucleotide sequence corresponds to a non-target allele. In certain embodiments, the target polynucleotide sequence is a DNA sequence encoding a regulatory region (e.g., a promoter or enhancer element) of a target gene. In another embodiment, the target polynucleotide sequence is a target mRNA encoded by a target gene.

[0212] The term "in vitro" has the meaning recognized in the art, for example, as relating to purified reagents or extracts, such as cell extracts. The term "in vivo" also has the meaning recognized in the art as relating to living cells, such as immortalized cells, primary cells, cell lines, and / or cells of an organism.

[0213] As used herein, the term "transgene" means any nucleic acid molecule that is inserted into a cell by a strategy and becomes part of the genome of an organism that grows from that cell. Such a transgene can contain genes that are partially or entirely heterologous (i.e., foreign) to the transgenic organism or can represent a gene homologous to an endogenous gene of the organism. The term "transgene" also means a nucleic acid molecule containing one or more nucleic acid sequences encoding one or more engineered RNA precursors for expression in a transgenic organism, e.g., an animal, selected from DNA, which is partially or entirely heterologous, i.e., foreign, to the transgenic animal or homologous to an endogenous gene of the transgenic animal but is designed to be inserted into the genome of the animal at a position different from the natural gene. A transgene contains one or more promoters and other DNA such as introns necessary for the expression of the selected nucleic acid sequence, all of which are operably linked to the selected sequence and can contain enhancer sequences.

[0214] Genes "involved" in a disease or disorder include those genes whose normal or abnormal expression or function results in, or causes, the disease or disorder or at least one symptom of the disease or disorder.

[0215] As used herein, the term "gain-of-function mutation" means any mutation in a gene in which the protein encoded by the gene (i.e., the mutant protein) acquires a function that is not normally associated with that protein (i.e., the wild-type protein) that causes or is involved in a disease or disorder. A gain-of-function mutation can be a deletion, addition, or substitution of a nucleotide in the gene that results in a change in the function of the encoded protein. In one embodiment, a gain-of-function mutation changes the function of the mutant protein or causes an interaction with another protein. In another embodiment, a gain-of-function mutation causes a reduction or elimination of the normal wild-type protein, for example, by an interaction between the modified mutant protein and the normal wild-type protein.

[0216] As used herein, the term "target gene" is a gene whose expression is substantially inhibited or "silenced". This silencing can be achieved by RNA silencing, for example, by cleaving the mRNA of the target gene or by inhibiting translation of the target gene. A "non-target gene" is a gene whose expression is not substantially silenced. In one embodiment, the polynucleotide sequences of the target gene and the non-target gene (e.g., the mRNAs encoded by the target and non-target genes) may differ by one or more nucleotides. In another embodiment, the target gene and the non-target gene may differ by one or more polymorphisms (e.g., single nucleotide polymorphisms or SNPs). In another embodiment, the target gene and the non-target gene can share less than 100% sequence identity. In another embodiment, the non-target gene can be a homolog (e.g., an ortholog or paralog) of the target gene.

[0217] A "target allele" is an allele (e.g., an SNP allele) whose expression is selectively inhibited or "silenced". This silencing can be achieved by RNA silencing, e.g., by cleaving the mRNA of the target gene or target allele with siRNA. A "non-target allele" is an allele whose expression is not substantially silenced. In certain embodiments, the target allele and the non-target allele can correspond to the same target gene. In other embodiments, the target allele corresponds to or is related to a target gene, and the non-target allele corresponds to or is related to a non-target gene. In one embodiment, the polynucleotide sequences of the target allele and the non-target allele may differ by one or more nucleotides. In another embodiment, the target allele and the non-target allele may differ by one or more allelic polymorphisms (e.g., one or more SNPs). In another embodiment, the target allele and the non-target allele can share less than 100% sequence identity.

[0218] As used herein, the term "polymorphism" means a diversity (e.g., one or more deletions, insertions, or substitutions) in a gene sequence that is identified or detected when comparing the same gene sequence from different sources or subjects (but from the same organism). For example, a polymorphism can be identified when comparing the same gene sequence from different subjects. Identification of such polymorphisms is routinely performed in the art, and the methods are similar to those used, for example, to detect point mutations in breast cancer. Identification can be performed, for example, by using DNA extracted from control lymphocytes, and then amplifying the polymorphic region using primers specific for the polymorphic region. Alternatively, a polymorphism can be identified when comparing two alleles of the same gene. In certain embodiments, the polymorphism is a single nucleotide polymorphism (SNP).

[0219] As used herein, the diversity in the sequence between two alleles of the same gene within an organism is referred to as "allelic polymorphism". In certain embodiments, the allelic polymorphism corresponds to SNP alleles. For example, the allelic polymorphism can include single nucleotide variation between two alleles of an SNP. The polymorphism can be in nucleotides within the coding region, but due to the degeneracy of the genetic code, changes in the amino acid sequence are not encoded. Alternatively, the polymorphic sequence can encode different amino acids at a particular position, but this change in the amino acid does not affect the function of the protein. The polymorphic region may also be found in the non-coding region of the gene. In an exemplary embodiment, the polymorphism is found in the coding region of the gene or the untranslated region of the gene (e.g., 5'UTR or 3'UTR).

[0220] As used herein, the term "allele frequency" is a measure (e.g., ratio or percentage) of the relative frequency of an allele (e.g., SNP allele) at a single locus in a population. For example, if a population has n copies of the locus of a particular chromosomal locus (and the gene occupying that locus) in each of their somatic cells, the allele frequency of an allele is the ratio or percentage of the loci occupied by that allele within the population. In certain embodiments, the allele frequency of an allele (e.g., SNP allele) is at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40% or more) in a sample population.

[0221] As used herein, the term "sample population" means a population of individuals that includes a statistically significant number of individuals. For example, a sample population can include 50, 75, 100, 200, 500, 1000 or more individuals. In certain embodiments, a sample population can include individuals that share at least a common disease phenotype (e.g., gain-of-function disorder) or mutation (e.g., gain-of-function mutation).

[0222] As used herein, the term "heterozygosity" means the proportion of individuals within a population that are heterozygous (e.g., contain two or more different alleles) at a particular locus (e.g., an SNP). Heterozygosity can be calculated for a sample population by methods well known to those of skill in the art.

[0223] As used herein, the term "polyglutamine domain" means a segment or domain of a protein consisting of consecutive glutamine residues joined by peptide bonds. In one embodiment, the consecutive region contains at least 5 glutamine residues.

[0224] As used herein, the term "elongated polyglutamine domain" or "elongated polyglutamine segment" means a segment or domain of a protein that contains at least 35 consecutive glutamine residues joined by peptide bonds. Such elongated segments are found in subjects suffering from the polyglutamine disorders described herein, regardless of whether the subject exhibits overt symptoms.

[0225] As used herein, the term "trinucleotide repeat" or "trinucleotide repeat region" means a segment of a nucleic acid sequence consisting of consecutive repeats of a particular trinucleotide sequence. In one embodiment, the trinucleotide repeat contains at least 5 consecutive trinucleotide sequences. Exemplary trinucleotide sequences include, but are not limited to, CAG, CGG, GCC, GAA, CTG, and / or CGG.

[0226] As used herein, the term "trinucleotide repeat disorder" means any disease or disorder characterized by an extended trinucleotide repeat region located within a gene, and the extended trinucleotide repeat region causes the disease or disorder. Examples of trinucleotide repeat disorders include, but are not limited to, spinocerebellar ataxia type 12, spinocerebellar ataxia type 8, fragile X syndrome, fragile XE mental retardation, Friedreich's ataxia, and myotonic dystrophy. Exemplary trinucleotide repeat disorders for treatment according to the present invention are those characterized by, or caused by, an extended trinucleotide repeat at the 5' end of the coding region of a gene, and the gene encodes a mutant protein that causes or is the cause of a disease or disorder. Certain trinucleotide disorders where the mutation is not associated with the coding region, such as fragile X syndrome, may not be suitable for treatment by the methodology of the present invention because there is no appropriate mRNA targeted by RNAi. In contrast, diseases such as Friedreich's ataxia, although the causative mutation is not within the coding region (i.e., it is within an intron), the mutation can be within, for example, an mRNA precursor (e.g., a pre-spliced mRNA precursor), and thus is considered suitable for treatment by the methodology of the present invention.

[0227] The expression "considering the function of a gene in a cell or organism" means considering or studying the resulting expression, activity, function, or phenotype therefrom.

[0228] As used herein, the term "RNA silencing agent" means an RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, the RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of mRNA molecules via a post-transcriptional silencing mechanism. RNA silencing agents include small (<50 b.p.), non-coding RNA molecules, such as RNA duplexes containing paired strands, and precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include siRNA, miRNA, siRNA-like duplexes, antisense oligonucleotides, gapmer molecules, and bifunctional oligonucleotides, as well as precursors thereof. In one embodiment, the RNA silencing agent can induce RNA interference. In another embodiment, the RNA silencing agent can mediate translational repression.

[0229] As used herein, the term "rare nucleotide" means a naturally occurring nucleotide that occurs rarely, including a naturally occurring deoxyribonucleotide or ribonucleotide that occurs rarely and that is not, for example, guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine.

[0230] The term "engineered" in an engineered RNA precursor or engineered nucleic acid molecule indicates that the precursor or molecule does not exist in nature and that all or a portion of the nucleic acid sequence of the precursor or molecule has been made or selected by a human. Once made or selected, the sequence is replicated, translated, transcribed by mechanisms within cells, or otherwise manipulated. Thus, an RNA precursor generated intracellularly from a transgene containing an engineered nucleic acid molecule is an engineered RNA precursor.

[0231] As used herein, the term "microRNA" ("miRNA"), also referred to in the art as "small temporal RNA" ("stRNA"), means a small (10-50 nucleotides) RNA that is genetically encoded (e.g., by a viral, mammalian, or plant genome) and can direct or mediate RNA silencing. "miRNA disorder" shall mean a disease or disorder characterized by abnormal expression or activity of miRNA.

[0232] As used herein, the term "dual-functional oligonucleotide" means an RNA silencing agent represented by the formula T-L-μ [wherein T is an mRNA targeting moiety, L is a linking moiety, and μ is an miRNA mobilizing moiety]. As used herein, the terms "mRNA targeting moiety", "targeting moiety", "mRNA targeting portion", or "targeting portion" mean a domain, portion, or region of a dual-functional oligonucleotide that has sufficient size and sufficient complementarity to a portion or region of an mRNA selected or targeted for silencing (i.e., this portion has a sequence sufficient to capture the target mRNA). As used herein, the terms "linking moiety" or "linking portion" mean a domain, portion, or region of an RNA-silencing agent that covalently joins or binds to an mRNA.

[0233] As used herein, the term "antisense strand" of an RNA silencing agent, e.g., siRNA or an RNA silencing agent, means a strand that is substantially complementary to a section of about 10 to 50 nucleotides, e.g., about 15 to 30, 16 to 25, 18 to 23, or 19 to 22 nucleotides, of the mRNA of the gene targeted for silencing. The antisense strand or first strand has a sequence that is sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., has sufficient complementarity to induce destruction of the desired target mRNA by RNAi machinery or manipulation (RNAi interference) or has sufficient complementarity to induce translational repression of the desired target mRNA.

[0234] The term "sense strand" or "second strand" of an RNA silencing agent, e.g., siRNA or an RNA silencing agent, means a strand that is complementary to the antisense strand or first strand. The antisense strand and the sense strand are also referred to as the first strand or the second strand, respectively, where the first strand or the second strand has complementarity to the target sequence, and the second strand or the first strand has complementarity to the first strand or the second strand, respectively. The miRNA duplex intermediate or siRNA-like duplex contains an miRNA strand that has sufficient complementarity to a section of about 10 to 50 nucleotides of the mRNA of the gene targeted for silencing, and an miRNA* strand that has sufficient complementarity to form a duplex with the miRNA strand.

[0235] As used herein, the term "guide strand" means the strand of an RNA silencing agent that enters the RISC complex and directs cleavage of the target mRNA, e.g., the antisense strand of an siRNA duplex or siRNA sequence.

[0236] As used herein, the term "asymmetric" in the context of the asymmetry of the duplex region of an RNA silencing agent (e.g., the stem of shRNA) means an inequality in the binding strength or base pairing strength between the ends of the RNA silencing agent (e.g., between the terminal nucleotides of the first strand or stem portion and the terminal nucleotides of the opposing second strand or stem portion) such that the 5' end of one strand of the duplex is more frequently in a transient unpaired state, e.g., a single-stranded state, than the 5' end of the complementary strand. This structural difference determines that one strand of the duplex is preferentially incorporated into the RISC complex. The strand whose 5' end is not tightly paired with the complementary strand is preferentially incorporated into RISC and mediates RNAi.

[0237] As used herein, the terms "binding strength" or "base pair strength" mean the strength of the interaction between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., an siRNA duplex), primarily due to H-bonds, van der Waals interactions, etc. between the nucleotides (or nucleotide analogs).

[0238] As used herein, the "5' end" at the 5' end of the antisense strand means the region between the 5' terminal nucleotide, e.g., the 1 to about 5 nucleotides at the 5' end of the antisense strand. As used herein, the "3' end" at the 3' end of the sense strand means the region complementary to the nucleotide at the 5' end of the complementary antisense strand, e.g., the region between 1 and about 5 nucleotides.

[0239] As used herein, the term "destabilizing nucleotide" refers to a first nucleotide or nucleotide analog that can form a base pair with a second nucleotide or nucleotide analog, and forms a base pair such that the binding strength of the base pair is lower than that of a conventional base pair (i.e., a Watson-Crick base pair). In certain embodiments, the destabilizing nucleotide can form a mismatched base pair with the second nucleotide. In other embodiments, the destabilizing nucleotide can form a wobble base pair with the second nucleotide. In yet other embodiments, the destabilizing nucleotide can form an ambiguous base pair with the second nucleotide.

[0240] As used herein, the term "base pair" refers to the interaction between a pair of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., a duplex formed by a strand of an RNA silencing agent and a target mRNA sequence), which is mainly due to hydrogen bonding, van der Waals interactions, etc. between the nucleotides (or nucleotide analogs). As used herein, the term "binding strength" or "base pair strength" refers to the strength of a base pair.

[0241] As used herein, the term "mismatched base pair" refers to a non-complementary or non-Watson-Crick base pair, e.g., a base pair consisting of something other than a normal complementary G:C, A:T or A:U base pair. As used herein, the term "ambiguous base pair" (also known as an undiscriminating base pair) refers to a base pair formed by common nucleotides.

[0242] As used herein, the term "universal nucleotide" (also known as "neutral nucleotide") includes nucleotides (e.g., certain destabilized nucleotides) having a base (a "universal base" or "neutral base") that does not significantly discriminate between bases on a complementary polynucleotide when forming a base pair. Universal nucleotides are primarily hydrophobic molecules and can be efficiently packed into antiparallel double nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base portion of a universal nucleotide typically includes a nitrogen-containing aromatic heterocyclic moiety.

[0243] As used herein, the terms "sufficient complementarity" or "sufficient degree of complementarity" mean that an RNA silencing agent has a sequence (e.g., an antisense strand, an mRNA target portion, or an miRNA mobilizing portion) sufficient to bind to a desired target RNA and induce RNA silencing of the target mRNA, respectively.

[0244] As used herein, the term "translation inhibition" means the selective inhibition of mRNA translation. Natural translation inhibition proceeds through miRNAs cleaved from shRNA precursors. Both RNAi and translation inhibition are mediated by RISC. Both RNAi and translation inhibition occur naturally but can be initiated by human hands, for example, to silence the expression of a target gene.

[0245] Various methodologies of the present invention include a step of comparing values, levels, features, characteristics, properties, etc. with a "suitable control", which is interchangeably referred to as an "appropriate control" herein. A "suitable control" or an "appropriate control" is a control or reference familiar to those skilled in the art that is useful for the purpose of comparison. In one embodiment, the "suitable control" or the "appropriate control" is a value, level, feature, characteristic, etc. determined before performing the RNAi methodology as described herein. For example, before introducing an RNA silencing agent of the present invention into a cell or an organism, the transcription rate, mRNA level, translation rate, protein level, biological activity, cell characteristics and properties, genotype, phenotype, etc. can be determined. In another embodiment, the "suitable control" or the "appropriate control" is a value, level, feature, characteristic, property, etc. determined in a cell or an organism, such as a control showing normal traits or a normal cell or organism. In yet another embodiment, the "suitable control" or the "appropriate control" is a predefined value, level, feature, characteristic, property, etc.

[0246] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, this specification, including definitions, will control. Also, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0247] Various aspects of the present invention are described in more detail in the following subsections. I. Novel Target Sequences

[0248] In certain exemplary embodiments, the RNA silencing agents of the invention can target the APOE mRNA targets set forth in Tables 1, 2, or 7. In certain exemplary embodiments, the RNA silencing agents of the invention can target 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'. In certain exemplary embodiments, the RNA silencing agents of the invention can target one or more target sequences of 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAA. In certain exemplary embodiments, the RNA silencing agents of the invention can target 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In certain exemplary embodiments, the RNA silencing agents of the invention can target the target sequence 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0249] The genomic sequence of each target sequence can be found, for example, in publicly available databases maintained by NCBI II. siRNA Design

[0250] In some embodiments, the siRNA is designed as follows. First, select one or more of the target sequences described in Table 1, Table 2, or Table 7, for example, a part of the target gene (e.g., the ApoE gene). Cleavage of the mRNA at these positions eliminates translation of the corresponding protein. The sense strand is designed based on the target sequence. (See Figure 3A). Preferably, the portion (and the corresponding sense strand) contains about 19 to 25 nucleotides, for example, 19, 20, 21, 22, 23, 24, or 25 nucleotides. More preferably, the portion (and the corresponding sense strand) contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs having a nucleotide length less than 19 or greater than 25 can also function to mediate RNAi. Thus, siRNAs of such lengths are also within the scope of the present invention if they retain the ability to mediate RNAi. Longer RNAi agents have been demonstrated to induce interferon and PKR responses in certain mammalian cells, which may be undesirable. However, longer RNAi agents may be useful in situations where, for example, the cell type does not undergo a PKR response, or the PKR response is downregulated or attenuated by alternative means.

[0251] The sequence of the sense strand is designed such that the target sequence is essentially in the center of the strand. Shifting the target sequence to a position away from the center may, in some cases, reduce the efficiency of cleavage by the siRNA. Such compositions, i.e., compositions with low efficiency, may desirably be used when off-silencing of the wild-type mRNA is detected.

[0252] The antisense strand is routinely the same length as the sense strand and contains complementary nucleotides. In one embodiment, the strands are fully complementary, i.e., the strands will have blunt ends when aligned or annealed. In another embodiment, the strands include an alignment or annealing such that overhangs of 1, 2, 3, 4, 5, 6, or 7 nucleotides are generated, e.g., the 3' end of the sense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5' end of the antisense strand and / or the 3' end of the antisense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5' end of the sense strand. The overhangs can comprise or consist of nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhangs can comprise or consist of deoxyribonucleotides, e.g., dTs, or nucleotide analogs, or other suitable non-nucleotide materials.

[0253] By facilitating the entry of the antisense strand into RISC, the base pair strength between the 5' end of the sense strand and the 3' end of the antisense strand can be altered, for example, softened or reduced to (increase or improve the efficiency of target cleavage and silencing), as described in detail in U.S. Patents 7,459,547, 7,772,203 and 7,732,593, entitled "Methods and Compositions for Controlling Efficacy of RNA Silencing" (filed June 2, 2003), and U.S. Patents 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705, entitled "Methods and Compositions for Enhancing the Efficacy and Specificity of RNAi" (filed June 2, 2003), the contents of which are incorporated herein by reference. In one embodiment of these aspects of the invention, the G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the second or sense strand are fewer than the G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the second or sense strand, resulting in a lower base pair strength. In another embodiment, there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the second or sense strand, resulting in a lower base pair strength. In certain exemplary embodiments, the mismatched base pairs are selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C and U:U. In another embodiment, there is at least one wobble base pair, for example, G:U, between the 5' end of the first or antisense strand and the 3' end of the second or sense strand, resulting in a lower base pair strength. In another embodiment, at least one base pair contains a rare nucleotide, for example, inosine (I), resulting in a lower base pair strength. In certain exemplary embodiments, the base pairs are selected from the group consisting of I:A, I:U and I:C. In yet another embodiment, at least one base pair contains a modified nucleotide, resulting in a lower base pair strength.In certain exemplary embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.

[0254] The design of siRNA suitable for targeting the ApoE target sequence shown in Figure 3 is described in detail below. The siRNA can be designed according to the above exemplary teachings for any other target sequence found in the ApoE gene. Furthermore, the present technique is also applicable to targeting any other target sequence, for example, a non-disease-causing target sequence.

[0255] To verify the effectiveness of siRNA in destroying mRNA (e.g., ApoE mRNA), the siRNA can be incubated with cDNA (e.g., ApoE cDNA) in a Drosophila-based in vitro mRNA expression system. Newly synthesized mRNA (e.g., ApoE mRNA) radiolabeled with 32P is detected by autoradiography on an agarose gel. The presence of cleaved mRNA indicates mRNA nuclease activity. Appropriate controls include the omission of siRNA. Alternatively, as a control siRNA, one having the same nucleotide composition as the selected siRNA but having no significant sequence complementarity to the appropriate target gene is selected. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA, and a homology search can be performed to confirm that the negative control lacks homology to any other gene within the appropriate genome. Furthermore, the control siRNA can be designed by introducing one or more base mismatches into the sequence. The siRNA-mRNA complementary site is selected to provide optimal mRNA specificity and maximum mRNA cleavage. III. RNAi Substances

[0256] The present invention includes, for example, siRNA molecules designed as described above. The siRNA molecules of the present invention can also be chemically synthesized, transcribed in vitro from a DNA template, or in vivo, for example, from shRNA, or can be cleaved in vitro using recombinant human Dicer enzyme to a pool of 20-, 21- or 23-bp double-stranded RNAs that mediate RNAi.

[0257] In one aspect, instead of the RNAi agent being an interfering ribonucleic acid, such as the siRNA or shRNA described above, the RNAi agent can encode an interfering ribonucleic acid, such as the shRNA described above, as described above. In other words, the RNAi agent can be a transcription template for an interfering ribonucleic acid. Thus, the RNAi agents of the present invention can also include small hairpin RNAs (shRNAs) and expression constructs engineered to express shRNAs. Transcription of shRNA is thought to be initiated by a polymerase III (pol III) promoter and to terminate at position 2 of a 4-5-thymidine transcription termination site. It is thought that upon expression, shRNAs fold into a stem-loop structure with 3' UU-overhangs, and then the ends of these shRNAs are processed to convert them into siRNA-like molecules of about 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002, Supra; Miyagishi et al., 2002; Paddison et al., 2002, supra; Paul et al., 2002, supra; Sui et al., 2002 supra; Yu et al., 2002, supra. Details regarding the design and use of shRNAs can be found at the following Internet addresses: katandin.cshl.org:9331 / RNAi / docs / BseRI-BamHI_Strategy.pdf and katandin.cshl.org:9331 / RNAi / docs / Web_version_of_PCR_Strategy_1.pdf).

[0258] The expression construct of the present invention includes any construct suitable for use in an appropriate expression system and includes, but is not limited to, retroviral vectors, linear expression cassettes, plasmids, and viral or virus-derived vectors known in the art. Such expression constructs can include one or more inducible promoters, an RNA Pol III promoter system, such as the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. The construct can include one or both strands of the siRNA. An expression construct that expresses both strands can also include a loop structure that binds both strands, or each strand may be transcribed separately from a separate promoter within the same construct. Also, each strand may be transcribed from a separate expression construct (Tuschl, T., 2002, Supra).

[0259] Synthetic siRNA can be delivered into cells by methods known in the art, including cationic liposome transfection and electroporation. To obtain longer-term suppression of a target gene (e.g., the ApoE gene) and to facilitate delivery under certain circumstances, one or more siRNAs can be expressed intracellularly from a recombinant DNA construct. Such methods that express siRNA duplexes intracellularly from a recombinant DNA construct and enable longer-term suppression of the target gene in cells include mammalian Pol III promoter systems (e.g., the H1 or U6 / snRNA promoter systems (Tuschl, T. 2002, supra); (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra)) that can express functional double-stranded siRNAs, which are known in the art. Transcription termination by RNA Pol III occurs by the execution of four consecutive T residues in the DNA template, which provides a mechanism for terminating the siRNA transcript at a specific sequence. The siRNA is complementary to the target gene sequence in both the 5'-3' and 3'-5' orientations, and the two strands of the siRNA can be expressed from the same construct or from separate constructs. Hairpin siRNAs driven by the H1 or U6 snRNA promoter and expressed intracellularly can inhibit the expression of the target gene ((Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra).In addition, a construct containing an siRNA sequence under the control of the T7 promoter can generate functional siRNA when co-transfected in cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra). A single construct can contain multiple sequences encoding siRNAs targeting the same gene or multiple genes, for example, can contain multiple regions of the gene encoding ApoE, and can be driven by separate PolIII promoter sites.

[0260] Animal cells express a series of non-coding RNAs of approximately 22 nucleotides called microRNAs (miRNAs) that can regulate gene expression at the post-transcriptional or post-translational level during animal development. A common feature of miRNAs is that they are all excised from a stem-loop of a precursor RNA of approximately 70 nucleotides, probably by Dicer, an RNase III-type enzyme, or its homolog. By replacing the stem sequence of the miRNA precursor with a sequence complementary to the target mRNA, siRNAs that initiate RNAi against specific mRNA targets in mammalian cells can be produced using a vector construct expressing the engineered precursor (Zeng et al., 2002, supra). When expressed in a DNA vector containing a polymerase III promoter, a hairpin designed with a microRNA can silence gene expression (McManus et al., 2002, supra). MicroRNAs targeting polymorphisms are also useful for blocking the translation of mutant proteins in the absence of siRNA-mediated gene-silencing. Such applications are useful, for example, in situations where the designed siRNA causes off-target silencing of the wild-type protein.

[0261] The virus-mediated delivery mechanism can also be used to induce specific silencing of target genes via the expression of siRNA, for example, by generating recombinant adenoviruses carrying siRNA under the transcriptional control of an RNA Pol II promoter (Xia et al., 2002, supra). By infecting HeLa cells with these recombinant adenoviruses, the expression of endogenous target genes can be reduced. Injecting a recombinant adenovirus vector into transgenic mice expressing the target gene of the siRNA results in a decrease in the expression of the target gene in vivo. Id. In animal models, synthetic siRNA can be efficiently delivered to post-implantation mouse embryos by whole embryo electroporation (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by rapid injection (within 5 seconds) of a large volume of siRNA-containing solution into the animals via the tail vein, a "high-pressure" delivery technique (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Also, nanoparticles and liposomes can be used to deliver siRNA to animals. In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and related vectors can be used to deliver one or more siRNAs to cells, such as nerve cells (e.g., brain cells) (U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766).

[0262] The nucleic acid composition of the present invention includes both unmodified siRNA and modified siRNA as known in the art, such as cross-linked siRNA derivatives, or derivatives having non-nucleotide moieties attached, for example, to their 3' or 5' ends. By modifying the siRNA derivative in this way, the cellular uptake of the resulting siRNA derivative is improved compared to the corresponding siRNA, or the cellular target activity of the resulting siRNA derivative is improved and useful for tracking the siRNA derivative intracellularly compared to the corresponding siRNA, or the stability of the siRNA derivative is completed.

[0263] As described herein, engineered RNA precursors introduced into cells or whole organisms lead to the production of the desired siRNA molecules. Such siRNA molecules bind to endogenous protein components of the RNAi pathway and bind to and target specific mRNA sequences for cleavage and destruction. Thereby, the mRNA targeted by the siRNA generated from the engineered RNA precursor is depleted from the cell or organism, which results in a reduction in the concentration of the protein encoded by that mRNA in the cell or organism. The RNA precursor is generally a nucleic acid molecule that encodes either one strand of the dsRNA alone or the entire nucleotide sequence of an RNA hairpin loop structure.

[0264] The nucleic acid compositions of the present invention can be unconjugated or conjugated to another moiety, such as a nanoparticle, in order to improve the properties of the composition, such as pharmacokinetic parameters, for example, absorption, efficacy, bioavailability, and / or half-life. This conjugation can be achieved by methods known in the art, for example, the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids carried on polyalkylcyanoacrylate (PACA) nanoparticles); Fat tal et al., J. Control Release 53(1-3):137-43 (1998) (describing nucleic acids binding to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids bound to intercalators, hydrophobic groups, polycations or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids bound to nanoparticles).

[0265] The nucleic acid molecules of the present invention can also be labeled using any method known in the art. For example, the nucleic acid composition can be labeled with a fluorophore, such as Cy3, fluorescein, or rhodamine. The labeling can be carried out using a kit, such as the SILENCER TM siRNA Labeling Kit (Ambion). Further, siRNA can be radiolabeled using, for example, 3 H, 32 P or other suitable isotopes.

[0266] Furthermore, since RNAi is thought to proceed through at least one single-stranded RNA intermediate, one of ordinary skill in the art will understand that ss-siRNA (e.g., the antisense strand of ds-siRNA) can also be designed (e.g., for chemical synthesis), generated (e.g., enzymatically), or expressed (e.g., from a vector or plasmid) as described herein and utilized according to the claimed methodology. Additionally, in invertebrates, long dsRNAs (e.g., dsRNAs about 100-1000 nucleotides in length, preferably about 200-500 nucleotides in length, e.g., dsRNAs about 250, 300, 350, 400, or 450 nucleotides in length) that act as effectors of RNAi can effectively induce RNAi (Brondani et al., Proc Natl Acad Sci USA. 2001 Dec. 4; 98(25):14428-33. Epub 2001 Nov. 27.). IV. Anti-ApoE RNA Silencing Agents

[0267] In one embodiment, the present invention provides novel anti-ApoE RNA silencing agents (e.g., siRNA and shRNA), methods of making the RNA silencing agents, and methods (e.g., research and / or therapeutic methods) for using the improved RNA silencing agents (or portions thereof) for RNA silencing of ApoE protein. The RNA silencing agents include an antisense strand (or a portion thereof) that is sufficiently complementary to a heterozygous single nucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi).

[0268] In certain embodiments, siRNA compounds are provided having one or any combination of the following characteristics: (1) being fully chemically stabilized (i.e., having no unmodified 2'-OH residues); (2) being asymmetric; (3) having a double-strand of 11 to 16 base pairs; (4) having an alternating pattern of chemically modified nucleotides (e.g., 2'-fluoro modification and 2'-methoxy modification), although continuous 2'-fluoro modifications and continuous 2'-methoxy modifications are also contemplated; (5) having a tail that is fully phosphorothioated with a single strand of 5 to 8 bases. The number of phosphorothioate modifications varies from a total of 6 to 17 in different embodiments.

[0269] In certain embodiments, the siRNA compounds described herein can be conjugated to various targeting substances including, but not limited to, cholesterol, DHA, phenyltropane, cortisol, vitamin A, vitamin D, GalNac, and ganglioside. The cholesterol-modified version has shown a 5- to 10-fold improvement in in vitro efficacy in a wide variety of cell types (e.g., HeLa, neurons, hepatocytes, trophoblasts) compared to previously used chemical stabilization patterns (e.g., all purines are modified while pyrimidines are unmodified).

[0270] Certain compounds of the invention having the structural properties described above and herein may be referred to as "hsiRNA-ASP" (characterized by hydrophobic modification, small interfering RNA, and a high degree of stabilization pattern). Furthermore, this hsiRNA-ASP pattern has shown a significantly improved distribution such as being delivered through the brain, spinal cord to the liver, placenta, kidney, spleen, and several other tissues, and thus has become available for therapeutic intervention.

[0271] In the liver, hsiRNA-ASP is delivered to endothelial cells and Kupffer cells rather than hepatocytes, creating a chemical modification pattern that is complementary rather than a competitive technology to GalNac conjugation.

[0272] The compounds of the present invention can be described in the following aspects and embodiments.

[0273] In a first aspect, described herein is an oligonucleotide of at least 16 consecutive nucleotides having a 5'-end, a 3'-end, and being complementary to a target, wherein (1) the oligonucleotide alternately includes 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at the 2nd and 14th positions from the 5'-end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) the nucleotides at positions 1 to 6, or positions 1 to 7 from the 3'-end are linked to adjacent nucleotides via phosphorothioate bonds. An oligonucleotide is provided.

[0274] In a second aspect, described herein is a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is an oligonucleotide as described herein (e.g., including one of the target sequences in FIG. 3A); (2) a part of the first oligonucleotide is complementary to a part of the second oligonucleotide; (3) the second oligonucleotide alternately includes 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at the 2nd and 14th positions from the 3'-end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds. A double-stranded chemically modified nucleic acid is provided.

[0275] In a third aspect, described herein is a structure: X-A(-L-B-L-A)j(-S-B-S-A)r(-S-B)t-OR [Here, X is a 5'-phosphate group; A is, each time it appears, independently a 2'-methoxy-ribonucleotide; B is, each time it appears, independently a 2'-fluoro-ribonucleotide; L is, each time it appears, independently a phosphodiester or phosphorothioate linker; S is a phosphorothioate linker; and R is selected from hydrogen and a capping group (e.g., an acyl such as acetyl); j is 4, 5, 6, or 7; r is 2 or 3; and t is 0 or 1]. An oligonucleotide having the same is provided.

[0276] In a fourth aspect, described herein is a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is selected from the oligonucleotides of the third aspect; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) the second oligonucleotide has the structure: C-L-B(-S-A-S-B)m'(-P-A-P-B)n'(-P-A-S-B)q'(-S-A)r'(-S-B)t'-OR [Here, C is a hydrophobic molecule; A is, each time it appears, independently a 2'-methoxy-ribonucleotide; B is, each time it appears, independently a 2'-fluoro-ribonucleotide; L is a linker comprising one or more moieties selected from the group consisting of 0 to 4 repeating units of ethylene glycol, phosphodiester, and phosphorothioate; S is a phosphorothioate linker; P is a phosphodiester linker; R is selected from hydrogen and a capping group (e.g., an acyl such as acetyl); m' is 0 or 1; n' is 4, 5, or 6; q' is 0 or 1; r' is 0 or 1; and t' is 0 or 1]. A double-stranded chemically modified nucleic acid having the same is provided. a) Design of anti-ApoE siRNA molecules

[0277] The siRNA molecule of the present invention is a double-strand comprising a sense strand and a complementary antisense strand, wherein the antisense strand is a double-strand that is sufficiently complementary to ApoE mRNA to mediate RNAi. Preferably, the siRNA molecule has a nucleotide length of about 10 to 50 or more, i.e., each strand comprises 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecule has a nucleotide length of about 15 to 30 in each strand, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, wherein one of the strands is sufficiently complementary to the target region. Preferably, the strands are aligned such that when the strands are annealed, 1, 2, or 3 residue overhangs occur at one or both ends of the double-strand, i.e., there are at least 1, 2, or 3 bases at the ends of the strands that are not aligned (i.e., there are no bases complementary to the opposing strand). Preferably, the siRNA molecule has a nucleotide length of about 10 to 50 or more, i.e., each strand comprises 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecule has a nucleotide length of about 15 to 30, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one strand is substantially complementary to the target sequence and the other strand is identical or substantially identical to the first strand.

[0278] Generally, siRNA can be designed using any method known in the art, e.g., it can be designed using the following protocol.

[0279] 1. The siRNA should be target sequence specific, for example, the target sequence shown in FIG. 3A. In one embodiment, the target sequence is found in the wild-type ApoE allele. In another embodiment, the target sequence is found in both the mutant ApoE allele and the wild-type ApoE allele. In another embodiment, the target sequence is found in the wild-type ApoE allele. The first strand should be complementary to the target sequence, and the other strand should be substantially complementary to the first strand. (See FIG. 3 for exemplary sense and antisense strands) Exemplary target sequences are selected from the 5' untranslated region (5'-UTR) of the target gene. Cleavage of the mRNA at these sites should eliminate translation of the corresponding ApoE protein. Target sequences from other regions of the ApoE gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with a low G / C content (35 - 55%) may be more active than those with a G / C content higher than 55%. Thus, in one embodiment, the invention includes nucleic acid molecules having a G / C content of 35 - 55%.

[0280] 2. The sense strand of the siRNA is designed based on the sequence of the selected target site. Preferably, the sense strand comprises from about 19 to 25 nucleotides, such as 19, 20, 21, 22, 23, 24 or 25 nucleotides. More preferably, the sense strand comprises 21, 22 or 23 nucleotides. However, one of ordinary skill in the art will understand that siRNAs having less than 19 nucleotides or a nucleotide length greater than 25 can also function to mediate RNAi. Thus, siRNAs of such lengths are also within the scope of the invention so long as they retain the ability to mediate RNAi. Longer RNA silencing agents have been shown to induce interferon or protein kinase R (PKR) responses in certain mammalian cells, which may be undesirable. Preferably, the RNA silencing agents of the present invention do not induce the PKR response (i.e., are of a sufficiently short length). However, longer RNA silencing agents may be useful in situations such as, for example, cell types that cannot elicit a PKR response or where the PKR response is down-regulated or attenuated by alternative means.

[0281] The siRNA molecules of the present invention have sufficient complementarity with the target sequence so that the siRNA can mediate RNAi. Generally, in order to bring about RISC-mediated cleavage of the target gene, siRNAs containing a nucleotide sequence sufficiently identical to the target sequence portion of the target gene are preferred. Thus, in a preferred embodiment, the sense strand of the siRNA is designed to have a sequence sufficiently identical to a part of the target. For example, the sense strand may be 100% identical to the target site. However, 100% identity is not essential. It is preferred to have more than 80% identity, such as 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% identity between the sense strand and the target RNA sequence. The present invention has the advantage that it can tolerate a certain degree of sequence diversity in order to improve the efficiency and specificity of RNAi. In one embodiment, the sense strand has 4, 3, 2, 1, or 0 mismatched nucleotides with a target region where at least one base pair differs between the wild-type allele and the mutant allele, such as a target region containing a gain-of-function mutation, and the other strand is identical or substantially identical to the first strand. Furthermore, siRNA sequences having small insertions or deletions of 1 or 2 nucleotides are also effective in mediating RNAi. Alternatively, siRNA sequences having substitutions or insertions of nucleotide analogs may also be effective for inhibition. Alternatively, siRNA sequences involving substitutions or insertions of nucleotide analogs may also be effective for inhibition.

[0282] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity between two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison (e.g., gaps can be introduced into the first or second sequence for optimal alignment). Then, the nucleotides (or amino acid residues) at the corresponding nucleotide (or amino acid) positions are compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions the sequences share (i.e., % homology = number of identical positions / total number of positions x 100), and optionally, a penalty is imposed on the score for the number of gaps introduced and / or the length of the gaps introduced.

[0283] Sequence comparison and determination of percent identity between two sequences can be performed using mathematical algorithms. In one embodiment, the alignment is generated over a particular portion of the aligned sequences that have sufficient identity, but not over portions with a low degree of identity (i.e., local alignment). A preferred non-limiting example of a local alignment algorithm used for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such algorithms are incorporated into the BLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0284] In another embodiment, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the length of the aligned sequences (i.e., gapped alignment). To obtain a gapped alignment for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the entire length of the aligned sequences (i.e., global alignment). A preferred non-limiting example of a numerical calculation algorithm utilized for global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program to compare amino acid sequences, the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0285] 3. The antisense or guide strand of the siRNA is always the same length as the sense strand and contains complementary nucleotides. In one embodiment, the guide strand and the sense strand are fully complementary, i.e., the strands are blunt-ended when aligned or annealed. In another embodiment, the strands of the siRNA can be paired in such a way that they have 1 to 7 (e.g., 2, 3, 4, 5, 6, or 7), or 1 to 4, e.g., 2, 3, or 4 nucleotide 3' overhangs. The overhangs can contain (or consist of) nucleotides corresponding to the target gene sequence (or its complement). The overhangs can contain (or consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhangs can contain (or consist of) deoxyribonucleotides, e.g., dT, or nucleotide analogs, or other suitable non-nucleotide materials. Thus, in another embodiment, the nucleic acid molecule may have a 2 nucleotide 3' overhang, e.g., TT. The overhanging nucleotides can be either RNA or DNA. As described above, it is preferred to select target regions where the mutant:wild-type mismatch is a purine:purine mismatch.

[0286] 4. Using any method known in the art, compare potential targets to a suitable genomic database (human, mouse, rat, etc.) and exclude target sequences that have significant homology to other coding sequences. Such methods for sequence homology searches are known as BLAST and are available on the website of the National Center for Biotechnology Information.

[0287] 5. Selection of one or more sequences that meet the evaluation criteria

[0288] Further general information regarding the design and use of siRNA can be found in the "The siRNA User Guide" available on the website of The Max-Plank-Institut fur Biophysikalische Chemie.

[0289] Alternatively, siRNA may be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing to a target sequence (e.g., hybridization at 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C for 12 - 16 hours; followed by washing). More preferred hybridization conditions include hybridization at 70 °C in 1x SSC or 50 °C in 1x SSC, 50% formamide, followed by washing at 70 °C in 0.3x SSC, or hybridization at 70 °C in 4x SSC or 50 °C in 4x SSC, 50% formamide, followed by washing at 67 °C in 1x SSC. The hybridization temperature of a hybrid expected to be less than 50 base pairs in length should be 5 - 10 °C lower than the melting temperature (Tm) of the hybrid, where T m is determined according to the following formula. For hybrids of less than 18 base pairs, T m ( o C)=2(# of A + T bases)+4(# of G + C bases). For hybrids of 18 - 49 base pairs in length, T m ( oC) = 81.5 + 16.6(log 10[Na+]) + 0.41(% G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the sodium ion concentration in the hybridization buffer (the [Na+] of 1xSSC is 0.165 M). Additional examples of stringency conditions for polynucleotide hybridization are described in Chapters 9 and 11 of Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., and Sections 2.10 and 6.3 to 6.4 of Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., which are hereby incorporated by reference.

[0290] The siRNA for the negative control should have the same nucleotide composition as the selected siRNA but should not have significant sequence complementarity to the appropriate genome. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. A homology search can be performed to confirm that the negative control lacks homology to any other gene of the appropriate genome. Also, the siRNA for the negative control can be designed by introducing 11 or more base mismatches into the sequence.

[0291] 6. To verify the effectiveness of siRNA in destroying target mRNA (e.g., wild-type or mutant ApoE mRNA), in a Drosophila-based in vitro mRNA expression system, the siRNA may be incubated with the target cDNA (e.g., ApoE cDNA). Newly synthesized mRNA (such as ApoE mRNA) radiolabeled with 32P is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Appropriate controls include omission of the siRNA and use of non-target cDNA. Alternatively, as a control siRNA, one having the same nucleotide composition as the selected siRNA but having no significant sequence complementarity to a suitable target gene is selected. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. A homology search can be performed to confirm that the negative control lacks homology to any other gene within the appropriate genome. Additionally, a negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0292] Anti-ApoE siRNA can be designed to target any of the target sequences described above. The siRNA includes an antisense strand that is sufficiently complementary to the target sequence to mediate silencing of the target sequence. In certain embodiments, the RNA silencing agent is siRNA.

[0293] In certain embodiments, the siRNA includes a sense strand containing the sequence shown in FIG. 3A, and an antisense strand containing the sequence shown in FIG. 3A.

[0294] The complementary site of the siRNA-mRNA is selected that provides optimal mRNA specificity and maximum mRNA cleavage. b) siRNA-like molecules

[0295] The siRNA-like molecules of the present invention have a sequence that is "sufficiently complementary" to the target sequence of ApoE mRNA (i.e., have a strand having the sequence) and direct gene silencing either by RNAi or translational repression. The siRNA-like molecules are designed in the same manner as siRNA molecules, but the degree of sequence identity between the sense strand and the target RNA approximates that observed between a miRNA and its target. Generally, as the degree of sequence identity between the miRNA sequence and the corresponding target gene sequence decreases, there is an increasing tendency to mediate post-transcriptional gene silencing by translational repression rather than RNAi. Thus, in alternative embodiments where post-transcriptional gene silencing by translational repression of the target gene is desired, the miRNA sequence has partial complementarity to the sequence of the target gene. In certain embodiments, the miRNA sequence has partial complementarity to one or more short sequences (complementary sites) that are dispersed within the target mRNA (e.g., within the 3'-UTR of the target mRNA) (Hutvagner and Zamore, Science, 2002; Zeng et al., Mol. Cell, 2002; Zeng et al., RNA, 2003; Doench et al., Genes & Dev., 2003). Because the mechanism of translational repression is cooperative, in certain embodiments, multiple complementary sites (e.g., 2, 3, 4, 5, or 6) can be targeted.

[0296] The ability of an siRNA-like duplex to mediate RNAi or translational repression can be predicted by the distribution of non-identical nucleotides between the target gene sequence at the complementary site and the nucleotide sequence of the silencing agent. In one embodiment where gene silencing by translational repression is desired, there is at least one non-identical nucleotide in the central portion of the complementary site, whereby the duplex formed by the miRNA guide strand and the target mRNA contains a central "bulge" (Doench J G et al., Genes & Dev., 2003). In another embodiment, 2, 3, 4, 5, or 6 consecutive or non-consecutive non-identical nucleotides are introduced. The non-identical nucleotides can be selected to form wobble base pairs (e.g., G:U) or mismatched base pairs (G:A, C:A, C:U, G:G, A:A, C:C, U:U). In a further preferred embodiment, the "bulge" is centered around the 12th and 13th nucleotides from the 5' end of the miRNA molecule. c) short hairpin RNA (shRNA) molecules

[0297] In certain specific embodiments, the present invention provides shRNAs that can mediate RNA silencing of ApoE target sequences with improved selectivity. In contrast to siRNAs, shRNAs mimic the natural precursors of microRNAs (miRNAs) and enter at the top of the gene silencing pathway. For this reason, shRNAs are thought to mediate gene silencing more efficiently by being supplied through the entire natural gene silencing pathway.

[0298] miRNAs are approximately 22-nucleotide non-coding RNAs that can regulate gene expression at the post-transcriptional or translational level during the development of plants and animals. One common characteristic of miRNAs is that they are all excised from a precursor RNA stem-loop of approximately 70 nucleotides, called pre-miRNA, by Dicer, an RNase III-type enzyme, or its homolog. Naturally occurring miRNA precursors (pre-miRNAs) generally have a single strand that forms a double-stranded stem containing two complementary parts, and a loop that joins the two parts of the stem. In a typical pre-miRNA, the stem contains one or more bulges, for example, extra nucleotides that create a single-nucleotide "loop" in one part of the stem, and / or one or more unpaired nucleotides that create a gap in the hybridization of the two parts of the stem. The short hairpin RNAs or engineered RNA precursors of the present invention are artificial constructs based on these naturally occurring pre-miRNAs, but are engineered to deliver a desired RNA silencing agent (e.g., the siRNAs of the present invention). shRNAs are formed by replacing the stem sequence of the pre-miRNA with a sequence complementary to the target mRNA. Since shRNAs are processed through the cell's gene silencing pathway, they efficiently mediate RNAi.

[0299] The necessary elements of the shRNA molecule include a first part and a second part, which have sufficient complementarity to anneal or hybridize to form a double-stranded or duplex stem portion. These two parts do not need to be completely or perfectly complementary. The first and second "stem" parts are joined by a part having a sequence that does not have sufficient sequence complementarity to anneal or hybridize to other parts of the shRNA. This latter part is referred to as the "loop" part in the shRNA molecule. This shRNA molecule is processed to generate siRNA. The shRNA can also contain one or more bulges, i.e., extra nucleotides that create small nucleotide "loops" in a part of the stem, for example, 1, 2, or 3 nucleotide loops. The stem parts may be of the same length, or one part may contain a protrusion of, for example, 1 to 5 nucleotides. The protruding nucleotides can include, for example, uracil (U), for example, all U. Such U is encoded in particular by thymidine (T) in the DNA encoding the shRNA, which indicates the termination of transcription.

[0300] In the shRNA (or engineered precursor RNA) of the present invention, a portion of the double-stranded stem is a nucleic acid sequence complementary (or antisense) to the ApoE target sequence. Preferably, one strand of the stem portion of the shRNA is sufficiently complementary (e.g., antisense) to the sequence of the target RNA (e.g., mRNA) to mediate degradation or cleavage of the target RNA via RNA interference (RNAi). Thus, the engineered RNA precursor comprises a double-stranded stem having two portions and a loop connecting the two stem portions. The antisense portion may be at the 5' or 3' end of the stem. The stem portion of the shRNA is preferably about 15 to about 50 nucleotides in length. Preferably, the two stem portions are about 18 or 19 to about 21, 22, 23, 24, 25, 30, 35, 37, 38, 39, or 40 or more nucleotides in length. In a preferred embodiment, the length of the stem portion should be 21 nucleotides or more. When used in mammalian cells, the length of the stem portion should be less than about 30 nucleotides so as not to induce non-specific responses such as the interferon pathway. In fact, the stem can include a much larger section complementary to the target mRNA (up to and including the entire mRNA). In fact, the stem portion can include a much larger section complementary to the target mRNA (up to and including the entire mRNA).

[0301] The two parts of the double-stranded stem should have sufficient complementarity to hybridize and form a double-stranded stem. Thus, the two parts can be fully or perfectly complementary, but do not necessarily have to be. Further, the two stem parts may have the same length, or one part may contain a protrusion of 1, 2, 3, or 4 nucleotides. The protruding nucleotides can include, for example, uracil (U), for example, all U. The loop of the shRNA or engineered RNA precursor differs from the natural pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Thus, the loop in the shRNA or engineered RNA precursor can be 2, 3, 4, 5, 6, 7, 8, 9, or more, for example, 15 or 20, or more nucleotides in length.

[0302] The loop of the shRNA or engineered RNA precursor differs from the natural pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Thus, the loop in the shRNA or engineered RNA precursor can be 2, 3, 4, 5, 6, 7, 8, 9, or more, for example, 15 or 20, or more nucleotides in length. Preferred loops consist of or contain a "tetraloop" sequence. Exemplary tetraloop sequences include, but are not limited to, the sequence GNRA [where N is any nucleotide and R is a purine nucleotide], GGGG, and UUU.

[0303] In certain embodiments, the shRNAs of the invention comprise the sequences of the desired siRNA molecules described above. In other embodiments, the sequence of the antisense portion of the shRNA can be designed essentially as described above, or generally, 18, 19, 20, 21 nucleotides, or more sequences can be selected from within the target RNA (e.g., ApoE mRNA), for example, from a region of 100-200 or 300 nucleotides upstream or downstream of the translation start. Generally, the sequence can be selected from any portion of the target RNA (e.g., mRNA) including the 5'UTR (untranslated region), coding sequence, or 3'UTR. This sequence can optionally follow immediately after the region of the target gene containing two adjacent AA nucleotides. The last two nucleotides of the nucleotide sequence can be selected to be UU. This sequence of about 21 nucleotides is used to make a part of the double-stranded stem of the shRNA. This sequence can, for example, enzymatically replace the stem portion of the wild-type pre-miRNA sequence, or be included in the fully synthesized sequence. For example, a DNA oligonucleotide encoding the entire engineered RNA precursor of the stem-loop can be synthesized, or a DNA oligonucleotide encoding only the portion to be inserted into the double stem of the precursor can be synthesized, and using restriction enzymes, an engineered RNA precursor construct can be constructed from, for example, the wild-type pre-miRNA.

[0304] The engineered RNA precursor contains in the double-stranded stem a nucleotide sequence of about 21-22 nucleotides of the siRNA or siRNA-like duplex that is desired to be generated in vivo. Thus, the stem portion of the engineered RNA precursor contains at least 18 or 19 nucleotide pairs corresponding to the sequence of the exon portion of the gene whose expression is reduced or inhibited. The two 3' nucleotides flanking this region of the stem are selected to maximize the generation of siRNA from the engineered RNA precursor and to maximize the effectiveness of the siRNA obtained when targeting the corresponding mRNA for translational repression or destruction by RNAi in vivo and in vitro.

[0305] In certain embodiments, the shRNAs of the invention include miRNA sequences, optionally terminally modified miRNA sequences, to enhance entry into RISC. The miRNA sequences can be the same as or identical to any naturally occurring miRNA (see, for example, The miRNA Registry; Griffiths-Jones S, Nuc. Acids Res., 2004). Over a thousand natural miRNAs have been identified to date, and together they are thought to cover approximately 1% of all predicted genes in the genome. Many natural miRNAs cluster in pre-mRNA introns and can be identified in silico using homology-based searches (Pasquinelli et al., 2000; Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001), or computer algorithms (such as MiRScan, MiRSeeker) that predict the ability of miRNA candidate genes to form stem-loop structures in pri-mRNA (Grad et al., Mol. Cell., 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003; Lai E C et al., Genome Bio., 2003). Online registries provide searchable databases of all published miRNA sequences (The miRNA Registry at the Sanger Institute website; Griffiths-Jones S, Nuc. Acids Res., 2004).Exemplary natural miRNAs include lin-4, let-7, miR-10, mirR-15, miR-16, miR-168, miR-175, miR-196 and their homologs, as well as other natural miRNAs from specific model organisms including Drosophila melanogaster, Caenorhabditis elegans, zebrafish, Arabidopsis thalania, Mus musculus, and Rattus norvegicus described in human and international PCT publication WO 03 / 029459.

[0306] Naturally occurring miRNAs are expressed by endogenous genes in vivo and are processed from hairpin or stem-loop precursors (pre-miRNAs or pri-miRNAs) by Dicer or other RNAses (Lagos-Quintana et al., Science, 2001; Lau et al., Science, 2001; Lee and Ambros, Science, 2001; Lagos-Quintana et al., Curr. Biol., 2002; Mourelatos et al., Genes Dev., 2002; Reinhart et al., Science, 2002; Ambros et al., Curr. Biol., 2003; Brennecke et al., 2003; Lagos-Quintana et al., RNA, 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003). miRNAs exist in vivo as transient double-stranded duplexes, but only the single strand is incorporated into the RISC complex and directs gene silencing. Certain miRNAs, such as plant miRNAs, have perfect or near-perfect complementarity to their target mRNAs and thus directly cleave their target mRNAs. Other miRNAs have incomplete complementarity to the target mRNA and thus directly inhibit the translation of the target mRNA. The degree of complementarity between the miRNA and its target mRNA is thought to determine the mechanism of its action. For example, perfect or near-perfect complementarity between the miRNA and its target mRNA predicts a cleavage mechanism (Yekta et al., Science, 2004), and incomplete complementarity predicts a translation inhibition mechanism. In certain embodiments, the miRNA sequence is that of a naturally occurring miRNA sequence, and its aberrant expression or activity is correlated with miRNA impairment. d) bifunctional oligonucleotide tether

[0307] In other embodiments, the RNA silencing agent of the present invention comprises a dual-functional oligonucleotide tether useful for the intercellular mobilization of miRNAs. Animal cells express a series of miRNAs, which are non-coding RNAs of about 22 nucleotides that can regulate gene expression at the post-transcriptional or translational level. By binding to the miRNA bound to RISC and mobilizing it to the target mRNA, the dual-functional oligonucleotide tether can, for example, suppress the expression of genes involved in the process of arteriosclerosis. The use of oligonucleotide tethers has several advantages compared to existing techniques for suppressing the expression of specific genes. First, the method described herein enables an endogenous molecule (often abundantly present), miRNA, to mediate RNA silencing. Thus, the method described herein eliminates the need to introduce foreign molecules (e.g., siRNA) to mediate RNA silencing. Second, the RNA silencing agent, and in particular the binding moiety (e.g., an oligonucleotide such as a 2'-O-methyl oligonucleotide), can be made stable and resistant to nuclease activity. As a result, the tethers of the present invention can be designed for direct delivery, which eliminates the need to indirectly deliver a precursor molecule or plasmid designed to make the desired agent intracellularly. Third, the tether and its respective moieties can be designed to be compatible with specific mRNA sites and specific miRNAs. This design can be made specific to cells or gene products. Fourth, in the method disclosed herein, the mRNA is left intact, which allows those skilled in the art to block protein synthesis in short pulses using the cell's own machinery. As a result, these RNA silencing methods allow for highly regulated control.

[0308] The dual-functional oligonucleotide tether (the "tether") of the present invention is designed to recruit miRNA (e.g., endogenous cellular miRNA) to a target mRNA so as to induce the regulation of a target gene. In a preferred embodiment, the tether has the formula T-L-μ [wherein T is an mRNA target portion, L is a linker portion, and μ is a miRNA recruitment portion]. Any one or more of the portions may be double-stranded. However, preferably, each site is single-stranded.

[0309] The portions within the tether may be arranged (in the 5' to 3' direction) or joined as shown in the formula T-L-μ (i.e., the 3' end of the target portion is joined to the 5' end of the linker portion and the 3' end of the linker portion is joined to the 5' end of the miRNA recruitment portion). Alternatively, the portions may be arranged or joined within the tether as follows: μ-T-L (i.e., the 3' end of the miRNA recruitment portion is joined to the 5' end of the linker portion and the 3' end of the linker portion is joined to the 5' end of the target portion).

[0310] The above mRNA target portion can capture a specific target mRNA. According to the present invention, the expression of the target mRNA is not desired, thereby desiring the translational repression of the mRNA. The mRNA target portion should be of a size sufficient to effectively bind to the target mRNA. The length of the target portion will vary widely, depending in part on the length of the target mRNA and the degree of complementarity between the target mRNA and the target portion. In various embodiments, the target portion is about 200, 100, 50, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or less than 5 nucleotides in length. In certain embodiments, the target portion is about 15 to about 25 nucleotides in length.

[0311] The above miRNA recruitment site can associate with miRNA. According to the present invention, the miRNA can be any miRNA capable of suppressing target mRNA. It has been reported that there are more than 250 endogenous miRNAs in mammals (Lagos-Quintana et al. (2002) Current Biol. 12:735-739; Lagos-Quintana et al. (2001) Science 294:858-862; and Lim et al. (2003) Science 299:1540). In various embodiments, the miRNA can be any miRNA recognized in the art.

[0312] The binding moiety is any agent capable of binding to the target moiety such that the activity of the target site is maintained. The binding moiety is preferably an oligonucleotide moiety consisting of a sufficient number of nucleotides such that the targeting agents can each sufficiently interact with their respective targets. The binding moiety is preferably an oligonucleotide moiety containing a sufficient number of nucleotides such that the targeting agents can each sufficiently interact with their respective targets. The binding moiety has little or no sequence homology with the mRNA or miRNA sequence in the cell. Exemplary binding moieties include one or more 2'-O-methyl nucleotides, such as 2'-β-methyladenosine, 2'-O-methylthymidine, 2'-O-methylguanosine or 2'-O-methyluridine. e) Gene silencing oligonucleotide

[0313] In certain exemplary embodiments, gene expression (i.e., ApoE gene expression) can be regulated using an oligonucleotide-based compound that includes two or more single-stranded antisense oligonucleotides linked through their 5′ ends that allow for the presence of two or more accessible 3′ ends, to effectively inhibit or reduce the expression of the ApoE gene. Oligonucleotides linked in this manner are also known as Gene Silencing Oligonucleotides (GSOs). (See, e.g., U.S. Patent No. 8,431,544, assigned to Idera Pharmaceuticals, Inc., which is hereby incorporated by reference in its entirety for all purposes.)

[0314] The linkage at the 5′ end of the GSO is independent of other oligonucleotide linkages and can be made directly through the 5′, 3′, or 2′ hydroxyl group, or indirectly through a non-nucleotide linker or nucleoside, using either the 2′ or 3′ hydroxyl position of the nucleotide. The linkage can also utilize a functionalized sugar or nucleobase of the 5′ terminal nucleotide.

[0315] GSOs can comprise two identical or different sequences conjugated at their 5'-5' termini via a phosphodiester, phosphorothioate, or non-nucleotide linker. Such compounds can contain 15 to 27 nucleotides complementary to a specific portion of an mRNA target for the purpose of antisense down-regulation of gene products. GSOs containing identical sequences can inhibit the expression of proteins bound to a specific mRNA via Watson-Crick hydrogen-bonding interactions. GSOs containing different sequences can inhibit the expression of proteins bound to two or more different regions of one or more mRNA targets. Such compounds consist of a heteronucleotide sequence complementary to the target mRNA and form a stable duplex structure via Watson-Crick hydrogen-hydrogen bonding. Under certain conditions, GSOs containing two free 3' termini (5'-5' linked antisense) can be more potent inhibitors of gene expression than those containing a single free 3' terminus or no free 3' termini.

[0316] In some embodiments, the non-nucleotide linker is glycerol, or a glycerol homolog of the formula HO--(CH2)o--CH(OH)--(CH2)p--OH [wherein o and p are independently integers from 1 to about 6, 1 to about 4, or 1 to about 3]. In some other embodiments, the non-nucleotide linker is a derivative of 1,3-diamino-2-hydroxypropane. Some such derivatives are of the formula: HO--(CH 2 )m--C(O)NH--CH 2 --CH(OH)--CH 2 --NHC(O)--(CH 2 ) m --OH [wherein m is an integer from 0 to about 10, 0 to about 6, 2 to about 6, or 2 to about 4].

[0317] Some non-nucleotide linkers allow the attachment of more than two GSO components. For example, the non-nucleotide linker glycerol has three hydroxyl groups to which GSO components can be covalently attached. Thus, some oligonucleotide-based compounds of the invention include two or more oligonucleotides attached to a nucleotide or non-nucleotide linker. Such oligonucleotides according to the invention are referred to as "branched."

[0318] In certain embodiments, the GSO is at least 14 nucleotides in length. In certain exemplary embodiments, the GSO is 15 - 40 nucleotides in length or 20 - 30 nucleotides in length. Thus, the oligonucleotides that are components of the GSO can independently be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0319] These oligonucleotides can be prepared by methods recognized in the art, such as phosphoramidate or H-phosphonate chemistry, which can be carried out manually or by an automated synthesizer. These oligonucleotides can also be modified in a number of ways without impairing their ability to hybridize to mRNA. Such modifications include at least one internucleotide linkage of the oligonucleotide that is an alkylphosphonate, phosphorothioate, phosphorodithioate, methylphosphonate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate hydroxyl, acetamidate or carboxymethyl ester or combinations thereof, and other internucleotide linkages between the 5' end of one nucleotide and the 3' end of another nucleotide, wherein the 5' nucleotide phosphodiester linkage is replaced by various chemical groups. V. Modified Anti-ApoE RNA Silencing Agent

[0320] In certain embodiments of the present invention, the RNA silencing agent (or any portion thereof) of the present invention described above may be modified such that the activity of the agent is further improved. The RNA silencing agent described in Section II above may be modified with any of the modifications described below. Such modifications may, in part, help to further improve target discrimination, confer stability to the agent (e.g., prevent degradation), facilitate cellular uptake, improve target efficiency, improve efficacy in binding to the target (e.g., to the target), improve patient tolerance to the agent, and / or reduce toxicity. 1) Modifications for Improved Target Discrimination

[0321] In certain embodiments, the RNA silencing agent of the present invention may be substituted with destabilizing nucleotides to improve single nucleotide target discrimination (see U.S. Application Ser. No. 11 / 698,689, filed Jan. 25, 2007, and U.S. Provisional Application No. 60 / 762,225, filed Jan. 25, 2006. Both are incorporated herein by reference). Such modifications are sufficient to disrupt the specificity of the RNA silencing agent for non-target mRNA (e.g., wild-type mRNA) without appreciably affecting the specificity of the RNA silencing agent for target mRNA (e.g., gain-of-function mutant mRNA).

[0322] In a preferred embodiment, the RNA silencing agent of the present invention is modified by introducing at least one general nucleotide into its antisense strand. A general nucleotide contains a base moiety that can base pair indiscriminately with any of the four bases of conventional nucleotides (e.g., A, G, C, U). General nucleotides are preferred because they have relatively little effect on the stability of the RNA duplex, or the duplex formed by the guide strand of the RNA silencing agent and the target mRNA. Exemplary general nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza 2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In a particularly preferred embodiment, the general nucleotide is an inosine residue or its naturally occurring analog.

[0323] In certain embodiments, the RNA silencing agent of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides of the specificity-determining nucleotide (i.e., the nucleotide that recognizes the disease-related polymorphism). For example, the destabilizing nucleotide can be introduced at a position within 5, 4, 3, 2, or 1 nucleotide of the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced at the position of 3 nucleotides from the specificity-determining nucleotide (i.e., such that there are 2 stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In an RNA silencing agent having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced into the strand or strand portion that does not contain the specificity-determining nucleotide. In a preferred embodiment, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity-determining nucleotide. 2) Modifications for improving efficacy and specificity

[0324] In certain embodiments, the RNA silencing agents of the invention may be modified to facilitate improved efficacy and specificity in mediating RNAi according to the asymmetric design rules (see U.S. Patents 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705). Such modifications facilitate entry of the antisense strand of the siRNA (e.g., siRNA made from siRNA or shRNA designed using the methods of the invention) into RISC for the sense strand, and cause the antisense strand to preferentially direct cleavage or translational repression of the target mRNA, increasing or improving the efficiency of target cleavage and silencing. Preferably, the base pair strength between the 5' end (AS 5') of the antisense strand and the 3' end (S 3') of the sense strand of the RNA silencing agent is reduced as compared to the binding strength or base pair strength between the 3' end (AS 3') of the antisense strand and the 5' end (S '5) of the sense strand of the RNA silencing agent, to improve the asymmetry of the RNA silencing agent.

[0325] In one embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that the G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion are fewer than the G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. Preferably, the mismatched base pairs are selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C and U:U. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that there is at least one wobble base pair, such as G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that there is at least one base pair containing a rare nucleotide, such as inosine (I). Preferably, the base pairs are selected from the group consisting of I:A, I:U and I:C. In yet another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that there is at least one base pair containing a modified nucleotide. In a preferred embodiment, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A. 3) RNA silencing agent with improved stability

[0326] The RNA silencing agent of the present invention can be modified to improve its stability in serum or in the growth medium for cell culture. To improve stability, the 3'-residue may be stabilized against degradation and may be selected, for example, to consist of purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, it is acceptable to replace pyrimidine nucleotides with modified analogs, for example replacing uridine with 2'-deoxythymidine, without affecting the efficiency of RNA interference.

[0327] In one aspect, the present invention features an RNA silencing agent comprising first and second strands wherein the second strand and / or the first strand is modified by replacing internal nucleotides with modified nucleotides such that the in vivo stability is improved as compared to a corresponding unmodified RNA silencing agent. As defined herein, an "internal" nucleotide is a nucleotide that occurs at any position other than the 5'- or 3'-end of a nucleic acid molecule, polynucleotide or oligonucleotide. Internal nucleotides can be within a single-stranded molecule, or within a strand of a double-stranded or multi-stranded molecule. In one embodiment, the sense strand and / or the antisense strand is modified by substitution of at least one internal nucleotide. In another embodiment, the sense strand and / or the antisense strand is modified by substitution of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In another embodiment, the sense strand and / or the antisense strand is modified by substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the internal nucleotides. In yet another embodiment, the sense strand and / or the antisense strand is modified by substitution of all of the internal nucleotides.

[0328] In one aspect, the present invention features an RNA silencing agent that is at least 80% chemically modified. In a preferred embodiment of the invention, the RNA silencing agent is fully chemically modified, i.e., 100% of the nucleotides are chemically modified.

[0329] In a preferred embodiment of the present invention, the RNA silencing agent may contain at least one modified nucleotide analog. The nucleotide analog may be located at a position where the target-specific silencing activity, such as RNAi-mediated activity or translational repression activity, is not substantially affected, for example, in the region of the 5'-end and / or 3'-end of the siRNA molecule. In particular, the ends may be stabilized by incorporating modified nucleotide analogs.

[0330] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., including modifications to the phosphate-sugar backbone). For example, the phosphodiester bond of natural RNA may be modified to include at least one heteroatom of nitrogen or sulfur. In an exemplary backbone-modified ribonucleotide, the phosphoester group linked to an adjacent ribonucleotide is replaced by a modifying group, such as a phosphorothioate group. In an exemplary sugar-modified ribonucleotide, the 2'-OH group is replaced by a group selected from the group consisting of H, OR, R, halo, SH, SR, NH 2 , NHR, NR 2 or ON, where R is C 1 -C 6 alkyl, alkenyl or alkynyl, and halo is F, Cl, Br or I.

[0331] In certain embodiments, the modification is a 2'-fluoro, 2'-amino and / or 2'-thio modification. Certain preferred modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino-allyl-uridine. In certain embodiments, the 2'-fluororibonucleotides are any uridine and cytidine. Additional exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribothymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and 5-fluoro-uridine. 2'-deoxynucleotides and 2'-Ome nucleotides can also be used within the modified RNA silencing agent moiety of the invention. Additional modified residues include deoxyabasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleosides and ribavirin. In a particularly preferred embodiment, the 2' moiety is a methyl group such that the linking moiety is a 2'-O-methyloligonucleotide.

[0332] In an exemplary embodiment, the RNA silencing agent of the present invention comprises locked nucleic acid (LNA). LNA contains sugar-modified nucleotides that are resistant to nuclease activity (very stable) and have single nucleotide discrimination of mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules have a 2'-O,4'-C-ethylene bridged nucleic acid and can be modified such as 2'-deoxy-2''-fluorouridine. Further, LNA increases the specificity of the oligonucleotide by binding the sugar moiety to the 3'-terminal structure, thereby pre-organizing the nucleotides for base pairing and increasing the melting temperature of the oligonucleotide by up to 10°C per base.

[0333] In another exemplary embodiment, the RNA silencing agent of the present invention comprises peptide nucleic acid (PNA). PNA contains modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced by a neutral 2-aminoethylglycine moiety that can form a polyamide backbone that is highly resistant to nuclease digestion and imparts improved binding specificity to the molecule (Nielsen, et al., Science, (2001), 254: 1497-1500).

[0334] Also preferred are nucleobase-modified ribonucleotides, i.e., ribonucleotides containing at least one non-naturally occurring nucleobase in place of a naturally occurring nucleobase. The base can be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include uridine and / or cytidine modified at the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at the 8-position, such as 8-bromoguanosine; deazapurine nucleotides, such as 7-deazaadenosine, O- and N-alkylated nucleotides, such as N6-methyladenosine, but are not limited thereto. Note that the above modifications may be combined.

[0335] In other embodiments, the cross-linking can be utilized to modify the pharmacokinetics of the RNA silencing agent, e.g., to increase its half-life in vivo. Accordingly, the present invention includes an RNA silencing agent having two complementary strands of nucleic acid, wherein the two strands are cross-linked. The present invention also includes an RNA silencing agent conjugated or not conjugated (e.g., at its 3' end) to another moiety (e.g., a non-nucleic acid moiety such as a peptide, an organic compound (e.g., a dye), etc.). Modifying the siRNA derivative in this way can improve the cellular uptake of the resulting siRNA derivative, improve the targeting of the resulting siRNA derivative within the cell, be useful for tracking the siRNA derivative in cells, or improve the stability of the siRNA derivative compared to the corresponding siRNA.

[0336] Other exemplary modifications include the following. (a) 2′ modifications, such as providing a 2′OMe moiety to U of the sense strand or the antisense strand, particularly the sense strand, or to a 3′ overhang, e.g., the 3′ end (the 3′ end means the 3′ atom of the molecule, or the outermost 3′ end, such as the outermost 3′P or 2′ position, as indicated by the context) of a 2′OMe moiety; (b) backbone modifications, such as replacing O with S in the phosphate backbone, e.g., providing a phosphorothioate modification to U or A or both; e.g., a backbone modification that replaces O with S; (c) replacing U with a C5 amino linker; (d) replacing A with G (the sequence variation is preferably located in the sense strand, rather than the antisense strand); and (d) modifications at the 2′, 6′, 7′, or 8′ positions. Exemplary embodiments are those in which one or more of these modifications are present in the sense strand but not in the antisense strand, or embodiments in which the antisense strand has fewer such modifications. Still other exemplary modifications include the use of methylated P at the 3′ overhang, e.g., the 3′ end; combinations of 2′ modifications, such as providing a 2′OMe moiety and a backbone modification (e.g., replacing O with S), e.g., providing a phosphorothioate modification, or the use of methylated P at the 3′ overhang, e.g., the 3′ end; modification by 3′ alkyl, modification by abasic pyrrolidone at the 3′ overhang, e.g., the 3′ end; modification by naproxen, ibuprofen, or other moieties that inhibit degradation at the 3′ end. 4) Modifications for improving cellular uptake

[0337] In other embodiments, the RNA silencing agent may be modified with a chemical moiety, for example, to improve cellular uptake by target cells (e.g., neurons). Thus, the present invention includes an RNA silencing agent that is conjugated or not conjugated (e.g., at its 3' end) to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), etc. Conjugation can be achieved by methods known in the art, for example, as described in Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (nucleic acids loaded into polyalkylcyanoacrylate (PACA) nanoparticles); Fat tal et al., J. Control Release 53(1-3):137-43 (1998) (nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (intercalators, hydrophobic groups, polycations or nucleic acids bound to PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (nucleic acids bound to nanoparticles).

[0338] In certain embodiments, the RNA silencing agent of the present invention is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand containing a cationic group. In another embodiment, the lipophilic moiety is bound to one or both of the siRNAs. In an exemplary embodiment, the lipophilic moiety is bound to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is bound to the 3'-end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl) chenodeoxycholic acid, dimethoxytrityl, or phenoxazine. 5) Tether ligand

[0339] Other entities can be tethered to the RNA silencing agent of the present invention. For example, ligands that are tethered to the RNA silencing agent to improve stability, hybridization thermodynamics with the target nucleic acid, targeting of specific tissues or cell types, or cell permeability by, for example, endocytosis-dependent or -independent mechanisms. The ligand and related modifications can also increase sequence specificity, and as a result, reduce off-site targets. The tethered ligand can include one or more modified bases or sugars that can function as an intervening agent. These are preferably located in an internal region such as a bulge of the RNA silencing agent / target duplex. The intervening agent can be an aromatic, for example, a polycyclic aromatic or a heterocyclic aromatic compound. The polycyclic intervening agent can have stacking ability and can include a system with 2, 3, or 4 fused rings. The general bases described herein can be included on the ligand. In one embodiment, the ligand can include a cleavage group that contributes to the inhibition of the target gene by cleavage of the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, for example, a Lu(III) or EU(III) macrocyclic complex, a Zn(II) 2,9-dimethylphenanthroline derivative, a Cu(II) terpyridine, or an acridine, and can promote the selective cleavage of the target RNA at the bulge site by a free metal ion such as Lu(III). In some embodiments, a peptide ligand is tethered to the RNA silencing agent to promote cleavage of the target RNA, for example, in the bulge region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (e.g., by an amino acid derivative) to promote cleavage of the target RNA.The tethering ligand can be an aminoglycoside ligand that enables an RNA silencing agent to have improved hybridization characteristics or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as neo-N-acridine, neo-S-acridine, neo-C-acridine, tobra-N-acridine, and KanaA-N-acridine. The use of acridine analogs can increase sequence specificity. For example, neomycin B has a high affinity for RNA compared to DNA but low sequence specificity. Neo-5-acridine, an acridine analog, has an increased affinity for the HIV Rev-response element (RRE). In some embodiments, a guanidine analog (guanidinoglycoside) of the aminoglycoside ligand is tethered to the RNA silencing agent. In guanidinoglycosides, the amine group of the amino acid is replaced with a guanidine group. The binding of the guanidine analog can improve the cellular permeability of the RNA silencing agent. The tethering ligand can be a poly-arginine peptide, peptoid, or peptidomimetic that can improve the cellular uptake of the oligonucleotide agent.

[0340] Exemplary ligands preferably bind, by a covalent bond, directly or indirectly via an intervening tether, to a carrier to which the ligand is attached. In an exemplary embodiment, the ligand is attached to the carrier via an intervening tether. In an exemplary embodiment, the ligand modifies the distribution, target, or lifespan of the RNA silencing agent in which it is incorporated. In an exemplary embodiment, the ligand improves the affinity for a selected target, such as a molecule, cell or cell type, compartment, such as a compartment of a body cell or organ, tissue, organ, or region, compared to a species in which such a ligand is absent.

[0341] Exemplary ligands can improve transport, hybridization, and specificity properties and may also improve the nuclease resistance of the resulting native or modified RNA silencing agents or polymeric molecules comprising any combination of monomers and / or native or modified ribonucleotides described herein. Ligands can be, for example, therapeutic modifiers to promote uptake; diagnostic compounds or reporter groups to monitor distribution; crosslinking agents; nuclease resistance conferring moieties; and can contain natural or rare nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanols derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binders, integrin target molecules, polycations, peptides, polyamines, and peptidomimetics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); amino acids or lipids. Also, ligands can be recombinant or synthetic molecules, such as synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helix peptides.

[0342] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specific cell type, such as a kidney cell, for example, a lectin, glycoprotein, lipid or protein, such as an antibody. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridine and substituted acridines), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptide, aminoglycoside, guanidinium aminoglycoside, artificial endonucleases (e.g., EDTA), lipophilic molecules, such as cholesterol (and its thio analogs), cholic acid, cholanic acid, lithocholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, such as C 10 、C 11 、C 12 、C 13 、C 14 、C 15 、C 16 、C 17 、C 18 、C 19or C 20 fatty acids) and their ethers, for example, C 10 C 11 C 12 C 13 C 14 C 15 C 16 C 17 C 18 C 19 or C 20 alkyl; for example, 1,3 - bis - O(hexadecyl)glycerol, 1,3 - bis - O(octadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3 - propanediol, heptadecyl group, palmitic acid, stearic acid (for example, glyceryl distearate), oleic acid, myristic acid, O3 - (oleoyl) lithocholic acid, O3 - (oleoyl) cholic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (for example, antennapedia peptide, Tat peptide), alkylating agents, phosphates, aminos, mercaptos, PEG (for example, PEG - 40K), MPEG, [MPEG]2, polyaminos, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (for example, biotin), transport / absorption facilitators (for example, aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (for example, imidazole, bisimidazole, histamine, imidazole cluster, acridine - imidazole conjugate, tetraaza macrocyclic ring Eu 3+ complex), dinitrophenyl, HRP or AP are included.

[0343] A ligand can be a molecule that has specific affinity for a protein, such as a glycoprotein, or a peptide, such as a co-ligand, or an antibody, such as an antibody that binds to a specific cell type such as a cancer cell, an endothelial cell, or an osteocyte. A ligand may also include hormones and hormone receptors. These may also include non-peptide species such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, or polyvalent fucose. A ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-kB.

[0344] A ligand can be a substance, such as a drug, that can increase the uptake of an RNA silencing agent into a cell, for example, by disrupting the cytoskeleton, for example, by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. Drugs can be, for example, taxol, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. A ligand can increase the uptake of an RNA silencing agent into a cell, for example, by activating an inflammatory response. Exemplary ligands that can have such an effect include tumor necrosis factor alpha (TNFα), interleukin-1β, or gamma interferon. In one aspect, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand enables the distribution of the conjugate to target tissues of the body, such as non-renal target tissues. For example, the target tissue can be the liver, including the parenchymal cells of the liver. Molecules that can bind to HSA can also be used as ligands. For example, neproxin or aspirin can be used. The lipid or lipid-based ligand , (a) can increase the resistance to the degradation of the conjugate, (b) can increase the targeting or transport to the target cell or cell membrane, and / or (c) can be used to modulate the binding to serum proteins, such as HSA. A lipid-based ligand can be used to regulate, for example, control the binding of the conjugate to the target tissue. For example, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidney and thus less likely to be removed from the body. A conjugate can be targeted to the kidney using a lipid or lipid-based ligand that binds more weakly to HSA. In a preferred embodiment, the lipid-based ligand binds to HSA. The lipid-based ligand can bind to HSA with sufficient affinity such that the conjugate is preferably distributed to non-kidney tissues. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed. In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA such that the conjugate is preferably distributed to the kidney. Other moieties that target kidney cells can also be used instead of or in addition to the lipid-based ligand.

[0345] In another aspect, the ligand is a moiety, such as a vitamin, that is taken up by target cells, such as proliferating cells. These are particularly useful, for example, for treating disorders characterized by unwanted cell proliferation, such as malignant or non-malignant, for example, cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamins B, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low density lipoprotein (LDL) are also included.

[0346] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphiphilic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, it can be modified including the use of peptidylmimetics, enantiomers, non-peptides or pseudo-peptide bonds, and D-amino acids. The helical agent is preferably an alpha-helical agent having preferably lipophilic and hydrophobic phases.

[0347] The ligand can be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can be folded into a defined three-dimensional structure similar to that of a natural peptide. The attachment of peptides and peptidomimetics to oligonucleotides can affect the pharmacokinetic distribution of RNA silencing agents, for example, by improving cell recognition and uptake. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (e.g., consisting mainly of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, a constrained peptide or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). The peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage display library, or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature 354:82-84, 1991). In an exemplary embodiment, the peptide or peptidomimetic tethered to the RNA silencing agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or an RGD mimetic. The peptide moiety can range from about 5 amino acids to about 40 amino acids in length. The peptide moiety can have structural modifications, such as to enhance stability or direct conformational properties. Any of the structural modifications described hereinafter can be used.

[0348] VI. Branched Oligonucleotides

[0349] The above two or more RNA silencing agents, such as oligonucleotide constructs such as anti-ApoE siRNA, can be linked to each other by one or more portions independently selected from linkers, spacers, and branch points to form a branched oligonucleotide RNA silencing agent. Figure 11 shows an example of a di-branched di-siRNA scaffold for delivering two siRNAs. In a typical embodiment, each nucleic acid of the branched oligonucleotide contains an antisense strand (or a portion thereof) having sufficient complementarity to a telomeric junction single nucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi). In other embodiments, provided is a second type of branched oligonucleotide characterized by a nucleic acid containing a sense strand (or a portion thereof) for silencing an ApoE antisense transcript, wherein the sense strand has sufficient complementarity to the antisense transcript to mediate an RNA-mediated silencing mechanism. In a further embodiment, provided is a third type of branched oligonucleotide comprising both types of nucleic acids, i.e., a first oligonucleotide containing an antisense strand (or a portion thereof) and a second oligonucleotide containing a sense strand (or a portion thereof).

[0350] In an exemplary embodiment, the branched oligonucleotide can have 2 to 8 RNA silencing agents linked via a linker. The linker can be hydrophobic. In some embodiments, the branched oligonucleotide of the present application comprises 2 to 3 oligonucleotides. In some embodiments, the oligonucleotides independently have substantial chemical stabilization (e.g., at least 40% of the constituent bases are chemically modified). In an exemplary embodiment, the oligonucleotide has complete chemical stabilization (i.e., all of the constituent bases are chemically modified). In some embodiments, the branched oligonucleotide has one or more single-stranded phosphorothioate tails each independently having 2 to 20 nucleotides. In a non-limiting embodiment, each single-stranded tail has 8 to 10 nucleotides.

[0351] In certain embodiments, the branched oligonucleotide is characterized by three properties: (1) a branched structure, (2) complete metabolic stabilization, and (3) the presence of a single-stranded tail containing phosphorothioate linkers. In certain embodiments, the branched oligonucleotide has 2 or 3 branches. An increase in the overall size of the branched structure is thought to facilitate increased uptake. Also, without being bound by a particular theory of action, multiple adjacent branches (e.g., 2 or 3) are thought to allow each branch to operate in concert and thus dramatically improve the rates of internalization, trafficking, and release.

[0352] Branched oligonucleotides are provided in a variety of structurally diverse embodiments. As shown in FIG. 17, for example, in some embodiments, the nucleic acids joined at the branch point are single-stranded or double-stranded and consist of miRNA inhibitors, gapmers, mixmers, SSOs, PMOs, or PNAs. These single strands can be joined at their 3' or 5' ends. Combinations of siRNA and single-stranded oligonucleotides can also be used bifunctionally. In another embodiment, short nucleic acids complementary to gapmers, mixmers, miRNA inhibitors, SSOs, PMOs, and PNAs can be used to carry active single-stranded nucleic acids and improve distribution and cellular internalization. The short double-stranded regions have a low melting temperature (Tm~37°C) and rapidly degrade when the branched structure is internalized into cells.

[0353] As shown in FIG. 21, the di-siRNA branched oligonucleotide can contain chemically diverse conjugates. The conjugate can use a bioactive ligand to improve cell specificity and promote membrane binding, internalization, and serum protein binding. Examples of bioactive moieties used for conjugation include DHAg2, DHA, GalNAc, and cholesterol. These moieties can be attached to the di-siRNA via a linking linker or spacer, or added via an additional linker or spacer attached to another free siRNA end.

[0354] The presence of the branched structure improves the tissue retention level in the brain by more than 100-fold compared to unbranched compounds of the same chemical composition, suggesting a new mechanism of cell retention and distribution. The branched oligonucleotide is unexpectedly uniformly distributed throughout the spinal cord and brain. Furthermore, the branched oligonucleotide exhibits unexpectedly efficient systemic delivery to various tissues and very high levels of tissue accumulation.

[0355] The branched oligonucleotide includes various therapeutic nucleic acids including ASO, miRNA, miRNA inhibitor, splice switching, PMO, and PNA. In some embodiments, the branched oligonucleotide further includes a conjugate hydrophobic moiety and exhibits unprecedented silencing and efficacy in vitro and in vivo.

[0356] Non-limiting embodiments of the branched oligonucleotide arrangement are disclosed in FIGS. 11, 17-19, 25-27, and 50-52. Non-limiting examples of linkers, spacers, and branch points are disclosed in FIG. 13.

[0357] Linker

[0358] In embodiments of the branched oligonucleotide, each linker is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof; wherein any carbon or oxygen atom of the linker may optionally be replaced by a nitrogen atom and has a hydroxyl substituent or an oxo substituent. In one embodiment, each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment, each linker is a peptide. In another embodiment, each linker is RNA. In another embodiment, each linker is DNA. In another embodiment, each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment, each linker is a phosphoramidate. In another embodiment, each linker is an ester. In another embodiment, each linker is an amide. In another embodiment, each linker is a triazole. In another embodiment, each linker is a structure selected from the formulae of FIG. 17. VII. Compounds of formula (I)

[0359] In another aspect, herein, formula (I)

Chemical formula

[0360] Subpart N is an RNA duplex containing a sense strand and an antisense strand; and n is 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the antisense strand of N contains a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, N contains a strand capable of targeting one or more target sequences of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'. The sense strand and the antisense strand each independently contain one or more chemical modifications.

[0361] In some embodiments, the compound represented by formula (I) has a structure selected from formulas (I-1) to (I-9) in Table 3. [Table 3]

[0362] In one embodiment, the compound represented by formula (I) is formula (I-1). In another embodiment, the compound represented by formula (I) is formula (I-2). In another embodiment, the compound represented by formula (I) is formula (I-3). In another embodiment, the compound represented by formula (I) is formula (I-4). In another embodiment, the compound represented by formula (I) is formula (I-5). In another embodiment, the compound represented by formula (I) is formula (I-6). In another embodiment, the compound represented by formula (I) is formula (I-7). In another embodiment, the compound represented by formula (I) is formula (I-8). In another embodiment, the compound represented by formula (I) is formula (I-9).

[0363] In embodiments of the compound represented by formula (I), each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof; wherein any carbon or oxygen atom of the linker may be replaced by a nitrogen atom and may have a hydroxyl substituent or an oxo substituent. In one embodiment of the compound represented by formula (I), each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment of the compound represented by formula (I), each linker is a peptide. In another embodiment of the compound represented by formula (I), each linker is RNA. In another embodiment of the compound represented by formula (I), each linker is DNA. In another embodiment of the compound represented by formula (I), each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment of the compound represented by formula (I), each linker is a phosphoramidate. In another embodiment of the compound represented by formula (I), each linker is an ester. In another embodiment of the compound represented by formula (I), each linker is an amide. In another embodiment of the compound represented by formula (I), each linker is a triazole. In another embodiment of the compound represented by formula (I), each linker is a structure selected from the formulas of FIG. 17.

[0364] In one embodiment of the compound represented by formula (I), B is a polyvalent organic species. In another embodiment of the compound represented by formula (I), B is a derivative of a polyvalent organic species. In one embodiment of the compound represented by formula (I), B is a triol or tetrol derivative. In another embodiment, B is a tri- or tetra-carboxylic acid derivative. In another embodiment, B is an amine derivative. In another embodiment, B is a tri- or tetra-amine derivative. In another embodiment, B is an amino acid derivative. In another embodiment of the compound represented by formula (I), B is selected from the formulas of FIG. 16.

[0365] The polyvalent organic species is a moiety containing carbon and three or more valences (i.e., bonding sites with moieties such as S, L, or N as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, etc.), tetrols (e.g., ribose, pentaerythritol, 1,2,3,5 - tetrahydroxybenzene, etc.), tri - carboxylic acids (e.g., citric acid, 1,3,5 - cyclohexanetricarboxylic acid, trimesic acid, etc.), tetra - carboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, etc.), tertiary amines (e.g., tripropargylamine, triethanolamine, etc.), triamines (e.g., diethylenetriamine, etc.), tetramines, and species containing combinations of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, cysteine, etc.).

[0366] In embodiments of the compound represented by formula (I), each nucleic acid comprises one or more chemically modified nucleotides. In embodiments of the compound represented by formula (I), each nucleic acid consists of chemically modified nucleotides. In certain embodiments of the compound represented by formula (I), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of each nucleic acid comprises chemically modified nucleotides.

[0367] In some embodiments, each antisense strand independently comprises a 5' - terminal group R selected from the group of Table 4. [Table 4]

[0368] In one embodiment, R is R 1 . In another embodiment, R is R 2 . In another embodiment, R is R 3 . In another embodiment, R is R 4 . In another embodiment, R is R 5is. In another embodiment, R is R 6 is. In another embodiment, R is R 7 is. In another embodiment, R is R 8 is. The structure of formula (II)

[0369] In some embodiments, the compound represented by formula (I) is of formula (II): [Chemical formula] [wherein X is independently selected, each time it appears, from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected, each time it appears, from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; - represents a phosphodiester nucleoside internucleoside linkage; = represents a phosphorothioate nucleoside internucleoside linkage; and --- represents, each time it appears, independently, a base pairing interaction or a mismatch].

[0370] In certain embodiments, the structure of formula (II) does not contain mismatches. In one embodiment, the structure of formula (II) contains one mismatch. In another embodiment, the compound represented by formula (II) contains two mismatches. In another embodiment, the compound represented by formula (II) contains three mismatches. In another embodiment, the compound represented by formula (II) contains four mismatches. In some embodiments, each nucleic acid consists of chemically modified nucleotides.

[0371] In certain embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of X' in the structure of formula (II) is a chemically modified nucleotide. In other embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of X' in the structure of formula (II) is a chemically modified nucleotide. The structure of formula (III)

[0372] In some embodiments, the compound represented by formula (I) is of formula (III):

Chemical formula

[0373] [wherein X is, each time it appears, independently a nucleotide comprising a 2'-deoxy-2'-fluoro modification; X is, each time it appears, independently a nucleotide comprising a 2'-O-methyl modification; Y is, each time it appears, independently a nucleotide comprising a 2'-deoxy-2'-fluoro modification; and Y is, each time it appears, independently a nucleotide comprising a 2'-O-methyl modification].

[0374] In some embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine or cytidine.

[0375] In certain embodiments, the structure of formula (III) does not contain mismatches. In one embodiment, the structure of formula (III) contains one mismatch. In another embodiment, the compound represented by formula (III) contains two mismatches. In another embodiment, the compound represented by formula (III) contains three mismatches. In another embodiment, the compound represented by formula (III) contains four mismatches. The structure of formula (IV)

[0376] In some embodiments, the compound represented by formula (I) is of formula (IV): [Chemistry] [wherein, each X is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; each Y is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - represents a phosphodiester nucleoside internucleoside linkage; = represents a phosphorothioate nucleoside internucleoside linkage; and --- each independently represents, when it appears, a base pairing interaction or a mismatch] has the structure of.

[0377] In certain embodiments, the structure of formula (IV) does not contain a mismatch. In one embodiment, the structure of formula (IV) contains one mismatch. In another embodiment, the compound represented by formula (IV) contains two mismatches. In another embodiment, the compound represented by formula (IV) contains three mismatches. In another embodiment, the compound represented by formula (IV) contains four mismatches. In some embodiments, each nucleic acid consists of chemically modified nucleotides.

[0378] In certain embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of X' in the structure of formula (IV) are chemically modified nucleotides. In other embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% of X' in the structure of formula (IV) are chemically modified nucleotides. The structure of formula (V)

[0379] In some embodiments, the compound represented by formula (I) is of formula (V): [Chemistry] [Wherein, each occurrence of X is independently a nucleotide comprising a 2'-deoxy-2'-fluoro modification; each occurrence of X is independently a nucleotide comprising a 2'-O-methyl modification; each occurrence of Y is independently a nucleotide comprising a 2'-deoxy-2'-fluoro modification; and each occurrence of Y is independently a nucleotide comprising a 2'-O-methyl modification] having the structure of.

[0380] In certain embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine or cytidine.

[0381] In certain embodiments, the structure of formula (V) does not contain mismatches. In one embodiment, the structure of formula (V) contains one mismatch. In another embodiment, the compound represented by formula (V) contains two mismatches. In another embodiment, the compound represented by formula (V) contains three mismatches. In another embodiment, the compound represented by formula (V) contains four mismatches. Variable linker

[0382] In an embodiment of the compound represented by formula (I), L is L1:

Chemical formula

[0383] In an embodiment of the structure represented by formula (II), L has the structure of L1. In an embodiment of the structure of formula (III), L has the structure of L1. In an embodiment of the structure of formula (IV), L has the structure of L1. In an embodiment of the structure of formula (V), L has the structure of L1. In an embodiment of the structure of formula (VI), L has the structure of L1. In an embodiment of the structure of formula (VI), L has the structure of L1.

[0384] In an embodiment of the compound represented by formula (I), L is L2:

Chemical formula

[0385] In an embodiment of L2, R is R3, and n is 2. In an embodiment of the structure of formula (II), L has the structure of L2. In an embodiment of the structure of formula (III), L has the structure of L2. In an embodiment of the structure of formula (IV), L has the structure of L2. In an embodiment of the structure of formula (V), L has the structure of L2. In an embodiment of the structure of formula (VI), L has the structure of L2. In an embodiment of the structure of formula (VI), L has the structure of L2. Delivery system

[0386] In a third aspect, herein, formula (VI):

Chemical formula

[0387] [In formula (VI), L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, phosphate, phosphonate, phosphoramidate, ester, amide, triazole, and combinations thereof, where formula (VI) may further include one or more branch points B and one or more spacers S (where B is, each time it appears independently, a polyvalent organic species or a derivative thereof; S is, each time it appears independently, selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, phosphate, phosphonate, phosphoramidate, ester, amide, triazole, and combinations thereof); each cNA is independently a carrier nucleic acid containing one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8]. A delivery system for a therapeutic nucleic acid having the structure is provided.

[0388] In one embodiment of the delivery system, L is an ethylene glycol chain. In another embodiment of the delivery system, L is an alkyl chain. In another embodiment of the delivery system, L is a peptide. In another embodiment of the delivery system, L is RNA. In another embodiment of the delivery system, L is DNA. In another embodiment of the delivery system, L is phosphate. In another embodiment of the delivery system, L is phosphonate. In another embodiment of the delivery system, L is phosphoramidate. In another embodiment of the delivery system, L is an ester. In another embodiment of the delivery system, L is an amide. In another embodiment of the delivery system, L is triazole.

[0389] In one embodiment of the delivery system, S is an ethylene glycol chain. In another embodiment, S is an alkyl chain. In another embodiment of the delivery system, S is a peptide. In another embodiment, S is RNA. In another embodiment of the delivery system, S is DNA. In another embodiment of the delivery system, S is phosphate. In another embodiment of the delivery system, S is phosphonate. In another embodiment of the delivery system, S is phosphoramidate. In another embodiment of the delivery system, S is an ester. In another embodiment, S is an amide. In another embodiment, S is a triazole.

[0390] In one embodiment of the delivery system, n is 2. In another embodiment of the delivery system, n is 3. In another embodiment of the delivery system, n is 4. In another embodiment of the delivery system, n is 5. In another embodiment of the delivery system, n is 6. In another embodiment of the delivery system, n is 7. In another embodiment of the delivery system, n is...

[0391] In certain embodiments, each cNA comprises >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% chemically modified nucleotides.

[0392] In some embodiments, the compound represented by formula (VI) is Table 5: [Table 5] having a structure selected from formulas (VI-1) to (VI-9) of

[0393] In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-1). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-2). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-3). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-4). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-5). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-6). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-7). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-8). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-9).

[0394] In some embodiments, for the compound represented by formula (VI) (including, for example, formulas (VI-1) to (VI-9)), each cNA independently comprises at least 15 consecutive nucleotides. In some embodiments, each cNA independently consists of chemically modified nucleotides.

[0395] In some embodiments, the delivery system further comprises a therapeutic nucleic acid (NA) comprising a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, the NA comprises a strand capable of targeting one or more of the target sequences of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0396] Also, each NA hybridizes to at least one cNA. In one embodiment, the delivery system consists of 2 NAs. In another embodiment, the delivery system consists of 3 NAs. In another embodiment, the delivery system consists of 4 NAs. In another embodiment, the delivery system consists of 5 NAs. In another embodiment, the delivery system consists of 6 NAs. In another embodiment, the delivery system consists of 7 NAs. In another embodiment, the delivery system consists of 8 NAs.

[0397] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides. In some embodiments, each NA independently comprises 16 - 20 consecutive nucleotides. In some embodiments, each NA independently comprises 16 consecutive nucleotides. In another embodiment, each NA independently comprises 17 consecutive nucleotides. In another embodiment, each NA independently comprises 18 consecutive nucleotides. In another embodiment, each NA independently comprises 19 consecutive nucleotides. In another embodiment, each NA independently comprises 20 consecutive nucleotides.

[0398] In some embodiments, each NA comprises at least a 2 - nucleotide overhang. In another embodiment, each NA comprises at least a 3 - nucleotide overhang. In another embodiment, each NA comprises at least a 4 - nucleotide overhang. In another embodiment, each NA comprises at least a 5 - nucleotide overhang. In another embodiment, each NA comprises at least a 6 - nucleotide overhang. In some embodiments, the overhanging nucleotides are linked via phosphorothioate bonds.

[0399] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagomiR, miRNA, gapmer, mixmer, or guide RNA. In one embodiment, each NA is independently DNA. In another embodiment, each NA is independently siRNA. In another embodiment, each NA is independently antagomiR. In another embodiment, each NA is independently miRNA. In another embodiment, each NA is independently gapmer. In another embodiment, each NA is independently mixmer. In another embodiment, each NA is independently guide RNA. In some embodiments, each NA is the same. In some embodiments, each NA is different.

[0400] In some embodiments, the delivery system further comprising n therapeutic nucleic acids (NAs) has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 2 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In another embodiment, the delivery system further comprises 3 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 4 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 5 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 6 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 7 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises 8 therapeutic nucleic acids (NAs) and has a structure selected from formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein.

[0401] In one embodiment, the delivery system further comprises a linker of structure L1 or L2 [where R is R 3 and n is 2] and has a structure selected from formula (I), (II), (III), (IV), (V), (VI). In another embodiment, the delivery system further comprises a linker of structure L1 [where R is R 3and n is 2], and further comprises a linker of formula (I), (II), (III), (IV), (V), (VI) selected from the structure having. In another embodiment, the delivery system, the structure L2 [wherein, R is R 3 and n is 2], and further comprises a linker of formula (I), (II), (III), (IV), (V), (VI) selected from the structure having.

[0402] In certain embodiments of the delivery system, the target of delivery is selected from the group consisting of brain, liver, skin, kidney, spleen, pancreas, colon, fat, lung, muscle, and thymus. In one embodiment, the target of delivery is the brain. In another embodiment, the target of delivery is the striatum of the brain. In another embodiment, the target of delivery is the cortex of the brain. In another embodiment, the target of delivery is the striatum of the brain. In one embodiment, the target of delivery is the liver. In one embodiment, the target of delivery is the skin. In one embodiment, the target of delivery is the kidney. In one embodiment, the target of delivery is the spleen. In one embodiment, the target of delivery is the pancreas. In one embodiment, the target of delivery is the colon. In one embodiment, the target of delivery is the fat. In one embodiment, the target of delivery is the lung. In one embodiment, the target of delivery is the muscle. In one embodiment, the target of delivery is the thymus. In one embodiment, the target of delivery is the spinal cord.

[0403] In certain embodiments, the compounds of the invention are characterized by the following properties: (1) for example, two or more branched oligonucleotides having unequal numbers of 3' and 5' ends; (2) substantially chemically stabilized, for example, more than 40%, optimally 100% of the oligonucleotides are chemically modified (e.g., no RNA, and optionally no DNA); and (3) at least 3, optimally 5 to 20 phosphorothioate bonds containing phosphorothioate single oligonucleotide.

[0404] The methods described in this disclosure are not limited to the specific methods and experimental conditions disclosed herein, and it should be understood that such methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0405] Furthermore, the experiments described herein use conventional molecular, cell biological, and immunological techniques within the skill of the art, unless otherwise noted. Such techniques are well known to those of skill in the art and are sufficiently described in the literature. See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition). Methods for introducing nucleic acids, vectors, and host cells

[0406] The RNA silencing agents of the present invention may be introduced directly into cells (e.g., nerve cells), i.e., intracellularly, introduced extracellularly into cavities, interstitial spaces, the circulation of an organism, introduced orally, or introduced by immersing cells or organisms in a solution containing the nucleic acid. Blood vessels or extravascular circulation, blood or lymphatic systems, and cerebrospinal fluid are sites where the nucleic acid can be introduced.

[0407] The RNA silencing agent of the present invention can be introduced using nucleic acid delivery methods known in the art, including injection of a solution containing the nucleic acid, bombardment with particles coated with the nucleic acid, immersion of cells or organisms in a solution of the nucleic acid, or electroporation of cell membranes in the presence of the nucleic acid. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate, can be used. The nucleic acid can be introduced together with other components that perform one or more of the activities such as enhancing nucleic acid uptake by cells or otherwise increasing inhibition of the target gene.

[0408] Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment with particles coated with the RNA, immersion of cells or organisms in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA. A viral construct packaged in viral particles can achieve both efficient introduction of the expression construct into cells and transcription of the RNA encoded by this expression construct. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated carrier transport, chemical-mediated transport such as calcium phosphate, etc., can be used. Thus, the RNA can be introduced together with components that perform one or more of the activities such as improving RNA uptake by cells, inhibiting single-stranded annealing, stabilizing single strands, or otherwise increasing inhibition of the target gene.

[0409] RNA can be introduced directly into cells (i.e., intracellularly), extracellularly into cavities, interstitial spaces, the circulation of an organism, orally, or by immersing cells or organisms in a solution containing the RNA. Blood vessels or extravascular circulation, blood or lymphatic systems, and cerebrospinal fluid are sites where RNA can be introduced.

[0410] Cells having a target gene can be derived from germ line or somatic cells, totipotent or pluripotent cells, dividing or non-dividing cells, parenchymal or epithelial cells, immortalized or transformed cells, etc. The cells can be stem cells or differentiated cells. The cell types to be differentiated include adipocytes, fibroblasts, muscle cells, cardiomyocytes, endothelial cells, nerve cells, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratin-producing cells, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of endocrine or exocrine glands.

[0411] Depending on the specific target gene and the dose of the double-stranded RNA material to be delivered, this process can provide a partial or complete loss of function of the target gene. Exemplary is a reduction or loss of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% or more of the targeted cells. Inhibition of gene expression means that the levels of protein and / or mRNA products from the target gene are absent (or an observable reduction). Specificity means the ability to inhibit the target gene without manifesting an effect on other genes of the cell. The results of the inhibition can be confirmed by testing the apparent properties of the cells or organisms (as shown in the following examples), or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring by microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence-activated cell sorting (FACS).

[0412] In the case of RNA-mediated inhibition in a cell line or an entire organism, gene expression can be conveniently assayed by using a reporter gene or a drug resistance gene whose protein product can be easily assayed. Such reporter genes include acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. A plurality of selectable markers that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracycline are available. Depending on the assay, by quantifying the amount of gene expression, it is possible to determine the degree of inhibition exceeding 10%, 33%, 50%, 90%, 95%, 99% compared to cells not treated by the present invention. If the dose of the injection is low and the time after administration of the RNAi agent is long, inhibition can occur in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of the target cells). Quantifying gene expression in cells can show a similar amount of inhibition at the level of accumulation of the target mRNA or translation of the target protein. As an example, the efficiency of inhibition can be determined by evaluating the amount of gene product in the cells. The mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the inhibitory double-stranded RNA, and the translated polypeptide may be detected with a raised antibody against the polypeptide sequence of that region.

[0413] RNA can be introduced in an amount that allows delivery of at least one copy per cell. High doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of the material can result in more effective inhibition, and low doses may also be useful for certain applications.

[0414] In an exemplary embodiment, the effectiveness of the RNAi agent of the present invention (e.g., siRNA targeting an ApoE target sequence) is tested for the ability to specifically degrade mutant mRNA (e.g., production of ApoE mRNA and / or ApoE protein) in cells, particularly in nerve cells (e.g., clonal lines of striatal or cortical nerve cells and / or primary nerve cells). Also suitable for cell-based validation assays are other easily transfectable cells, such as HeLa cells or COS cells. The cells are transfected with human wild-type or mutant cDNA (e.g., human wild-type or mutant ApoE cDNA). A standard siRNA, a modified siRNA, or a vector capable of generating siRNA from U-loop mRNA is co-transfected. Selective reduction in the target mRNA (e.g., ApoE mRNA) and / or the target protein (e.g., ApoE protein) is measured. The reduction in the target mRNA or protein can be compared to the level of the target mRNA or protein in the absence of the RNAi agent or in the presence of an RNAi agent that does not target ApoE mRNA. Exogenously introduced mRNA or protein (or endogenous mRNA or protein) can be assayed for comparison purposes. When using nerve cells that are known to be somewhat resistant to standard transfection techniques, it may be desirable to introduce the RNAi agent (e.g., siRNA) by passive uptake. Recombinant adeno-associated virus and vector

[0415] In certain exemplary embodiments, one or more siRNAs can be delivered to cells, such as neuronal cells (e.g., brain cells), using recombinant adeno-associated virus (rAAV) and related vectors. AAV can infect a variety of cell types, but the infection efficiency varies depending on the serotype determined by the sequence of the capsid protein. Several native AAV serotypes have been identified, and serotypes 1-9 are most commonly used for recombinant AAV. AAV-2 is the most well-studied and published serotype. The AAV-DJ system includes serotypes AAV-DJ and AAV-DJ / 8. These serotypes are created by DNA shuffling of multiple AAV serotypes and generate AAVs with hybrid capsids that have improved transduction efficiency in vitro (AAV-DJ) and in vivo (AAV-DJ / 8) in various cells and tissues.

[0416] In certain embodiments, widespread central nervous system (CNS) delivery can be achieved by intravascular delivery of recombinant adeno-associated virus 7 (rAAV7), rAAV9, and rAAV10, or other suitable rAAVs (Zhang et al. (2011) Mol. Ther. 19(8):1440-8. doi: 10.1038 / mt.2011.98. Epub 2011 May 24). rAAV and related vectors are well known in the art and are described in U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766, each of which is hereby incorporated by reference in its entirety for all purposes.

[0417] rAAV can be delivered to a subject in a composition by any suitable method known in the art. rAAV can be suspended in a physiologically compatible carrier (i.e., in the composition) and administered to a subject, i.e., a host animal such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, non-human primate (e.g., macaque), etc. In certain embodiments, the host animal is a non-human host animal.

[0418] Delivery of one or more rAAVs to a mammalian subject can be accomplished, for example, by intramuscular injection or administration into the bloodstream of the mammalian subject. Administration into the bloodstream can be by injection into a vein, artery, or other blood vessel conduit. In certain embodiments, one or more rAAVs are administered into the bloodstream by isolated limb perfusion, a technique well known in the surgical arts that essentially enables one of ordinary skill in the art to isolate a limb from the systemic circulation prior to administration of the rAAV virions. Variants of the isolated limb perfusion technique described in U.S. Patent 6,177,403 can also be utilized by one of ordinary skill in the art to administer virions into the vasculature of the isolated limb and potentially improve transduction of muscle cells or tissues. Further, in certain instances, it may be desirable to deliver virions to the central nervous system (CNS) of the subject. "CNS" means all cells and tissues of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, and the like. Recombinant AAV can be delivered directly to the CNS or brain, for example, into ventricular regions, as well as the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord, and neuromuscular junction, or cerebellar lobules, using neurosurgical techniques known in the art such as stereotactic injection using a needle, catheter, or related device (see, for example, Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).

[0419] The composition of the present invention can contain rAAV alone or in combination with one or more other viruses (e.g., a second encoded rAAV having one or more different transgenes). In certain embodiments, the composition contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different rAAVs, each having one or more different transgenes.

[0420] An effective amount of rAAV is an amount sufficient to target infect an animal and target a desired tissue. In some embodiments, an effective amount of rAAV is an amount sufficient to generate a stable somatic cell line transgenic animal model. This effective amount may vary from animal to animal and tissue to tissue because it depends mainly on factors such as the species, age, weight, health status, and tissue to be targeted of the subject. For example, an effective amount of one or more rAAVs is generally about 10 9 ~10 16 genome copies in a solution in the range of about 1 ml to about 100 ml. In some cases, a dose of about 10 11 ~10 12 rAAV genome copies is appropriate. In certain embodiments, 10 12 rAAV genome copies are effective for targeting heart, liver, and pancreatic tissues. In some cases, stable transgenic animals are generated by multiple doses of rAAV.

[0421] In some embodiments, the rAAV composition is formulated to reduce aggregation of AAV particles in the composition, particularly when a particularly high rAAV concentration (e.g., about 10 13 genome copies / mL or more) is present. Methods for reducing aggregation of rAAV are well known, such as, for example, addition of surfactants, pH adjustment, adjustment of salt concentration, etc. (See, for example, Wright et al. (2005) Molecular Therapy 12:171-178. The content is incorporated herein by reference.)

[0422] A "recombinant AAV (rAAV) vector" contains at least a transgene and its regulatory sequences, as well as 5' and 3' AAV inverted terminal repeats (ITRs). This recombinant AAV vector is packaged into a capsid protein and delivered to a selected target cell. In some embodiments, the transgene is a nucleic acid sequence heterologous to the vector sequence that encodes a polypeptide, protein, functional RNA molecule (e.g., siRNA), or other gene product of interest. The nucleic acid coding sequence is operably linked to regulatory components in a manner that enables transcription, translation, and / or expression of the transgene in the cells of the target tissue.

[0423] The AAV sequences of the vector typically include cis - acting 5' and 3' inverted terminal (ITR) sequences (see, for example, B. J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 - 168 (1990)). The ITR sequences are usually about 145 base pairs in length. In certain embodiments, substantially the entire sequence encoding the ITR is used in the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the skill of the art (see, for example, the teachings of Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 - 532 (1996)). Examples of such molecules used in the present invention are "cis - acting" plasmids containing a transgene, where the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The AAV ITR sequences can be obtained from any of the known AAVs, including mammalian AAV types further described herein. VIII. Treatment Methods

[0424] In one aspect, the present invention provides prophylactic and therapeutic methods for treating a subject at risk of (or susceptible to) a disease or disorder caused in whole or in part by abnormal cholesterol transport. In one embodiment, the disease or disorder is such that reduced ApoE levels in the central nervous system (CNS) have been found to predict the progression of neurodegeneration. In another embodiment, the disease or disorder is a polyglutamine disorder. In a preferred embodiment, reduction of ApoE in the CNS is one of the diseases or disorders that reduce the clinical symptoms seen in neurodegenerative diseases such as AD and ALS.

[0425] As used herein, "treating" or "treatment" is defined as applying or administering a therapeutic agent (e.g., an RNA agent or a vector or transgene encoding the same) to a patient, or applying or administering a therapeutic agent to a tissue or cell line isolated from a patient having a disease or disorder, having symptoms of a disease or disorder, or having a predisposition to a disease or disorder, for the purpose of curing, healing, reducing, alleviating, altering, treating, ameliorating, improving or affecting the disease or disorder, the symptoms of the disease or disorder, or the predisposition to the disease.

[0426] In one aspect, the present invention provides a method for preventing the above-described diseases or disorders in a subject by administering to the subject a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding the same). A subject at risk of a disease can be identified, for example, by any or a combination of the diagnostic or prognostic assays described herein. Administration of the prophylactic agent is performed before the characteristic symptoms of the disease or disorder appear, thereby preventing the disease or disorder or delaying its progression.

[0427] Another aspect of the invention relates to a method of therapeutically treating a patient, i.e., altering the onset of a disease or disorder. In an exemplary embodiment, the method of modification of the invention comprises contacting a CNS cell expressing ApoE with a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding the same) specific for a target sequence in a gene (e.g., SEQ ID NO: 1, 2, or 3) such that sequence-specific interference of the gene is achieved. These methods can be performed in vitro (e.g., by culturing cells with the agent) or alternatively in vivo (e.g., by administering the agent to a subject).

[0428] With respect to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or varied based on knowledge obtained from the field of pharmacogenomics. As used herein, "pharmacogenomics" means the application of genomics technologies such as gene sequencing, statistical genetics, gene expression analysis, etc. to drugs in clinical development and drugs on the market. More specifically, this term means studying how a patient's genes determine their response to a drug (e.g., a patient's "drug response phenotype" or "drug response genotype"). Thus, another aspect of the invention provides a method of tailoring prophylactic or therapeutic treatment of an individual using either a target gene molecule of the invention or a target gene modifying substance according to the drug response genotype of the individual. Pharmacogenomics allows a clinician or physician to administer prophylactic or therapeutic treatments to those patients who will most benefit from the treatment and to avoid treating patients who will experience drug-related toxic side effects.

[0429] The therapeutic agent can be tested in a suitable animal model. For example, the RNAi agent (or the expression vector or transgene encoding the same) described herein can be used in an animal model to identify the efficacy, toxicity, or side effects of treatment with this agent. Alternatively, an animal model can be used with a certain therapeutic agent to identify the mechanism of action of such an agent. For example, a certain agent can be used in an animal model to identify the efficacy, toxicity, or side effects of treatment with this agent. Alternatively, a certain agent can be used in an animal model to identify the mechanism of action of this agent.

[0430] The pharmaceutical composition containing the RNA silencing agent of the present invention can be administered to a patient diagnosed as having a neurodegenerative disease or at risk of developing the same. In one embodiment, the patient is diagnosed with a neurological disease and is otherwise generally healthy. For example, the patient is not in the terminal stage of the disease and may be expected to live at least 2 years, 3 years, 5 years, or more after diagnosis. The patient may be treated immediately after diagnosis, or the treatment may be delayed until the patient experiences more debilitating symptoms such as motor fluctuations and dyskinesia in patients with Parkinson's disease. In another embodiment, the patient has not reached an advanced stage of the disease.

[0431] In embodiments of this aspect, the prophylactic and therapeutic methods are directed to treating or managing neurodegenerative diseases or disorders that reduce abnormal amyloid accumulation by reducing ApoE in the CNS. In non-limiting examples, an RNA silencing agent is a branched oligonucleotide as described in Sections VI and VII of this specification, administered to a patient diagnosed with or at risk of developing an amyloid-related neurodegenerative disease or disorder such as Alzheimer's disease, cerebral amyloid angiopathy, or mild to moderate cognitive impairment. The patient may be treated after diagnosis, at various stages of the disease, or prophylactically if there is a risk of neurodegenerative disease or disorder due to a genetic trait, family history, or other factors. Effective dosages and dosing schedules can be established and monitored by a measure that indicates effective treatment, such as the degree of cognitive decline detected after treatment initiation, formation of β-amyloid plaques in the brain, and inhibition, delay, prevention, or reduction of symptoms of neurodegeneration.

[0432] In one embodiment, the patient is diagnosed with or at risk of developing Alzheimer's disease and is otherwise healthy. The treatment is by administering a Di-siRNA ApoE , i.e., a branched oligonucleotide containing two nucleic acids each 15 to 35 bases in length. Each nucleic acid is characterized by a region substantially complementary to one or more of the target sequences described in Table 1, Table 2, or Table 7, which are part of the ApoE mRNA. The two nucleic acids are joined to each other, for example, by a linker, spacer, or branch point. Each nucleic acid can independently be single-stranded (ss) RNA or double-stranded (ds) RNA. For example, each nucleic acid can independently be an antisense molecule or a gapmer.

[0433] An RNA silencing agent modified to improve uptake into nerve cells can be administered at a unit dose of less than about 1.4 mg per kg of body weight, or less than 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of body weight and less than 200 nmole of the RNA agent (e.g., about 4.4×1016 copies) per kg of body weight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmole of the RNA silencing agent per kg of body weight. The unit dose can be administered, for example, by injection (e.g., directly into a vein or muscle, intrathecally, or intracerebrally), inhalation, or topical application. Particularly preferred doses are less than 2, 1, or 0.1 mg per kg of body weight.

[0434] Direct delivery of the RNA silencing agent to an organ (e.g., directly to the brain) can be at a dosage on the order of about 0.00001 mg to about 3 mg per organ, or preferably, on the order of about 0.0001 to 0.001 mg per organ, about 0.03 to 3.0 mg per organ, about 0.1 to 3.0 mg per eye, or about 0.3 to 3.0 mg per organ. In another embodiment, the dosage can be on the order of about 10 mg to about 50 mg per organ, or preferably, on the order of about 20 mg to about 30 mg per organ. The dosage can be an amount effective to treat or prevent a neurodegenerative disease or disorder, such as AD or ALS. In one embodiment, the unit dose is administered at a frequency less than once a day, e.g., less than every 2, 4, 8, or 30 days. In another embodiment, the unit dose is not administered with a frequency (e.g., not at a regular frequency). For example, the unit dose can be administered only once. In one embodiment, the effective amount is administered with other traditional therapeutic modalities.

[0435] In one embodiment, the subject is administered an initial dose of the RNA silencing agent, and 11 or more maintenance doses. The maintenance dose is generally less than the initial dose, for example, half less than the initial dose. The maintenance regimen can include treating the subject with a dose in the range of 0.01 g to 10 mg per kg of body weight per day, for example, 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg per kg of body weight per day. The maintenance dose is preferably administered at a frequency of no more than once every 5 days, 10 days, or 30 days. Further, the treatment regimen can continue over a period that varies depending on the nature of the particular disease, its severity, and the overall condition of the patient. In a preferred embodiment, the dose may be administered at a frequency of no more than once per day, for example, no more than once per 24 hours, 36 hours, 48 hours, or more, for example, no more than once every 5 days or 8 days. After treatment, changes in the patient's condition and alleviation of the symptoms of the medical condition can be monitored. The dose of the compound can be increased if the patient does not respond significantly at the current dose level, or decreased if alleviation of the symptoms of the medical condition is observed, the medical condition is eliminated, or undesirable side effects are observed.

[0436] An effective amount can be administered in a single dose or in two or more doses, as desired or appropriate under the particular circumstances. If it is desired to facilitate repeated or frequent infusions, implantation of a delivery device, such as a pump, a semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or a reservoir is desirable. In one embodiment, the pharmaceutical composition comprises a plurality of RNA silencing agent species. In another embodiment, the RNA silencing agent species has a non-overlapping, non-adjacent sequence with respect to a naturally occurring target sequence that is different from another species. In another embodiment, the plurality of RNA silencing agent species is specific for different naturally occurring target genes. In another embodiment, the RNA silencing agent is allele-specific. In another embodiment, the plurality of RNA silencing agent species targets two or more target sequences (e.g., 2, 3, 4, 5, 6, or more target sequences).

[0437] After successful treatment, it may be desirable to subject the patient to maintenance therapy to prevent recurrence of the condition, in which case the compounds of the invention are administered in a maintenance amount in the range of 0.01 g to 100 g per kg of body weight (see U.S. Patent No. 6,107,094).

[0438] The concentration of the RNA silencing agent composition is an amount effective to treat or prevent a disorder or sufficient to modulate a physiological condition in a human. The concentration or amount of the RNA silencing agent administered depends on the parameters determined for the agent and the method of administration, such as nasal, buccal, or pulmonary. For example, in a nasal formulation, some components tend to be used at lower concentrations to avoid irritation or burns to the nasal cavity. In some cases, it may be desirable to dilute an oral formulation 10 to 100-fold to provide an appropriate nasal formulation.

[0439] Certain factors can affect the dosage required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Further, treatment of a subject with a therapeutically effective amount of an RNA silencing agent can include a single treatment, and preferably can include a series of treatments. It will also be understood that the effective dosage of the RNA silencing agent for treatment can increase or decrease over the course of a particular treatment. Changes in dosage may become apparent, as a result, from the results of the diagnostic assays described herein. For example, after administering an RNA silencing agent composition, the subject may be monitored. Based on the information from the monitoring, additional amounts of the RNA silencing agent composition can be administered.

[0440] Administration depends on the severity and responsiveness of the disease to be treated, and the course of treatment can continue for several days to several months, or until a cure or reduction of the medical condition is achieved. The optimal dosing schedule can be calculated from measurements of drug accumulation in the patient's body. One of ordinary skill in the art can readily determine the optimal dosage amount, dosage method, and number of repetitions. The optimal dosage may depend on the relative potency of the individual compound, but generally can be estimated based on the EC50 found to be effective in in vitro and in vivo animal models. In some embodiments, the animal model includes a transgenic animal that expresses a human gene, e.g., a gene that produces an RNA, e.g., an RNA expressed in nerve cells. The transgenic animal may be deficient in the corresponding endogenous RNA. In another embodiment, the composition to be tested includes an RNA silencing agent that is complementary at least in an internal region to a sequence conserved between the target RNA in the animal model and the target RNA in humans. IX. Pharmaceutical Compositions and Methods of Administration

[0441] The present invention relates to the use of the above-described agents for prophylactic and / or therapeutic treatment as described below. Accordingly, the modifying substances of the present invention (e.g., RNAi agents) can be incorporated into a pharmaceutical composition suitable for administration. Such compositions typically include a nucleic acid molecule, protein, antibody, or modifying compound and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any solvent, dispersion medium, coating agent, antibacterial agent, antifungal agent, isotonic agent, absorption delaying agent, etc. that is compatible with pharmaceutical administration. The use of such media and agents with pharmaceutically active substances is well known in the art. Such compositions can be contemplated for use, except when conventional media or agents are incompatible with the active compound. Auxiliary active compounds can also be incorporated into the compositions.

[0442] The pharmaceutical composition of the present invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral administration, such as intravenous administration, intradermal administration, subcutaneous administration, intraperitoneal administration, intramuscular administration, oral (e.g., inhalation) administration, transdermal (topical) administration, and transmucosal administration. In certain exemplary embodiments, the pharmaceutical composition of the present invention is delivered to the cerebrospinal fluid (CSF) by routes of administration including, but not limited to, intrasternal (IS) administration, intracerebroventricular (ICV) administration, and intrathecal (IT) administration (e.g., via pumps, infusions, etc.). Solutions or suspensions used for parenteral, intradermal, and subcutaneous applications contain the following components: sterile diluents, such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid, sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetate, citrate, or phosphate, and agents for the adjustment of tonicity, such as sodium chloride or dextrose. The pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.

[0443] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble), dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, IS administration, ICV administration, and IT administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.), phosphate buffered saline (PBS). In all cases, the composition should be sterile and should have a fluidity facilitating easy injection. It should be stable under the conditions of manufacture and storage and should be protected against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycols, etc.), and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved, for example, by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal. In many cases, it will be preferable to include in the composition isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride. Prolonged absorption of the injectable composition can be brought about by including in the composition agents that delay absorption, for example, aluminum monostearate and gelatin.

[0444] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound in an appropriate solvent containing one or a combination of the ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound in a sterile vehicle containing a basic dispersion medium and the other required ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying, which yield, in addition to the powder of the active ingredient, any additional desired ingredients from the previously sterile filtered solutions.

[0445] Oral compositions generally contain an inert diluent or an edible carrier. These can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compounds can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a gargle, where the compound in the fluid carrier is applied orally, spat out, or swallowed. Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, troches, etc. can contain any of the following ingredients or compounds of similar nature: binders such as microcrystalline cellulose, tragacanth gum or gelatin; excipients such as starch or lactose; disintegrants such as alginic acid, Primogel, or corn starch; lubricants such as magnesium stearate or Sterote; flow promoters such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; or flavoring additives such as peppermint, methyl salicylate, or orange flavoring.

[0446] For administration by inhalation, the compounds are provided in the form of a spray from a suitable propellant such as a gas like carbon dioxide or a pressurized container or dispenser containing an oiled nebulizer.

[0447] Systemic administration is also possible by transmucosal or transdermal means. In the case of transmucosal or transdermal administration, a penetration enhancer suitable for the barrier to be penetrated is used in the formulation. Such penetration enhancers are generally known in the art and include, for example, detergents, bile salts, fusidic acid derivatives, etc. for transmucosal administration. Transmucosal administration can be achieved using nasal sprays or suppositories. In the case of transdermal administration, the active compounds are formulated into ointments, plasters, gels, creams as is generally known.

[0448] The compound can also be prepared in the form of a suppository for rectal administration (using conventional suppository bases such as cocoa butter or other glycerides) or a retention enema.

[0449] The RNA silencing agent can also be administered by transfection or infection using methods known in the art including, but not limited to, the methods described in McCaffrey et al. (2002), Nature, 418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20(10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm. 53(2), 151-160, erratum at Am. J. Health Syst. Pharm. 53(3), 325 (1996).

[0450] The RNA silencing agent can also be administered by any method suitable for the administration of nucleic acid agents such as DNA vaccines. These methods include needle-free methods such as gene guns, biological syringes, skin patches, and microparticle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389, as well as transdermal needle-free vaccination of mammals using powdered vaccines disclosed in U.S. Patent 6,168,587. Additionally, intranasal administration is possible, particularly as described in Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2), 205-10. Liposomes (such as those described in U.S. Patent No. 6,472,375) and microencapsulation can also be used. Biodegradable targetable microparticle delivery systems can also be used (such as those described in U.S. Patent No. 6,471,996).

[0451] In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid excretion from the body, such as in a controlled release formulation including implants or microencapsulation delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Also, such materials are commercially available from, for example, Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (including liposomes that target infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, such as those described in, for example, U.S. Patent 4,522,811.

[0452] Formulating oral or parenteral compositions in the form of dosage units is particularly advantageous for ease of administration and uniformity of dosage. As used herein, the term dosage unit form means a physically discrete unit suitable as a single dosage for the subject to be treated, each unit containing a predetermined quantity of the active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications for the dosage unit forms of the present invention are directly dependent on and determined by the unique characteristics of the active compound and the particular therapeutic effect to be achieved, as well as the limitations inherent in the art of compounding such active compounds for the treatment of individuals.

[0453] The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell culture or experimental animals, for example, to determine the LD50 (lethal dose for 50% of the population) and ED50 (therapeutically effective dose for 50% of the population). The dose ratio between the toxic effect and the therapeutic effect is the therapeutic index and can be expressed as the ratio of LD50 / ED50. Compounds showing a large therapeutic index are preferred. Compounds showing toxic side effects may be used, but care should be taken to design a delivery system that targets such compounds to the site of the tissue affected so as to minimize potential damage to uninfected cells and thereby reduce side effects.

[0454] Data obtained from cell culture assays and animal experiments can be used in formulating the dosage range for use in humans. The dosage of such compounds preferably lies within the range of circulating concentrations that include an ED50 with little or no toxicity. The dosage within this range depends on the dosage form used and the route of administration used. For any compound used in the method of the present invention, the therapeutically effective dose can first be calculated from cell culture assays. The dosage can be formulated in an animal model to achieve a range of circulating plasma concentrations that includes the EC50 (i.e., the concentration of the test compound that achieves a half-maximal response) determined in cell culture. Such information can be used to more accurately determine the useful dosage in humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

[0455] The pharmaceutical composition can be included in a container, pack, or dispenser, together with any instructions for use.

[0456] As defined herein, a therapeutically effective amount of an RNA silencing agent (i.e., an effective dosage) depends on the RNA silencing agent selected. For example, if a plasmid encoding shRNA is selected, it may be administered in a single dosage in the range of about 1 μg to 1000 mg, and in some embodiments, it may be administered at 10 μg, 30 μg, 100 μg or 1000 μg. In some embodiments, a composition of 1 - 5 g can be administered. The composition can be administered once or more per day to once or more per week; including once every other day, it can be administered once. One of ordinary skill in the art will understand that the dosage and timing required to effectively treat a subject are affected by specific factors including the severity of the disease or disorder, previous treatment, the general health and / or age of the subject, and other diseases present. Further, treatment of a subject having a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment, and preferably, can include a series of treatments.

[0457] The nucleic acid molecules of the present invention can be inserted into an expression construct, such as a viral vector, a retroviral vector, an expression cassette, or a plasmid viral vector, using methods known in the art including, but not limited to, the methods described in Xia et al., (2002) supra. The expression construct can be administered to a subject by, for example, inhalation, oral, intravenous injection, topical administration (see U.S. Patent 5,328,470), or stereotactic injection (see, for example, Chen et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 3054 - 3057). A pharmaceutical formulation of a delivery vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the delivery vehicle is embedded. Alternatively, if a complete delivery vector can be produced directly from recombinant cells, such as retroviral vectors, the pharmaceutical formulation can include one or more cells that produce the gene delivery system.

[0458] The nucleic acid molecules of the present invention can also include small hairpin RNAs (shRNAs) and expression constructs engineered to express shRNAs. Transcription of shRNAs is thought to be initiated by a polymerase III (pol III) promoter and to terminate at the +2 position of a 4-5 thymidine transcription termination site. The expressed shRNAs are folded into a stem-loop structure with 3' UU-overhangs, and it is thought that the ends of these shRNAs are then processed to convert the shRNAs into siRNA-like molecules of approximately 21 nucleotides. Brummelkamp et al. (2002), Science, 296, 550-553; Lee et al, (2002). supra; Miyagishi and Taira (2002), Nature Biotechnol., 20, 497-500; Paddison et al. (2002), supra; Paul (2002), supra; Sui (2002) supra; Yu et al. (2002), supra.

[0459] The expression construct can be any construct suitable for use in an appropriate expression system and includes, but is not limited to, retroviral vectors, linear expression cassettes, plasmids, and viral or virus-derived vectors known in the art. Such expression constructs can include one or more inducible promoters, an RNA Pol III promoter system, such as the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. The construct can include one or both strands of the siRNA. An expression construct that expresses both strands can also include a loop structure that links the two strands, or each strand can be transcribed separately from separate promoters within the same construct. Each strand can also be transcribed from separate expression constructs. Tuschl (2002), Supra.

[0460] In certain exemplary embodiments, the compositions containing the RNA silencing agents of the invention can be delivered to the nervous system of a subject by various routes. Exemplary routes include intrathecal delivery, parenchymal (e.g., intracerebral) delivery, intranasal delivery, and intraocular delivery. The compositions can also be delivered systemically, for example, by intravenous, subcutaneous, or intramuscular injection, which is particularly useful for delivering the RNA silencing agents to peripheral nerve cells. Preferred delivery routes are direct delivery to the brain, such as to the ventricles or hypothalamus of the brain, or to the lateral or dorsal regions of the brain. The RNA silencing agents for neuronal delivery of the invention can be incorporated into a pharmaceutical composition suitable for administration.

[0461] For example, the composition can comprise one or more species of RNA silencing agents and a pharmaceutically acceptable carrier. The pharmaceutical compositions of the invention can be administered in several ways depending on whether local or systemic treatment is desired and on the region to be treated. Administration can be local (including intraocular, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous infusion, subcutaneous injection, intraperitoneal injection, or intramuscular injection, intrathecal administration, or intracerebroventricular (e.g., intraventricular) administration. In certain exemplary embodiments, the RNA silencing agents of the invention are delivered across the blood-brain barrier (BBB) using the various suitable compositions and methods described herein.

[0462] The delivery route can depend on the patient's disorder. For example, for a subject diagnosed with a neurodegenerative disease, the anti-ApoE RNA silencing agent of the present invention can be directly administered into the brain (e.g., near the globus pallidus or the striatum of the basal ganglia, and medium spiny neurons in the striatum). In addition to the RNA silencing agent of the present invention, a second therapy, such as palliative therapy and / or disease-specific therapy, can be administered to the patient. Secondary therapies include symptomatic therapies (e.g., to relieve symptoms), neuroprotective therapies (e.g., to slow or stop the progression of the disease), and restorative therapies (e.g., to reverse the stage of the disease). Other therapies include psychotherapy, physical therapy, speech therapy, assistance with communication and memory, social support services, and vocational guidance assistance.

[0463] The RNA silencing agent can be delivered to neurons in the brain. Delivery methods that do not require the composition to cross the blood-brain barrier can be utilized. For example, a pharmaceutical composition containing the RNA silencing agent can be delivered to a patient by directly injecting it into the region containing the cells affected by the disease. For example, the pharmaceutical composition can be delivered by directly injecting it into the brain. The injection can be performed by stereotactic injection into a specific region of the brain (e.g., the substantia nigra, cortex, hippocampus, striatum, or globus pallidus). The RNA silencing agent can be delivered into multiple regions of the central nervous system (e.g., multiple regions of the brain and / or within the spinal cord). The RNA silencing agent can be delivered into the diffuse regions of the brain (e.g., diffuse delivery to the cortex of the brain).

[0464] In one embodiment, the RNA silencing agent can be delivered by a cannula or other delivery device having one end implanted in a tissue, such as the brain, such as the substantia nigra, cortex, hippocampus, striatum, or globus pallidus of the brain. The cannula may be connected to a reservoir of the RNA silencing agent. Flow or delivery may be mediated by a pump, such as an osmotic pump or a mini pump, such as an Alzet pump (Durect, Cupertino, CA). In one embodiment, the pump and reservoir are implanted in a region away from the tissue, such as the abdomen, and delivery is effected by a conduit connecting from the pump or reservoir to the release site. Devices for delivery to the brain are described, for example, in U.S. Patents 6,093,180 and 5,814,014.

[0465] The RNA silencing agent of the present invention may be further modified so as to be able to cross the blood-brain barrier. For example, the RNA silencing agent may be conjugated to a molecule that enables the drug to cross the barrier. Such a modified RNA silencing agent may be administered by any desired method, such as by intracerebroventricular or intramuscular injection, or delivery to the lung.

[0466] In certain embodiments, exosomes are used for delivery of the RNA silencing agents of the invention. Exosomes can cross the BBB and specifically deliver siRNA, antisense oligonucleotides, chemotherapeutic agents, and proteins to neurons after systemic injection. (See Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr;29(4):341-5. doi: 10.1038 / nbt.1807; El-Andaloussi S, Lee Y, Lakhal-Littleton S, Li J, Seow Y, Gardiner C, Alvarez-Erviti L, Sargent IL, Wood MJ.(2011). Exosome-mediated delivery of siRNA in vitro and in vivo. Nat Protoc. 2012 Dec;7(12):2112-26. doi: 10.1038 / nprot.2012.131; EL Andaloussi S, Mager I, Breakefield XO, Wood MJ. (2013). Extracellular vesicles: biology and emerging therapeutic opportunities. Nat Rev Drug Discov. 2013 May;12(5):347-57. doi: 10.1038 / nrd3978; El Andaloussi S, Lakhal S, Mager I, Wood MJ. (2013). Exosomes for targeted siRNA delivery across biological barriers. Adv Drug Deliv Rev. 2013 Mar;65(3):391-7. doi: 10.1016 / j.addr.2012.08.008).

[0467] In certain embodiments, one or more lipophilic molecules are used to enable delivery of the RNA silencing agents of the invention across the BBB (Alvarez-Ervit (2011)). The RNA silencing agent will then be activated, for example, by enzymatic degradation of the lipophilic disguise, releasing the agent in its active form.

[0468] In certain embodiments, one or more receptor-mediated permeability compounds can be used to enhance the permeability of the BBB to enable delivery of the RNA silencing agents of the invention. These drugs transiently increase the permeability of the BBB by raising the osmotic pressure in the blood and loosening the tight junctions between endothelial cells ((El-Andaloussi (2012)). Loosening the tight junctions allows for normal intravenous injection of the RNA silencing agent.

[0469] In certain embodiments, nanoparticle-based delivery systems are used to deliver the RNA silencing agents of the invention across the BBB. As used herein, "nanoparticle" means polymeric nanoparticles, which are typically solid, biodegradable colloidal systems that have been widely studied as drug or gene carriers. (S. P. Egusquiaguirre, M. Igartua, R. M. Hernandez, and J. L. Pedraz, “Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research,” Clinical and Translational Oncology, vol. 14, no. 2, pp. 83-93, 2012). Polymeric nanoparticles are broadly classified into two types: natural polymers and synthetic polymers. Natural polymers for siRNA delivery include, but are not limited to, cyclodextrin, chitosan, and atelocollagen. (Y. Wang, Z. Li, Y. Han, L. H. Liang, and A. Ji, “Nanoparticle-based delivery system for application of siRNA in vivo,” Current Drug Metabolism, vol. 11, no. 2, pp. 182-196, 2010). Synthetic polymers include, but are not limited to, polyethyleneimine (PEI), poly(dl-lactide-co-glycolide) (PLGA), and dendrimers, which have been intensively studied.(X. Yuan, S. Naguib, and Z. Wu, “Recent advances of siRNA delivery by nanoparticles,” Expert Opinion on Drug Delivery, vol. 8, no. 4, pp. 521-536, 2011). For a review of nanoparticles and other suitable delivery stems, see Jong-Min Lee, Tae-Jong Yoon, and Young-Seok Cho, “Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy,” BioMed Research International, vol. 2013, Article ID 782041, 10 pages, 2013. doi:10.1155 / 2013 / 782041 (which is incorporated by reference in its entirety).

[0470] The RNA silencing agents of the present invention can be administered to the eye, for example, for treating retinal disorders such as retinopathy. For example, the pharmaceutical composition can be applied to the surface of the eye or tissues near it, such as the inner surface of the eyelid. They can be applied topically, for example, by spraying, dropping, as an eye wash, or as an ointment. The ointment or droppable liquid can be delivered by an eye delivery system known in the art, such as an applicator or an eye dropper. Such compositions can also include a mucomimetic, such as hyaluronic acid, chondroitin sulfate, hydroxypropylmethylcellulose or poly(vinyl alcohol), a preservative, such as sorbic acid, EDTA or benzalkonium chloride, and a conventional amount of diluent and / or carrier. The pharmaceutical composition can be administered inside the eye and can be introduced by a needle or other delivery device that can introduce it into a selected region or structure. Compositions containing the RNA silencing agent can also be applied via an eye patch.

[0471] Generally, the RNA silencing agent of the present invention can be administered by any suitable method. As used herein, topical delivery can mean directly applying the RNA silencing agent to any surface of the body, including the eye, mucosa, surface of a body cavity, or any surface within the body. Formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickening agents, etc. may be necessary or desirable. Topical administration can also be used as a means to selectively deliver the RNA silencing agent to the epidermis or dermis of the subject, a particular layer thereof, or the underlying tissue.

[0472] Compositions for intrathecal or intraventricular (e.g., intracerebroventricular) administration can include sterile aqueous solutions that can also contain buffers, diluents and other suitable additives. Compositions for intrathecal or intraventricular administration preferably do not contain transfection reagents or additional lipophilic moieties other than, for example, lipophilic moieties conjugated to the RNA silencing agent.

[0473] Formulations for parenteral administration can include sterile aqueous solutions that can also contain buffers, diluents and other suitable additives. Intraventricular injection can be readily performed, for example, by means of an intraventricular catheter coupled to a reservoir. When used intravenously, the total concentration of solutes should be controlled to make the formulation isotonic.

[0474] The RNA silencing agent of the present invention can be administered to a subject by pulmonary delivery. Pulmonary delivery compositions can be delivered by inhalation of a dispersion, whereby the composition in the dispersion reaches the lungs where it can be readily absorbed directly into the bloodstream via the alveolar region. Pulmonary delivery is effective for both systemic delivery and local delivery for treating lung diseases. In one embodiment, the RNA silencing agent administered by pulmonary delivery is modified to be able to cross the blood-brain barrier.

[0475] Lung delivery can be achieved by a variety of approaches, including the use of nebulized, aerosolized, micellar and dry powder-based formulations. Delivery can be achieved using liquid nebulizers, aerosol-based inhalers, and dry powder dispensers. A metered-dose device is preferred. One advantage of using an atomizer or inhaler is that the device is self-contained, minimizing the potential for contamination. For example, a dry powder dispensing device delivers a drug that can be easily formulated as a dry powder. The RNA silencing agent composition can be stably stored as a lyophilized or spray-dried powder, either alone or in combination with a suitable powder carrier. Delivery of the composition for inhalation is mediated by an administration timing element that includes a timer, dose counter, time-measuring device, or time indicator, which, when incorporated into the device, enables dose tracking, compliance monitoring, and / or dose triggering for the patient during administration of the aerosol pharmaceutical.

[0476] Examples of types of pharmaceutical excipients useful as carriers include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides; pH adjusters or buffers; salts such as sodium chloride, and the like. These carriers may be in crystalline or amorphous form, or a mixture of both.

[0477] Particularly useful bulking agents include compatible carbohydrates, polypeptides, amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, etc.; disaccharides such as lactose, trehalose, etc.; cyclodextrins such as 2-hydroxypropyl-β-cyclodextrin; and polysaccharides such as raffinose, maltodextrin, dextran, etc.; alditols such as mannitol, xylitol, etc. Preferred groups of carbohydrates include lactose, trehalose, raffinose, maltodextrin, and mannitol. A suitable polypeptide is aspartame. Amino acids include alanine and glycine, with glycine being preferred.

[0478] Suitable pH adjusters or buffers include organic salts prepared from organic acids and organic bases such as sodium citrate, sodium ascorbate, etc., with sodium citrate being preferred.

[0479] The RNA silencing agent of the present invention can be administered by oral and nasal delivery. For example, drugs administered through these membranes have a rapid onset of action, provide therapeutic plasma levels, avoid the first-pass effect of hepatic metabolism, and avoid exposure of the drug to the hostile gastrointestinal (GI) environment. An additional advantage is that access to the membrane site is easy so that the drug can be easily applied, localized, and removed. In one embodiment, the RNA silencing agent administered by oral or nasal delivery is modified to be able to cross the blood-brain barrier.

[0480] In one embodiment, a unit dose or measured dose of a composition containing an RNA silencing agent is dispensed by an implanted device. This device can include a sensor for monitoring parameters in the subject's body. For example, the device can include a pump such as an osmotic pump and, optionally, associated electronics.

[0481] RNA silencing agents can be packaged in the natural capsids of viruses, or in artificial capsids produced chemically or enzymatically, or in structures derived therefrom. X. Kits

[0482] In certain other embodiments, the invention provides a kit comprising a suitable container containing a pharmaceutical formulation of an RNA silencing agent, such as a double-stranded RNA silencing agent, or an sRNA agent (e.g., a precursor, e.g., a larger RNA silencing agent that can be processed into an sRNA agent, or DNA encoding an RNA silencing agent, such as a double-stranded RNA silencing agent, or an sRNA agent, or a precursor thereof). In certain embodiments, the individual components of the pharmaceutical formulation can be provided in one container. Alternatively, it is desirable to divide the components of the pharmaceutical formulation into two or more containers, e.g., one container contains a preparation of the RNA silencing agent and at least one other container contains a carrier compound. The kit can be packaged in various configurations, such as placing one or more containers in one box. The various components can be combined, for example, according to instructions for use attached to the kit. The components can be combined, for example, according to the methods described herein for preparing and administering pharmaceutical compositions. The kit can include a delivery device.

[0483] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made without departing from the scope of the embodiments disclosed herein, using appropriate equivalents. Although specific embodiments have been described in detail heretofore, the same will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

Examples

[0484] Example 1. In vitro identification of hyper-functional ApoE target sequences 1.1 Identification of siRNAs targeting mouse ApoE that cause dose-dependent reduction in mRNA and protein The mouse ApoE gene was used as a target for mRNA knockdown. A panel of cholesterol-conjugated siRNAs targeting the mouse ApoE gene was developed and screened in primary mouse astrocytes in vitro compared to untreated control cells. The siRNAs were tested at a concentration of 1.5 μM each, and the mRNA was evaluated at the 72-hour time point using the QuantiGene gene expression assay (ThermoFisher, Waltham, MA). Figure 1A reports the results of the screen.

[0485] As shown in Figure 1B, for the hit compounds identified in the screen, dose-response curves and IC50 values were obtained, and 1134 and 1203 were selected for further study based on their high efficacy and potency.. Figure 1C shows the dose response of 1134 for protein silencing in primary mouse astrocytes evaluated after 1 week using the protein quantification assay of ProteinSimple (San Jose, CA). Table 1 below describes the two targets, 1134 and 1203.

Table 6

[0486] The human ApoE gene was used as a target for mRNA knockdown. A panel of siRNAs targeting the human ApoE gene was developed and screened in vitro in human HepG2 cells compared to untreated control cells. Each siRNA was tested at a concentration of 1.5 μM and mRNA was evaluated at 72 hours using the QuantiGene gene expression assay (ThermoFisher, Waltham, MA). Figure 2A reports the results of the screen, and 1156 and 1163 were selected for further study based on their high efficacy and potency. Next, as shown in Figure 2B, dose-response curves and IC50 values were obtained for the hit compounds from the screen. The following Table 2 describes 1156 and 1163, the two targets.

Table 7

[0487] A second screening of the human ApoE gene was performed using siRNAs with a methyl-rich chemical pattern in Figure 43 to test multiple target regions of the gene. Figure 44A reports the results of the screen, and as shown in Figure 44B, 64, 1125, 1129, 1133, 1139, and 1143 were selected for further study based on their high efficacy and potency. Next, as shown in Figure 44C, dose-response curves and IC50 values were obtained for the hit compounds from the screen (first column, left to right: 64, 1129, 1139; second column, left to right: 1125, 1133, 1143). The following Table 7 describes the target sequences.

Table 8

[0488] Figure 3A is a table showing the target sequences identified in the mouse and human ApoE genes and the antisense and sense sequences of oligonucleotides targeting such sequences. As shown in Figure 3B, the oligonucleotide sequences can be used with different chemical conjugates (e.g., GalNAc, CNS-siRNA, cholesterol) in the context of a number of chemical modifications (P2, P3, P2G, P3G). Also, this oligonucleotide can be used in the context of antisense oligonucleotide gene silencing. Example 2. In Vivo Efficacy of Tissue-Specific ApoE-Targeted siRNA in Mice 2.1 CNS-siRNA ApoE Silences the expression of mRNA and protein in the whole brain of mice 1 month after injection.

[0489] The first group of wild-type mice was administered 475 μg of di-siRNAApoE by ICV injection. The second control group was administered phosphate-buffered saline (PBS), and the third control group was administered di-siRNA NTC (non-targeting control). Each group included 6 mice. One month after injection, mRNA silencing was evaluated by QuantiGene in the entire brain region (Figure 4A), and protein silencing was evaluated by ProteinSimple (Figure 4B). Also, protein silencing in the whole brain was evaluated by Western blot (Figure 4C).

[0490] It can be seen that the novel siRNA sequences targeting ApoE show strong mRNA and protein silencing in vivo. Previous reports using oligonucleotides that silence ApoE used sequences that showed approximately 50% silencing of target mRNA and protein after ICV injection. Without being bound by a particular theory, due to the low degree of silencing, many of the conclusions obtained using previous sequences may be invalidated. On the other hand, the novel sequences represent a major advantage in studying the role of ApoE in neurodegeneration. 2.2 CNS-siRNAApoE silences ApoE protein in the hippocampus at low doses

[0491] Groups of wild-type mice were administered 475 μg, 237.5 μg, and 118.75 μg of di-siRNA, respectively ApoE One month after injection, protein silencing in the hippocampus was quantified and compared to control mice injected with PBS or NTC. As seen in the graph of Figure 5A and the Western blot of Figure 5B, the novel siRNA targeting ApoE shows protein silencing in vivo at low doses. Previous reports using oligonucleotides that silence ApoE used sequences that showed that after ICV injection of the oligonucleotide at a dose of approximately 400 μg, the target mRNA and protein were silenced by approximately 50%. 2.3 CNS-siRNA ApoE silences ApoE throughout the spinal cord at low doses

[0492] Figure 6A is the quantification of protein silencing in the spinal cord one month after injection. Doses of Di-siRNAApoE: 237.5 μg and 118.75 μg. Figure 6B is a Western blot (ProteinSimple) showing target ApoE (37 kDa) protein silencing compared to control vinculin (116 kDa). After ICV injection, ApoE 1134 silenced protein expression in all regions of the spinal cord (cervical, thoracic, lumbar). ApoE silencing in the spinal cord has not been shown previously. The ability to silence spinal cord ApoE has many implications for the treatment of spinal cord-related neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). 2.4 CNS-siRNA ApoE Brain-specific (non-hepatic) ApoE silencing with is possible at low doses

[0493] Figure 7A shows the quantification of protein silencing in the liver one month after injection. Doses of Di-siRNAApoE: 475 μg, 237.5 μg, and 118.75 μg. Figure 7B is a Western blot (ProteinSimple) showing target ApoE (37 kDa) protein silencing compared to control vinculin (116 kDa). In the dose response to ICV injection of CNS-ApoE, reduction of hepatic protein expression was shown after injection of 475 μg, but not after injection of 237.5 μg and 118.75 μg. Considering this data in conjunction with the silencing data in the brain and spinal cord following injection of 237.5 μg and 118.75 μg, this data further suggests that CNS-specific silencing of ApoE is achieved by siRNA. Furthermore, this data also suggests that the two pools of ApoE (CNS and systemic) do not affect each other. The remaining hepatic expression did not appear to replenish the silenced CNS (brain or spinal cord) ApoE. 2.5 GalNAc-siRNA ApoE silences protein expression in the liver but does not affect brain proteins

[0494] GalNAc conjugates targeting siRNA to hepatocytes of liver cells were synthesized and administered by subcutaneous injection to WT mice in an amount of 10 mg / kg. GalNAc-siRNA ApoE One month after injection of, protein silencing in the liver and hippocampus was quantified. Figure 8A is a Western blot (ProteinSimple) comparing ApoE protein silencing in the liver to control vinculin. Figure 8B is a Western blot (ProteinSimple) showing no effect on protein levels in the brain. Figure 8C is the quantification of protein silencing in the liver and brain. GalNAc-siRNA ApoEThe conjugate is found to potently silence ApoE expression in the liver but not affect ApoE expression in the brain. Without being bound to a particular theory, it appears that ApoE produced in the brain does not cross the blood-brain barrier to replenish the systemic ApoE pool even after systemic silencing. 2.6 Reducing hepatic ApoE increases serum cholesterol, but silencing CNS-ApoE alone does not increase serum cholesterol

[0495] A major concern in silencing ApoE as a treatment for Alzheimer's disease is its potential impact on systemic cholesterol metabolism. Mice with genetically removed ApoE develop high systemic cholesterol and aortic atherosclerosis. Tissue-specific regulation of ApoE in the CNS does not cause an increase in serum cholesterol, while systemic regulation shows a significant increase in cholesterol, particularly LDL. This level of discrimination of the effect of ApoE silencing on cholesterol has not been shown previously. Figure 9A shows the quantification of total serum cholesterol after silencing CNS ApoE. Figure 9B shows the quantification of total serum cholesterol after silencing systemic ApoE and the quantification of cholesterol in the LDL and HDL fractions after silencing systemic ApoE. 2.7 CNS and systemic ApoE represent two distinct protein pools

[0496] By using the ApoE sequences of the present application in combination with tissue-specific chemical conjugates, evidence was provided that there are two distinct pools of ApoE, namely CNS ApoE and systemic ApoE. Without being bound by a particular theory, the data suggest that the two pools of ApoE do not interact, do not affect each other's expression, and do not cross the blood-brain barrier. This allows us to hypothesize that one pool of ApoE (CNS or systemic) may affect the progression of neuropathology, while the other pool may have little or no effect. Figure 10A shows protein silencing in the brain and liver after injection of CNS-siRNA ApoE Figure 10B shows silencing in the brain (absent) and liver after injection of GalNAc-siRNA ApoE Figure 10B shows silencing in the brain (absent) and liver after injection of GalNAc-siRNA Example 3 Chemical Synthesis of Di-siRNAs and Vitamin D-Conjugated hsiRNAs

[0497] The di-siRNAs used for in vitro and in vivo efficacy evaluation were synthesized as follows. As shown in Figure 12, triethylene glycol was reacted with acrylonitrile to introduce a protected amine functionality. Next, a branching point was added as tosylated sorbitol ketal, followed by reduction of the nitrile to obtain a primary amine, which was then coupled to vitamin D (calcipherol) via a carbamate linker. Next, the ketal was hydrolyzed to release a cis-diol, which was selectively protected with a dimethoxytrityl (DMTr) protecting group at the primary hydroxyl, followed by succinylation with succinic anhydride. After binding the resulting moiety to a solid support, solid-phase oligonucleotide synthesis and deprotection were performed to obtain three products: VitD, a capped linker, and di-siRNA. Next, the synthetic products were analyzed as described in Example 6. Example 4 Alternative Synthetic Route 1

[0498] As shown in Figure 15A, the approach of the monophosphoramidate linker involves the following steps: Monoazidotetraethylene glycol has a branching point added as tosylated sorbitol ketal. Subsequently, the ketal is removed to release cis-diol, which is selectively protected with a dimethoxytrityl (DMTr) protecting group at the primary hydroxyl. Subsequently, the azide is reduced to a primary amine with triphenylphosphine, which is immediately protected with a monomethoxytrityl (MMTr) protecting group. The remaining hydroxyls are succinylated with succinic anhydride and coupled to a solid support (LCAA CPG). By synthesis and deprotection of the oligonucleotide, a single major product, di-siRNA with phosphate and phosphoramidate linkages, was obtained. In this example, an alternative direct synthetic route that produces only phosphate and phosphoramidate linkers is introduced. Example 5 Alternative Synthetic Route 2

[0499] To create a diphosphate-containing moiety, a second alternative synthetic approach was developed. As shown in Figure 15B, the approach of the diphosphonate linker involves the following steps: Starting from sorbitol ketal-modified tetraethylene glycol, the ketal is removed and the two primary hydroxyls are selectively protected with dimethoxytrityl (DMTr). The remaining hydroxyls are elongated with silyl-protected 1-bromoethanol. TBDMS is removed, succinylated, and coupled to a solid support. Subsequently, solid-phase oligonucleotide synthesis and deprotection are performed to generate di-siRNA with a diphosphate-containing linker. Example 6 Quality Control of Chemical Synthesis of Di-siRNA and Vitamin D-Conjugated hsiRNA HPLC

[0500] To evaluate the quality of the chemical synthesis of Di-siRNA and vitamin D-conjugated hsiRNA, the synthesized products were identified and quantified using analytical HPLC. Three major products were identified: the siRNA sense strand capped with a triethylene glycol (TEG) linker, Di-siRNA, and the vitamin D-conjugated siRNA sense strand (Figure 13). Each product was isolated by HPLC and used in subsequent experiments. The chemical structures of the three major synthesized products are shown in Figure 13. HPLC conditions included: 5 - 80% B over 15 minutes, buffer A (0.1 M TEAA + 5% ACN), buffer B (100% ACN). Mass spectrometry

[0501] Furthermore, quality control was performed by mass spectrometry to confirm the identity of the Di-siRNA complex. The product was observed to have a mass of 11683 m / z, which corresponds to two sense strands of siRNA linked at the 3'-end via the TEG linker (Figure 14). In this particular example, the sense strands of siRNA were designed to target the huntingtin gene (Htt). Using the chemical synthesis method summarized in Example 5, the desired product of the di-branched siRNA complex targeting the huntingtin gene was successfully generated. LC-MS conditions included: 0 - 100% B over 7 minutes, 0.6 mL / min., buffer A (25 mM HFIP, 15 mM DBA in 20% MeOH), buffer B (MeOH containing 20% buffer A). Example 7 Incorporation of a hydrophobic moiety in a branched oligonucleotide structure: Strategy 1

[0502] In one example, a short hydrophobic alkylene or alkane (Hy) having an unprotected hydroxyl group (or amine) that can be phosphorylated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phosphitylation reagent) is used to generate the corresponding lipophilic phosphoramidite. These lipophilic phosphoramidites can be added to the terminal positions of branched oligonucleotides using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 29. Example 8 Incorporation of Hydrophobic Moieties in Branched Oligonucleotide Structures: Strategy 2

[0503] In another example, a short / small aromatic planar molecule (Hy) having an unprotected hydroxyl group (or amine) with or without a positive charge that can be phosphitylated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phosphitylation reagent) is used to generate the corresponding aromatic hydrophobic phosphoramidite. The aromatic moiety can have a positive charge. These lipophilic phosphoramidites can be added to the terminal positions of branched oligonucleotides using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 30. Example 9 Incorporation of Hydrophobic Moieties in Branched Oligonucleotide Structures: Strategy 3

[0504] To introduce a biologically important hydrophobic moiety, short lipophilic peptides are created by sequential peptide synthesis either on a solid support or in solution (the latter is described herein). The short (1-10) amino acid chain can contain a positively charged or polar amino acid moiety, because the positive charge reduces the overall net charge of the oligonucleotide and thus increases hydrophobicity. Once a peptide of appropriate length has been created, it should be capped with acetic anhydride or another short fatty acid to increase hydrophobicity and mask free amines. Thereafter, the carbonyl protecting group is removed to allow attachment of 3-aminopropan-1-ol and phosphorylation of the free hydroxyl (or amine). This amino acid phosphoramidite can then be added to the terminal 5' position of a branched oligonucleotide using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 31. Example 10 Silencing of ApoE in Neurodegeneration

[0505] Table 6 summarizes models of transgenic mice that mimic a range of pathologies associated with Alzheimer's disease. None of the models fully recapitulate human disease, but the models provide significant insight into the pathophysiology of β-amyloid toxicity: [Table 9]

[0506] To evaluate the effect of ApoE silencing on neurodegenerative disease, APP / PSEN1 mice at 8 weeks of age were injected ICV with di-siRNA ApoE or di-siRNA NTC (5 females and 5 males per group). A second group (n = 7 per group) was injected subcutaneously at 8 weeks of age with GalNAc ApoE and GalNAc NTC . The animals were euthanized at 4 months of age, 2 months after injection. In the di-siRNA NTC female group, there were 4 cases, in the di-siRNA ApoE female group, there was 1 case, in the di-siRNA NTCIn the male group, there was 1 case of di-siRNA ApoE In the male group, 1 case of death was observed. GalNAc NTC In the group, there were 3 cases, GalNAc ApoE In the group, 1 case of death was observed. All deaths were due to natural causes of the pathology of the animal model and occurred at least 1 month after injection.

[0507] Figure 34 is a chart reporting mRNA silencing in all regions of the brain 2 months after injection in APP / PSEN1 AD mice (2 - 5 females and 5 males per group, 237 μg / injection). Also, strong silencing was observed in all regions of the brain. These results indicate that the nucleic acid of the present application provides significant advantages in studying the role of ApoE in neurodegeneration. As shown in the chart of Figure 35, the novel siRNA targeting either the brain (di-siRNA ApoE ) or the liver (GalNAc-siRNA ApoE ) shows strong target-specific mRNA silencing in the target tissue 2 months after ICV injection. Also, strong target-specific protein silencing was observed (Figure 36). The raw Western blot in Figure 37 shows ApoE protein expression in the hippocampus, cortex, and liver after injecting di-siRNA NTC , di-siRNA ApoE , GalNAc NTC , or GalNAc ApoE by ICV or SC.

[0508] The disappearance of the second band indicating ApoE protein shows strong silencing compared to the NTC control group. In summary, the evidence indicates that in the APP / PSEN1 model of Alzheimer's disease, there are two different pools of ApoE, CNS ApoE and systemic ApoE. This data suggests that the two pools of ApoE do not interact with each other, do not affect each other's expression, and do not cross the blood-brain barrier. This data supports the hypothesis that one pool of ApoE (CNS or systemic) can affect the progression of neuropathology, while the other pool has little or no effect.

[0509] Cerebral cortex tissue slices with a thickness of 40 μm (4 slices per animal) were stained with a standard immunofluorescence protocol using anti-APP 6E10 antibody and anti-Lamp1 antibody. Tiled images (10x) were taken with a Leica microscope. As shown in Figure 38, di-siRNA ApoE In the treated animals, di-siRNA NTC A visual reduction in β-amyloid and Lamp1-positive plaques was observed compared to the treated animals. This reduction was statistically significant as shown in the graph of Figure 39.

[0510] Since a worsening of the phenotype has been observed in female mice in the past, di-siRNA NTC Between the treated mice and di-siRNA ApoE Sex-specific analysis was performed between the treated mice. As reported in Figure 40, significant differences were observed between both the female and male groups, although the differences in female mice appeared to be more dramatic. Also, the data reported in Figure 41 indicate that sex did not affect the efficacy of silencing.

[0511] In previous reports using oligonucleotides for silencing of human ApoE, sequences showing approximately 50% silencing of the target mRNA and protein were used after an ICV injection of about 400 μg. On the other hand, for the novel di-siRNA ApoE 1156, approximately 80 - 90% protein silencing was found in the hippocampus (Figure 42A) and spinal cord (Figure 42B) one month after injection of 237 μg.

[0512] Additional cortical staining was performed to show a reduction in neuropathology after administration of di-siRNA ApoE 1156. Pathological amyloid β-42 was measured in female and male mice, and a reduction in amyloid β-42 content was observed (Figure 45). Furthermore, protein aggregates in the mouse cerebral cortex were imaged using X-34 staining. Di-siRNA ApoEIn addition, a reduction in X-34 positive plaques was also observed compared to the control (Figures 46A and 46B). When comparing the number of APP6E10 and LAMP1 positive plaques in the mouse cortex, no effect was observed with GalNAc-conjugated APOE siRNA, indicating that the ApoE format is important for neuropathology reduction (Figure 46C).

[0513] di-siRNA ApoE To demonstrate that di-siRNA ApoE does not affect serum cholesterol, di-siRNA ApoE was injected into the APP / PSEN1 mouse model and compared with GalNAc-conjugated APOE siRNA. Di-siRNA ApoE was injected at 237 μg via bilateral ICV. Two months after injection, the levels of LDL and HDL were measured. These results were compared with the case when GalNAc-conjugated siRNA was injected subcutaneously at 10 mg / kg. As shown in Figure 47, di-siRNA

[0514] di-siRNA ApoE 1156 was further tested in a transgenic mouse model of Alzheimer's disease (3xTg-AD) over a 4-month period to demonstrate long-term silencing of APOE in the central nervous system. Di-siRNA ApoE was injected into 3xTg-AD mice at 237 μg, and the APOE protein level was measured 4 months after injection. As shown in Figures 48A and 48B, di-siRNA ApoE strongly inhibited APOE in the hippocampus and cortex even 4 months after injection.

[0515] Additional APOE targets were tested in a pattern rich in 2'-O-methyl as shown in Figure 43. Di-siRNA ApoE1133 was injected, and the APOE protein level was measured one month after the injection. As shown in FIGS. 49A and 49B, the di-siRNA ApoE 1133 strongly inhibited APOE in the hippocampus and cortex.

[0516] To further demonstrate the effectiveness of the ApoE siRNA of the present invention, 25 mg of di-siRNA was administered to non-human primates (NHPs) ApoE 1133 was injected into the large tank. Two months after the injection, the accumulation amount of the di-siRNA ApoE 1133 guide strand was measured in several regions of the posterior cortex and cerebellum. As shown in FIG. 50, a high level of siRNA accumulated in the sample tissues, and the average accumulation amount was 20 μg siRNA / gram of tissue. Incorporation by reference

[0517] The content of all reference documents (including documents, patents, patent applications, websites, etc.) that may be cited throughout this application is hereby expressly incorporated by reference in its entirety for all purposes, in the same manner as the documents cited therein. In the present disclosure, unless otherwise indicated, conventional techniques in immunology, molecular biology, and cell biology well known in the art are employed.

[0518] In addition, the present disclosure incorporates by reference in its entirety techniques well known in the fields of molecular biology and drug delivery. These techniques include, but are not limited to, the techniques described in the following publications: Atwell et al. J. Mol. Biol. 1997, 270: 26-35; Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley &Sons, NY (1993); Ausubel, F.M. et al. eds., Short Protocols In Molecular Biology (4th Ed. 1999) John Wiley & Sons, NY. (ISBN 0-471-32938-X); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Giege, R. and Ducruix, A. Barrett, Crystallization of Nucleic Acids and Proteins, a Practical Approach, 2nd ea., pp. 20 1-16, Oxford University Press, New York, New York, (1999); Goodson, in Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981; Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991); Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Kontermann and Dubel eds., Antibody Engineering (2001) Springer-Verlag. New York. 790 pp. (ISBN 3-540-41354-5). Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); Lu and Weiner eds., Cloning and Expression Vectors for Gene Function Analysis (2001) BioTechniques Press. Westborough, MA. 298 pp. (ISBN 1-881299-21-X). Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Old, R.W. & S.B. Primrose, Principles of Gene Manipulation: An Introduction To Genetic Engineering (3d Ed. 1985) Blackwell Scientific Publications, Boston. Studies in Microbiology; V.2:409 pp. (ISBN 0-632-01318-4). Sambrook, J. et al. eds., Molecular Cloning: A Laboratory Manual (2d Ed. 1989) Cold Spring Harbor Laboratory Press, NY. Vols. 1-3. (ISBN 0-87969-309-6). Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978 Winnacker, E.L. From Genes To Clones: Introduction To Gene Technology (1987) VCH Publishers, NY (translated by Horst Ibelgaufts). 634 pp. (ISBN 0-89573-614-4). Equivalent

[0519] The present disclosure can be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the foregoing embodiments are considered to be illustrative rather than restrictive in all respects. The scope of the present disclosure is thus indicated by the appended claims rather than by the foregoing description, and all modifications that fall within the meaning and scope of equivalence of the claims are intended to be included herein. Furthermore, the present invention includes the following aspects. 1. An RNA molecule 15-35 bases in length, comprising a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. 2. The RNA molecule according to item 1, comprising a complementary region substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'. 3. The RNA molecule according to item 1 or 2, comprising single-stranded (ss) RNA or double-stranded (ds) RNA. 4. The dsRNA according to item 3, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. 5. The dsRNA molecule according to item 3 or 4, wherein the RNA molecule is 15-25 base pairs in length. 6. The dsRNA according to any one of items 3 to 5, wherein the complementary region is complementary to at least 10, 11, 12 or 13 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. 7. The dsRNA according to any one of items 3 to 6, wherein the complementary region contains 3 or fewer mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. 8. The dsRNA according to any one of items 3 to 7, wherein the complementary region is completely complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. 9. The dsRNA according to any one of items 3 to 9, which has blunt ends. 10. The dsRNA according to any one of items 3 to 9, which contains at least one single-stranded nucleotide overhang. 11. The dsRNA according to any one of items 3 to 10, which contains naturally occurring nucleotides. 12. The dsRNA according to any one of items 3 to 11, which contains at least one modified nucleotide. 13. The dsRNA according to item 12, wherein the modified nucleotide contains a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, or a terminal nucleotide conjugated to a cholesteryl derivative or a bisdecylamide group of dodecanoic acid. 14. The dsRNA of item 12, wherein the modified nucleotide contains a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, a abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing an unnatural base. 15. The dsRNA according to any one of items 3 to 14, which contains at least one 2'-O-methyl modified nucleotide and at least one nucleotide containing a 5' phosphorothioate group. 16. The dsRNA according to any one of items 3 to 15, at least 80% of which is chemically modified. 17. The dsRNA according to any one of items 3 to 10 and 12 to 16, which is completely chemically modified. 18. The dsRNA according to any one of items 3 to 17, which contains a cholesterol moiety. 19. An RNA molecule according to any one of items 1 to 18, which has a 5'-end and a 3'-end and is complementary to a target, (1) the RNA molecule alternately contains 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5'-end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) the nucleotides at positions 1 to 2 to 1 to 7 from the 3'-end are linked to adjacent nucleotides via phosphorothioate bonds, said RNA molecule. 20. A dsRNA according to any one of items 3 to 18, which has a 5'-end and a 3'-end, is complementary to a target, and contains a first oligonucleotide and a second oligonucleotide, (1) the first oligonucleotide contains a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a part of the first oligonucleotide is complementary to a part of the second oligonucleotide; (3) the second oligonucleotide alternately contains 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3'-end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds, said dsRNA. 21. An RNA molecule according to any one of items 1 to 18, which has a 5'-end and a 3'-end and is complementary to a target, (1) the RNA molecule contains a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5'-end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; (4) The nucleotides at positions 1 to 7 counted from the 3'-end and positions 1 to 2 counted from the 3'-end are linked to the adjacent nucleotides via phosphorothioate linkages; and, (5) The nucleotides at positions 1 to 2 counted from the 5'-end of the RNA molecule are linked via phosphorothioate linkages. 22. A dsRNA according to any one of items 3 to 17, having a 5'-end and a 3'-end, having complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, wherein (1) The first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) A part of the first oligonucleotide is complementary to a part of the second oligonucleotide; (3) The second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) The nucleotides at positions 2 and 14 counted from the 3'-end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and, (5) The nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages. 23. The RNA according to item 20 or 22, wherein a hydrophobic molecule is bound to the 3'-end of the second oligonucleotide. 24. The RNA according to any one of items 20, 22, and 23, wherein the bond between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol. 25. The RNA according to any one of items 20 and 22 to 24, wherein the nucleotides at positions 1 and 2 counted from the 3'-end of the second oligonucleotide are linked to the adjacent nucleotides via phosphorothioate linkages. 26. The RNA according to any one of items 20 and 22 to 25, wherein the nucleotides at positions 1 and 2 counted from the 3'-end of the second oligonucleotide and the nucleotides at positions 1 and 2 counted from the 5'-end of the second oligonucleotide are linked to the adjacent ribonucleotides via phosphorothioate linkages. 27. A pharmaceutical composition comprising the RNA according to any one of items 1 to 26 for inhibiting the expression of apolipoprotein E (ApoE) gene in an organism, and a pharmaceutically acceptable carrier. 28. The pharmaceutical composition according to item 27, wherein the dsRNA inhibits the expression of the ApoE gene...

Claims

1. A di-branched RNA compound comprising two double-stranded RNA (dsRNA) molecules each containing a sense strand and an antisense strand that are each 15 to 35 bases in length, each dsRNA molecule contains a complementary region that is complementary to apolipoprotein E (ApoE) mRNA, where the complementary region is complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', the two dsRNA molecules are covalently bonded to each other, the di-branched RNA compound.

2. The di-branched RNA compound according to claim 1, wherein the two dsRNA molecules are covalently bonded to each other by one or more moieties including a linker, a spacer, or a branch point.

3. Formula (I): 【Chemical 1】 [wherein, L includes an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, phosphate, phosphonate, phosphoramidate, ester, amide, triazole, or a combination thereof, where formula (I) may further include one or more branch points B and one or more spacers S (where, the one or more branch points B are each independently, upon each occurrence, a polyvalent organic species or a derivative thereof; the one or more spacers S are each independently, upon each occurrence, an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, phosphate, phosphonate, phosphoramidate, ester, amide, triazole, or a combination thereof); N is a double-stranded RNA (dsRNA) molecule containing a sense strand and an antisense strand that are each 15 to 35 bases in length, where, the antisense strand contains a complementary region that is complementary to apolipoprotein E (ApoE) mRNA, where the complementary region is 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; the sense strand and the antisense strand each independently contain one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8] The compound represented by.

4. Structures selected from the group consisting of formulas (I-1) to (I-9): 【Table 1】 The compound according to claim 3, having a structure selected from the group consisting of.

5. where L is structural L1: 【Chemical 2】 and the antisense strand contains a 5' terminal group R which is [Chemical Formula 3] and n is 2, the compound according to claim 4.

6. A double-stranded RNA (dsRNA) molecule: where the dsRNA molecule comprises a sense strand and an antisense strand that are 15 to 35 bases in length, the dsRNA molecule comprises a complementary region that is complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions that are complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3']] A medicament for treating or managing a neurodegenerative disease, comprising a therapeutically effective amount of the dsRNA molecule is administered to a patient in need of such treatment or management.

7. The di-branched RNA compound according to claim 1, wherein the dsRNA molecule comprises one or more complementary regions that are complementary to 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

8. The medicament according to claim 6, wherein the dsRNA molecule is administered to the brain of a patient.

9. A vector for inhibiting the expression of the apolipoprotein E (ApoE) gene intracellularly, the vector comprising a regulatory sequence operably linked to a nucleotide sequence encoding a dsRNA molecule [where the dsRNA molecule comprises a sense strand and an antisense strand that are 15 to 35 bases in length, and the dsRNA molecule comprises a complementary region that is complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions that are complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3'], wherein when the dsRNA molecule contacts a cell expressing the ApoE gene, the vector inhibits the expression of the ApoE gene by at least 50% or at least 90%.

10. A cell comprising the vector according to claim 9.

11. A pharmaceutical composition for inhibiting the expression of apolipoprotein E (ApoE) gene in a living organism, comprising the di-branched RNA compound according to any one of claims 1, 2 and 7, the compound according to any one of claims 3 to 5, or a dsRNA molecule [wherein the dsRNA molecule comprises a sense strand and an antisense strand each having a length of 15 to 35 bases, and the dsRNA molecule comprises a complementary region complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3'], and a pharmaceutically acceptable carrier.

12. A pharmaceutical composition for use in the treatment or management of a disease, comprising the di-branched RNA compound according to any one of claims 1, 2 and 7, the compound according to any one of claims 3 to 5, or a dsRNA molecule [wherein the dsRNA molecule comprises a sense strand and an antisense strand each having a length of 15 to 35 bases, and the dsRNA molecule comprises a complementary region complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3'], wherein the disease is a neurodegenerative disease, and a therapeutically effective amount of the pharmaceutical composition is administered to a patient in need of such treatment or management.

13. A method for inhibiting the expression of apolipoprotein E (ApoE) gene intracellularly in vitro, a. Introducing into a cell a di-branched RNA compound according to any one of claims 1, 2 and 7, a compound or a dsRNA molecule according to any one of claims 3 to 5 [wherein the dsRNA molecule comprises a sense strand and an antisense strand 15 to 35 bases in length, and the dsRNA molecule comprises a complementary region complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3]; and b. Maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ApoE gene, thereby inhibiting the expression of the ApoE gene in the cell. A method comprising the steps of:

14. The pharmaceutical according to claim 6, wherein the dsRNA molecule has blunt ends.

15. The method according to claim 13, wherein the dsRNA molecule has blunt ends.

16. A pharmaceutical composition for use in the treatment or management of a neurodegenerative disease, comprising a di-branched RNA compound according to any one of claims 1, 2 and 7, a compound according to any one of claims 3 to 5, or a dsRNA molecule [wherein the dsRNA molecule comprises a sense strand and an antisense strand 15 to 35 bases in length, and the dsRNA molecule comprises a complementary region complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3], A pharmaceutical composition, wherein the neurodegenerative disease is characterized by at least one of the following features: a. The neurodegenerative disease is an amyloid-related disease; and / or b. The neurodegenerative disease is selected from the group consisting of Alzheimer's disease, cerebral amyloid angiopathy, mild cognitive impairment, moderate cognitive impairment, and combinations thereof.

17. A pharmaceutical composition for treating or managing a neurodegenerative disease, comprising a di-branched RNA compound according to any one of claims 1, 2 and 7, a compound according to any one of claims 3 to 5, or a dsRNA molecule [wherein the dsRNA molecule comprises a sense strand and an antisense strand 15 to 35 bases in length, and the dsRNA molecule comprises a complementary region complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'; or the dsRNA molecule comprises one or more complementary regions complementary to 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAAA 3'], wherein the neurodegenerative disease is an amyloid-related disease; and / or the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, cerebral amyloid angiopathy, mild cognitive impairment, moderate cognitive impairment, and combinations thereof, and the pharmaceutical composition is administered to the brain of a patient.

Citation Information

Patent Citations

  • Functional siRNA and hyperfunctional siRNA

    JP2006507841A

  • Treatment of Alzheimer's disease by inhibitors of apoe binding to apoe receptors

    JP2009531299A

  • Compositions that inhibit gene expression and their use

    JP2013507905A

  • Compositions and methods for regulating gene expression

    JP2015518714A

  • Cells expressing apolipoprotein E and uses thereof

    JP2017534255A