Method for inducing plant resistance, plant resistance inducer, and biostimulant
By using a low molecular weight compound to activate both the SA and JA/ET signal transduction systems, this method induces robust plant resistance against various pathogens, addressing the limitations of current resistance inducers and achieving effective control with minimal environmental impact.
Patent Information
- Application Number
- JP2023507113
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-03-19
- Filing Date
- 2022-03-14
- Publication Date
- 2025-06-05
- Estimated Expiration
- 2042-03-14
AI Technical Summary
Current resistance inducers primarily target the salicylic acid (SA) signal transduction system, offering limited effectiveness against necrotrophic pathogens, and no low-molecular-weight compounds have been found to effectively induce the Jasmonic Acid (JA)/Ethylene (ET) signal transduction system for commercial use.
A method involving a low molecular weight compound that activates both the salicylic acid signal transduction system and the jasmonic acid and/or ethylene signal transduction system, thereby inducing robust plant resistance against both biotrophic and necrotrophic fungi.
This approach achieves excellent resistance induction activity, comparable or superior to existing resistance inducers, by activating multiple plant hormone pathways, thereby providing effective control against a wide range of pathogens without promoting drug-resistant bacteria.
Smart Images

Figure 0007688943000011 
Figure 0007688943000012 
Figure 0007688943000013
Abstract
Description
Technical Field
[0001] The present invention relates to a method for inducing plant resistance, a plant resistance inducer, and a biostimulant. This application claims priority based on Japanese Patent Application No. 2021-046236 filed in Japan on March 19, 2021, and incorporates its content herein by reference.
Background Art
[0002] Plants are attacked by various pathogenic microorganisms such as filamentous fungi, bacteria, and viruses. To counter them, plants have developed defense mechanisms. The defense mechanisms have various stages. First, at the stage before the pathogen invades, physical barriers such as cell walls and the opening and closing of leaf stomata prevent pathogen invasion. Even after the pathogen has invaded, plant cells recognize the pathogen invasion and have a mechanism to inhibit the progression of infection by accumulating polysaccharides at the invasion site. Furthermore, plants have a mechanism to enhance resistance not only at the infection site of the pathogen but also systemically by transmitting signals from the infected site to the whole body. This mechanism involves plant hormones and the expression of a large number of genes.
[0003] Figure 1 is a diagram for explaining the signal transduction pathway related to the induction of plant resistance. As a mechanism for inducing resistance systemically, there is Systemic Acquired Resistance (SAR) in which the plant hormone salicylic acid (SA) is involved in signal transduction, and research has been progressing in recent years. It has been clarified that the defense response by SAR can counter a wide range of pathogens to enhance the disease resistance of the plant itself.
[0004] SA is mainly known to induce resistance against "biotrophic pathogens", which are pathogens that take nutrients from living cells. Biotrophic pathogens often absorb nutrients from plant cells and coexist with plants. Examples of biotrophic pathogens include Magnaporthe oryzae and Colletotrichum spp.
[0005] Compounds having the activity of inducing SAR are put into practical use as resistance inducers or plant activators, and are mainly utilized as effective materials for controlling rice diseases in our country. In the case of probenazole (PBZ, trade name: OriseMate), although more than 40 years have passed since its development, it still has an annual sales volume of about 10 billion yen. In addition to probenazole, there are multiple resistance inducers or plant activators having the activity of inducing SAR, such as acibenzolar-S-methyl (ASM), validamycin A (VMA), benzothiadiazole (BTH), thiazinyl (TDL), isothianyl, etc.
[0006] On the other hand, the mechanism of disease resistance expression that works through a different mechanism of action from SAR is also known. Induced Systemic Resistance (ISR) is known to be induced by a disease resistance expression pathway that depends on jasmonic acid (JA), a plant hormone, and does not depend on SA unlike SAR (see Figure 1). In ISR, it has been found that the induced defense response genes and the types of pathogens effective as resistance targets are also different from those of SAR.
[0007] JA mainly induces resistance to "necrotrophic pathogens" (also called "saprophytic fungi"), which are pathogens that obtain nutrients from dead cells, and defense responses to "injuries" such as damage caused by pests. A typical necrotrophic pathogen is Botrytis cinerea. Botrytis cinerea infects almost all plants and is very likely to generate drug-resistant bacteria. However, compounds having the activity of inducing SAR have poor control effects against necrotrophic pathogens, and existing plant activators such as probenazole are ineffective against necrotrophic pathogens such as Botrytis cinerea.
[0008] Therefore, if there are compounds having the activity of inducing the ISR system, they may be utilized as novel pest control materials that are effective against types of diseases that cannot be addressed by existing SAR system resistance inducers. However, in previous studies, no low-molecular-weight compounds having such activity to a commercially available extent have been found. Bestatin has been reported to be a compound that specifically activates the JA signal (Non-Patent Document 1).
[0009] In addition to the JA signal transduction system, a pathway for the expression of disease resistance that depends on the plant hormone ethylene (ET) is known, and like JA, it induces a defense response against "necrotrophic fungi". So far, hexanoic acid, arachidonic acid, N-acylamide (alkamide), etc. are known as compounds that induce the activation of defense activity by the JA / ET signal transduction system (Non-Patent Documents 2 to 4). It has been shown using Arabidopsis thaliana that all of these induce the expression of JA-responsive genes including PDF1.2 and VSP2 and are effective in suppressing the lesion formation of Botrytis cinerea. Also, in the treatment with hexanoic acid and arachidonic acid, suppression of lesion formation has similarly been observed in tomatoes (Non-Patent Document 5). This indicates that JA-based resistance inducers are effective in controlling gray mold. However, these drugs also have problems such as the need for high-concentration treatment.
[0010] Since resistance inducers act on plants and have no bactericidal activity themselves, drug-resistant bacteria are less likely to appear, and they have attracted attention in recent years as drugs with a low environmental load. However, currently, the resistance inducers that have been put into practical use are only PBZ, ASM, etc. that act on the SA signal transduction system, and no resistance inducers that act on the JA / ET signal transduction system have been put into practical use.
[0011] Based on the inventors' previous studies, a resistance inducer that acts on the SA signal transduction system (Patent Document 1) and a resistance inducer that acts on the JA signal transduction system (Patent Document 2) have been provided.
Prior Art Documents
Patent Documents
[0012] [Patent Document 1] Japanese Unexamined Patent Application Publication No. 2017-197456 [Patent Document 2] International Publication No. 2016 / 006351 [Non-Patent Document]
[0013] [Non-Patent Document 1] Zheng W, Zhai Q, Sun J, Li CB, Zhang L, Li H, Zhang X, Li S, Xu Y, Jiang H, Wu X, Li C. Bestatin, an inhibitor of aminopeptidases, provides a chemical genetics approach to dissect jasmonate signaling in Arabidopsis. Plant Physiol. (2006) 141, 1400-1413. [Non-Patent Document 2] Kravchuk Z, Vicedo B, Flors V, Camanes G, Gonzalez-Bosch C, Garcia-Agustin P (2011) Priming for JA-dependent defenses using hexanoic acid is an effective mechanism to protect Arabidopsis against B. cinerea. J Plant Physiol 168: 359-366 [Non-Patent Document 3] Mendez-Bravo A, Calderon-Vazquez C, Ibarra-Laclette E, Raya-Gonzalez J, Ramirez-Chavez E, Molina-Torres J, Guevara-Garcia AA, Lopez-Bucio J, Herrera-Estrella L (2011) Alkamides activate jasmonic acid biosynthesis and signaling pathways and confer resistance to Botrytis cinerea in Arabidopsis thaliana. PLoS One 6 e27251
Non-Patent Document 4
Non-Patent Document 5
Summary of the Invention
Problems to be Solved by the Invention
[0014] As described above, although a plurality of compounds that activate JA signals have been reported, they have not been put into practical use. In addition, since the JA / ET signal transduction system is usually suppressed by activating the SA signal transduction system, a resistance inducer having excellent plant resistance induction control activity that activates both the SA signal transduction system and the JA / ET signal transduction system is not known. The present invention has been made in view of the above circumstances, and an object thereof is to provide a method for inducing plant resistance having excellent plant resistance induction activity and a plant resistance inducer. Another object of the present invention is to provide a biostimulant.
Means for Solving the Problems
[0015] As a result of intensive studies to solve the above problems, the present inventors have found that it is possible to activate both the SA signal transduction system and the JA / ET signal transduction system, and thereby it is possible to induce extremely excellent resistance, and have completed the present invention. That is, the present invention has the following aspects.
[0016] [1] A method for inducing plant resistance, comprising: applying a plant resistance inducer to a plant to activate the salicylic acid signal transduction system and the jasmonic acid and / or ethylene signal transduction system, wherein the active ingredient of the plant resistance inducer is a low molecular weight compound, and one kind of the active ingredient activates the salicylic acid signal transduction system and the jasmonic acid and / or the ethylene signal transduction system. [2] The method according to [1], wherein the plant resistance inducer contains, as an active ingredient, a compound represented by the following general formula (1) or a salt thereof.
Chemical formula
Chemical formula
Chemical formula
Advantages of the Invention
[0017] According to the present invention, a method for inducing plant resistance excellent in plant resistance induction activity and a plant resistance inducer can be provided. In addition, according to the present invention, a biostimulant can be provided.
Brief Description of the Drawings
[0018]
Figure 1
Figure 2
Figure 3
Figure 4A
Figure 4B
Figure 5
Figure 6
Figure 7A
Figure 7B
Figure 8A
Figure 8B
Figure 9A
Figure 9B
Figure 10A
Figure 10B
Modes for Carrying Out the Invention
[0019] Hereinafter, embodiments of the method for inducing plant resistance, the plant resistance inducer, and the biostimulant of the present invention will be described.
[0020] ≪Method for Inducing Plant Resistance≫ The method for inducing plant resistance according to the embodiment is a method for inducing plant resistance, which includes applying a plant resistance inducer to a plant to activate the salicylic acid signal transduction system and the jasmonic acid and / or ethylene signal transduction system. The active ingredient of the plant resistance inducer is a low molecular weight compound, and one kind of the active ingredient activates the salicylic acid signal transduction system and the jasmonic acid and / or ethylene signal transduction system.
[0021] According to the classification of the mode of action of fungicides by the FRAC: Fungicide Resistance Action Committee, plant resistance inducers are classified as "P induction of host plant resistance". This is clearly distinguished from general fungicides (including bactericides) that act on the biosynthetic pathway on the pathogen side. Resistance inducers have no bactericidal activity by themselves. Therefore, there is an advantage that drug-resistant bacteria are less likely to appear. Note that what is presented as the above classification of resistance inducers is only the salicylic acid signal transduction. Hereinafter, the plant resistance inducer may be simply referred to as "resistance inducer".
[0022] Figure 1 is a diagram for explaining the signal transduction pathway related to the induction of plant resistance. As shown in Figure 1, the salicylic acid signal transduction system (also referred to as the "SA system") includes a signal transduction pathway that follows from SA to NPR1 gene expression and PR1 gene expression. The SA system can induce resistance to biotrophic fungi.
[0023] The jasmonic acid signal transduction system (also referred to as the "JA system") includes a signal transduction pathway that follows from JA to JAR1 gene expression and VSP1 gene expression. The JA system can induce resistance to necrotrophic fungi and / or stress responses. Examples of stress responses include pest resistance and drought tolerance.
[0024] The ethylene signal transduction system (also referred to as the "ET system") includes a signal transduction pathway that follows from ET to EIN2 gene expression and PDF1.2 gene expression. The ET system can induce resistance to necrotrophic fungi. Since the signal from JAR1 also induces PDF1.2 gene expression, jasmonic acid can activate the JA system and / or the ET system.
[0025] On the one hand, it has been widely known that the JA system and the SA system have been in an antagonistic relationship. It has not been known that both of them can be activated by a resistance inducer to induce resistance.
[0026] However, according to the method of the embodiment, by applying one kind of active ingredient, the SA system, as well as the JA system and / or the ET system can be activated, and this finding overrides the conventional concept of resistance induction.
[0027] According to the method of the embodiment, compared with ASM and PBZ, which are typical resistance inducers that activate only the SA system, equivalent or higher resistance induction activity can be exhibited. This excellent effect is presumably achieved by a novel mechanism of action that activates the SA system, as well as the JA system and / or the ET system. And according to the method of the embodiment, at least one kind of active ingredient can activate the SA system, as well as the JA system and / or the ET system.
[0028] The reason why it is possible to activate the SA system, as well as the JA system and / or the ET system, is not necessarily clear. However, in the examples described later, since the JA system is activated initially and the SA system is activated later, it is presumed that even in the resistance induction pathways that are in an antagonistic relationship, activation can be achieved with a time difference.
[0029] Among the resistances in plants, the expression of disease resistance can be determined by, for example, any one or more of the following indicators "1" to "2". "1" Using the expression of a gene whose expression is induced in the SA system, the JA system, or the ET system as an indicator, comparing a plant treated with a resistance inducer with a non-treated plant (control plant), when the expression of the gene is significantly improved in the plant treated with the resistance inducer, the expression of disease resistance can be determined. The expression of resistance to biotrophic fungi can be indicated by the expression of a gene whose expression is induced in the SA system. The expression of resistance to necrotrophic fungi can be measured by the expression of genes whose expression is induced in the JA pathway and / or the ET pathway. Using "2" the degree of the state of a plant disease as an indicator, comparing a plant treated with a resistance inducer with a plant not treated (control plant), when the disease state of the plant treated with the resistance inducer is significantly improved, the expression of disease resistance can be determined.
[0030] The expression of pest resistance in a plant can be determined by, for example, any one or more of the following "3" to "5" indicators. Using "3" the expression of a gene whose expression is induced in the JA pathway as an indicator, comparing a plant treated with a resistance inducer with a plant not treated (control plant), when the expression of the gene is significantly increased in the plant treated with the resistance inducer, the expression of pest resistance can be determined. Using "4" the degree of the state of feeding damage to the plant body as an indicator, comparing a plant treated with a resistance inducer with a plant not treated (control plant), when the state of feeding damage to the plant body is improved in the plant treated with the resistance inducer, the expression of pest resistance can be determined. Using "5" the living state of organisms such as pests in the treatment section of the resistance inducer as an indicator, comparing a plant treated with a resistance inducer with a plant not treated (control plant), when the number of organisms such as pests in the treatment section of the resistance inducer is low in the plant treated with the resistance inducer, the expression of pest resistance can be determined.
[0031] The method of the embodiment is excellent in activating the salicylic acid signaling system and the jasmonic acid and / or ethylene signaling system, and causes the plant to exhibit excellent resistance. Numerical values representing the degree of activation of the SA system, the JA system and / or the ET system compared with the control plant are preferably as follows. The method of the embodiment preferably activates the SA system by two or more times, using the expression level of the VSP1 gene as an index, compared with the control plant. Also preferably activates the JA system by two or more times, using the expression level of the PR1 gene as an index, and / or preferably activates the ET system by two or more times, using the expression level of the PDF1.2 gene as an index.
[0032] The above activation of the SA system is preferably two or more times, more preferably 2 to 100 times, even more preferably 3 to 60 times, and particularly preferably 4 to 10 times. The above activation of the JA system is preferably two or more times, more preferably 2 to 10 times, and even more preferably 3 to 8 times. The above activation of the ET system is preferably two or more times, more preferably 2 to 150 times, even more preferably 3 to 60 times, and particularly preferably 4 to 50 times.
[0033] As the above VSP1, PR1, and PDF1.2 genes, genes (homologs) corresponding to each gene of the plant to which the resistance inducer is applied are applicable.
[0034] Examples of the VSP1 gene include genes encoding proteins selected from the group consisting of the following (a1) to (c1). (a1) A protein having the amino acid sequence represented by SEQ ID NO: 1 (b1) A protein having an amino acid sequence in which 1 to several amino acids are substituted, deleted, inserted, or added in the amino acid sequence represented by SEQ ID NO: 1 and having acid phosphatase activity (c1) A protein having an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having acid phosphatase activity
[0035] The amino acid sequence represented by SEQ ID NO: 1 is the amino acid sequence of Arabidopsis thaliana VSP1 (AT5G24780.1).
[0036] Examples of the PR1 gene include genes encoding proteins selected from the group consisting of the following (a2) to (c2). (a2) A protein having the amino acid sequence represented by SEQ ID NO: 2 (b2) A protein having an amino acid sequence in which one to several amino acids are substituted, deleted, inserted, or added in the amino acid sequence represented by SEQ ID NO: 2 and inducing resistance in plants (c2) A protein having an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 2 and inducing resistance in plants
[0037] The amino acid sequence represented by SEQ ID NO: 2 is the amino acid sequence of PR1 (AT2G14610.1) of Arabidopsis thaliana.
[0038] Examples of the PDF1.2 gene include genes encoding proteins selected from the group consisting of the following (a3) to (c3). (a3) A protein having the amino acid sequence represented by SEQ ID NO: 3 (b3) A protein having an amino acid sequence in which one to several amino acids are substituted, deleted, inserted, or added in the amino acid sequence represented by SEQ ID NO: 3 and inducing resistance in plants (c3) A protein having an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 3 and inducing resistance in plants
[0039] The amino acid sequence represented by SEQ ID NO: 3 is the amino acid sequence of PDF1.2 (AT5G44420.1) of Arabidopsis thaliana.
[0040] The "one to several" bases may be, for example, 1 to 30, 1 to 20, 1 to 10, 1 to 5, or 1 to 3. The sequence identity is 80% or more and less than 100%, and may be, for example, 85% or more, 90% or more, 95% or more, or 98% or more. The sequence identity between amino acid sequences can be calculated using BLAST (Basic Local Alignment Search Tool), a known sequence alignment algorithm, or blastp.
[0041] The plant resistance inducer used in the method of the embodiment is a low-molecular compound. Preferred plant resistance inducers will be described in detail below. In this specification, the "low-molecular compound" refers to a compound having a molecular weight of 10,000 or less, and as an example, it may have a molecular weight of 100 to 10,000, 130 to 1,000, or 150 to 500. Regarding the method of applying the plant resistance inducer, various methods exemplified as methods of bringing the following plant resistance inducers into contact with plants are also included.
[0042] According to the method of the embodiment, a wide range of resistances including activation of the JA system and / or ET system using a resistance inducer can be induced, including resistance to biotrophic fungi and necrotrophic fungi. In addition, it can be implemented as a production method with low environmental impact that has no antibacterial activity against fungi including biotrophic fungi and necrotrophic fungi and reduces damage to environmental microorganisms.
[0043] As the plant resistance inducer used in the method of the embodiment, the following plant resistance inducers can be exemplified.
[0044] ≪Plant Resistance Inducer≫
[0045] The plant resistance inducer of the embodiment contains, as an active ingredient, a compound represented by the following general formula (1) or a salt thereof.
[0046]
Chemical formula
[0047] [In formula (1), R 1 、R 2 and R 3each independently represents a linear or branched alkyl group having 1 to 4 carbon atoms, a hydroxyl group, a halogen atom, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 4 represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 5 and R 6 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, a linear or branched alkenyl group having 2 to 4 carbon atoms, or a halogen atom. n1 is R 1 represents the number of, and is an integer from 0 to 5. When n1 is 2 or more, R 1 may be the same or different. n2 is R 2 represents the number of, and is an integer from 0 to 5. When n2 is 2 or more, R 2 may be the same or different. n3 is R 3 represents the number of, and is an integer from 0 to 3. When n3 is 2 or more, R 3 may be the same or different.]
[0048] R 1 , R 2 , R 3 , R 4 , R 5 and R 6 Examples of the linear or branched alkyl group having 1 to 4 carbon atoms include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, and a tert-butyl group. R 1 , R 2 , R 3 , R 4 , R 5 and R 6 The linear or branched alkenyl group having 2 to 4 carbon atoms preferably has a carbon number of 2 to 3. Examples of the alkenyl group include an ethenyl group (vinyl group) and a 2-propenyl group (allyl group).
[0049] R 1 , R 2 , R 3 , R 5 and R 6 The halogen atom is an element belonging to Group 17 of the periodic table, such as F, Cl, Br, or I.
[0050] In the compound represented by the general formula (1), R 4 ~R 6 When is a hydrogen atom, examples of the compound include those represented by the following general formula (1-1).
[0051] [ka]
[0052] [In formula (1-1), R 1 , R 2 , R 3 , n1, n2 and n3 are the same as those in the general formula (1).
[0053] In the compound represented by the general formula (1-1), R 1 , R 2 and R 3 may each independently represent a linear or branched alkyl group having 1 to 4 carbon atoms.
[0054] In the compound represented by the general formula (1-1), when n1 to n3 are 0, examples of the compound include compounds represented by the following formula (1-2).
[0055] [ka]
[0056] The compound represented by the general formula (1) may be a salt, and the salt is preferably an agriculturally acceptable salt. Depending on the type of substituent, it may form an acid addition salt or a salt with a base. Specifically, inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, mandelic acid, tartaric acid, dibenzoyl tartaric acid, ditoluoyl tartaric acid, citric acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, aspartic acid, glutamic acid, etc. Acid addition salts with inorganic bases such as sodium, potassium, magnesium, calcium, aluminum, organic bases such as methylamine, ethylamine, ethanolamine, lysine, ornithine, salts of various amino acids and amino acid derivatives such as acetyl leucine, and ammonium salts, etc. are mentioned. Acid addition salts with inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, mandelic acid, tartaric acid, dibenzoyl tartaric acid, ditoluoyl tartaric acid, citric acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, aspartic acid, glutamic acid, etc. are preferred.
[0057] Furthermore, the active ingredient also includes various hydrates, solvates, and crystalline polymorphic substances of the compound of the general formula (1) and its salts. The active ingredient also includes compounds labeled with various radioactive or non-radioactive isotopes.
[0058] Commercially available compounds and their salts can be used as the compound of the general formula (1) and its salts. Also, the compound of the general formula (1) and its salts can be produced by applying known synthetic methods to various known compounds by utilizing the characteristics based on their basic structure or the type of substituent. In that case, depending on the type of functional group, it may be effective in manufacturing technology to replace the functional group with an appropriate protecting group well-known to those skilled in the art at the stage from the raw material to the intermediate.
[0059] The induction of plant resistance in this specification includes inducing, enhancing, promoting, and maintaining the disease resistance or pest resistance of plants. Since the plant resistance inducer of the embodiment induces disease resistance, it can also be provided as a plant disease control agent. Since the plant resistance inducer of the embodiment induces pest resistance, it can also be provided as a pest control agent.
[0060] Inducing, enhancing, and promoting the disease resistance or pest resistance of plants means that, when comparing the plants treated with the resistance inducer of the embodiment with the untreated plants, in the plants treated with the plant resistance inducer of the embodiment, the expression of plant resistance or pest resistance is significantly improved.
[0061] Maintaining the disease resistance or pest resistance of plants means that, when comparing the plants treated with the plant resistance inducer of the embodiment with the untreated plants, in the plants treated with the plant resistance inducer of the embodiment, the expression of plant resistance or pest resistance is significantly sustained for a longer time.
[0062] According to the resistance inducer of the embodiment, the SA system, as well as the JA system and / or ET system involved in plant resistance induction, can be activated. It has been demonstrated in the examples described below that the resistance inducer of the embodiment exhibits equivalent or higher resistance induction activity compared to the existing resistance inducers ASM and PBZ. This excellent effect is presumably achieved by a novel mechanism of action related to signal transduction. And according to the resistance inducer of the embodiment, the SA system, as well as the JA system and / or ET system, can be activated by one kind of active ingredient.
[0063] The type of plant to which the resistance inducer is applied is not particularly limited as long as it is a plant that can acquire resistance by inducing the above-mentioned SAR (i.e., SA system) and the above-mentioned ISR (i.e., JA system and / or ET system), and it may be a terrestrial plant or an aquatic plant. As terrestrial plants, angiosperms or gymnosperms are preferred, and they may be herbs or woody plants. As angiosperms, Rosaceae, Rutaceae, Vitaceae, Asteraceae, Orchidaceae, Liliaceae, Fabaceae, Poaceae, Rubiaceae, Equisetaceae, Selaginellaceae, Apiaceae, Lamiaceae, Cucurbitaceae, Solanaceae, and Brassicaceae are more preferred, and Brassicaceae is even more preferred.
[0064] Examples of the plants of the Liliaceae family include onions. Examples of the plants of the Fabaceae family include soybeans. Examples of the plants of the Apiaceae family include carrots. Examples of the plants of the Poaceae family include, for example, rice, corn, wheat, barley, etc. Examples of the plants of the Cucurbitaceae family include, for example, melons, watermelons, wax gourds, cucumbers, pumpkins, etc. Examples of the plants of the Solanaceae family include, for example, tobacco, tomatoes, potatoes, eggplants, peppers, etc. Examples of the plants of the Brassicaceae family include, for example, shepherd's purse, rape, cabbages, kale, Chinese cabbages, turnips, daikons, wasabi, mustard, etc. Preferred plants to which the resistance inducer of the embodiment is applied include tomatoes, tobacco, cucumbers, shepherd's purse, and rape.
[0065] The resistance inducer of the embodiment may, if necessary, be mixed with an agriculturally acceptable carrier, extender, etc. and provided in a formulation form such as a powder, tablet, granule, fine granule, etc. Alternatively, it can be made into a dosage form such as an emulsion, solution, suspension, wettable powder, aqueous solution, oil agent, etc. by mixing with an agriculturally acceptable solvent, surfactant, emulsifier, dispersant, etc.
[0066] The solvent for dissolving the resistance inducer may be appropriately selected according to the resistance inducer and the type of plant, and examples of preferable solvents include sulfoxide compounds such as dimethyl sulfoxide (DMSO); amide compounds such as N,N-dimethylformamide (DMF), N,N-dimethylacetamide (DMAc), and N-methylpyrrolidone (NMP), and other hydrophilic solvents.
[0067] The resistance inducer of the embodiment may be provided in a dosage form that is used in combination with other agricultural and horticultural agents. For example, it may be provided in a dosage form such as a combined agent or a combined preparation of the resistance inducer of the embodiment and other JA-based resistance inducers such as bestatin, hexanoic acid, arachidonic acid, and N-acylamide. Also, for example, it may be provided in a dosage form such as a combined agent or a combined preparation of the resistance inducer of the embodiment and other SA-based resistance inducers such as probenazole and acibenzolar-S-methyl.
[0068] The pathogen to be protected by using the resistance inducer of the embodiment is not particularly limited, but it is preferably a pathogen that causes the induction of SAR or ISR or can be protected by the induction of SAR or ISR. Or, it is preferably a pathogen that causes the induction of SAR or ISR and can be protected by the induction of SAR or ISR. From this perspective, the pathogen to be protected by the resistance inducer of the embodiment is more preferably a biotrophic pathogen (also simply referred to as a "biotrophic bacterium") or a necrotrophic pathogen (also referred to as a "necrotrophic bacterium").
[0069] According to the resistance inducer of the embodiment, plant resistance against both biotrophic bacteria and necrotrophic bacteria can be induced. Also, the resistance inducer of the embodiment preferably does not have antibacterial activity against biotrophic bacteria and necrotrophic bacteria. Examples of biotrophic fungi include various biotrophic phytopathogenic filamentous fungi [such as Colletotrichum higginsianum, Puccinia graminis, Erysiphe graminis, Ustilago maydis, Magnaporthe grisea, etc. that infect cruciferous plants], various biotrophic phytopathogenic bacteria, and various plant viruses.
[0070] Among them, as the pathogen to be protected by using the resistance inducer of the embodiment, fungi belonging to the genus Colletotrichum can be preferably exemplified.
[0071] Examples of necrotrophic fungi include pathogenic fungi such as Botrytis cinerea, Colletotrichum atramentarium, Colletotrichum lagenarium, Phytophthora infestans, Gaeumannomyces graminis, Erwinia carotovora, Diplocarpon rosae, Valsa ceratosperma, Cryphonectria parasitica, Claviceps purpurea, Alternaria alternata, Mycosphaerella pinodes, Cochliobolus miyabeanus, Stemphylium lycopersici, Sclerotinia sclerotiorum, Monilinia sp., Passalora fulva, Fusarium oxysporum f. sp. cucumerinum, Fusarium oxysporum, Raffaelea quercivora, Penicillium digitatum, Penicillium italicum, Xanthomonas campestris pv. citri, and Ralstonia solanacearum. Among them, Alternaria alternata of the genus Alternaria and Botrytis cinerea of the genus Botrytis can be exemplified as typical necrotrophic fungi.
[0072] Among them, as the pathogens to be protected by using the resistance inducer of the embodiment, fungi of the genus Alternaria, which are necrotrophic fungi, and fungi of the genus Botrytis, such as Botrytis cinerea, Botrytis byssoidea, Botrytis squamosa, and Botrytis allii, which are necrotrophic fungi, can be preferably exemplified, and fungi of the genus Botrytis are more preferable. Among them, Alternaria alternata of the genus Alternaria and Botrytis cinerea of the genus Botrytis can be exemplified as preferable use targets, and Botrytis cinerea (tomato gray mold) or Botrytis cinerea (cucumber gray mold) can be exemplified as particularly preferable use targets. As necrotrophic fungi, it also includes saprophytic pathogens that are conditionally saprophytic depending on the surrounding environment.
[0073] The organisms such as pests to be controlled by using the resistance inducer of the embodiment are not particularly limited. As described above, the ISR system induces a defense response against "damage" such as damage caused by pests. Therefore, the resistance inducer of the embodiment can also be applied as a control agent to organisms such as a wide range of types of pests, such as insects and mites that feed on plants.
[0074] Examples of organisms such as pests to be controlled by using the resistance inducer of the embodiment include Coleoptera pests such as Callosobruchus chinensis, Lepidoptera pests such as Plutella xylostella and Pieris rapae, Diptera pests such as Musca domestica and Dacus cucurbitae, Hemiptera pests such as Nezara antennata, Thysanoptera pests such as Frankliniella occidentalis, Orthoptera pests such as Locusta migratoria, Blattodea pests such as Blattella germanica, Acari pests such as Dermatophagoides farinae, and various agricultural pests such as nematodes such as Meloidogyne incognita. Examples of forest pests include Coleoptera pests, such as Platypus quercivorus and other pests of the family Platypodidae, and Tomicus piniperda and other pests of the family Scolytidae. Other examples include pests of the genus Mochamus, such as Mochamus alternatus and Mochamus saltuaris.
[0075] As one embodiment, the present invention provides a method for inducing resistance by bringing a compound represented by the general formula (1) or a salt thereof into contact with a plant to be applied. As one embodiment, the present invention provides a compound represented by the general formula (1) or a salt thereof for inducing plant resistance. As one embodiment, the present invention provides the use of a compound represented by the general formula (1) or a salt thereof for inducing plant resistance. As one embodiment, the present invention provides the use of a compound represented by the general formula (1) or a salt thereof for producing a resistance inducer.
[0076] By contacting a plant to be treated with an effective amount of an elicitor of resistance, resistance can be induced in the plant. As a method for applying an elicitor of resistance, the method of bringing an effective amount into contact with a plant may be the same as that for known elicitors. For example, methods include spraying an elicitor of resistance on the soil in which the plant is growing, mixing it into the soil, irrigating the soil, applying or spraying a solution of the elicitor of resistance dissolved in a plant, growing the plant in the solution of the elicitor of resistance, and mixing an elicitor of resistance into a hydroponic solution. Among these, a method of bringing an effective amount of an elicitor of resistance into contact with the roots of a plant is preferred, and examples include a treatment method of applying an elicitor of resistance to the soil in which the plant is cultivated or to the hydroponic solution in which the plant is cultivated, and perfusion treatment is preferred.
[0077] In the method for inducing resistance in a plant according to the embodiment, the part of the plant body to which the elicitor of resistance is treated or administered is not particularly limited. For example, it may be sprayed on all the leaves, stems, and entire roots of the plant body, or only on some leaves, some stems, and some roots. Even when not sprayed on the entire plant body, secondary metabolites produced at the sprayed site can be distributed to necessary parts of the plant body, and resistance can be acquired even at unsprayed sites. In addition, resistance can also be acquired by permeating from the root system to the plant body by soil treatment, immersion treatment, perfusion treatment, or the like.
[0078] The amount of the elicitor of resistance used can be appropriately adjusted according to the type of the elicitor of resistance and the plant. When treating by spraying, mixing, or irrigating an elicitor of resistance into the soil, for example, the amount of the active ingredient used per application is 1 to 20 kg / 10a, 1 to 10 kg / 10a, or 1 to 1.3 kg / 10a, and it can be used once a year or a plurality of times as necessary during the period from when the plant germinates until it is harvested. When using it a plurality of times, it is preferably used at a frequency of 2 to 6 times a year or 1 to 3 times a month.
[0079] In addition, when the solution of the resistance inducer is applied or sprayed to the stems and leaves of the plant, the concentration of the compound represented by the general formula (1) or its salt contained in the solution of the resistance inducer is preferably 0.1 to 500 μM, more preferably 1 to 500 μM, more preferably 1 to 300 μM, more preferably 1 to 100 μM, more preferably 1 to 10 μM, and even more preferably 1 to 5 μM, and in another aspect, preferably 10 to 50 μM. For example, the amount of the solution of the resistance inducer having a concentration of 0.1 to 500 μM or 1 to 500 μM used per time is 1 to 1000 μL per leaf, and the solution can be used once a year or multiple times as necessary during the period from when the plant germinates to when it is harvested. When used multiple times, it is preferable to use the solution 2 to 6 times a year, or 1 to 3 times a month.
[0080] When the plant is grown in a solution of the resistance inducer, such as irrigation or hydroponics, the concentration of the compound represented by the general formula (1) or its salt contained in the solution of the resistance inducer is preferably 0.1 to 500 μM, more preferably 1 to 500 μM, more preferably 1 to 300 μM, even more preferably 1 to 100 μM, more preferably 1 to 10 μM, and even more preferably 1 to 5 μM, and in another aspect, preferably 10 to 50 μM. For example, the amount of a solution of the resistance inducer having a concentration of 0.1 to 500 μM or 1 to 500 μM used at one time is 1 to 1000 μL per plant body, and the solution can be used once a year or multiple times as necessary during the period from when the plant germinates to when it is harvested. When the solution is used multiple times, it is preferably used 2 to 6 times a year, or 1 to 3 times a month.
[0081] The timing of application of the resistance inducer can be any time when the plant is sowed, transplanted, or planted. It can also be applied at any growth stage of the seed, sprout, young plant, or mature individual. For example, it can be applied 1 to 3 times from 20 days after germination to 14 days before harvest.
[0082] The resistance inducer of the embodiment may be used in combination with other agricultural and horticultural agents. The resistance inducer and the other agricultural and horticultural agents may be used simultaneously or separately. For example, the resistance inducer of the embodiment may be used in combination with other JA-based resistance inducers such as bestatin, hexanoic acid, arachidonic acid, N-acylamide, etc. Also for example, the resistance inducer of the embodiment may be used in combination with other SAR-based resistance inducers such as probenazole, acibenzolar-S-methyl, etc.
[0083] In this specification, "used in combination" means applying a plurality of types of drugs to the same plant individual.
[0084] The resistance inducer may be brought into contact with the plant body after the occurrence of pests or the onset of plant diseases. Also, the resistance inducer may be used prophylactically, and the resistance inducer may be brought into contact with the plant body before the occurrence of pests or the onset of plant diseases.
[0085] Compared with conventional JA-based resistance inducers, the resistance inducer of the embodiment enables good resistance induction by treating the active ingredient at a low concentration.
[0086] According to the resistance inducer of the embodiment, it is possible to activate the SA-based, JA-based and / or ET-based systems involved in plant resistance induction. The resistance inducer of the embodiment can be suitably used in the method for inducing plant resistance described in the above embodiments.
[0087] ≪Biostimulant≫ The plant resistance inducer of the embodiment can also be used as a biostimulant. The biostimulant of the embodiment contains a compound represented by the following general formula (1) or a salt thereof as an active ingredient.
[0088]
Chemical formula
[0089] [In formula (1), R 1 , R 2 and R 3Each independently represents a linear or branched alkyl group having 1 to 4 carbon atoms, a hydroxyl group, a halogen atom, or a linear or branched alkenyl group having 2 to 4 carbon atoms. R 4 represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, or a linear or branched alkenyl group having 2 to 4 carbon atoms. R 5 and R 6 each independently represent a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, a linear or branched alkenyl group having 2 to 4 carbon atoms, or a halogen atom. n1 represents the number of R 1 and is an integer from 0 to 5. When n1 is 2 or more, R 1 may be the same as or different from each other. n2 represents the number of R 2 and is an integer from 0 to 5. When n2 is 2 or more, R 2 may be the same as or different from each other. n3 represents the number of R 3 and is an integer from 0 to 3. When n3 is 2 or more, R 3 may be the same as or different from each other.
[0090] As used herein, a "biostimulant" is one that, when applied to a plant, has the function of improving the production amount and / or accumulation amount of secondary metabolites of the plant. According to the examples described below, it is suggested that the compound represented by the above general formula (1) or a salt thereof contributes to the activation of multiple plant hormone synthesis pathways. That is, according to the compound represented by the above general formula (1) or a salt thereof, the biosynthetic pathway is activated over a wide range, and it is possible to improve the synthesis of various secondary metabolites and the like.
[0091] Examples of secondary metabolites include alkaloids and terpenoids, and these secondary metabolites can be used as active ingredients in crude drug preparations and Kampo preparations.
[0092] According to the biosimulant of the embodiment, for example, by applying it to raw material plants of crude drug preparations or Kampo preparations, it is possible to improve the production amount and / or accumulation amount of the active ingredient, which is the target secondary metabolite. The raw material plants are not particularly limited, and examples include plants such as licorice, cultivated ginseng, ginger, and cinnamon.
[0093] As the method of using the biosimulant, the dosage form, etc., those similar to those described in the above plant resistance inducer can be exemplified, and thus detailed description is omitted.
[0094] The biosimulant of the embodiment may be provided in a dosage form that is used in combination with other agricultural and horticultural agents. For example, it may be provided in a dosage form such as a combined preparation or a combined formulation of the biosimulant of the embodiment and a compound having other known biosimulant effects.
[0095] The biosimulant of the embodiment may be used in combination with other agricultural and horticultural agents. The biosimulant and other agricultural and horticultural agents may be used simultaneously or separately. For example, the biosimulant of the embodiment and a compound having other known biosimulant effects may be used in combination.
[0096] The biosimulant of the embodiment has an effect of improving the production amount and / or accumulation amount of secondary metabolites. The expression of the biosimulant effect in plants can be judged, for example, by the following indicators. Using the amount of secondary metabolites produced in the plant body as an index, comparing the plant treated with the biosimulant of the embodiment with the plant not treated, when the amount of secondary metabolites produced in the plant body significantly increases in the plant treated with the biosimulant of the embodiment, the expression of the biosimulant effect can be judged.
[0097] In one embodiment, the present invention provides a method for promoting the production of secondary metabolites, which includes bringing a biostimulant containing a compound represented by the above general formula (1) or a salt thereof into contact with a plant. Since the same methods as those described in the method of bringing a plant resistance inducer into contact with a plant can be exemplified, the description thereof is omitted.
[0098] As one embodiment, the present invention provides a method for producing a secondary metabolite, which comprises bringing a compound represented by the above general formula (1) or a salt thereof into contact with a plant to be applied. As one embodiment, the present invention provides a method for improving the production amount of a secondary metabolite, which comprises bringing a compound represented by the above general formula (1) or a salt thereof into contact with a plant to be applied.
Examples
[0099] Next, the present invention will be described in more detail with reference to examples, but the present invention is not limited to the following examples.
[0100] <Selection of a compound that induces the expression of the VSP1 gene> First, according to the results shown in the literature (Utsugi et al. (1998) Plant Mol Biol 38:565-576; Guerineau et al. (2003) J Exp Bot 54:1153-1162), the promoter sequence of the Vegetative Storage Protein 1 (VSP1) gene was amplified from the genomic DNA of Arabidopsis thaliana ecotype Columbia by PCR. The promoter sequence of the VSP1 gene was ligated upstream of Fluc in a plasmid (pBI221-Fluc) having the gene sequence of a reporter gene (firefly luciferase gene (FLuc)) to obtain a pBI121-VSP1::Fluc plasmid. This plasmid was introduced into Arabidopsis thaliana via Agrobacterium tumefaciens LBA4404 to obtain transgenic Arabidopsis thaliana VSP1::Fluc having VSP1::Fluc. Seeds of this transgenic Arabidopsis thaliana were sown in a multi-well plate and germinated in an aqueous luciferin solution.
[0101] DMSO solutions of each compound in a generally commercially available compound library were each prepared, and this solution was added to each well so that the concentration of the compound became 30 μM, and the sprouting of transgenic Arabidopsis thaliana was treated. Growth was carried out under photoperiod conditions of 22°C, 12-hour dark period / 12-hour light period (70 μmolm -2 S -1 ).
[0102] Using a photon counting device (ARGUS system, manufactured by Hamamatsu Photonics) and software (AQUACOSMOS, manufactured by Hamamatsu Photonics), the luminescence intensity in each well was measured to measure the expression level of Fluc as a reporter, and the VSP1 gene expression induction activity of each compound was evaluated respectively.
[0103] As a result, it was revealed that the treatment with the compound represented by the above formula (1-2) (molecular weight 356.4) induced the expression of the Fluc protein in the above-mentioned transformed Arabidopsis thaliana VSP1::Fluc. The compound 2-{2-[(1,3-dioxaindan-5-yl)methylidene]hydrazin-1-ylidene}-1,2-diphenylethan-1-one represented by the above formula (1-2) is hereinafter referred to as "Compound X". Hereinafter, commercially available Compound X from Enamine was used.
[0104] <Evaluation of the effect of Compound X on the JA system in 1-week-old Arabidopsis thaliana individuals> The same experiment as the above selection experiment was conducted on 1-week-old Arabidopsis thaliana individuals (n = 24). A DMSO solution of Compound X was prepared, and each solution was added to each well so that the concentrations of Compound X were 1 μM, 5 μM, 30 μM, and 100 μM, respectively, to treat the transformed Arabidopsis thaliana group (Compound X group), and an evaluation was performed on the group treated with only DMSO instead of the DMSO solution of the above Compound X (DMSO group). Furthermore, in addition to the Compound X group and the DMSO group, an evaluation was also performed on the group treated with a 10 μM MeJA DMSO solution instead of the DMSO solution of Compound X (MeJA group).
[0105] The results are shown in Figure 2. In the transformed Arabidopsis thaliana VSP1::Fluc of the Compound X group, a significant increase in the luminescence intensity of the Fluc protein was confirmed by 72 hours after treatment. On the other hand, in the Arabidopsis thaliana VSP1::Fluc of the DMSO group, the luminescence of the Fluc protein was not detected. From this, it was suggested that Compound X also has the activity of inducing the expression of the VSP1 gene in 1-week-old Arabidopsis thaliana individuals. Moreover, when comparing compound X with MeJA, the effect of compound X on VSP1 gene expression activity was exerted slightly later than that in the MeJA group. However, the effect of compound X on VSP1 gene expression activity continued for a longer period than that of MeJA. Furthermore, compound X could induce high VSP1 gene expression activity at any concentration, and showed high activity even at a very low concentration. That is, it was found that compound X has a very excellent resistance induction effect.
[0106] <Evaluation of the effect of compound X on the JA system in 4-week-old Arabidopsis thaliana individuals> A solid medium was prepared by mixing compound X into the MS medium at a concentration of 50 μM, or a solid medium was prepared by mixing only DMSO into the MS medium instead of compound X. Four-week-old individuals (n = 24) of Arabidopsis thaliana VSP1::Fluc grown on the MS solid medium were transplanted there, and compound X was absorbed from the roots. Immediately after transplantation was set as 0 hour, and the time-course observation of VSP1 activity was carried out in the same manner as above from 24 to 168 hours after transplantation.
[0107] The results are shown in Figure 3. A significant increase in the luminescence intensity of the Fluc protein was confirmed by the application of compound X, and it was confirmed that compound X shows the activity of inducing the expression of the VSP1 gene even in mature individuals. It was also suggested that compound X is highly efficiently absorbed from the roots, and it was inferred that perfusion treatment is suitable as the application method.
[0108] <Evaluation of the effect of compound X on the SA system and ET system in 4-week-old Arabidopsis thaliana individuals> According to the content shown in the literature (Ono S, Kusama M, Ogura R, Hiratsuka K (2011) Evaluation of the use of the tobacco PR-1a promoter to monitor defense gene expression by the luciferase bioluminescence reporter system. Biosci Biotechnol Biochem 75: 1796-1800), a plasmid having a fusion gene (PR-1a::F-luc) in which a firefly luciferase gene (Firefly luciferase; F-luc) was ligated downstream of a Pathogenesis-related gene 1a (PR-1a) gene promoter derived from tobacco was obtained. The plasmid was introduced into Arabidopsis thaliana via Agrobacterium tumefaciens LBA4404 to obtain transformed Arabidopsis thaliana PR-1a::F-luc having PR-1a::F-luc.
[0109] Also, according to the content shown in the literature (Minami T, Tanaka T, Takasaki S, Kawamura K, Hiratsuka K, In vivo bioluminescence monitoring of defense gene expression in response to treatment with yeast cell wall extract. Plant biotechnol. 28, 481-484, 2011), a plasmid having a fusion gene (PDF1.2::F-luc) in which a firefly luciferase gene was ligated downstream of a PDF1.2 gene promoter derived from Arabidopsis thaliana was obtained. The plasmid was introduced into Arabidopsis thaliana via Agrobacterium tumefaciens LBA4404 to obtain transformed Arabidopsis thaliana PDF1.2::F-luc having PDF1.2::F-luc.
[0110] A solid medium was prepared by mixing compound X into the MS medium at a concentration of 50 μM, or a solid medium prepared by mixing only DMSO into the MS medium instead of compound X. Four-week-old individuals (n = 24) of Arabidopsis PR-1a::F-luc or PDF1.2::F-luc grown on MS solid medium were replanted therein, and compound X was absorbed from the roots. Immediately after replanting was set as 0 hour, and the time-course observation of VSP1 activity was carried out in the same manner as above from 24 to 168 hours after replanting.
[0111] The results are shown in FIGS. 4A to 4B. A significant increase in the luminescence intensity of the Fluc protein was confirmed by the application of compound X, suggesting that compound X acts not only on the JA system but also on the SA system and the ET system.
[0112] <Verification of the disease suppression effect against Botrytis cinerea> As a study on the usefulness as resistance induction, the disease suppression effect of Botrytis cinerea in mature individuals of Arabidopsis was verified. Botrytis cinerea is a necrotrophic fungus. A perfusion treatment was performed by pouring each solution of a DMSO solution of compound X (50 μM), a DMSO solution of MeJA (50 μM), and DMSO onto the soil surface of four-week-old individuals (n = 6) of wild-type Arabidopsis cultivated in cultivation soil. Then, a spore suspension (1×10 5 spores / mL) was dropped onto the leaves of Arabidopsis 120 to 144 hours later, and the lesions were measured 72 hours later.
[0113] The results are shown in FIG. 5. The graph shows the maximum lesion diameter 72 hours after inoculation. A high inhibitory effect against Botrytis cinerea was observed only when compound X was subjected to perfusion treatment.
[0114] <Verification of the disease suppression effect against Colletotrichum higginsianum> Also, in the same manner as the verification of the disease suppression effect against the above-mentioned Botrytis cinerea, the disease suppression effect of Colletotrichum higginsianum when compound X was subjected to perfusion treatment was verified. Colletotrichum higginsianum is a biotrophic fungus. For 4-week-old individuals (n = 6) of wild-type Arabidopsis thaliana cultivated in cultivation soil, a perfusion treatment was performed by pouring a DMSO solution of compound X (50 μM), a DMSO solution of ASM (50 μM), and each solution of DMSO onto the soil surface. Then, 96 to 144 hours later, a spore suspension (1 × 10 5 spores / mL) was dropped onto the leaves of Arabidopsis thaliana, and the lesions were measured 144 hours later.
[0115] The results are shown in Figure 6. The graph shows the maximum lesion diameter 144 hours after inoculation. Compound X was shown to exhibit a suppressive effect similar to or exceeding that of ASM, a typical resistance inducer, and to have an excellent effect in suppressing the infection and growth of Colletotrichum higginsianum.
[0116] <Verification of the difference in induction patterns between the JA pathway and the SA pathway> Many papers have reported that the JA pathway and the SA pathway act antagonistically to each other. However, from the present examples shown above, it was suggested that compound X acts not only on the JA pathway but also on the SA pathway. Therefore, it was confirmed how these multiple pathways are induced by compound X. Using seedlings and mature individuals of wild-type Arabidopsis thaliana, the expression levels (mRNA levels) of the VSP1 gene of the JA pathway and the PR1 gene of the SA pathway were quantified by real-time PCR.
[0117] Hereinafter, unless otherwise specified, the treatment of compound X was performed in the same manner as above by replanting Arabidopsis thaliana on a solid medium in which compound X was mixed in MS medium, and the time immediately after replanting was defined as treatment 0 hour. The same applies to the treatments of the other control groups (MeJA group and DMSO group).
[0118] The nucleotide sequences of the primer sets for real-time PCR used for quantifying the expression level of the VSP1 gene of Arabidopsis thaliana are as follows. F: 5´- TCGAAGTTGACGCAAGTGGT -3´ (SEQ ID NO: 4) R: 5´- GGGGACAATGCCATGAAGAT -3´ (SEQ ID NO: 5)
[0119] The nucleotide sequences of the primer sets for real-time PCR used for quantifying the expression level of the PR1 gene of Arabidopsis thaliana are as follows. F: 5´- CTAACTACAACTACGCTGCGAAC -3´ (SEQ ID NO: 6) R: 5´- TTCATTAGTATGGCTTCTCGTTCA -3´ (SEQ ID NO: 7)
[0120] The results in seedlings are shown in FIGS. 7A to 7B. VSP1 showed an increased expression starting from 48 hours after treatment with compound X and reached a peak at 96 hours, and then its activity decreased, showing an induction pattern. On the other hand, PR1 was highly expressed at 144 hours after treatment.
[0121] The results in mature individuals are shown in FIGS. 8A to 8B. VSP1 was highly expressed at 48 hours after treatment. On the other hand, it was confirmed that the expression of PR1 increased from 48 hours after treatment and reached a peak at 96 hours. From these results, although there is a time lag in the peak of expression between seedlings and mature individuals, it was suggested that in both growth stages, compound X initially activates the JA pathway and simultaneously activates the SA pathway at a later stage along with the decrease in JA pathway activity.
[0122] Since compound X has such a JA-SA induction pattern, it is considered that it exhibits excellent control effects against both Botrytis cinerea and Colletotrichum orbiculare.
[0123] <Verification of the induction pattern of the ET pathway> Similarly, the expression level of the PDF1.2 gene of the ET pathway was also quantified by real-time PCR.
[0124] The nucleotide sequences of the primer sets for real-time PCR used for quantifying the expression level of the PDF1.2 gene of Arabidopsis thaliana are as follows. F: 5´- TTTGCTGCTTTCGACGCAC -3´ (SEQ ID NO: 8) R: 5´- CGCAAACCCCTGACCATG -3´ (SEQ ID NO: 9)
[0125] The results are shown in FIGS. 9A - B. The graph in FIG. 9A shows the results for seedlings, and the graph in FIG. 9B shows the results for mature individuals. At both growth stages, it was confirmed that PDF1.2 was highly expressed 144 hours after treatment with Compound X. Therefore, it was suggested that Compound X activates the ET system at a later stage.
[0126] <Evaluation of the Antibacterial Activity of Compound X> To confirm the antibacterial activity of Compound X itself, an evaluation was performed by the inhibition zone method. Here, the antibacterial activities against Botrytis cinerea and Colletotrichum higginsianum were investigated. Botrytis cinerea is a representative of saprophytic pathogens, and Colletotrichum higginsianum is a representative of biotrophic pathogens.
[0127] 100 μl (3.0×10 5 spores / ml) of spores of Botrytis cinerea were spread on PSA medium, and 10 μl (100 mM) of Compound X solution was further treated. For the positive control, 10 μl (100 mM) of hygromycin was used, and for the negative control, DMSO was used. This was cultured at 24°C for 5 days.
[0128] 100 μl (1.0×10 5 spores / ml) of spores of Colletotrichum higginsianum were spread on PDA medium, and 10 μl (100 mM) of Compound X solution was further treated. For the positive control, 10 μl (100 mM) of hygromycin was used, and for the negative control, DMSO was used. This was cultured in the dark at 24°C for 10 days.
[0129] The results are shown in FIGS. 10A - B. As a result of the test, it was revealed that Compound X did not show antibacterial activity against Botrytis cinerea and Colletotrichum higginsianum even at a high - concentration treatment of 100 mM. Compounds without antibacterial activity are less likely to produce drug - resistant bacteria. Therefore, Compound X according to the plant resistance inducer of the embodiment is excellent in that it is less likely to produce drug - resistant bacteria and can be expected to be used for a long period.
[0130] Unlike existing resistance inducers, compound X activates not only the JA pathway but also the SA and ET pathways, and exhibits distinct resistance against both Botrytis cinerea (necrotrophic fungus) and Colletotrichum spp. (biotrophic fungus). This indicates that compound X can induce resistance against a wide range of pathogens. In addition, compound X was able to effectively induce resistance even at low application concentrations.
[0131] The effect of compound X was equal to or greater than that of typical resistance inducers such as ASM and PBZ, indicating that its effect and usefulness as a resistance inducer are very high.
[0132] Each configuration and their combinations in each embodiment are examples, and additions, omissions, substitutions, and other changes to the configuration are possible without departing from the spirit of the present invention. Further, the present invention is not limited by each embodiment and is limited only by the scope of the claims.
Claims
Claim 1 A method for inducing plant resistance, comprising: applying a plant resistance inducer to a plant to activate a salicylic acid signaling system and a jasmonic acid and / or ethylene signaling system; The method for inducing plant resistance, wherein the plant resistance inducer contains, as an active ingredient, a compound represented by the following general formula (1) or a salt thereof. 【Chemical 1】 [In formula (1), R 1 , R 2 and R 3 each independently represents a linear or branched alkyl group having 1 to 4 carbon atoms, a hydroxyl group, a halogen atom, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 4 represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 5 and R 6 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, a linear or branched alkenyl group having 2 to 4 carbon atoms, or a halogen atom. n1 represents the number of R 1 and is any integer from 0 to 5. When n1 is 2 or more, R 1 s may be the same as or different from each other. n2 represents the number of R 2 and is any integer from 0 to 5. When n2 is 2 or more, R 2 s may be the same as or different from each other. n3 represents the number of R 3 and is any integer from 0 to 3. When n3 is 2 or more, R 3 s may be the same as or different from each other. ] Claim 2 (Deleted) Claim 3 The method according to claim 1, which induces plant resistance against both biotrophic fungi and necrotrophic fungi. Claim 4 The method according to claim 1 or 3, which has no antibacterial activity against biotrophic fungi and necrotrophic fungi. Claim 5 The method according to any one of claims 1, 3, and 4, wherein the application comprises contacting an effective amount of the plant resistance inducer with the roots of the plant. Claim 6 A plant resistance inducer containing, as an active ingredient, a compound represented by the following general formula (1) or a salt thereof. [Chemical Formula 2] [In formula (1), R 1 , R 2 and R 3 each independently represents a linear or branched alkyl group having 1 to 4 carbon atoms, a hydroxyl group, a halogen atom, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 4 represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 5 and R 6 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, a linear or branched alkenyl group having 2 to 4 carbon atoms, or a halogen atom. n1 represents the number of R 1 and is any integer from 0 to 5. When n1 is 2 or more, R 1 may be the same as or different from each other. n2 represents the number of R 2 and is any integer from 0 to 5. When n2 is 2 or more, R 2 may be the same as or different from each other. n3 represents the number of R 3 and is any integer from 0 to 3. When n3 is 2 or more, R 3 may be the same as or different from each other. ] Claim 7 A biostimulant containing, as an active ingredient, a compound represented by the following general formula (1) or a salt thereof. 【Chemical Formula 3】 [In formula (1), R 1 , R 2 and R 3 each independently represents a linear or branched alkyl group having 1 to 4 carbon atoms, a hydroxyl group, a halogen atom, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 4 represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, or a linear or branched alkenyl group having 2 to 4 carbon atoms, R 5 and R 6 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 4 carbon atoms, a linear or branched alkenyl group having 2 to 4 carbon atoms, or a halogen atom. n1 represents the number of Rs 1 and is any integer from 0 to 5. When n1 is 2 or more, the Rs 1 may be the same as or different from each other. n2 represents the number of Rs 2 and is any integer from 0 to 5. When n2 is 2 or more, the Rs 2 may be the same as or different from each other. n3 represents the number of Rs 3 and is any integer from 0 to 3. When n3 is 2 or more, the Rs 3 may be the same as or different from each other. ]
Citation Information
Patent Citations
A method and system for determining the relative priority of work-in-progress and narrowing down the targets for process improvement.
JP2011511385A
Plant resistance induction control agent, plant resistance induction control method, and method of controlling plant disease
JP2017197456A
Plant resistance inducing control agent, plant resistance inducing control method, plant disease prevention method, insect prevention method, plant growth promoter, microbial infection efficiency promoter, and transgene expression efficiency promoter
WO2016006351A1