Growth-promoting Prussia adamsii M6 and application thereof

By applying the M6 strain of Priesteria anaerobic bacteria, the problem of lack of millet rhizosphere proliferation strains was solved, significant growth promotion and soil improvement effects were achieved, the growth and development of millet crops were promoted, and the use of chemical fertilizers was reduced, and the sustainable development of agriculture was promoted.

CN120330094APending Publication Date: 2025-07-18INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 4 Cited by

Patent Information

Application Number
CN202510476820.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

The lack of efficient and stable millet rhizosphere proliferation strains and their application methods in the prior art has resulted in insignificant effects on millet growth and soil environment improvement.

Method used

It provides a M6 strain of Priestia aryabhattai, which has the proliferation properties of nitrogen fixation, phosphorus soluble, IAA and iron-producing carriers. It is applied to millet by preparing bacterial suspensions and soaking seeds during seeds and watering bacterial fluid once 7 days after sowing to promote its growth.

Benefits of technology

It significantly increased the plant height, root length, aboveground and underground biomass of millet seedlings, reduced the use of chemical fertilizers, improved the soil environment, and promoted the sustainable development of agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330094A_ABST
    Figure CN120330094A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and provides a growth-promoting P.adami M6 and application thereof, the P.adami M6 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC No: M20242835, the preservation date is December 18, 2024, the preservation number is CCTCC No: M20242835, the preservation number is CCTCC No: M20242835, the preservation number is CCTCC No: M20242835, and the preservation number is CCTCC No: M20242835. The strain is separated from rhizosphere soil of field planting foxtail millet in the Inner Mongolia red peak area, and is obtained through artificial separation and purification; the strain has the growth promoting characteristics of nitrogen fixation, phosphorus dissolution, IAA production and siderophore production; the M6 fungicide is used for inoculating millet, so that the growth of millet seedlings can be obviously promoted, and the plant height, the root length and the overground part and underground part biomass of the millet are obviously increased; m6 is used as a microbial agent to soak seeds during sowing and irrigate a bacterial liquid once 7 days after sowing, so that the growth effect of millet is best.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and specifically relates to Priestia aryabhattai M6 and its application. Background Art

[0002] Plant growth-promoting rhizobacteria (PGPR) refers to bacteria that live in the rhizosphere of plants, such as soil, root surface, and root internal tissues, for a long time. They can promote the nutrient absorption of plants, help plants resist biotic and abiotic stresses, and play an important role in the growth process of plants. PGPR can not only directly synthesize substances required for plant growth and development, secrete plant growth regulatory substances, and directly promote cell division and root elongation of plants, such as auxin and cytokinin, but also fix nitrogen in the air, dissolve elements in the soil that cannot be directly utilized, increase the available elements that can be directly absorbed in the soil environment, improve the bioavailability of insoluble minerals, and promote the absorption of nutrients by plants. Rhizosphere beneficial microorganisms help plants obtain nutrients, promote plant growth and development, enhance plant stress resistance, and reduce the occurrence of plant soil-borne diseases.

[0003] Microbial fertilizers produced from specific growth-promoting strains screened based on PGPR can improve soil structure, increase soil organic matter content, reduce the use of chemical fertilizers, and increase crop yields at the same time. However, there is relatively little research on rhizosphere growth-promoting bacteria for foxtail millet at present, and there is a lack of efficient and stable growth-promoting strains and their application methods. Therefore, developing a rhizosphere growth-promoting bacterium and its microbial preparation that can effectively promote the growth of foxtail millet is of great significance for increasing foxtail millet yields and improving the soil environment. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a Priestia aryabhattai M6 in the rhizosphere of foxtail millet and its application.

[0005] The technical solution of the present invention is: Priestia aryabhattai M6, which is deposited in the China Center for Type Culture Collection, and the deposit number is CCTCC No: M20242835.

[0006] A microbial preparation containing the above-mentioned Priestia aryabhattai M6.

[0007] The application of the above-mentioned Priestia aryabhattai M6 or microbial preparation in promoting the growth of foxtail millet.

[0008] Preservation Information:

[0009] Priestia aryabhattai M6, Preservation Institution: China Center for Type Culture Collection, Preservation Address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Preservation Number: CCTCC No: M20242835, Preservation Date: December 18, 2024.

[0010] This strain was isolated from the rhizosphere soil of field-grown foxtail millet in Chifeng area, Inner Mongolia, and obtained through artificial isolation and purification. This strain has the growth-promoting characteristics of nitrogen fixation, phosphorus solubilization, IAA production, and siderophore production.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] Priestia aryabhattai M6 of the present invention has a significant growth-promoting function for foxtail millet. At the same time, Priestia aryabhattai M6 of the present invention and its application method not only contribute to the growth and development of foxtail millet crops and increase yields, but also help improve the soil environment and reduce the use of chemical fertilizers, which is of great significance for promoting the sustainable development of agriculture. Brief Description of the Drawings

[0013] Figure 1 It is a morphological diagram of Priestia aryabhattai M6 of the present invention;

[0014] Figure 2 It is a diagram showing the effect of Priestia aryabhattai M6 of the present invention on the growth of foxtail millet seedlings;

[0015] Figure 3 It is a schematic diagram of inoculation with Priestia aryabhattai M6 of the present invention. Detailed Embodiments

[0016] The following further describes the embodiments of the present invention in detail in conjunction with the drawings and examples. The following examples are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0017] The culture medium of the present invention is as follows:

[0018] 1. 1 / 2R2A medium: 0.25 g of yeast extract, 0.25 g of peptone, 0.25 g of glucose, 0.25 g of starch, 0.25 g of acid hydrolysate of casein, 0.15 g of K2HPO4, 0.15 g of sodium pyruvate, 0.025 g of MgSO4, 20 g of agar, 1 mL of TES, 1000 mL of distilled water;

[0019] 2. Ashby nitrogen-fixing medium: 0.2 g of K2HPO4, 0.2 g of NaCl, 0.2 g of MgSO4, 5 g of CaCO3, 0.1 of K2SO4, 10 g of glucose, 20 g of agar, 1000 mL of distilled water, pH 7.4 ± 0.2;

[0020] 3. NBRIP inorganic phosphorus medium: 10 g of glucose, 0.1 g of (NH4)2SO4, 0.2 g of KCl, 0.25 g of MgSO4·7H2O, 5 g of Ca3(PO4)2, 5 g of MgCl2, 20 g of agar, 1000 mL of distilled water, pH 7.0 ± 0.2;

[0021] 4. DF medium: Purchased from Beijing Coolaber Technology Co., Ltd., product number: M6150;

[0022] 5. ADF medium: Replace (NH4)2SO4 in DF medium with ACC;

[0023] 6. CAS detection medium: 60.5 mg of chrome azurol S (CAS), 72.9 mg of hexadecyltrimethylammonium bromide (HDTMA), 2.645 mg of ferric chloride hexahydrate, 9000 mg of agar, 295.25 mg of sodium dihydrogen phosphate dihydrate, 1213.5 mg of disodium hydrogen phosphate dodecahydrate, 125 mg of ammonium chloride, 37.5 mg of potassium dihydrogen phosphate, 62.5 mg of sodium chloride, 1000 mL of distilled water, pH 6.8 ± 0.1 (25 °C).

[0024] Example 1: Isolation of rhizosphere microorganisms of foxtail millet

[0025] Collect the roots of foxtail millet in the foxtail millet field. The test site is located in Xinhui Town, Aohan Banner, Chifeng City, Inner Mongolia Autonomous Region. The geographical coordinates of the test site are 42°30′53″N, 119°92′62″E, and the altitude is 601 m. Select the root samples of foxtail millet planted in dry land in the test area. Gently shake the roots of foxtail millet, remove a large amount of soil, and retain the soil about 1 mm attached to the surface of the roots of foxtail millet. Add 1 g of root soil to 99 mL of sterile normal saline, place it on a shaker at 30 °C and 150 rpm for 30 min to evenly disperse the rhizosphere soil particles into a suspension, let it stand for several minutes, and absorb the supernatant. Use the gradient dilution method to perform 10-fold gradient dilution on the above bacterial suspension, and take 10 -3 10 -4, 10 -5 The three concentration diluents were spread on 1 / 2 R2A medium and incubated at a constant temperature of 28°C. After single colonies grew on the plate, colonies with different morphological characteristics were selected according to the growth state, color, and strain size of the colonies, and purified by the four-zone streaking method.

[0026] Example 2: 1. Identification of the strain

[0027] (1) Morphological, physiological, and biochemical characteristics of the strain

[0028] A strain was isolated from Example 1 and named Priestia aryabhattai M6. It was Gram-positive, with light yellow, round, semi-transparent, mucous, moist, and smooth colonies (as Figure 1 shown).

[0029] (2) 16S rRNA gene identification

[0030] Using the genomic DNA of the strain obtained by isolation and purification as a template, with 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT) as primers, the 16S rRNA gene of the strain was amplified by PCR. After the PCR product was detected by 1% agarose gel electrophoresis, it was entrusted to BGI Genomics Co., Ltd. for sequencing. The sequencing results were submitted to the NCBI database for BLAST alignment to obtain the strain with the highest similarity. It was found that the strain M6 of the present invention had a 100% similarity with the strain of Priestia aryabhattai strain 22821. Combining the above physiological and biochemical characteristics and 16S rRNA gene sequence analysis, the strain Priestia aryabhattai M6 of the present invention should belong to the genus Priestia aryabhattai.

[0031] Preservation information:

[0032] Priestia aryabhattai M6, preservation unit: China Center for Type Culture Collection, preservation address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, preservation number: CCTCC No: M20242835, preservation date: December 18, 2024.

[0033] 2. Identification of the strain's growth-promoting characteristics

[0034] (1) Determination of nitrogen fixation ability

[0035] Inoculate strain M6 onto Ashby nitrogen-free medium and culture it in an incubator at 30 °C for 7 days. Observe whether colonies are formed. If colonies appear, then subculture the single colony continuously for another 2 times. The strain that can still grow stably on Ashby nitrogen-free medium in the 3rd generation indicates that it has nitrogen fixation ability.

[0036] (2) Determination of inorganic phosphorus solubilizing ability

[0037] Inoculate the tested strains into NBRIP inorganic phosphorus medium, observe and measure the size of the phosphorus solubilizing halo formed by each strain to preliminarily determine the phosphorus solubilizing ability of the strains for qualitative determination.

[0038] (3) Determination of IAA production activity

[0039] Inoculate strain M6 into LB liquid medium containing 0.5 g·L -1 L-tryptophan, culture it on a shaker at 30 °C and 120 rpm for 24 h. After the culture is completed, take 2 mL of the bacterial liquid and centrifuge it at 10000 rpm for 15 min. Take 1 mL of the supernatant and add 1 mL of Salkowski colorimetric solution, mix well, observe the color change after reacting in the dark for 30 min. If the color turns red, it indicates that the strain can secrete IAA. Quantitatively measure the absorbance value of the sample at 530 nm, and calculate the IAA content according to the standard curve. Set 3 replicates for each sample.

[0040] (4) Determination of siderophore production ability

[0041] Culture and activate the tested strains in the basal medium. Spot-inoculate the bacterial liquid on the CAS agar medium. The appearance of an obvious orange or yellow halo indicates that the strain can produce siderophores.

[0042] (5) Determination of the property of producing ACC deaminase

[0043] Take sterile centrifuge tubes and add DF (ammonium sulfate-free) medium, DF medium, and ADF medium respectively. Inoculate the purified strains into the three different media and culture them on a shaker (28 °C, 120 rpm) to measure OD 600 , to determine their growth status. Growing in ADF medium but not in DF medium indicates that the strain can grow with ACC as the sole nitrogen source, that is, it can produce ACC deaminase;

[0044] The results are shown in Table 1;

[0045] Table 1 Growth-promoting characteristics of Priestia aryabhattai M6

[0046]

[0047] Example 3: Preparation of M6 bacterial suspension and its growth-promoting effect on foxtail millet seedlings

[0048] (1) Preparation of M6 Bacterial Suspension

[0049] Inoculate the well-activated bacterial solution on the plate into 50 mL of LB liquid medium at an inoculation amount of 1%, and place it in a shaker for 48 h, with a temperature of 30 °C and a rotation speed of 180 rpm. Centrifuge the cultured bacterial solution at 8000 rpm and room temperature for 10 min, resuspend it with sterile water, and prepare a bacterial suspension with an OD 600 of 1.0 for standby.

[0050] (2) M6 Inoculation Experiment on Foxtail Millet Seedlings in Pot

[0051] Select uniformly sized and plump Jinmiao K seeds, surface disinfect and imbibe the seeds and then thoroughly wash them before sowing. Sow 10 seeds in each pot, and the soil matrix composition is: field soil: vermiculite = 1:1. Put 100 g of the tested soil in each pot. The control group sows directly, and the experimental group soaks the seeds in 20 mL of the bacterial suspension for 2 h and then sows. There are 5 replicates for both the inoculated and non-inoculated treatments. After growing in an artificial climate chamber (16 / 8 h light-dark cycle, relative humidity 50% - 60%) for 7 d and all the seeds have germinated, keep 6 seedlings with consistent growth in each pot for thinning. Inoculate the prepared M6 bacterial suspension around the roots of the foxtail millet seedlings at 10 mL per pot, and irrigate the control with sterile water. The potted plants are cultured for 21 d and then the foxtail millet seedlings are harvested, and the plant height, root length, and dry weights of the above-ground and underground parts of the foxtail millet are measured.

[0052] The results are shown in Table 2 and Figure 2 as follows;

[0053] Table 2 Growth Promotion Effect of M6 Bacterial Suspension on Foxtail Millet Seedlings

[0054]

[0055] As can be seen from the above, the increases in plant height and root length of the plants under the treatment of strain M6 compared with the control reached 52.59% and 21.62% respectively; after the M6 treatment, the dry weights of the above-ground and underground parts increased by 70.38% and 165.21% respectively, which were significantly higher than the control.

[0056] Example 4: Growth Promotion Effect of Applying M6 Bacterial Agent at Different Times on Foxtail Millet

[0057] Surface disinfect and thoroughly wash the seeds and then sow them in the inoculated or non-inoculated manner. Put 500 g of the tested soil in each pot, sow 10 seeds in each pot, and thin to 8 seedlings. The potted plants are cultured for 30 d and then the foxtail millet seedlings are harvested, and the plant height, and dry weights of the above-ground and underground parts of the foxtail millet are measured.

[0058] The potted plants were inoculated according to 5 different treatments, with 5 replicates in each group. CK was the control group, that is, normal sowing and watering; M61 represented irrigating 10 mL of M6 bacterial solution to the soil 7 days before sowing; M62 represented irrigating the bacterial solution 7 days before sowing and soaking the seeds with the bacterial solution at sowing; M63 represented only soaking the seeds with the bacterial solution at sowing; M64 represented soaking the seeds with the bacterial solution at sowing and irrigating 10 mL of the bacterial solution again 7 days after sowing; The results are shown in Table 3 and Figure 3 as follows.

[0059] Table 3 Effects of different M6 application times on growth indexes of foxtail millet seedlings

[0060]

[0061] Note: In the figure, CK is the control group, M61 represents irrigating the bacterial solution 7 days before sowing; M62 represents irrigating the bacterial solution 7 days before sowing and soaking the seeds with the bacterial solution at sowing; M63 represents only soaking the seeds with the bacterial solution at sowing; M64 represents soaking the seeds with the bacterial solution at sowing and irrigating once again 7 days after sowing.

[0062] The results showed that there was no difference in the growth indexes of foxtail millet seedlings between the M61 treatment and the control, indicating that inoculating the bacterial agent into the soil before sowing did not promote the growth of foxtail millet. There were significant differences in the plant height, aboveground and underground dry weights of foxtail millet seedlings between the M63 treatment and the control, suggesting that soaking the seeds at sowing was the most important and could significantly promote the growth of foxtail millet. The underground dry weight of foxtail millet in the M64 treatment was higher than that in the M63 treatment, indicating that the inoculation method of soaking the seeds at sowing and irrigating the bacterial solution 7 days after sowing had the best effect on promoting the growth of foxtail millet; Furthermore, it was concluded that inoculating foxtail millet with the M6 bacterial agent could significantly promote the growth of foxtail millet seedlings, significantly increase the plant height, root length, aboveground and underground biomass of foxtail millet. Using M6 as a microbial bacterial agent, soaking the seeds at sowing and irrigating the bacterial solution once 7 days after sowing had the best effect on promoting the growth of foxtail millet.

[0063] In summary: Priestia aryabhattai M6 of the present invention has a significant growth-promoting function for foxtail millet. Through experimental verification, this strain has growth-promoting characteristics such as nitrogen fixation, phosphorus solubilization, IAA (indole-3-acetic acid) production, and siderophore production, and can significantly increase the biomass of foxtail millet at the seedling stage. Compared with the control group, the foxtail millet seedlings inoculated with the M6 strain had significant increases in plant height, root length, aboveground and underground dry weights. In addition, under the inoculation method of soaking the seeds at sowing and irrigating the bacterial solution once 7 days after sowing, the M6 strain of the present invention had the best effect on promoting the growth of foxtail millet, providing strong technical support for the yield increase of foxtail millet.

[0064] Priestia aryabhattai M6 of the present invention and its application method not only contribute to the growth and development of foxtail millet crops and increase the yield, but also help to improve the soil environment and reduce the use of chemical fertilizers, which is of great significance for promoting the sustainable development of agriculture.

[0065] Embodiments of the present invention are provided for purposes of illustration and description. Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A plant growth-promoting Priestia aryabhattai M6, characterized in that: The growth-promoting Priestia aryabhattai M6 is deposited in the China Center for Type Culture Collection, with the deposit number CCTCC No: M20242835, and the deposit date is December 18, 2024.

2. A microbial preparation containing Priestia aryabhattai M6 as described in claim 1.

3. Use of the Priestia aryabhattai M6 as described in claim 1 or the microbial preparation as described in claim 2 in promoting the growth of foxtail millet.

Citation Information

Cited By

  • Complex microbial inoculant for promoting quality improvement and yield increase of alfalfa as well as preparation method and application of complex microbial inoculant

    CN121086939A

  • Prussella adamsii, microbial agent and application of Prussella adamsii and microbial agent

    CN121610411A

  • Desert plant endophyte, microbial agent and application

    CN121699802A

  • Plant growth-promoting rhizobacteria HB-63 and application thereof

    CN121718464A