Fusion proteins and methods for stimulating plant growth, protecting plants, and immobilizing Bacillus spores on plants

By using a fusion protein expressed in a recombinant Bacillus cereus family member, the challenges of delivering and maintaining the activity of peptides and proteins in the soil are addressed, achieving enhanced plant growth, stress tolerance, and pathogen protection.

JP7688962B2Active Publication Date: 2025-06-05BAYER CROPSCIENCE LP
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
JP2020073437
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2013-03-15
Filing Date
2020-04-16
Publication Date
2025-06-05
Estimated Expiration
2034-03-17

AI Technical Summary

Technical Problem

Existing methods struggle to efficiently deliver peptides, enzymes, and proteins to plant roots and maintain their activity in the soil, due to proteases and harsh environmental conditions in the rhizosphere.

Method used

A fusion protein containing a targeting sequence, an exosporium protein, or an exosporium protein fragment, combined with plant growth-stimulating proteins or peptides, is expressed in a recombinant Bacillus cereus family member, allowing for targeted delivery and attachment to plant roots.

Benefits of technology

The method effectively stimulates plant growth, enhances stress tolerance, and protects plants from pathogens by maintaining the activity of the fusion proteins on plant roots and in the rhizosphere.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007688962000049
    Figure 0007688962000049
  • Figure 0007688962000050
    Figure 0007688962000050
  • Figure 0007688962000001
    Figure 0007688962000001
Patent Text Reader

Abstract

To provide methods for protecting plants from pathogens.SOLUTION: The invention relates to recombinant Bacillus cereus family members expressing fusion proteins, and application of formulations containing the recombinant Bacillus cereus family members expressing fusion proteins.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 61 / 799,262, filed on March 15, 2013, which is hereby incorporated by reference in its entirety.

[0002] The present invention generally relates to a targeting sequence that directs a fusion protein to the exosporium of a member of the Bacillus cereus family, an exosporium protein, or a fusion protein containing an exosporium protein fragment. The present invention also relates to a member of the recombinant Bacillus cereus family that expresses such a fusion protein, or a formulation containing a member of the recombinant Bacillus cereus family that expresses the fusion protein. The present invention further relates to a method for stimulating plant growth, protecting plants from pathogens, and enhancing stress tolerance in plants by applying a member of the recombinant Bacillus cereus family or the formulation to a plant or a plant growth environment. The present invention also relates to a method for immobilizing spores of a member of the recombinant Bacillus cereus family that expresses a fusion protein on a plant or a plant material.

Background Art

[0003] The area around a plant root is a region called the rhizosphere. In the rhizosphere, bacteria, fungi, and other organisms compete for nutrients and compete to bind to the plant root tissue. Both harmful bacteria and fungi, as well as beneficial bacteria and fungi, can dominate the rhizosphere. Bacteria, fungi, and the plant root system can all be affected by the action of peptides, enzymes, and other proteins in the rhizosphere. Treating plants with soil additives or specific ones of these peptides, enzymes, or other proteins can have beneficial effects on the entire group of beneficial soil bacteria and fungi, creating a more healthy soil environment for plant growth, improving plant growth, and protecting the plant against specific bacterial and fungal pathogens. However, in the past, attempts have been made to introduce peptides, enzymes, and other proteins to bring such beneficial effects to plants, but it has been difficult to maintain the activity of enzymes, proteins, and peptides in the soil, and these attempts have ended in failure. Furthermore, since there are proteases widely present naturally in the soil, proteins are decomposed in the soil. The environment around the plant root (rhizosphere) is a unique mixture of bacteria, fungi, nutrients, and roots that is different from the original soil quality. The symbiotic relationship between these organisms is unique and may be able to incorporate exogenous proteins and modify them for the better. When high concentrations of fungi and bacteria are present in the rhizosphere, the proteases and other harmful factors against proteins in the soil reach abnormally high levels, resulting in even more protein degradation. Moreover, the enzymes and other proteins introduced into the soil are rapidly dissipated from the plant roots.

[0004] Therefore, in the art, there is a need for methods to efficiently deliver peptides, enzymes, and other proteins to plants (such as plant root systems) and extend the period during which these molecules maintain their activity. Furthermore, in the art, there is a need for methods to selectively direct these peptides, enzymes, and proteins to the rhizosphere and the leaves of plants, and particularly to plant roots. SUMMARY OF THE INVENTION

[0005] The present invention aims at a fusion protein containing at least one plant growth-stimulating protein or peptide, at least one protein or peptide enhancing plant stress tolerance, or at least one plant-binding protein or peptide. The plant growth-stimulating protein or peptide contains a peptide hormone, a non-hormone peptide, or an enzyme involved in the production or activation of a plant growth-stimulating compound. The fusion protein also contains a targeting sequence, an exosporium protein, or an exosporium protein fragment. The targeting sequence, exosporium protein, or exosporium protein fragment is: (a) a targeting sequence containing an amino acid sequence having at least about 43% identity with amino acids 20 to 35 of SEQ ID NO: 1, wherein the identity with amino acids 25 to 35 is at least about 54%, the targeting sequence; (b) a targeting sequence containing amino acids 1 to 35 of SEQ ID NO: 1; (c) a targeting sequence containing amino acids 20 to 35 of SEQ ID NO: 1; (d) a targeting sequence containing SEQ ID NO: 1; (e) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 2; (f) a targeting sequence containing amino acids 1 to 27 of SEQ ID NO: 3; (g) a targeting sequence containing amino acids 12 to 27 of SEQ ID NO: 3; (h) a targeting sequence containing SEQ ID NO: 3; (i) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 4; (j) a targeting sequence containing amino acids 1 to 38 of SEQ ID NO: 5; (k) a targeting sequence containing amino acids 23 to 38 of SEQ ID NO: 5; (l) a targeting sequence containing SEQ ID NO: 5; (m) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 6; (n) a targeting sequence containing amino acids 1 to 28 of SEQ ID NO: 7; (o) a targeting sequence containing amino acids 13 to 28 of SEQ ID NO: 7; (p) a targeting sequence containing SEQ ID NO: 7; (q) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 8; (r) a targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 9; (s) a targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 9; (t) a targeting sequence containing SEQ ID NO: 9;An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 10; (v) a targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 11; (w) a targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 11; (x) a targeting sequence containing SEQ ID NO: 11; (y) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 12; (z) a targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 13; (aa) a targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 13; (ab) a targeting sequence containing SEQ ID NO: 13; (ac) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 14; (ad) a targeting sequence containing amino acids 1 to 43 of SEQ ID NO: 15; (ae) a targeting sequence containing amino acids 28 to 43 of SEQ ID NO: 15; (af) a targeting sequence containing SEQ ID NO: 15; (ag) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 16; (ah) a targeting sequence containing amino acids 1 to 27 of SEQ ID NO: 17; (ai) a targeting sequence containing amino acids 12 to 27 of SEQ ID NO: 17; (aj) a targeting sequence containing SEQ ID NO: 17; (ak) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 18; (al) a targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 19; (am) a targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 19; (an) a targeting sequence containing SEQ ID NO: 19; (ao) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 20; (ap) a targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 21; (aq) a targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 21; (ar) a targeting sequence containing SEQ ID NO: 21; (as) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 22; (at) a targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 23; (au) a targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 23; (av) a targeting sequence containing SEQ ID NO: 23; (aw) an exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 24;(ax) A targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 25; (ay) A targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 25; (az) A targeting sequence containing SEQ ID NO: 25; (ba) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 26; (bb) A targeting sequence containing amino acids 1 to 30 of SEQ ID NO: 27; (bc) A targeting sequence containing amino acids 15 to 30 of SEQ ID NO: 27; (bd) A targeting sequence containing SEQ ID NO: 27; (be) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 28; (bf) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 29; (bg) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 29; (bh) A targeting sequence containing SEQ ID NO: 29; (bi) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 30; (bj) A targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 31; (bk) A targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 31; (bl) A targeting sequence containing SEQ ID NO: 31; (bm) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 32; (bn) A targeting sequence containing amino acids 1 to 15 of SEQ ID NO: 33; (bo) A targeting sequence containing SEQ ID NO: 33; (bp) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 34; (bq) A targeting sequence containing amino acids 1 to 16 of SEQ ID NO: 35; (br) A targeting sequence containing SEQ ID NO: 35; (bs) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 36; (bt) A targeting sequence containing amino acids 1 to 29 of SEQ ID NO: 43; (bu) A targeting sequence containing amino acids 14 to 29 of SEQ ID NO: 43; (bv) A targeting sequence containing SEQ ID NO: 43; (bw) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 44; (bx) A targeting sequence containing amino acids 1 to 35 of SEQ ID NO: 45; (by) A targeting sequence containing amino acids 20 to 35 of SEQ ID NO: 45; (bz) A targeting sequence containing SEQ ID NO: 45;(ca) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 46; (cb) A targeting sequence containing amino acids 1 to 43 of SEQ ID NO: 47; (cc) A targeting sequence containing amino acids 28 to 43 of SEQ ID NO: 47; (cd) A targeting sequence containing SEQ ID NO: 47; (ce) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 48; (cf) A targeting sequence containing amino acids 1 to 32 of SEQ ID NO: 49; (cg) A targeting sequence containing amino acids 17 to 32 of SEQ ID NO: 49; (ch) A targeting sequence containing SEQ ID NO: 49; (ci) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 50; (cj) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 51; (ck) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 51; (cl) A targeting sequence containing SEQ ID NO: 51; (cm) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 52; (cn) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 53; (co) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 53; (cp) A targeting sequence containing SEQ ID NO: 53; (cq) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 54; (cr) A targeting sequence containing amino acids 1 to 30 of SEQ ID NO: 55; (cs) A targeting sequence containing amino acids 15 to 30 of SEQ ID NO: 55; (ct) A targeting sequence containing SEQ ID NO: 55; (cu) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 56; (cv) A targeting sequence containing amino acids 1 to 130 of SEQ ID NO: 57; (cw) A targeting sequence containing amino acids 115 to 130 of SEQ ID NO: 57; (cx) A targeting sequence containing SEQ ID NO: 57; (cy) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 58; (cz) An exosporium protein fragment containing an amino acid sequence having at least 85% identity with SEQ ID NO: 59; (da) A targeting sequence containing SEQ ID NO: 60; (db) A targeting sequence containing SEQ ID NO: 61; (dc) A targeting sequence containing SEQ ID NO: 62; (dd) A targeting sequence containing SEQ ID NO: 63;(de) Targeting sequence containing SEQ ID NO: 64; (df) Targeting sequence containing SEQ ID NO: 65; (dg) Targeting sequence containing SEQ ID NO: 66; (dh) Targeting sequence containing SEQ ID NO: 67; (di) Targeting sequence containing SEQ ID NO: 68; (dj) Targeting sequence containing SEQ ID NO: 69; (dk) Targeting sequence containing SEQ ID NO: 70; (dl) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 71; (dm) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 72; (dn) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 73; (do) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 74; (dp) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 75; (dq) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 76; (dr) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 77; (ds) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 78; (dt) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 79; (du) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 80; (dv) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 81; (dw) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 82; (dx) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 83; (dy) Exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 84; (dz) Targeting sequence containing amino acids 22 - 31 of SEQ ID NO: 1; (ea) Targeting sequence containing amino acids 22 - 33 of SEQ ID NO: 1; (eb) Targeting sequence containing amino acids 20 - 31 of SEQ ID NO: 1; (ec) Targeting sequence containing amino acids 14 - 23 of SEQ ID NO: 3;(ed) a targeting sequence containing amino acids 14 to 25 of SEQ ID NO: 3; or, (ef) a targeting sequence containing amino acids 12 to 23 of SEQ ID NO: 3 may also be used.

[0006] The present invention also aims at a fusion protein containing at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a protein or peptide that defends a plant from a pathogen. The targeting sequence, exosporium protein, or exosporium protein fragment is: (a) a targeting sequence consisting of 16 amino acids and having an amino acid sequence with at least about 43% identity to amino acids 20 - 35 of SEQ ID NO: 1, wherein the identity to amino acids 25 - 35 is at least about 54%; (b) a targeting sequence consisting of amino acids 1 - 35 of SEQ ID NO: 1; (c) a targeting sequence consisting of amino acids 20 - 35 of SEQ ID NO: 1; (d) a targeting sequence consisting of SEQ ID NO: 1; (e) a targeting sequence containing SEQ ID NO: 60; (f) a targeting sequence containing amino acids 1 - 27 of SEQ ID NO: 3; (g) a targeting sequence containing amino acids 12 - 27 of SEQ ID NO: 3; (h) a targeting sequence containing SEQ ID NO: 3; (i) an exosporium protein containing an amino acid sequence with at least 85% identity to SEQ ID NO: 4; (j) a targeting sequence containing amino acids 1 - 38 of SEQ ID NO: 5; (k) a targeting sequence containing amino acids 23 - 38 of SEQ ID NO: 5; (l) a targeting sequence containing SEQ ID NO: 5; (m) an exosporium protein containing an amino acid sequence with at least 85% identity to SEQ ID NO: 6; (n) a targeting sequence containing amino acids 1 - 28 of SEQ ID NO: 7; (o) a targeting sequence containing amino acids 13 - 28 of SEQ ID NO: 7; (p) a targeting sequence containing SEQ ID NO: 7; (q) an exosporium protein containing an amino acid sequence with at least 85% identity to SEQ ID NO: 8; (r) a targeting sequence containing amino acids 1 - 24 of SEQ ID NO: 9; (s) a targeting sequence containing amino acids 9 - 24 of SEQ ID NO: 9; (t) a targeting sequence containing SEQ ID NO: 9; (u) an exosporium protein containing an amino acid sequence with at least 85% identity to SEQ ID NO: 10; (v) a targeting sequence containing amino acids 1 - 33 of SEQ ID NO: 11; (w) a targeting sequence containing amino acids 18 - 33 of SEQ ID NO: 11; (x) a targeting sequence containing SEQ ID NO: 11; (y) an exosporium protein containing an amino acid sequence with at least 85% identity to SEQ ID NO: 12;(z) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 13; (aa) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 13; (ab) A targeting sequence containing SEQ ID NO: 13; (ac) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 14; (ad) A targeting sequence containing amino acids 1 to 43 of SEQ ID NO: 15; (ae) A targeting sequence containing amino acids 28 to 43 of SEQ ID NO: 15; (af) A targeting sequence containing SEQ ID NO: 15; (ag) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 16; (ah) A targeting sequence containing amino acids 1 to 27 of SEQ ID NO: 17; (ai) A targeting sequence containing amino acids 12 to 27 of SEQ ID NO: 17; (aj) A targeting sequence containing SEQ ID NO: 17; (ak) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 18; (al) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 19; (am) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 19; (an) A targeting sequence containing SEQ ID NO: 19; (ao) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 20; (ap) A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 21; (aq) A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 21; (ar) A targeting sequence containing SEQ ID NO: 21; (as) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 22; (at) A targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 23; (au) A targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 23; (av) A targeting sequence containing SEQ ID NO: 23; (aw) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 24; (ax) A targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 25; (ay) A targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 25; (az) A targeting sequence containing SEQ ID NO: 25; (ba) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 26; (bb) A targeting sequence containing amino acids 1 to 30 of SEQ ID NO: 27; (bc) A targeting sequence containing amino acids 15 to 30 of SEQ ID NO: 27;(bd)A targeting sequence containing SEQ ID NO: 27; (be)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 28; (bf)A targeting sequence containing amino acids 1 to 33 of SEQ ID NO: 29; (bg)A targeting sequence containing amino acids 18 to 33 of SEQ ID NO: 29; (bh)A targeting sequence containing SEQ ID NO: 29; (bi)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 30; (bj)A targeting sequence containing amino acids 1 to 24 of SEQ ID NO: 31; (bk)A targeting sequence containing amino acids 9 to 24 of SEQ ID NO: 31; (bl)A targeting sequence containing SEQ ID NO: 31; (bm)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 32; (bn)A targeting sequence containing amino acids 1 to 15 of SEQ ID NO: 33; (bo)A targeting sequence containing SEQ ID NO: 33; (bp)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 34; (bq)A targeting sequence containing amino acids 1 to 16 of SEQ ID NO: 35; (br)A targeting sequence containing SEQ ID NO: 35; (bs)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 36; (bt)A targeting sequence containing amino acids 1 to 29 of SEQ ID NO: 43; (bu)A targeting sequence containing amino acids 14 to 29 of SEQ ID NO: 43; (bv)A targeting sequence containing SEQ ID NO: 43; (bw)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 44; (bx)A targeting sequence containing amino acids 1 to 35 of SEQ ID NO: 45; (by)A targeting sequence containing amino acids 20 to 35 of SEQ ID NO: 45; (bz)A targeting sequence containing SEQ ID NO: 45; (ca)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 46; (cb)A targeting sequence containing amino acids 1 to 43 of SEQ ID NO: 47; (cc)A targeting sequence containing amino acids 28 to 43 of SEQ ID NO: 47; (cd)A targeting sequence containing SEQ ID NO: 47; (ce)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 48; (cf)A targeting sequence containing amino acids 1 to 32 of SEQ ID NO: 49;(cg) A targeting sequence containing amino acids 17 - 32 of SEQ ID NO: 49; (ch) A targeting sequence containing SEQ ID NO: 49; (ci) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 50; (cj) A targeting sequence containing amino acids 1 - 33 of SEQ ID NO: 51; (ck) A targeting sequence containing amino acids 18 - 33 of SEQ ID NO: 51; (cl) A targeting sequence containing SEQ ID NO: 51; (cm) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 52; (cn) A targeting sequence containing amino acids 1 - 33 of SEQ ID NO: 53; (co) A targeting sequence containing amino acids 18 - 33 of SEQ ID NO: 53; (cp) A targeting sequence containing SEQ ID NO: 53; (cq) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 54; (cr) A targeting sequence containing amino acids 1 - 30 of SEQ ID NO: 55; (cs) A targeting sequence containing amino acids 15 - 30 of SEQ ID NO: 55; (ct) A targeting sequence containing SEQ ID NO: 55; (cu) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 56; (cv) A targeting sequence containing amino acids 1 - 130 of SEQ ID NO: 57; (cw) A targeting sequence containing amino acids 115 - 130 of SEQ ID NO: 57; (cx) A targeting sequence containing SEQ ID NO: 57; (cy) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 58; (cz) An exosporium protein fragment containing an amino acid sequence having at least 85% identity with SEQ ID NO: 59; (da) A targeting sequence containing SEQ ID NO: 61; (db) A targeting sequence containing SEQ ID NO: 62; (dc) A targeting sequence containing SEQ ID NO: 63; (dd) A targeting sequence containing SEQ ID NO: 64; (de) A targeting sequence containing SEQ ID NO: 65; (df) A targeting sequence containing SEQ ID NO: 66; (dg) A targeting sequence containing SEQ ID NO: 67; (dh) A targeting sequence containing SEQ ID NO: 68; (di) A targeting sequence containing SEQ ID NO: 69; (dj) A targeting sequence containing SEQ ID NO: 70; (dk) An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 71;(dl)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 72; (dm)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 73; (dn)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 74; (do)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 75; (dp)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 76; (dq)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 77; (dr)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 78; (ds)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 79; (dt)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 80; (du)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 81; (dv)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 82; (dw)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 83; (dx)An exosporium protein containing an amino acid sequence having at least 85% identity with SEQ ID NO: 84; (dy)A targeting sequence containing amino acids 22 - 31 of SEQ ID NO: 1; (dz)A targeting sequence containing amino acids 22 - 33 of SEQ ID NO: 1; (ea)A targeting sequence consisting of amino acids 22 - 33 of SEQ ID NO: 1; (eb)A targeting sequence containing amino acids 14 - 23 of SEQ ID NO: 3; (ec)A targeting sequence containing amino acids 14 - 25 of SEQ ID NO: 3; or, (ed)A targeting sequence containing amino acids 12 - 23 of SEQ ID NO: 3, may also be used.

[0007] The present invention further aims at a fusion protein containing at least one of a targeting sequence, an exosporium protein or an exosporium protein fragment, and a protein or peptide that defends a plant from a pathogen. The protein or peptide that defends a plant from a pathogen may contain harpin, α-elastin, β-elastin, cystatin, phenylalanine ammonia-lyase, ericin, defensin, cryptogein, fragerin protein, fragerin peptide, bacteriocin, lysozyme, lysozyme peptide, siderophore, non-ribosomal active peptide, conalbumin, albumin, lactoferrin, lactoferrin peptide, or TasA. Alternatively, the protein or peptide that defends a plant from a pathogen has insecticidal activity, anthelmintic activity, or suppresses predation of insects or helminths, or a combination thereof. Alternatively, the protein that defends a plant from a pathogen contains an enzyme. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments listed in the above paragraph

[0005] .

[0008] The present invention also aims at a fusion protein containing at least one of a target protein or peptide and an exosporium protein. The exosporium protein may be an exosporium protein containing an amino acid sequence having at least 85% identity with any one of SEQ ID NOs: 71, 75, 80, 81, 82, 83, and 84.

[0009] The present invention further relates to a member of the recombinant Bacillus cereus family that expresses any of the fusion proteins.

[0010] The present invention also aims at a formulation containing any member of the recombinant Bacillus cereus family and an agriculturally acceptable carrier.

[0011] The present invention also relates to a method for stimulating plant growth. The method includes introducing into the plant growth environment any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one plant growth-stimulating protein or peptide, or a formulation containing any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one plant growth-stimulating protein or peptide. Alternatively, the method includes applying to the plant or plant seeds, or to the area surrounding the plant or plant seeds, any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one plant growth-stimulating protein or peptide, or a formulation containing any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one plant growth-stimulating protein or peptide. The plant growth-stimulating protein or peptide is physically attached to the exosporium of a member of the recombinant Bacillus family.

[0012] The present invention also aims at a method for stimulating plant growth. The method includes introducing into the plant growth environment a member of the recombinant Bacillus cereus family that expresses a fusion protein, or applying to the plant, plant seeds, or the area surrounding the plant or plant seeds, a member of the recombinant Bacillus cereus family that expresses a fusion protein. The fusion protein contains at least one plant growth-stimulating protein or peptide, and a targeting sequence, an exosporium protein, or an exosporium protein fragment. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of those listed in the above paragraph

[0005] . The plant growth-stimulating protein or peptide is physically attached to the exosporium of a member of the recombinant Bacillus cereus family.

[0013] The present invention further relates to a method for protecting plants from pathogens or enhancing stress tolerance in plants. The method includes introducing into the plant growth environment any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one protein or peptide that protects plants from pathogens or at least one protein or peptide that enhances stress tolerance in plants, or any preparation containing any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one protein or peptide that protects plants from pathogens or at least one protein or peptide that enhances stress tolerance in plants. Alternatively, the method includes applying to the plant, plant seeds, or the area surrounding the plant any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one protein or peptide that protects plants from pathogens or at least one protein or peptide that enhances stress tolerance in plants, or any preparation containing any member of the recombinant Bacillus cereus family that expresses a fusion protein containing at least one protein or peptide that protects plants from pathogens or at least one protein or peptide that enhances stress tolerance in plants. The protein or peptide that protects plants from pathogens or the protein or peptide that enhances stress tolerance in plants is physically attached to the exosporium of a member of the recombinant Bacillus cereus family.

[0014] The present invention also aims to provide a method for immobilizing spores of a member of the Bacillus cereus family in plants. The method includes introducing into the plant growth environment any member of the Bacillus cereus family expressing at least one plant-binding protein or peptide, or any preparation containing any member of the Bacillus cereus family expressing at least one plant-binding protein or peptide. Alternatively, the method includes applying to the plant, plant seed, or the surrounding area of the plant or plant seed any member of the Bacillus cereus family expressing at least one plant-binding protein or peptide, or any preparation containing any member of the Bacillus cereus family expressing at least one plant-binding protein or peptide. The plant-binding protein or peptide is physically attached to the exosporium of the member of the Bacillus cereus family.

[0015] Other objectives and characteristics will be apparent in some parts and pointed out in some parts hereinafter.

Brief Description of the Drawings

[0016]

Figure 1

[0017]

Figure 2

[0018] Definitions As used herein, the words "a," "an," and "the," and the word "said" have the meaning of "at least one" or "one or more" unless otherwise indicated.

[0019] The terms "comprising," "including," and "having" are intended to be inclusive and mean that there may be additional elements other than the recited elements.

[0020] The term "bioactive peptide" refers to any peptide that exhibits biological activity. A "bioactive peptide" may be produced, for example, via cleavage of a protein, peptide, proprotein, or preproprotein by a protease or peptidase.

[0021] "Enzymes involved in the production or activation of plant growth-stimulating compounds" includes any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or modifies the structure of a plant, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or modifies the structure of a plant to the active form or a more highly active form of the compound. Such compounds include, but are not limited to, for example, small molecule plant hormones such as auxin and cytokinin, bioactive peptides, and plant growth-stimulating small molecules synthesized by bacteria or fungi in the rhizosphere (e.g., 2,3-butanediol).

[0022] As used herein, the term "fusion protein" refers to a protein having a polypeptide sequence that contains sequences obtained from two or more different proteins. A fusion protein may be produced by covalently joining together a nucleic acid molecule encoding all or part of a first polypeptide and a nucleic acid molecule encoding all or part of a second polypeptide in order to generate a nucleic acid sequence that, when expressed, produces a single polypeptide having the functional properties derived from each of the original proteins.

[0023] The term "fixing spores of a member of the recombinant Bacillus cereus family on a plant" refers to binding spores of a member of the Bacillus cereus family to a plant (e.g., the roots of a plant or the aerial parts of a plant such as, for example, leaves, stems, flowers, or fruits), such that the spores are maintained on the root structure or aerial parts of the plant instead of being dissipated in the plant growth environment or the surrounding environment of the aerial parts of the plant.

[0024] The "plant growth environment" includes any substance that can support the growth of a plant.

[0025] As used herein, the "protein or peptide that enhances the plant immune system" includes any protein or peptide that has a beneficial effect on the plant immune system.

[0026] As used herein, the term "protein or peptide that stimulates plant growth" includes any protein or peptide that increases the growth of a plant when the plant is exposed to the protein or peptide.

[0027] As used herein, the "protein or peptide that defends a plant from a pathogen" includes any protein or peptide that makes a plant exposed to the protein or peptide less susceptible to infection by a pathogen.

[0028] As used herein, the "protein or peptide that enhances stress tolerance in a plant" includes any protein or peptide that makes a plant exposed to the protein or peptide more tolerant to stress.

[0029] The term "plant-binding protein or peptide" refers to any peptide or protein that can specifically or non-specifically bind to any part of a plant (e.g., the roots of a plant or the aerial parts such as, for example, branches, leaves, stems, flowers, or fruits) or plant substances.

[0030] As used herein, the term "targeting sequence" refers to a polypeptide sequence that, when present as part of a longer polypeptide or protein, localizes the longer polypeptide or protein to a specific intracellular location within a cell. The targeting sequences described herein result in the localization of proteins to the exosporium of members of the Bacillus cereus family.

DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention relates to a targeting sequence, an exosporium protein, or an exosporium protein fragment that directs a fusion protein to the exosporium of a member of the Bacillus cereus family, and: (a) at least one plant growth-stimulating protein or peptide; (b) at least one protein or peptide that defends a plant from a pathogen; (c) at least one protein or peptide that enhances the stress tolerance of a plant; or (d) at least one plant-binding protein or peptide, contained fusion protein. When expressed in bacteria that are members of the Bacillus cereus family, these fusion proteins are directed to the exosporium layer of the spore and physically directed such that the protein or peptide is presented outside of the spore.

[0032] This Bacillus exosporium presentation (BEMD) system can be used to deliver peptides, enzymes, and other proteins to plants (e.g., plant foliage, fruits, flowers, stems, or roots) or to the plant growth environment (e.g., soil, etc.). Peptides, enzymes, and proteins delivered to the soil or other plant growth environments in this method maintain activity and exhibit activity in the soil for a long time. By introducing bacteria that are members of the recombinant Bacillus cereus family expressing the fusion proteins described herein into the soil or the rhizosphere of plants, plant growth is beneficially enhanced under many different soil conditions. By using BEMD to produce these enzymes, it is possible to continue to exert beneficial effects on plants and the rhizosphere over the first few months of plant development.

[0033] Targeting sequences, exosporium proteins, and exosporium protein fragments For ease of reference, the sequence numbers of the peptides and proteins referred to herein are listed in Table 1 below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]

Table 1-8

Table 1-9

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

Table 1-15

Table 1-16

[0034] Bacillus is a genus of rod-shaped bacteria. The Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, and Bacillus weihenstephensis. Under stressful environmental conditions, Bacillus cereus family bacteria can form oval-shaped spores through sporulation and enter a dormant state for a long time. The outermost layer of the spore is known as the exosporium and contains a basal layer surrounded by hair-like projections. The filaments above the hair-like projections are mainly formed by the collagen-like glycoprotein BclA, while the basal layer is composed of many different proteins. Another collagen-related protein, BclB, is also present in the exosporium and is exposed on the spores of members of the Bacillus cereus family. BclA, the main component of the surface projections, is attached to the exosporium at its amino-terminal (N-terminal) located in the basal layer, and its carboxy-terminal (C-terminal) has been shown to extend outside the spore.

[0035] Previously, it has been found that peptides or proteins can be directed to the exosporium of Bacillus cereus spores using certain sequences in the N-terminal regions of BclA and BclB (see U.S. Patent Application Nos. 2010 / 0233124 and 2011 / 0281316, and Thompson et al., Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface, Molecular Microbiology 70(2):421-34 (2008), each of which is incorporated herein by reference in its entirety). Also, the BetA / BAS3290 protein of Bacillus anthracis has been found to localize to the exosporium.

[0036] In particular, it has been found that amino acids 20 to 35 of BclA of Bacillus anthracis Sterne strain are sufficient to direct it towards the exosporium. The sequence alignment of amino acids 1 to 41 of BclA (SEQ ID NO: 1) with the corresponding N-terminal regions of several other exosporium proteins of the Bacillus cereus family having related sequences and proteins of the Bacillus cereus family is shown in Figure 1. As is clear from Figure 1, in the region corresponding to amino acids 20 to 41 of BclA, there are regions of high homology among all the proteins. However, in these sequences, the amino acids corresponding to amino acids 36 to 41 of BclA have a secondary structure and are not essential for the localization of the fusion protein to the exosporium. The conserved targeting sequence regions of BclA (amino acids 20 to 35 of SEQ ID NO: 1) are shown in bold in Figure 1, and they correspond to the minimal targeting sequences required for localization to the exosporium. The sequences underlined in Figure 1 are more highly conserved regions (spanning amino acids 25 to 35 of BclA within the targeting sequence) and are recognition sequences for ExsFA / BxpB / ExsFB and homologs, and direct and assemble the described proteins onto the surface of the exosporium. The amino acid sequences of SEQ ID NOs: 3, 5 and 7 in Figure 1 are the amino acids 1 to 33 of BetA / BAS3290 of Bacillus anthracis Sterne strain, methionine, followed by amino acids 2 to 43 of BAS4623 of Bacillus anthracis Sterne strain, and amino acids 1 to 34 of BclB of Bacillus anthracis Sterne strain, respectively. (For BAS4623, it was found that substituting valine present at the first position of the native protein with methionine resulted in better expression). As is clear from Figure 1, each of these sequences contains a conserved region corresponding to amino acids 20 to 35 of BclA (bold in SEQ ID NO: 1) and contains a more highly conserved region corresponding to amino acids 20 to 35 of BclA (underlined).

[0037] Additional proteins from members of the Bacillus cereus family also contain conserved targeting regions. In particular, in FIG. 1, SEQ ID NO: 9 is amino acids 1-30 of Bacillus anthracis Sterne strain BAS1882, SEQ ID NO: 11 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 2280 gene product, SEQ ID NO: 13 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 3572 gene product, SEQ ID NO: 15 is amino acids 1-49 of the Bacillus cereus VD200 exosporium leader peptide, SEQ ID NO: 17 is amino acids 1-33 of the Bacillus cereus VD166 exosporium leader peptide, SEQ ID NO: 19 is amino acids 1-39 of the Bacillus cereus VD200 hypothetical protein IKG_04663, SEQ ID NO: 21 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 YVTN β-propeller protein, SEQ ID NO: 23 is amino acids 1-30 of the Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, SEQ ID NO: 25 is amino acids 1-30 of the Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, SEQ ID NO: 27 is amino acids 1-36 of the Bacillus weihenstephensis KBAB4 triple helix repeat-containing collagen, SEQ ID NO: 29 is amino acids 1-39 of the Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, SEQ ID NO: 31 is amino acids 1-30 of the Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, SEQ ID NO: 33 is amino acids 1-21 of the Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, SEQ ID NO: 35 is amino acids 1-22 of the Bacillus thuringiensis 35646 collagen triple helix repeat protein, SEQ ID NO: 43 is amino acids 1-35 of the Bacillus cereus hypothetical protein WP_69652, SEQ ID NO: 45 is BacillusAmino acids 1 to 41 of the cereus exosporium leader WP016117717, SEQ ID NO: 47 are amino acids 1 to 49 of the Bacillus cereus exosporium peptide WP002105192, SEQ ID NO: 49 are amino acids 1 to 38 of the Bacillus cereus hypothetical protein WP87353, SEQ ID NO: 51 are amino acids 1 to 39 of the Bacillus cereus exosporium peptide 02112369, SEQ ID NO: 53 are amino acids 1 to 39 of the Bacillus cereus exosporium protein WP016099770, SEQ ID NO: 55 are amino acids 1 to 36 of the Bacillus thuringiensis hypothetical protein YP006612525, and SEQ ID NO: 57 are amino acids 1 to 36 of the Bacillus mycoides hypothetical protein TIGR03720. As shown in Figure 1, each of the N-terminal regions of these proteins contains a region conserved with amino acids 20 to 35 (SEQ ID NO: 1) of BclA, and a more highly conserved region corresponding to amino acids 25 to 35 of BclA.

[0038] In the fusion protein of the present invention, any portion of BclA containing amino acids 20 to 35 can be used as a targeting sequence in the present invention. Further, the full-length exosporium protein, or an exosporium protein fragment, can be used to direct the fusion protein to the exosporium. Therefore, the full-length BclA or a fragment of BclA containing amino acids 20 to 35 can be used for targeting to the exosporium. For example, the full-length BclA (SEQ ID NO: 2) or an intermediate-sized BclA fragment lacking the carboxy terminus such as SEQ ID NO: 59 (amino acids 1 to 196 of BclA) can be used to direct the fusion protein to the exosporium. For example, intermediate-sized fragments such as the fragment of SEQ ID NO: 59 have been found to have less secondary structure than the full-length BclA and to be suitable for use as a targeting sequence. The targeting sequence may also contain a shorter BclA portion containing amino acids 20 to 35, such as SEQ ID NO: 1 (amino acids 1 to 41 of BclA), amino acids 1 to 35 of SEQ ID NO: 1, amino acids 20 to 35 of SEQ ID NO: 1, or SEQ ID NO: 60 (methionine residue linked to amino acids 20 to 35 of BclA). Even shorter BclA fragments containing only a portion of amino acids 20 to 35 also show the ability to direct the fusion protein to the exosporium. For example, the targeting sequence may contain amino acids 22 to 31 of SEQ ID NO: 1, amino acids 22 to 33 of SEQ ID NO: 1, or amino acids 20 to 31 of SEQ ID NO: 1.

[0039] Alternatively, any portion of BetA / BAS3290, BAS4623, BclB, BAS1882, the KBAB4 2280 gene product, the KBAB4 3572 gene product, the B. cereus VD200 exosporium leader peptide, the B. cereus VD166 exosporium leader peptide, the B. cereus VD200 hypothetical protein IKG_04663, the B. weihenstephensis KBAB4 YVTN β-propeller protein, the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, the B. weihenstephensis KBAB4 triple helix repeat-containing collagen, the B. mycoides 2048 hypothetical protein bmyco0001_21660, the B. mycoides 2048 hypothetical protein bmyc0001_22540, the B. mycoides 2048 hypothetical protein bmyc0001_21510, the B. thuringiensis 35646 collagen triple helix repeat protein, the B. cereus hypothetical protein WP_69652, the B. cereus exosporium leader WP016117717, the B. cereus exosporium peptide WP002105192, the B. cereus hypothetical protein WP87353, the B. cereus exosporium peptide 02112369, the B. cereus exosporium protein WP016099770, the B. thuringiensis hypothetical protein YP006612525, or the B. mycoides hypothetical protein TIGR03720 (which contain amino acids corresponding to amino acids 20 - 35 of BclA) may be used as the targeting sequence. As shown in Figure 1, amino acids 12 - 27 of BetA / BAS3290, amino acids 23 - 38 of BAS4623, amino acids 13 - 28 of BclB, amino acids 9 - 24 of BAS1882, amino acids 18 - 33 of the KBAB4 2280 gene product, amino acids 18 - 33 of the KBAB4 3572 gene product, amino acids 28 - 43 of the B. cereus VD200 exosporium leader peptide, B.The amino acids 12 - 27 of the exosporium leader peptide of B. cereus VD166, the amino acids 18 - 33 of the hypothetical protein IKG_04663 of B. cereus VD200, the amino acids 18 - 33 of the YVTN β - propeller protein of B. weihenstephensis KBAB4, the amino acids 9 - 24 of the hypothetical protein bcerkbab4_2363 of B. weihenstephensis KBAB4, the amino acids 9 - 24 of the hypothetical protein bcerkbab4_2131 of B. weihenstephensis KBAB4, the amino acids 15 - 30 of the triple - helix repeat - containing collagen of B. weihenstephensis KBAB4, the amino acids 18 - 33 of the hypothetical protein bmyco0001_21660 of B. mycoides 2048, the amino acids 9 - 24 of the hypothetical protein bmyc0001_22540 of B. mycoides 2048, the amino acids 1 - 15 of the hypothetical protein bmyc0001_21510 of B. mycoides 2048, the amino acids 1 - 16 of the collagen triple - helix repeat protein of B. thuringiensis 35646, the amino acids 14 - 29 of the hypothetical protein WP_69652 of B. cereus, the amino acids 20 - 35 of the exosporium leader WP016117717 of B. cereus, the amino acids 28 - 43 of the exosporium peptide WP002105192 of B. cereus, the amino acids 17 - 32 of the hypothetical protein WP87353 of B. cereus, the amino acids 18 - 33 of the exosporium peptide 02112369 of B. cereus, the amino acids 18 - 33 of the exosporium protein WP016099770 of B. cereus, the amino acids 15 - 30 of the hypothetical protein YP006612525 of B. thuringiensis, and the amino acids 115 - 130 of the hypothetical protein TIGR03720 of B. mycoides correspond to the amino acids 20 - 35 of BclA. Therefore, any portion of these proteins containing the corresponding amino acids described above may be used as a targeting sequence.

[0040] Furthermore, the amino acids 20 - 35 of BclA or any amino acid sequence containing any of the corresponding amino acids described above may be used as a targeting sequence.

[0041] Thus, the targeting sequence may contain amino acids 1 to 35 of SEQ ID NO: 1, amino acids 20 to 35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 60, amino acids 22 to 31 of SEQ ID NO: 1, amino acids 22 to 33 of SEQ ID NO: 1, or amino acids 20 to 31 of SEQ ID NO: 1. Alternatively, the targeting sequence may consist of amino acids 1 to 35 of SEQ ID NO: 1, amino acids 20 to 35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60. Alternatively, the targeting sequence may consist of amino acids 22 to 31 of SEQ ID NO: 1, amino acids 22 to 33 of SEQ ID NO: 1, or amino acids 20 to 31 of SEQ ID NO: 1. Alternatively, the exosporium protein may contain full-length BclA (SEQ ID NO: 2), or the exosporium protein fragment may contain an intermediate-sized fragment of BclA lacking the carboxy terminus, such as SEQ ID NO: 59 (amino acids 1 to 196 of BclA). Alternatively, the exosporium protein fragment may consist of SEQ ID NO: 59.

[0042] The targeting sequence may also contain amino acids 1 to 27 of SEQ ID NO: 3, amino acids 12 to 27 of SEQ ID NO: 3, or SEQ ID NO: 3, or the exosporium protein may contain full-length BetA / BAS3290 (SEQ ID NO: 4). It has also been shown that a methionine residue linked to amino acids 12 to 27 of BetA / BAS3290 can be used as the targeting sequence. Thus, the targeting sequence may contain SEQ ID NO: 61. The targeting sequence may also contain amino acids 14 to 23 of SEQ ID NO: 3, amino acids 14 to 25 of SEQ ID NO: 3, or amino acids 12 to 23 of SEQ ID NO: 3.

[0043] The targeting sequence may also contain amino acids 1 to 38 of SEQ ID NO: 5, amino acids 23 to 38 of SEQ ID NO: 5, or SEQ ID NO: 5, or the exosporium protein may contain full-length BAS4623 (SEQ ID NO: 6).

[0044] Alternatively, the targeting sequence may contain amino acids 1 to 28 of SEQ ID NO: 7, amino acids 13 to 28 of SEQ ID NO: 7, or SEQ ID NO: 7, or the exosporium protein may contain full-length BclB (SEQ ID NO: 8).

[0045] The targeting sequence may also contain amino acids 1 to 24 of SEQ ID NO: 9, amino acids 9 to 24 of SEQ ID NO: 9, or SEQ ID NO: 9, or the exosporium protein may contain full-length BAS1882 (SEQ ID NO: 10). The methionine residue linked to amino acids 9 to 24 of BAS1882 can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 69.

[0046] The targeting sequence may also contain amino acids 1 to 33 of SEQ ID NO: 11, amino acids 18 to 33 of SEQ ID NO: 11, or SEQ ID NO: 11, or the exosporium protein may contain full-length B. weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12). The methionine residue linked to amino acids 18 to 33 of the B. weihenstephensis KBAB4 2280 gene product can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 62.

[0047] The targeting sequence may contain amino acids 1 to 33 of SEQ ID NO: 13, amino acids 18 to 33 of SEQ ID NO: 13, or SEQ ID NO: 13, or the exosporium protein may contain full-length B. weihenstephensis KBAB4 3572 gene product (SEQ ID NO: 14). The methionine residue linked to amino acids 18 to 33 of the B. weihenstephensis KBAB4 3572 gene product can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 63.

[0048] Alternatively, the targeting sequence may contain amino acids 1 to 43 of SEQ ID NO: 15, amino acids 28 to 43 of SEQ ID NO: 15, or SEQ ID NO: 15, or the exosporium protein may contain the full-length B. cereus VD200 exosporium leader peptide (SEQ ID NO: 16).

[0049] The targeting sequence may contain amino acids 1 to 27 of SEQ ID NO: 17, amino acids 12 to 27 of SEQ ID NO: 17, or SEQ ID NO: 17, or the exosporium protein may contain the full-length B. cereus VD166 exosporium leader peptide (SEQ ID NO: 18). The methionine residue linked to amino acids 12 to 27 of the B. cereus VD166 exosporium leader peptide can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 64.

[0050] The targeting sequence may contain amino acids 1 to 33 of SEQ ID NO: 19, amino acids 18 to 33 of SEQ ID NO: 19, or SEQ ID NO: 19, or the exosporium protein may contain the full-length B. cereus VD200 hypothetical protein IKG_04663 (SEQ ID NO: 20).

[0051] Alternatively, the targeting sequence may contain amino acids 1 to 33 of SEQ ID NO: 21, amino acids 18 to 33 of SEQ ID NO: 21, or SEQ ID NO: 21, or the exosporium protein may contain the full-length B. weihenstephensis KBAB4 YVTN β-propeller protein (SEQ ID NO: 22). The methionine residue linked to amino acids 18 to 33 of the B. weihenstephensis KBAB4 YVTN β-propeller protein can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 65.

[0052] The targeting sequence may also contain amino acids 1 to 24 of SEQ ID NO: 23, amino acids 9 to 24 of SEQ ID NO: 23, or SEQ ID NO: 23, or the exosporium protein may contain the full-length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 (SEQ ID NO: 24). The methionine residue linked to amino acids 9 to 24 of the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 66.

[0053] The targeting sequence may also contain amino acids 1 to 24 of SEQ ID NO: 25, amino acids 9 to 24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exosporium protein may contain the full-length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 (SEQ ID NO: 26). The methionine residue linked to amino acids 9 to 24 of the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 67.

[0054] Alternatively, the targeting sequence may contain amino acids 1 to 30 of SEQ ID NO: 27, amino acids 15 to 30 of SEQ ID NO: 27, or SEQ ID NO: 27, or the exosporium protein may contain the full-length B. weihenstephensis KBAB4 triple helix repeat-containing collagen (SEQ ID NO: 28).

[0055] The targeting sequence may also contain amino acids 1 to 33 of SEQ ID NO: 29, amino acids 18 to 33 of SEQ ID NO: 29, or SEQ ID NO: 29, or the exosporium protein may contain the full-length B. mycoides 2048 hypothetical protein bmyco0001_21660 (SEQ ID NO: 30).

[0056] The targeting sequence may also contain amino acids 1 to 24 of SEQ ID NO: 31, amino acids 9 to 24 of SEQ ID NO: 31, or SEQ ID NO: 31, or the exosporium protein may contain the full-length B. mycoides 2048 virtual protein bmyc0001_22540 (SEQ ID NO: 32). The methionine residue linked to amino acids 9 to 24 of the B. mycoides 2048 virtual protein bmyc0001_22540 can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 68.

[0057] Alternatively, the targeting sequence contains amino acids 1 to 15 of SEQ ID NO: 33, SEQ ID NO: 33, or the exosporium protein contains the full-length B.mycoides 2048 virtual protein bmyc0001_21510 (SEQ ID NO: 34).

[0058] The targeting sequence may also contain amino acids 1 to 16 of SEQ ID NO: 35, SEQ ID NO: 35, or the exosporium protein may contain the full-length B.thuringiensis 35646 collagen triple helix repeat protein (SEQ ID NO: 36).

[0059] The targeting sequence may contain amino acids 1 to 29 of SEQ ID NO: 43, amino acids 14 to 29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exosporium protein may contain the full-length B.cereus virtual protein WP_69652 (SEQ ID NO: 44).

[0060] Alternatively, the targeting sequence contains amino acids 1 to 35 of SEQ ID NO: 45, amino acids 20 to 35 of SEQ ID NO: 45, or SEQ ID NO: 45, or the exosporium protein may contain the full-length B.cereus exosporium leader WP016117717 (SEQ ID NO: 46). The methionine residue linked to amino acids 20 to 35 of the B.cereus exosporium leader WP016117717 can also be used as a targeting sequence. Therefore, the targeting sequence may contain SEQ ID NO: 70.

[0061] The targeting sequence may contain amino acids 1-43 of SEQ ID NO: 47, amino acids 28-43 of SEQ ID NO: 47, or SEQ ID NO: 47, or the exosporium protein may contain the full-length B. cereus exosporium peptide WP002105192 (SEQ ID NO: 48).

[0062] The targeting sequence may contain amino acids 1-32 of SEQ ID NO: 49, amino acids 17-32 of SEQ ID NO: 49, or SEQ ID NO: 49, or the exosporium protein may contain the full-length B. cereus hypothetical protein WP87353 (SEQ ID NO: 50).

[0063] Alternatively, the targeting sequence may contain amino acids 1-33 of SEQ ID NO: 51, amino acids 18-33 of SEQ ID NO: 51, or SEQ ID NO: 51, or the exosporium protein may contain the full-length B. cereus exosporium peptide 02112369 (SEQ ID NO: 52).

[0064] The targeting sequence may contain amino acids 1-33 of SEQ ID NO: 53, amino acids 18-33 of SEQ ID NO: 53, or SEQ ID NO: 53, or the exosporium protein may contain the full-length B. cereus exosporium protein WP016099770 (SEQ ID NO: 54).

[0065] Alternatively, the targeting sequence may contain amino acids 1-30 of SEQ ID NO: 55, amino acids 15-30 of SEQ ID NO: 55, or SEQ ID NO: 55, or the exosporium protein may contain the full-length B. thuringiensis hypothetical protein YP006612525 (SEQ ID NO: 56).

[0066] The targeting sequence may also contain amino acids 1-130 of SEQ ID NO: 57, amino acids 115-130 of SEQ ID NO: 57, or SEQ ID NO: 57, or the exosporium protein may contain the full-length B. mycoides hypothetical protein TIGR03720 (SEQ ID NO: 58).

[0067] Furthermore, amino acids 20 - 35 of BclA are conserved, and amino acids 25 - 35 are even more conserved. It will be clear from the sequence alignment in Figure 1 that there can be some variation in this region without affecting the ability of the targeting sequence to direct the protein to the exosporium. In Figure 1, the percent identity of each corresponding amino acid of each sequence to amino acids 20 - 35 of BclA (“20 - 35 identity %”) and to amino acids 25 - 35 of BclA (“25 - 35 identity %”) is listed. Thus, for example, compared to the comparison with amino acids 20 - 35 of BclA, the corresponding amino acid of BetA / BAS3290 is about 81.3% identical, the corresponding amino acid of BAS4623 is about 50.0% identical, the corresponding amino acid of BclB is about 43.8% identical, the corresponding amino acid of BAS1882 is about 62.5% identical, the corresponding amino acid of the KBAB4 2280 gene product is about 81.3% identical, and the corresponding amino acid of the KBAB4 3572 gene product is about 81.3% identical. The sequence identities over this region for the remaining sequences are listed in Figure 1.

[0068] Regarding amino acids 25 - 35 of BclA, the corresponding amino acid of BetA / BAS3290 is about 90.9% identical, the corresponding amino acid of BAS4623 is about 72.7% identical, the corresponding amino acid of BclB is about 54.5% identical, the corresponding amino acid of BAS1882 is 72.7% identical, the corresponding amino acid of the KBAB4 2280 gene product is about 90.9% identical, and the corresponding amino acid of the KBAB4 3572 gene product is about 81.8% identical. The sequence identities over this region for the remaining sequences are listed in Figure 1.

[0069] Thus, the targeting sequence may contain an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%.

[0070] The targeting sequence may also contain an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0071] The targeting sequence may also contain an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[0072] The targeting sequence may also contain an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0073] The targeting sequence may also contain an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0074] The targeting sequence may also contain an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0075] The targeting sequence may also contain an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0076] The targeting sequence may also contain an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 81%.

[0077] The targeting sequence may also contain an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0078] The targeting sequence may also contain an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[0079] One skilled in the art will understand that variants of the above sequences can also be used as targeting sequences as long as the targeting sequence contains the corresponding amino acids of amino acids 20-35 of BclA, BetA / BAS3290, BAS4263, BclB, BAS1882, the KBAB4 2280 gene product, or the KBAB 3572 gene product, or as long as there is a sequence containing any of the above sequence identities to amino acids 20-35 and 25-35 of BclA.

[0080] Furthermore, it has been found that an exosporium protein of a Bacillus cereus family lacking a region having homology with amino acids 25-35 of BclA can also be used to direct a peptide or protein to the exosporium of a member of the Bacillus cereus family. In particular, the fusion protein may contain an exosporium protein containing SEQ ID NO: 71 (B. mycoides InhA), an exosporium protein containing SEQ ID NO: 72 (B. anthracis Sterne BAS1141 (ExsY)), an exosporium protein containing SEQ ID NO: 73 (B. anthracis Sterne BAS1144 (BxpB / ExsFA)), an exosporium protein containing SEQ ID NO: 74 (B. anthracis Sterne BAS1145 (CotY)), an exosporium protein containing SEQ ID NO: 75 (B. anthracis Sterne BAS1140), an exosporium protein containing SEQ ID NO: 76 (B. anthracis H9401 ExsFB), an exosporium protein containing SEQ ID NO: 77 (B. thuringiensis HD74 InhA1), an exosporium protein containing SEQ ID NO: 78 (B. cereus ATCC 10876 ExsJ), an exosporium protein containing SEQ ID NO: 79 (B. cereus ExsH), an exosporium protein containing SEQ ID NO: 80 (B. anthracis Ames YjcA), an exosporium protein containing SEQ ID NO: 81 (B. anthracis YjcB), an exosporium protein containing SEQ ID NO: 82 (B. anthracis Sterne BclC), an exosporium protein containing SEQ ID NO: 83 (Bacillus thuringiensis serotype konkukian strain 97-27 acid phosphatase), or an exosporium protein containing SEQ ID NO: 84 (B. thuringiensis HD74 InhA2).Targeting to the exosporium of members of the B.cereus family is achieved by including an exosporium protein containing SEQ ID NO: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, or 84 in the fusion protein described in this specification.

[0081] Furthermore, either the full-length exosporium protein or the exosporium protein fragment described above, and an exosporium protein having a high degree of sequence identity can be used to direct a peptide or protein to the exosporium of members of the Bacillus cereus family. Therefore, the fusion protein may contain an exosporium protein having an amino acid sequence with at least 85% identity to any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84. Alternatively, the fusion protein may contain an exosporium protein having at least 90%, at least 95%, at least 98%, or at least 100% identity to any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84.

[0082] Alternatively, the fusion protein may contain an exosporium protein fragment consisting of an amino acid sequence having at least 85% identity to SEQ ID NO: 59. Alternatively, the fusion protein may contain an exosporium protein fragment consisting of an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 59.

[0083] In any of the targeting sequences, exosporium proteins, or exosporium protein fragments described herein, the targeting sequence, exosporium protein, or exosporium protein fragment may contain the amino acid sequence of GXT at its carboxy terminus, where X is any amino acid.

[0084] In any of the targeting sequences, exosporium proteins, or exosporium protein fragments described herein, the targeting sequence, exosporium protein, or exosporium protein fragment may contain an alanine residue at the position of the targeting sequence corresponding to amino acid 20 of SEQ ID NO: 1.

[0085] Fusion protein The present invention relates to a fusion protein containing a targeting sequence, an exosporium protein, or an exosporium protein fragment, and at least one plant growth-stimulating protein or peptide, wherein the plant growth-stimulating protein or peptide contains a peptide hormone, a non-hormonal peptide, or an enzyme involved in the production or activation of a plant growth-stimulating compound. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments described in paragraph

[0005] above.

[0086] The present invention further relates to a fusion protein containing a targeting sequence, an exosporium protein, or an exosporium protein fragment, and at least one protein or peptide that enhances stress tolerance in plants. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments described in paragraph

[0005] above.

[0087] Furthermore, the present invention relates to a fusion protein comprising at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a plant-binding protein or peptide. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments described in the above

[0005] paragraph.

[0088] The present invention also relates to a fusion protein comprising at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a protein or peptide that defends plants from pathogens. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments described in the above

[0006] paragraph.

[0089] The present invention further relates to a fusion protein comprising at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a protein or peptide that defends a plant from a pathogen. The protein or peptide that defends a plant from a pathogen contains harpin, α-elastin, β-elastin, cysteine, phenylalanine ammonia lyase, ericin, defensin, cryptogein, fragerin protein, fragerin peptide, bacteriocin, lysozyme, lysozyme peptide, siderophore, non-ribosomal active peptide, conalbumin, albumin, lactoferrin, lactoferrin peptide, or TasA. Alternatively, the protein or peptide that defends a plant from a pathogen has insecticidal activity, anthelmintic activity, or suppresses the predation of insects or helminths, or a combination thereof. Alternatively, the protein that defends a plant from a pathogen contains an enzyme. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments listed in the above paragraph

[0005] .

[0090] The fusion protein may be prepared using standard cloning and molecular biology methods known in the art. For example, a gene encoding a protein or peptide (e.g., a gene encoding a plant growth-stimulating protein or peptide) may be amplified by polymerase chain reaction (PCR) and ligated to DNA encoding any of the targeting sequences described above to form a DNA molecule encoding the fusion protein. The DNA molecule encoding the fusion protein may be cloned into any suitable vector (e.g., a plasmid vector). The vector appropriately contains a multiple cloning site into which the DNA molecule encoding the fusion protein can be easily inserted. The vector also appropriately contains a selectable marker, such as an antibiotic resistance gene, so that bacteria transformed, transfected, or produced with the vector can be easily identified and isolated. When the vector is a plasmid, the plasmid also appropriately contains an origin of replication. The DNA encoding the fusion protein is under the appropriate control of a sporulation promoter (e.g., the native bclA promoter from a member of the Bacillus cereus family) that induces the expression of the fusion protein in the exosporium of spores of members of the Bacillus cereus family. Alternatively, the DNA encoding the fusion protein may be integrated into the chromosomal DNA of the host of a member of the Bacillus cereus family.

[0091] The fusion protein may also contain an additional polypeptide sequence that is not part of the targeting sequence, exosporium protein, exosporium protein fragment, or plant growth-stimulating protein or peptide, protein or peptide that defends plants from pathogens, protein or peptide that enhances stress tolerance in plants, or protein or peptide that binds to plants. For example, the fusion protein may contain a tag or marker for the purification or visualization of the fusion protein (e.g., a polyhistidine tag, or a fluorescent protein (e.g., GFP or YFP)), or for the visualization of spores of recombinant Bacillus cereus family members expressing the fusion protein.

[0092] The expression of fusion proteins in exosporium using the targeting sequences, exosporium proteins, and exosporium protein fragments described herein is enhanced by the lack of secondary structure at the amino terminus of these sequences, thereby allowing for the maintenance of the native folding and activity of the fusion proteins. Appropriate folding can be further enhanced by including short amino acid linkers between the targeting sequence, exosporium protein, exosporium protein fragment, and the fusion partner protein.

[0093] Thus, any fusion protein described herein may contain an amino acid linker between a targeting sequence, exosporium protein, or exosporium protein fragment, and a plant growth stimulating protein or peptide, a protein or peptide that defends plants from pathogens, a protein or peptide that enhances stress tolerance in plants, or a plant binding protein or peptide.

[0094] The linker may contain a polyalanine linker or a polyglycine linker. A linker containing a mixture of both alanine and glycine residues may also be used. For example, when the targeting sequence contains SEQ ID NO: 1, the fusion protein may have one of the following structures: No linker: SEQ ID NO: 1 - fusion partner protein Alanine linker: SEQ ID NO: 1 - A n - fusion partner protein Glycine linker: SEQ ID NO: 1 - G n - fusion partner protein Mixed alanine and glycine linker: SEQ ID NO: 1 - (A / G) n - fusion partner protein where A n , G n , and (A / G) nEach is an arbitrary number of alanines, an arbitrary number of glycines, or a mixture of an arbitrary number of alanines and glycines. For example, n may be from 1 to 25, preferably from 6 to 10. When the linker contains a mixture of alanine residues and glycine residues, any combination of glycine residues and alanine residues may be used. In the above structure, the "fusion partner protein" refers to a plant growth stimulating protein or peptide, a protein or peptide that defends plants from pathogens, a protein or peptide that enhances stress tolerance in plants, or a plant binding protein or peptide.

[0095] Alternatively, or further, the linker may contain a protease recognition site. By containing a protease recognition site, when exposed to a protease that recognizes the protease recognition site, targeted removal of a plant growth stimulating protein or peptide, a protein or peptide that defends plants from pathogens, a protein or peptide that enhances stress tolerance in plants, or a plant binding protein or peptide becomes possible.

[0096] Plant growth stimulating proteins and peptides As described above, the present invention relates to a fusion protein containing at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a plant growth stimulating protein or peptide, wherein the plant growth stimulating protein or peptide contains a peptide hormone, a non-hormonal peptide, or an enzyme involved in the production or activation of a plant growth stimulating compound.

[0097] For example, when the plant growth stimulating protein or peptide contains a peptide hormone, the peptide hormone may contain phytosulfokine (for example, phytosulfokine-α), clavata3 (CLV3), systemin, ZmlGF, or SCR / SP11.

[0098] When the plant growth-stimulating protein or peptide contains a non-hormonal peptide, the non-hormonal peptide may contain RKN 16D10, Hg-Syv46, eNOD40 peptide, melittin, mastoparan, Mas7, RHPP, POLARIS, or kunitz trypsin inhibitor (KTI).

[0099] The plant growth-stimulating protein or peptide may contain an enzyme involved in the production or activation of a plant growth-stimulating compound. The enzyme involved in the production or activation of a plant growth-stimulating compound may be any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or a compound that changes the structure of a plant, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or a compound that changes the structure of a plant to an active form or a more active form of the compound.

[0100] The plant growth-stimulating compound may contain a compound produced by bacteria or fungi in the rhizosphere (for example, 2,3-butanediol).

[0101] Alternatively, the plant growth-stimulating compound may contain a plant growth hormone (for example, cytokinin or cytokinin derivative, ethylene, auxin or auxin derivative, gibberellic acid or gibberellic acid derivative, abscisic acid or abscisic acid derivative, or jasmonic acid or jasmonic acid derivative).

[0102] When the plant growth stimulating compound contains a cytokinin or a cytokinin derivative, the cytokinin or cytokinin derivative may contain kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyzeatin, N6-(D2-isopentenyl)adenine, ribosylzeatin, N6-(D2-isopentenyl)adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosylzeatin, trans-ribosylzeatin, 2-methylthio-trans-ribosylzeatin, ribosylzeatin-5-monophosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2'-deoxyzeatin riboside, 4-hydroxy-3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzyladenine, ortho-methyltopolin, meta-methyltopolin, or a combination thereof.

[0103] When the plant growth stimulating compound contains an auxin or an auxin derivative, the auxin or auxin derivative may contain active auxin, inactive auxin, bound auxin, natural auxin or synthetic auxin, or a combination thereof. For example, the auxin or auxin derivative may contain indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldoxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3-pyruvate, indole-3-acetaldoxime, indole-3-butyric acid, phenylacetic acid, 4-chloroindole-3-acetic acid, glucose-bound auxin, or a combination thereof.

[0104] Enzymes involved in the production or activation of plant growth-stimulating compounds include acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, 2,3-butanediol dehydrogenase, aminotransferase (e.g., tryptophan aminotransferase), tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side-chain oxidase, nitrile hydratase, nitrilase, peptidase, protease, adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5'-ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyl transferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyl transferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylic acid deaminase, or an enzyme involved in the production of nod factors (e.g., nodA, nodB, or nodI).

[0105] When the enzyme contains a protease or peptidase, the protease or peptidase may be a protease or peptidase that cleaves a protein, peptide, proprotein, or preproprotein to produce a bioactive peptide. The bioactive peptide may be any peptide that exhibits biological activity.

[0106] Examples of bioactive peptides include RKN 16D10 and RHPP.

[0107] Proteases or peptidases that cleave proteins, peptides, proproteins or preproproteins to produce bioactive peptides may contain subtilisin, acid protease, alkaline protease, proteinase, endopeptidase, exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, carboxylase, serine protease, glutamic acid protease, aspartic acid protease, cysteine protease, threonine protease or metalloprotease.

[0108] Proteases or peptidases can cleave proteins in protein-rich foods (e.g., soy foods or yeast extracts).

[0109] Proteins and peptides that defend plants from pathogens The present invention relates to a fusion protein containing at least one of a targeting sequence, an exosporium protein, or an exosporium protein fragment, and a protein or peptide that defends plants from pathogens.

[0110] The protein or peptide that defends plants from pathogens may contain a protein or peptide that stimulates the plant's immune response. For example, the protein or peptide that stimulates the plant's immune response may contain an enhancer protein or peptide of the plant immune system. The enhancer protein or peptide of the plant immune system may be any protein or peptide that has a beneficial effect on the plant's immune system. Suitable plant immune system enhancer proteins or peptides include harpin, α-elastin, β-elastin, systemin, phenylalanine ammonia-lyase, elicitin, defensin, cryptogein, flagellin protein and flagellin peptide (e.g., flg22).

[0111] Alternatively, the protein or peptide that defends plants from pathogens may be a protein or peptide having antibacterial activity, antifungal activity, or both antibacterial and antifungal activities. Examples of such proteins or peptides include bacteriocins, lysozyme, lysozyme peptides (e.g., LysM), siderophores, non-ribosomal active peptides, conalbumin, albumin, lactoferrin, lactoferrin peptides (e.g., LfcinB), and TasA.

[0112] The protein or peptide that defends plants from pathogens may be a protein or peptide having insecticidal activity, anthelmintic activity, or suppressing the predation of insects or helminths, or a combination thereof. For example, the protein or peptide that defends plants from pathogens may contain an insecticidal bacterial toxin (e.g., VIP insecticidal protein), endotoxin, Cry toxin (e.g., Cry toxin derived from Bacillus thuringiensis), protease inhibitor protein or peptide (e.g., trypsin inhibitor, or mulberry protease inhibitor), cysteine protease, or chitinase. When the Cry toxin is a Cry toxin derived from Bacillus thuringiensis, the Cry toxin may be a Cry5B protein or a Cry21A protein. Cry5B and Cry21A have both insecticidal activity and nematicidal activity.

[0113] The protein that defends plants from pathogens may contain an enzyme. Suitable enzymes include protease and lactonase. Protease and lactonase may be specific for bacterial signaling molecules (e.g., bacterial lactone homoserine signaling molecules).

[0114] When the enzyme is lactonase, the lactonase may contain 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol lactonase, actinomycin lactonase, deoxylimonate A-ring-lactonase, gluconolactonase L-rhamno-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase, or xylono-1,4-lactonase.

[0115] The enzyme may also be an enzyme specific to bacterial or fungal cell components. For example, the enzyme may contain β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, chitinase, chitinaselike enzyme, lichenase, peptidase, proteinase, protease (e.g., alkaline protease, acid protease, or neutral protease, etc.), mutanolysin, stapholysin, or lysozyme.

[0116] For any of the above-described fusion proteins containing a protein or peptide that defends a plant from a pathogen, the pathogen may be a bacterial pathogen or a fungal pathogen. For example, the pathogen may contain α-class proteobacteria, β-class proteobacteria, γ-class proteobacteria, or a combination thereof. Specific bacterial pathogens include Agrobacterium tumefaciens, Pantoea stewartii, Erwinia carotovora, Ralstonia solanacearum, Pseudomonas syringae, Pseudomonas aeruginosa, Xanthomonas campestris, and combinations thereof.

[0117] Other bacterial and fungal pathogens include Acarosporina microspora, Aceria guerreronis, Achlya conspicua, Achlya klebsiana, Achlysiella williamsi, Acholeplasmataceae, Acidovorax avenae, Acremonium strictum, Acrocalymma medicaginis, Acrodontium simplex, Acrophialophora fusispora, Acrosporium tingitaninum, Aecidium, Aecidium aechmantherae, Aecidium amaryllidis, Aecidium breyniae, Aecidium campanulastri, Aecidium cannabis, Aecidium cantensis, Aecidium caspicum, Aecidium foeniculi, Agrobacterium tumefaciens, Albonectria rigidiuscula, Albugo bliti, Albugo candida, Albugo ipomoeae-panduratae, Albugo laibachii, Albugo occidentalis, Albugo tragopogonis, Alternaria, Alternaria alternata, Alternaria brassicae, Alternaria brassicicola, Alternaria carthami, Alternaria cinerariae, Alternaria citri, Alternaria dauci, Alternaria dianthi, Alternaria dianthicola, Alternaria euphorbiicola, Alternaria helianthi, Alternaria helianthicola, Alternaria japonica, Alternaria leucanthemi, Alternaria limicola, Alternaria linicola, Alternaria mali, Alternaria padwickii, Alternariapanax, Alternaria radicina, Alternaria raphani, Alternaria saponariae, Alternaria senecionis, Alternaria solani, Alternaria tenuissima, Alternaria triticina, Alternaria zinniae, Amazonia, Amphobotrys ricini, Anguillosporella vermiformis, Anguina (genus), Anguina agrostis, Anguina amsinckiae, Anguina australis, Anguina balsamophila, Anguina funesta, Anguina graminis, Anguina spermophaga, Anguina tritici, Anisogramma anomala, Anthostomella pullulans, Antrodia albida, Antrodia serialiformis, Antrodia serialis, Aphanomyces cladogamus, Aphanomyces cochlioides, Aphanomyces euteiches, Aphanomyces euteiches f.sp. pisi, Aphanomyces raphani, Aphelenchoides, Aphelenchoides arachidis, Aphelenchoides besseyi, Aphelenchoides fragariae, Aphelenchoides parietinus, Aphelenchoides ritzemabosi, Aphelenchus avenae, Apiognomonia errabunda, Apiognomonia veneta, Apiospora montagnei, Appendiculella, Armillaria, Armillaria affinis, Armillaria apalosclera, Armillaria camerunensis, Armillaria duplicate, Armillaria fellea, Armillaria fumosa, Armillariafuscipes, Armillaria griseomellea, Armillaria heimii, Armillaria mellea, Armillaria melleorubens, Armillaria montagnei, Armillaria omnituens, Armillaria pallidula, Armillaria paulensis, Armillaria pelliculata, Armillaria procera, Armillaria puiggarii, Armillaria singular, Armillaria socialis, Armillaria solidipes, Armillaria tabescens, Armillaria tigrensis, Armillaria umbrinobrunnea, Armillaria viridiflava, Armillaria yungensis, Arthrocladiella, Arthuriomyces peckianus, Ascochyta asparagine, Ascochyta bohemica, Ascochyta caricae, Ascochyta doronici, Ascochyta fabae f.sp. lentis, Ascochyta graminea, Ascochyta hordei, Ascochyta humuli, Ascochyta pisi, Ascochyta prasadii, Ascochyta sorghi, Ascochyta spinaciae, Ascochyta tarda, Ascochyta tritici, Ascospora ruborum, Ashbya gossypii, Aspergillus aculeatus, Aspergillus fischerianus, Aspergillus niger, Asperisporium caricae, Asperisporium minutulum, Asteridiella, Asteridiella perseae, Asteroma caryae, Asteroma coryli, Asteroma inconspicuum, Athelia arachnoidea, Athelia rolfsii, Aurantiporusfissilis, Belonolaimus, Belonolaimus gracilis, Belonolaimus longicaudatus, Beniowskia sphaeroidea, Bionectria ochroleuca, Bipolaris, Bipolaris cactivora, Bipolaris cookie, Bipolaris incurvata, Bipolaris sacchari, Biscogniauxia capnodes var. capnodes, Biscogniauxia marginata, Biscogniauxia nummularia, Bjerkandera adusta, Blakeslea trispora, Blumeria graminis, Botryodiplodia oncidii, Botryodiplodia ulmicola, Botryosphaeria cocogena, Botryosphaeria corticola, Botryosphaeria disrupta, Botryosphaeria dothidea, Botryosphaeria marconii, Botryosphaeria obtuse, Botryosphaeria quercuum, Botryosphaeria rhodina, Botryosphaeria ribis, Botryosphaeria stevensii, Botryosporium pulchrum, Botryotinia, Botryotinia fuckeliana, Botrytis anthophila, Botrytis cinerea, Botrytis fabae, Bremia lactucae, Brenneria salicis, Briosia ampelophaga, Bulbomicrosphaera, Burkholderia andropogonis, Burkholderia caryophylli, Burkholderia glumae, Cadophora malorum, Caespitotheca, Calonectria indusiata, Calonectria kyotensis, Calonectria quinqueseptata, Calvatiaversispora, Camarosporium pistaciae, Camarotella acrocomiae, Camarotella costaricensis, Candidatus Liberibacter, Capitorostrum cocoes, Capnodium footii, Capnodium mangiferum, Capnodium ramosum, Capnodium theae, Caulimoviridae, Cephaleuros virescens, Cephalosporium gramineum, Ceratobasidium cereal, Ceratobasidium cornigerum, Ceratobasidium noxium, Ceratobasidium ramicola, Ceratobasidium setariae, Ceratobasidium stevensii, Ceratocystis adiposa, Ceratocystis coerulescens, Ceratocystis fimbriata, Ceratocystis moniliformis, Ceratocystis paradoxa, Ceratocystis pilifera, Ceratocystis pluriannulata, Ceratorhiza hydrophila, Ceratospermopsis, Cercoseptoria ocellata, Cercospora, Cercospora angreci, Cercospora apii, Cercospora apii f.sp. clerodendri, Cercospora apiicola, Cercospora arachidicola, Cercospora asparagi, Cercospora atrofiliformis, Cercospora beticola, Cercospora brachypus, Cercospora brassicicola, Cercospora brunkii, Cercospora cannabis, Cercospora cantuariensis, Cercospora capsici, Cercospora carotae, Cercosporacorylina, Cercospora fragariae, Cercospora fuchsiae, Cercospora fusca, Cercospora fusimaculans, Cercospora gerberae, Cercospora halstedii, Cercospora handelii, Cerc Ospora hayi, Cercospora hydrangea, Cercospora kikuchii, Cercospora lentis, Cercospora liquidambaris, Cercospora longipes, Cercospora longissima, Cercospora mamaonis, Cercospora mangiferae, Cercospora medicaginis, Cercospora melongenae, Cercospora minima, Cercospora minuta, Cercospora nicotianae, Cercospora odontoglossi, Cercospora papaya, Cercospora penniseti, Cercospora pisa - sativae, Cercospora platanicola, Cercospora puderii, Cercospora pulcherrima, Cercospora rhapidicola, Cercospora rosicola, Cercospora rubrotincta, Cercospora sojina, Cercospora solani, Cercospora solani - tuberosi, Cercospora sorghi, Cercospora theae, Cercospora tuberculans, Cercospora vexans, Cercospora vicosae, Cercospora zeae - maydis, Cercospora zebrina, Cercospora zonata, Cercosporella rubi, Cereal cyst nematode, Ceriporia spissa, Ceriporia xylostromatoides, Cerrena unicolor, Ceuthospora lauri, Choanephora, Choanephora cucurbitarum, Choanephora infundibulifera, Chondrostereum purpureum, Chrysomyxa ledi var. rhododendri, Chrysomyxa ledicola, Chrysomyxapiperiana, Chrysomyxa roanensis, Cladosporium, Cladosporium arthropodii, Cladosporium caryigenum, Cladosporium cladosporioides, Cladosporium cladosporioides f.sp. pisicola, Cladosporium cucumerinum, Cladosporium herbarum, Cladosporium musae, Cladosporium oncobae, Clavibacter michiganensis, Claviceps fusiformis, Claviceps purpurea, Claviceps sorghi, Claviceps zizaniae, Climacodon pulcherrimus, Climacodon septentrionalis, Clitocybe parasitica, Clonostachys rosea f. rosea, Clypeoporthe iliau, Cochliobolus, Cochliobolus carbonum, Cochliobolus cymbopogonis, Cochliobolus hawaiiensis, Cochliobolus heterostrophus, Cochliobolus lunatus, Cochliobolus miyabeanus, Cochliobolus ravenelii, Cochliobolus sativus, Cochliobolus setariae, Cochliobolus spicifer, Cochliobolus stenospilus, Cochliobolus tuberculatus, Cochliobolus victoriae, Coleosporium helianthi, Coleosporium ipomoeae, Coleosporium madiae, Coleosporium pacificum, Coleosporium tussilaginis, Colletotrichum acutatum, Colletotrichum arachidis, Colletotrichum capsici, Colletotrichumcereale, Colletotrichum crassipes, Colletotrichum dematium, Colletotrichum dematium f. spinaciae, Colletotrichum derridis, Colletotrichum destructivum, Colletotrichum fragariae, Colletotrichum gossypii, Colletotrichum higginsianum, Colletotrichum kahawae, Colletotrichum lindemuthianum, Colletotrichum lini, Colletotrichum mangenotii, Colletotrichum musae, Colletotrichum nigrum, Colletotrichum orbiculare, Colletotrichum pisi, Colletotrichum sublineolum, Colletotrichum trichellum, Colletotrichum trifolii, Colletotrichum truncatum, Coniella castaneicola, Coniella diplodiella, Coniella fragariae, Coniothecium chomatosporum, Coniothyrium celtidis-australis, Coniothyrium henriquesii, Coniothyrium rosarum, Coniothyrium wernsdorffiae, Coprinopsis psychromorbida, Cordana johnstonii, Cordana musae, Coriolopsis floccose, Coriolopsis gallica, Corticium invisum, Corticium penicillatum, Corticium theae, Coryneopsis rubi, Corynespora cassiicola, Coryneum rhododendri, Crinipellis sarmentosa, Cronartium ribicola, Cryphonectriaceae, Cryptoclinecyclaminis, Cryptomeliola, Cryptoporus volvatus, Cryptosporella umbrina, Cryptosporiopsis tarraconensis, Cryptosporium minimum, Curvularia caricae - papayae, Curvularia penniseti, Curvularia senegalensis, Curvularia trifolii, Cylindrocarpon candidum, Cylindrocarpon ianthothele var. ianthothele, Cylindrocarpon magnusianum, Cylindrocarpon musae, Cylindrocladiella camelliae, Cylindrocladiella parva, Cylindrocladium clavatum, Cylindrocladium lanceolatum, Cylindrocladium peruvianum, Cylindrocladium pteridis, Cylindrosporium cannabinum, Cylindrosporium juglandis, Cylindrosporium rubi, Cymadothea trifolii, Cytospora, Cytospora palmarum, Cytospora personata, Cytospora platani, Cytospora sacchari, Cytospora sacculus, Cytospora terebinthi, Cytosporina ludibunda, Dactuliophora elongata, Daedaleopsis confragosa, Dasineura urticae, Datronia scutellata, Davidiella carinthiaca, Davidiella dianthi, Davidiella tassiana, Deightoniella papuana, Deightoniella torulosa, Dendrophoma marconii, Dendrophora erumpens, Denticularia mangiferae, Dermeapseudotsugae, Diaporthaceae, Diaporthe, Diaporthe arctii, Diaporthe citri, Diaporthe dulcamarae, Diaporthe eres, Diaporthe helianthi, Diaporthe lagunensis, Diaporthe lokoyae, Diaporthe melonis, Diaporthe orthoceras, Diaporthe perniciosa, Diaporthe phaseolorum, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. phaseolorum, Diaporthe phaseolorum var. sojae, Diaporthe rudis, Diaporthe tanakae, Diaporthe toxica, Dibotryon morbosum, Dicarpella dryina, Didymella bryoniae, Didymella fabae, Didymella lycopersici, Didymosphaeria arachidicola, Didymosphaeria taiwanensis, Dilophospora alopecuri, Dimeriella sacchari, Diplocarpon earlianum, Diplocarpon mali, Diplocarpon mespili, Diplocarpon rosae, Diplodia laelio-cattleyae, Diplodia manihoti, Diplodia paraphysaria, Diplodia theae-sinensis, Discosia artocreas, Guignardia fulvida, Discostroma corticola, Distocercospora, Distocercospora livistonae, Ditylenchus, Ditylenchus africanus, Ditylenchus angustus, Ditylenchus destructor, Ditylenchus dipsaci, Dolichodorusheterocephalus, Dothideomycetes, Dothiorella aromatic, Dothiorella dominicana, Dothiorella gregaria, Dothiorella ulmi, Drechslera avenacea, Drechslera campanulata, Dre Chslera dematioidea, Drechslera gigantea, Drechslera glycines, Drechslera musae-sapientium, Drechslera teres f. maculate, Drechslera wirreganensis, Durandiella pseudotsugae, Eballistra lineata, Eballistra oryzae, Eballistraceae, Echinodontium tinctorium, Ectendomeliola, Elsinoe ampelina, Elsinoe australis, Elsinoe batatas, Elsinoe brasiliensis, Elsinoe fawcettii, Elsinoe leucospila, Elsinoe mangiferae, Elsinoe piri, Elsinoe randii, Elsinoe rosarum, Elsinoe sacchari, Elsinoe theae, Elsinoe veneta, Endomeliola, Endothia radicalis, Endothiella gyrosa, Entoleuca mammata, Entorrhizomycetes, Entyloma ageratinae, Entyloma dahlia, Entyloma ellisii, Epicoccum nigrum, Ergot, Erwinia, Erwinia chrysanthemi, Erwinia psidii, Erysiphaceae, Erysiphales, Erysiphe, Erysiphe alphitoides, Erysiphe betae, Erysiphe brunneopunctata, Erysiphe cichoracearum, Erysiphe cruciferarum, Erysiphe flexuosa, Erysiphe graminis f. sp. avenae, Erysiphe graminis f.sp. tritici, Erysiphe heraclei, Erysiphe pisi, Eutypella parasitica, Eutypella scoparia, Exobasidiumburtii, Exobasidium reticulatum, Exobasidium vaccinii var. japonicum, Exobasidium vaccinii-uliginosi, Exobasidium vexans, Exophiala, Flavescence doree, Fomes fasciatus, Fomes lamaensis, Fomes meliae, Fomitopsis cajanderi, Fomitopsis palustris, Fomitopsis rosea, Fomitopsis spraguei, Fomitopsis supina, Forma specialis, Frommeella tormentillae, Fusarium, Fusarium affine, Fusarium arthrosporioides, Fusarium circinatum, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium incarnatum, Fusarium solani, Fusarium merismoides, Fusarium oxysporum f.sp. albedinis, Fusarium oxysporum f.sp. asparagi, Fusarium oxysporum f.sp. batatas, Fusarium oxysporum f.sp. betae, Fusarium oxysporum f.sp. cannabis, Fusarium oxysporum f.sp. citri, Fusarium oxysporum f.sp. coffea, Fusarium oxysporum f.sp. cubense, Fusarium oxysporum f.sp. cyclaminis, Fusarium oxysporum f.sp. dianthi, Fusarium oxysporum f.sp. lentis, Fusarium oxysporum f.sp. lini, Fusarium oxysporum f.sp. lycopersici, Fusarium oxysporum f.sp. medicaginis, Fusariumoxysporum f.sp. pisi, Fusarium oxysporum f.sp. radicis-lycopersici, Fusarium pallidoroseum, Fusarium proliferatum, Fusarium redolens, Fusarium sacchari, Fusarium solani f.sp. pisi, Fusarium sporotrichioides, Fusarium subglutinans, Fusarium sulphureum, Fuscoporia torulosa, Fusicladium pisicola, Fusicoccum aesculi, Fusicoccum amygdali, Gaeumannomyces graminis var tritici, Gaeumannomyces graminis var. avenae, Gaeumannomyces graminis var. graminis, Galactomyces candidum, Ganoderma brownii, Ganoderma lobatum, Ganoderma orbiforme, Ganoderma philippii, Ganoderma tornatum, Ganoderma zonatum, Geastrumia polystigmatis, Georgefischeriaceae, Georgefischeriales, Geosmithia morbida, Geotrichum, Geotrichum candidum, Geotrichum candidum var. citri-aurantii, Geotrichum klebahnii, Gibberella, Gibberella acuminata, Gibberella avenacea, Gibberella baccata, Gibberella cyanogena, Gibberella fujikuroi, Gibberella fujikuroi var. subglutinans, Gibberella intricans, Gibberella pulicaris, Gibberella stilboides, Gibberella xylarioides, Gibberellazeae, Gibellina cerealis, Gilbertella persicaria, Gjaerumiaceae, Gliocladium vermoeseni, Globodera pallida, Globodera rostochiensis, Globodera tabacum, Gloeocercospora sorghi, Gloeocystidiellum porosum, Gloeophyllum mexicanum, Gloeophyllum trabeum, Gloeoporus dichrous, Gloeosporium cattleyae, Gloeosporium theae-sinensis, Glomerella cingulate, Glomerella glycines, Glomerella graminicola, Glomerella tucumanensis, Gnomonia caryae, Gnomonia comari, Gnomonia dispora, Gnomonia iliau, Gnomonia leptostyla, Gnomonia nerviseda, Gnomonia rubi, Golovinomyces cichoracearum var. latisporus, Granulobasidium vellereum, Graphiola phoenicis, Graphium rigidum, Graphium rubrum, Graphyllium pentamerum, Grovesinia pyramidalis, Guignardia bidwellii f. muscadinii, Guignardia camelliae, Guignardia citricarpa, Guignardia mangiferae, Guignardia musae, Guignardia philoprina, Gummosis, Gymnoconia nitens, Gymnopus dryophilus, Gymnosporangium clavipes, Gymnosporangium sabinae, Gymnosporangium globosum, Gymnosporangium juniperi-virginianae, Gymnosporangiumkernianum, Gymnosporangium nelsonii, Gymnosporangium yamadae, Haematonectria haematococca, Hansenula subpelliculosa, Hapalosphaeria deformans, Haplobasidion musae, Haustorium, Helicobasidium compactum, Helicobasidium longisporum, Helicobasidium purpureum, Helicoma muelleri, Helicotylenchus, Helicotylenchus dihystera, Helicotylenchus multicinctus, Helminthosporium cookei, Helminthosporium papulosum, Helminthosporium solani, Helotiales, Hemicriconemoides kanayaensis, Hemicriconemoides mangiferae, Hemicycliophora arenaria, Hemlock woolly adelgid, Hendersonia creberrima, Hendersonia theicola, Hericium coralloides, Heterobasidion annosum, Heterodera, Heterodera amygdali, Heterodera arenaria, Heterodera aucklandica, Heterodera avenae, Heterodera bergeniae, Heterodera bifenestra, Heterodera cacti, Heterodera cajani, Heterodera canadensis, Heterodera cardiolata, Heterodera carotae, Heterodera ciceri, Heterodera cruciferae, Heterodera delvii, Heterodera elachista, Heterodera filipjevi, Heterodera gambiensis, Heteroderagoettingiana, Heterodera hordecalis, Heterodera humuli, Heterodera latipons, Heterodera medicaginis, Heterodera oryzae, Heterodera oryzicola, Heterodera rosii, Heterodera sacch ari, Heterodera schachtii, Heterodera tabacum, Heterodera trifolii, Heteroderidae, Hexagonia hydnoides, Hirschmanniella oryzae, Hoplalaimus galeatus, Hoplolaimidae, Hoplolaimus columbus, Hoplolaimus indicus, Hoplolaimus magnistylus, Hoplolaimus pararobustus, Hoplolaimus seinhorsti, Hoplolaimus uniformis, Huanglongbing, Hyaloperonospora, Hyaloperonospora arabidopsidis, Hyaloperonospora brassicae, Hyaloperonospora parasitica, Hymenula affinis, Hyphodermella corrugata, Hyphodontia aspera, Hyphodontia sambuci, Hypochnus, Hypoxylon tinctor, Idriella lunata, Inonotus arizonicus, Inonotus cuticularis, Inonotus dryophilus, Inonotus hispidus, Inonotus ludovicianus, Inonotus munzii, Inonotus tamaricis, Irenopsis, Irpex destruens, Irpex lacteus, Isariopsis clavispora, Johncouchia mangiferae, Kabatiella caulivora, Kabatiella lini, Karnal bunt, Khuskia oryzae, Kretzschmaria deusta, Kretzschmaria zonata, Kuehneola uredinis, Kutilakesa pironii, Labrella coryli, Laeticorticium roseum, Laetiporus baudonii, Lagenocystis radicicola, Laricifomesofficinalis, Lasiodiplodia theobromae, Leandria momordicae, Leifsonia xyli xyli, Lentinus tigrinus, Lenzites betulina, Lenzites elegans, Lepteutypa cupressi, Leptodontidium elatius var. elatius, Leptographium microsporum, Leptosphaeria acuta, Leptosphaeria cannabina, Leptosphaeria coniothyrium, Leptosphaeria libanotis, Leptosphaeria lindquistii, Leptosphaeria maculans, Leptosphaeria musarum, Leptosphaeria pratensis, Leptosphaeria sacchari, Leptosphaeria woroninii, Leptosphaerulina crassiasca, Leptosphaerulina trifolii, Leptothyrium nervisedum, Leptotrochila medicaginis, Leucocytospora leucostoma, Leucostoma auerswaldii, Leucostoma kunzei, Leucostoma persoonii, Leveillula compositarum f. helianthi, Leveillula leguminosarum f. lentis, Leveillula taurica, Ligniera pilorum, Limacinula tenuis, Linochora graminis, Longidorus africanus, Longidorus maximus, Longidorus sylphus, Lopharia crassa, Lophodermium, Lophodermium aucupariae, Lophodermium schweinitzii, Lophodermium seditiosum, Macrophoma mangiferae, Macrophomatheicola, Macrophomina phaseolina, Macrosporium cocos, Magnaporthe, Magnaporthe grisea, Magnaporthe salvinii, Mamianiella coryli, Marasmiellus cocophilus, Marasmiellus inoderma, Marasmiellus scandens, Marasmiellus stenophyllus, Marasmius crinis-equi, Marasmius sacchari, Marasmius semiustus, Marasmius stenophyllus, Marasmius tenuissimus, Massarina walkeri, Mauginiella scaettae, Melampsora, Melampsora lini var. lini, Melampsora medusae, Melampsora occidentalis, Melanconis carthusiana, Melanconium juglandinum, Meliola, Meliola mangiferae, Meliolaceae, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne artiellia, Meloidogyne brevicauda, Meloidogyne chitwoodi, Meloidogyne enterolobii, Meloidogyne fruglia, Meloidogyne gajuscus, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne naasi, Meloidogyne partityla, Meloidogyne thamesi, Meripilus giganteus, Merlinius brevidens, Meruliopsis ambigua, Mesocriconema xenoplax, Microascus brevicaulis, Microbotryum violaceum, Microdochium bolleyi, Microdochium dimerum, Microdochiumpanattonianum, Microdochium phragmitis, Microsphaera, Microsphaera coryli, Microsphaera diffusa, Microsphaera ellisii, Microsphaera euphorbiae, Microsphaera hommae, Microsphaera penicillata, Microsphaera penicillata var. vaccinii, Microsphaera vaccinii, Microsphaera verruculosa, Microstroma juglandis, Moesziomyces bullatus, Monilinia azaleae, Monilinia fructicola, Monilinia fructigena, Monilinia laxa, Monilinia mali, Moniliophthora perniciosa, Moniliophthora roreri, Monilochaetes infuscans, Monochaetia coryli, Monochaetia mali, Monographella albescens, Monographella cucumerina, Monographella nivalis var. neglecta, Monographella nivalis var. nivalis, Mononegavirales, Monosporascus cannonballus, Monosporascus eutypoides, Monostichella coryli, Mucor circinelloides, Mucor hiemalis, Mucor hiemalis f. silvaticus, Mucor mucedo, Mucor paronychius, Mucor piriformis, Mucor racemosus, Mycena citricolor, Mycena maculate, Mycocentrospora acerina, Mycoleptodiscus terrestris, Mycosphaerella angulata, Mycosphaerella arachidis, Mycosphaerellaareola, Mycosphaerella berkeleyi, Mycosphaerella bolleana, Mycosphaerella brassicicola, Mycosphaerella caricae, Mycosphaerella caryigena, Mycosphaerella cerasella, Mycosphaerella citri, Mycosphaerella coffeicola, Mycosphaerella confusa, Mycosphaerella cruenta, Mycosphaerella dendroides, Mycosphaerella eumusae, Mycosphaerella fragariae, Mycosphaerella gossypina, Mycosphaerella graminicola, Mycosphaerella henningsii, Mycosphaerella horii, Mycosphaerella juglandis, Mycosphaerella lageniformis, Mycosphaerella linicola, Mycosphaerella louisianae, Mycosphaerella musae, Mycosphaerella musicola, Mycosphaerella palmicola, Mycosphaerella pinodes, Mycosphaerella pistaciarum, Mycosphaerella pistacina, Mycosphaerella platanifolia, Mycosphaerella polymorpha, Mycosphaerella pomi, Mycosphaerella punctiformis, Mycosphaerella pyri, Didymella rabiei, Mycosphaerella recutita, Mycosphaerella rosicola, Mycosphaerella rubi, Mycosphaerella stigmina-platani, Mycosphaerella striatiformans, Mycovellosiella concors, Mycovellosiellafulva, Mycovellosiella koepkei, Mycovellosiella vaginae, Myriogenospora aciculispora, Myrothecium roridum, Myrothecium verrucaria, Nacobbus aberrans, Nacobbus dorsalis, Naevala perexigua, Naoh idemyces vaccinii, Nectria, Nectria cinnabarina, Nectria coccinea, Nectria ditissima, ectria foliicola, Nectria mammoidea var. rubi, Nectria mauritiicola, Nectria peziza, Nectria pseudotrichia, Nectria radicicola, Nectria ramulariae, Nectriella pironii, Nemania diffusa, Nemania serpens var. serpens, Nematospora coryli, Neocosmospora vasinfecta, Neodeightonia phoenicum, Neoerysiphe, Neofabraea malicorticis, Neofabraea perennans, Neofusicoccum mangiferae, Neonectria galligena, Oidiopsis gossypii, Oidium (genus), Oidium arachidis, Oidium caricae - papayae, Oidium indicum, Oidium mangiferae, Oidium manihotis, Oidium tingitaninum, Olpidium brassicae, Omphalia tralucida, Oncobasidium theobromae, Onnia tomentosa, Ophiobolus anguillides, Ophiobolus cannabinus, Ophioirenina, Ophiostoma ulmi, Ophiostoma wageneri, Ovulariopsis papayae, Ovulinia azaleae, Ovulitis azaleae, Oxyporus corticola, Oxyporus latemarginatus, Oxyporus populinus, Oxyporus similis, Ozonium texanum var. parasiticum, Paecilomyces fulvus, Paralongidorus maximus, Paratrichodoruschristiei, Paratrichodorus minor, Paratylenchus curvitatus, Paratylenchus elachistus, Paratylenchus hamatus, Paratylenchus macrophallus, Paratylenchus microdorus, Paratylenchus projectus, Paratylenchus tenuicaudatus, Pathovar, Pauahia, Peach latent mosaic viroid, Pectobacterium carotovorum, Peltaster fructicola, Penicillium aurantiogriseum, Penicillium digitatum, Penicillium expansum, Penicillium funiculosum, Penicillium glabrum, Penicillium italicum, Penicillium purpurogenum, Penicillium ulaiense, Peniophora, Peniophora albobadia, Peniophora cinerea, Peniophora quercina, Peniophora sacrata, Perenniporia fraxinea, Perenniporia fraxinophila, Perenniporia medulla-panis, Perenniporia subacida, Periconia circinata, Periconiella cocoes, Peridermium californicum, Peronosclerospora miscanthi, Peronosclerospora sacchari, Peronosclerospora sorghi, Peronospora, Peronospora anemones, Peronospora antirrhini, Peronospora arborescens, Peronospora conglomerata, Peronospora destructor, Peronospora dianthi, Peronospora dianthicola, Peronosporafarinosa, Peronospora farinosa f.sp. betae, Peronospora hyoscyami f.sp. tabacina, Peronospora manshurica, Peronospora potentillae, Peronospora sparsa, Peronospora trifoliorum, Peronospora valerianellae, Peronospora viciae, Pestalosphaeria concentrica, Pestalotia longiseta, Pestalotia longisetula, Pestalotia rhododendri, Pestalotiopsis, Pestalotiopsis adusta, Pestalotiopsis arachidis, Pestalotiopsis disseminata, Pestalotiopsis guepini, Pestalotiopsis leprogena, Pestalotiopsis longiseta, Pestalotiopsis mangiferae, Pestalotiopsis palmarum, Pestalotiopsis sydowiana, Pestalotiopsis theae, Pestalotiopsis versicolor, Phacidiopycnis padwickii, Phacidium infestans, Phaeochoropsis mucosa, Phaeocytostroma iliau, Phaeocytostroma sacchari, Phaeoisariopsis bataticola, Phaeolus schweinitzii, Phaeoramularia angolensis, Phaeoramularia dissiliens, Phaeoramularia heterospora, Phaeoramularia manihotis, Phaeoseptoria musae, Phaeosphaerella mangiferae, Phaeosphaerella theae, Phaeosphaeria avenaria f.sp. avenaria, Phaeosphaeria avenaria f.sp.Triticae, Phaeosphaeria herpotrichoides, Phaeosphaeria microscopica, Phaeosphaeria nodorum, Phaeosphaeriopsis obtusispora, Phaeotrichoconis crotalariae, Phakopsora gossypii, Phakopsora pachyrhizi, Phanerochaete allantospora, Phanerochaete arizonica, Phanerochaete avellanea, Phanerochaete burtii, Phanerochaete carnosa, Phanerochaete chrysorhizon, Phanerochaete radicata, Phanerochaete salmonicolor, Phanerochaete tuberculata, Phanerochaete velutina, Phellinus ferreus, Phellinus gilvus, Phellinus igniarius, Phellinus pini, Phellinus pomaceus, Phellinus weirii, Phialophora asteris, Phialophora cinerescens, Phialophora gregata, Phialophora tracheiphila, Phloeospora multimaculans, Pholiota variicystis, Phoma, Phoma caricae - papayae, Phoma clematidina, Phoma costaricensis, Phoma cucurbitacearum, Phoma destructiva, Phoma draconis, Phoma eupyrena, Phoma exigua, Phoma exigua var. exigua, Phoma exigua var. foveata, Phoma exigua var. linicola, Phoma glomerata, Phoma glycinicola, Phoma herbarum, Phoma insidiosa, Phoma medicaginis, Phomamicrospora, Phoma nebulosa, Phoma oncidii-sphacelati, Phoma pinodella, Phoma scabra, Phoma sclerotioides, Phoma strasseri, Phoma tracheiphila, Phomopsis arnoldiae, Phomopsis asparagi, Phomopsis asparagicola, Phomopsis azadirachtae, Phomopsis cannabina, Phomopsis caricae-papayae, Phomopsis coffeae, Phomopsis elaeagni, Phomopsis ganjae, Phomopsis javanica, Phomopsis lokoyae, Phomopsis mangiferae, Phomopsis obscurans, Phomopsis perseae, Phomopsis prunorum, Phomopsis scabra, Phomopsis sclerotioides, Phomopsis tanakae, Phomopsis theae, Photoassimilate, Phragmidium, Phragmidium mucronatum, Phragmidium rosae-pimpinellifoliae, Phragmidium rubi-idaei, Phragmidium violaceum, Phyllachora cannabis, Phyllachora graminis var. graminis, Phyllachora gratissima, Phyllachora musicola, Phyllachora pomigena, Phyllachora sacchari, Phyllactinia, Phyllactinia angulata, Phyllactinia guttata, Phyllody, Phyllosticta, Phyllosticta alliariaefoliae, Phyllosticta anacardiacearum, Phyllosticta arachidis-hypogaeae, Phyllosticta batatas, Phyllostictacapitalensis, Phyllosticta caricae - papayae, Phyllosticta carpogena, Phyllosticta circumscissa, Phyllosticta coffeicola, Phyllosticta concentrica, Phyllosticta co ryli, Phyllosticta cucurbitacearum, Phyllosticta cyclaminella, Phyllosticta erratica, Phyllosticta hawaiiensis, Phyllosticta lentisci, Phyllosticta manihotis, Phyllosticta micropuncta, Phyllosticta mortonii, Phyllosticta nicotianae, Phyllosticta palmetto, Phyllosticta penicillariae, Phyllosticta perseae, Phyllosticta platani, Phyllosticta pseudocapsici, Phyllosticta sojaecola, Phyllosticta solitaria, Phyllosticta theae, Phyllosticta theicola, Phymatotrichopsis omnivora, Physalospora abdita, Physalospora disrupta, Physalospora perseae, Physarum cinereum, Physoderma alfalfae, Physoderma leproides, Physoderma trifolii, Physopella ampelopsidis, Phytophthora, Phytophthora alni, Phytophthora boehmeriae, Phytophthora cactorum, Phytophthora cajani, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, Phytophthora erythroseptica, Phytophthora fragariae, Phytophthora fragariae var. rubi, Phytophthora gallica, Phytophthorahibernalis, Phytophthora infestans, Phytophthora inflata, Phytophthora iranica, Phytophthora katsurae, Phytophthora kernoviae, Phytophthora lateralis, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora megasperma, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora plurivora, Phytophthora ramorum, Phytophthora sojae, Phytophthora syringae, Phytophthora tentaculata, Phytoplasma, Pichia membranifaciens, Pichia subpelliculosa, Pileolaria terebinthi, Pilidiella quercicola, Plasmodiophora brassicae, Plasmopara, Plasmopara halstedii, Plasmopara helianthi f. helianthi, Plasmopara lactucae-radicis, Plasmopara nivea, Plasmopara obducens, Plasmopara penniseti, Plasmopara pygmaea, Plasmopara viticola, Platychora ulmi, Plenodomus destruens, Plenodomus meliloti, Pleochaeta, Pleosphaerulina sojicola, Pleospora alfalfae, Pleospora betae, Pleospora herbarum, Pleospora lycopersici, Pleospora tarda, Pleospora theae, Pleurotus dryinus, Podosphaera, Podosphaera clandestina var. clandestine, Podosphaerafusca, Podosphaera leucotricha, Podosphaera macularis, Podosphaera pannosa, Podosphaera tridactyla, Podosphaera tridactyla var. tridactyla, Podosphaera xanthii, Polymyxa graminis, Polyscytalum pustulans, Polystigma fulvum, Poria hypobrunnea, Postia tephroleuca, Potato cyst nematode, Pratylenchus alleni, Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus crenatus, Pratylenchus dulscus, Pratylenchus fallax, Pratylenchus flakkensis, Pratylenchus goodeyi, Pratylenchus hexincisus, Pratylenchus loosi, Pratylenchus minutus, Pratylenchus mulchandi, Pratylenchus musicola, Pratylenchus neglectus, Pratylenchus penetrans, Pratylenchus pratensis, Pratylenchus reniformia, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, Pratylenchus zeae, Pseudocercospora, Pseudocercospora arecacearum, Pseudocercospora cannabina, Pseudocercospora fuligena, Pseudocercospora gunnerae, Pseudocercospora kaki, Pseudocercospora mali, Pseudocercospora pandoreae, Pseudocercospora puderi, Pseudocercospora purpurea, Pseudocercosporarhapisicola, Pseudocercospora subsessilis, Pseudocercospora theae, Pseudocercospora vitis, Pseudocercosporella capsellae, Pseudocochliobolus eragrostidis, Pseudoepicoccum cocos, Pseudomonas amygdali, Pseudomonas asplenii, Pseudomonas avellanae, Pseudomonas caricapapayae, Pseudomonas cichorii, Pseudomonas coronafaciens, Pseudomonas corrugate, Pseudomonas ficuserectae, Pseudomonas flavescens, Pseudomonas fuscovaginae, Pseudomonas helianthi, Pseudomonas marginalis, Pseudomonas meliae, Pseudomonas oryzihabitans, Pseudomonas palleroniana, Pseudomonas papaveris, Pseudomonas salomonii, Pseudomonas savastanoi, Pseudomonas syringae, Pseudomonas tomato, Pseudomonas tremae, Pseudomonas turbinellae, Pseudomonas viridiflava, Pseudoperonospora cannabina, Pseudoperonospora cubensis, Pseudoperonospora humuli, Pseudopezicula tetraspora, Pseudopezicula tracheiphila, Pseudopeziza jonesii, Pseudopeziza medicaginis, Pseudopeziza trifolii, Pseudoseptoria donacis, Puccinia, Puccinia angustata, Puccinia arachidis, Puccinia aristidae, Pucciniaasparagi, Puccinia cacabata, Puccinia campanulae, Puccinia carthami, Puccinia coronate, Puccinia coronata var. hordei, Puccinia dioicae, Puccinia erianthi, Puccinia extensicola var. hieraciata, Puccinia helianthi, Puccinia hordei, Puccinia jaceae var. solstitialis, Puccinia kuehnii, Puccinia mariae-wilsoniae, Puccinia melanocephala, Puccinia menthae, Puccinia pelargonii-zonalis, Puccinia pittieriana, Puccinia poarum, Puccinia psidii, Puccinia purpurea, Puccinia recondita, Puccinia schedonnardii, Puccinia sessilis, Puccinia striiformis f. sp. hordei, Puccinia striiformis var. striiformis, Puccinia subnitens, Puccinia substriata var. indica, Puccinia verruca, Puccinia xanthii, Pucciniaceae, Pucciniastrum, Pucciniastrum americanum, Pucciniastrum arcticum, Pucciniastrum coryli, Pucciniastrum epilobii, Pucciniastrum hydrangeae, Punctodera chalcoensis, Pycnoporus cinnabarinus, Pycnoporus sanguineus, Pycnostysanus azaleae, Pyrenochaeta lycopersici, Pyrenochaeta terrestris, Pyrenopeziza brassicae, Pyrenophora, Pyrenophoraavenae, Pyrenophora chaetomioides, Pyrenophora graminea, Pyrenophora seminiperda, Pyrenophora teres, Pyrenophora teres f. maculata, Pyrenophora teres f. teres, Pyre nophora tritici-repentis, Pythiaceae, Pythiales, Pythium, Pythium acanthicum, Pythium aphanidermatum, Pythium aristosporum, Pythium arrhenomanes, Pythium buismaniae, Pythium debaryanum, Pythium deliense, Pythium dissotocum, Pythium graminicola, Pythium heterothallicum, Pythium hypogynum, Pythium irregulare, Pythium iwayamae, Pythium mastophorum, Pythium middletonii, Pythium myriotylum, Pythium okanoganense, Pythium paddicum, Pythium paroecandrum, Pythium perniciosum, Pythium rostratum, Pythium scleroteichum, Pythium spinosum, Pythium splendens, Pythium sulcatum, Pythium sylvaticum, Pythium tardicrescens, Pythium tracheiphilum, Pythium ultimum, Pythium ultimum var. ultimum, Pythium vexans, Pythium violae, Pythium volutum, Quinisulcius acutus, Quinisulcius capitatus, Radopholous similis, Radopholus similis, Ralstonia solanacearum, Ramichloridium musae, Ramularia, Ramularia beticola, Ramularia brunnea, Ramularia coryli, Ramularia cyclaminicola, Ramularia macrospora, Ramularia menthicola, Ramularia necator, Ramularia primulae, Ramulariaspinaciae, Ramularia subtilis, Ramularia tenella, Ramulispora sorghi, Ramulispora sorghicola, Resinicium bicolor, Rhabdocline pseudotsugae, Rhabdocline weirii Rhabdoviridae, Rhinocladium corticola, Rhizoctonia, Rhizoctonia leguminicola, Rhizoctonia rubi, Rhizoctonia solani, Rhizomorpha subcorticalis, Rhizophydium graminis, Rhizopus arrhizus, Rhizopus circinans, Rhizopus microsporus var. microspores, Rhizopus oryzae, Rhodococcus fascians, Rhynchosporium, Rhynchosporium secalis, Rhytidhysteron rufulum, Rhytisma acerinum, Rhytisma vitis, Rigidoporus lineatus, Rigidoporus microporus, Rigidoporus ulmarius, Rigidoporus vinctus, Rosellinia arcuata, Rosellinia bunodes, Rosellinia necatrix, Rosellinia pepo, Rosellinia subiculata, Rotylenchulus, Rotylenchulus parvus, Rotylenchulus reniformis, Rotylenchus brachyurus, Rotylenchus robustus, Saccharicola taiwanensis, Saccharomyces florentinus, Saccharomyces kluyveri, Sarocladium oryzae, Sawadaea, Sawadaea tulasnei, Schiffnerula cannabis, Schizoparme straminea, Schizophyllum commune, Schizoporaflavipora, Schizothyrium pomi, Scleroderris canker, Sclerophthora macrospora, Sclerophthora rayssiae, Sclerospora graminicola, Sclerospora mischanthi, Sclerotinia borealis, Sclerotinia minor, Sclerotinia ricini, Sclerotinia sclerotiorum, Sclerotinia spermophila, Sclerotinia trifoliorum, Sclerotium, Sclerotium cinnamomi, Sclerotium delphinii, Scutellonema brachyurum, Scutellonema cavenessi, Scytinostroma galactinum, Seimatosporium mariae, Seimatosporium rhododendri, Selenophoma linicola, Septobasidium, Septobasidium bogoriense, Septobasidium pilosum, Septobasidium pseudopedicellatum, Septobasidium theae, Septocyta ruborum, Septogloeum potentillae, Septoria, Septoria aciculosa, Septoria ampelina, Septoria azalea, Septoria bataticola, Septoria campanulae, Septoria cannabis, Septoria caryae, Septoria citri, Septoria cucurbitacearum, Septoria darrowii, Septoria dianthi, Septoria eumusae, Septoria fragariae, Septoria fragariaecola, Septoria glycines, Septoria helianthi, Septoria humuli, Septoria hydrangeae, Septoria lactucae, SeptoriaLiquidambaris, Septoria lycopersici, Septoria lycopersici var. malagutii, Septoria menthae, Septoria ostryae, Septoria passerinii, Septoria pisi, Septoria pistaciae, Septoria platanifolia, Septoria rhododendri, Septoria secalis, Septoria selenophomoides, Setosphaeria rostrata, Setosphaeria turcica, Sirosporium diffusum, Sparassis, Sphaceloma, Sphaceloma arachidis, Sphaceloma coryli, Sphaceloma menthae, Sphaceloma perseae, Sphaceloma poinsettiae, Sphaceloma pyrinum, Sphaceloma randii, Sphaceloma sacchari, Sphaceloma theae, Sphacelotheca reiliana, Sphaerella platanifolia, Sphaeropsis tumefaciens, Sphaerotheca, Sphaerotheca castagnei, Sphaerotheca fuliginea, Sphaerulina oryzina, Sphaerulina rehmiana, Sphaerulina rubi, Sphenospora kevorkianii, Spiniger meineckellus, Spiroplasma, Spongipellis unicolor, Sporisorium cruentum, Sporisorium ehrenbergi, Sporisorium scitamineum, Sporisorium sorghi, Sporonema phacidioides, Stagonospora avenae f.sp. triticae, Stagonospora meliloti, Stagonospora recedens, Stagonospora sacchari, Stagonosporatainanensis, Steccherinum ochraceum, Stegocintractia junci, Stegophora ulmea, Stemphylium alfalfa, Stemphylium bolickii, Stemphylium cannabinum, Stemphylium globuliferum, Stemphylium lycopersici, Stemphylium sarciniforme, Stemphylium solani, Stemphylium vesicarium, Stenella anthuriicola, Stereum, Stereum hirsutum, Stereum rameale, Stereum sanguinolentum, Stigmatomycosis, Stigmella platani-racemosae, Stigmina carpophila, Stigmina liquidambaris, Stigmina palmivora, Stigmina platani, Stigmina platani-racemosae, Subanguina radicicola, Subanguina wevelli, Sydowia polyspora, Sydowiella depressula, Sydowiellaceae, Synchytrium endobioticum, Synchytrium fragariae, Synchytrium liquidambaris, Taiwanofungus camphoratus, Tapesia acuformis, Tapesia yallundae, Taphrina aurea, Taphrina bullata, Taphrina caerulescens, Taphrina coryli, Taphrina deformans, Taphrina entomospora, Taphrina johansonii, Taphrina potentillae, Taphrina ulmi, Taphrina wiesneri, Thanatephorus cucumeris, Thielaviopsis, Thielaviopsis basicola, Thyrostroma compactum, Tilletiabarclayana, Tilletia caries, Tilletia controversa, Tilletia laevis, Tilletia tritici, Tilletia walkeri, Tilletiariaceae, Tobacco necrosis virus, To gniniaceae, Trachysphaera fructigena, Trametes gibbosa, Trametes hirsute, Trametes nivosa, Trametes pubescens, Tranzschelia discolor f.sp. persica, Tranzschelia pruni-spinosae var. discolor, Trichaptum biforme, Trichoderma harzianum, Trichoderma koningii, Trichoderma viride, Trichothecium roseum, Tripospermum acerinum, Truncatella, Truncatella laurocerasi, Tubercularia lateritia, Tubercularia ulmea, Tubeufia pezizula, Tunstallia aculeata, Tylenchorhynchus, Tylenchorhynchus brevilineatus, Tylenchorhynchus claytoni, Tylenchorhynchus dubius, Tylenchorhynchus maximus, Tylenchorhynchus nudus, Tylenchorhynchus phaseoli, Tylenchorhynchus vulgaris, Tylenchorhynchus zeae, Tylenchulus semipenetrans, Typhula idahoensis, Typhula incarnate, Typhula ishikariensis, Typhula ishikariensis var.canadensis, Typhula variabilis, Typhulochaeta, Tyromyces calkinsii, Tyromyces chioneus, Tyromyces galactinus, Ulocladium atrum, Ulocladium consortiale, Uncinula, Uncinula macrospora, Uncinula necator, Uredo behnickiana, Uredo kriegeriana, Uredo musae, Uredo nigropuncta, Uredo rangelii, Urocystis, Urocystis agropyri, Urocystis brassicae, Urocystis occulta, Uromyces, Uromyces apiosporus, Uromyces beticola, Uromyces ciceris-arietini, Uromyces dianthi, Uromyces euphorbiae, Uromyces graminis, Uromyces inconspicuus, Uromyces lineolatus subsp. nearcticus, Uromyces medicaginis, Uromyces musae, Uromyces oblongus, Uromyces pisi-sativi, Uromyces proeminens var. poinsettiae, Uromyces trifolii-repentis var. fallens, Uromyces viciae-fabae var.viciae - fabae, Urophlyctis leproides, Urophlyctis trifolii, Urophora cardui, Ustilaginales, Ustilaginoidea virens, Ustilaginomycetes, Ustilago, Ustilago avenae, Ustilago hordei, Ustilago maydis, Ustilago nigra, Ustilago nuda, Ustilago scitaminea, Ustilago tritici, Valsa abietis, Valsa ambiens, Valsa auerswaldii, Valsa ceratosperma, Valsa kunzei, Valsa nivea, Valsa sordida, Valsaria insitiva, Venturia carpophila, Venturia inaequalis, Venturia pirina, Venturia pyrina, Veronaea musae, Verticillium, Verticillium albo - atrum, Verticillium albo - atrum var. menthae, Verticillium dahliae, Verticillium longisporum, Verticillium theobromae, Villosiclava virens, Virescence, Waitea circinata, Wuestneiopsis Georgiana, Xanthomonas ampelina, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomonas campestris pv.Examples include campestris, Xanthomonas oryzae, Xeromphalina fraxinophila, Xiphinema americanum, Xiphinema bakeri, Xiphinema brevicolle, Xiphinema diversicaudatum, Xiphinema insigne, Xiphinema rivesi, Xiphinema vuittenezi, Xylaria mali, Xylaria polymorpha, Xylella fastidiosa, Xylophilus, Xylophilus ampelinus, Zopfia rhizophila, Zygosaccharomyces bailii, and Zygosaccharomyces florentinus.

[0118] As pathogens of insects and worms, there are Acalymma, Acyrthosiphon pisum, African armyworm, African honey bee, Agromyzidae, Agrotis munda, Agrotis porphyricollis, Aleurocanthus woglumi, Aleyrodes proletella, Alphitobius diaperinus, Altica chalybea, Anasa tristis, Anguina tritici, Anisoplia austriaca, Anthonomus pomorum, Anthonomus signatus, Aonidiella aurantii, Apamea apamiformis, Apamea niveivenosa, Aphelenchoides spp., aphids, Aphis gossypii, apple maggot, Argentine ant, army cutworm, Arotrophora arcuatalis, Asterolecanium coffeae, Athous haemorrhoidalis, Aulacophora, Australian plague locust, Bactericera cockerelli, Bactrocera, Bactrocera correcta, Bagrada hilaris, banded hickory borer, beet armyworm, Belonolaimus spp., black bean aphid, Blepharidopterus chlorionis, Bogong moth, cotton aphid, Bradysia similigibbosa, Brassica pod midge, Brevicoryne brassicae, brown locust, green stink bug, brown planthopper, Bursephelenchus spp., diamondback moth, aphid, Callosobruchus maculatus, cane beetle, carrot fly, wheat midge, Cecidomyiidae, Ceratitis capitata, Ceratitis rosa, cereal leaf beetle, Chlorops pumilionis, citrus long-horned beetle, Coccus viridis, codling moth, coffee berry borer, Colorado potato beetle, Hylotrupes bajulus, crambus, cucumber beetle, Curculio nucum, Curculio occidentis, corn earworm, Cyclocephala borealis, dark sword-grass, date stone beetle, Delia spp., Delia antiqua, Delia floralis, Delia radicum, desert locust, Diabrotica, Diabrotica balteata, Diabrotica speciosa, diamondback moth, Diaphania indica, Diaphania nitidalis, Diaphorina citri, Diaprepes abbreviatus, Diatraea saccharalis, differential grasshopper, Ditylenchus spp., Dociostaurus maroccanus, Drosophila suzukii, Dryocosmus kuriphilus, Earias perhuegeli, Epicauta vittata, Epilachna varivestis, Erionota thrax, Eriosomatinae, Euleia heraclei, Eumetopina flavipes, Eupoecilia ambiguella, European corn borer, Eurydema oleracea, Eurygaster integriceps, forest bug, Frankliniella tritici, Galleria mellonella, garden dart, glassy-winged sharpshooter, greenhouse whitefly, Gryllotalpa orientalis, Gryllus pennsylvanicus, rice leaf beetle, Helicoverpa armigera, Helicoverpa gelotopoeon, Helicoverpa punctigera, Helicoverpa zea, Heliothis virescens, Henosepilachna vigintioctopunctata, Hessian fly, Heterodera spp., Jacobiasca formosana, bean leaf beetle, small red shrimp beetle, Lampides boeticus, leaf-mining insects, Lepidiota consobrina, Lepidosaphes beckii, Lepidosaphes ulmi, Leptoglossus zonatus, Leptopterna dolabrata, lesser wax moth, Leucoptera (moth), Leucoptera caffeina, light brown apple moth, Lissorhoptrus oryzophilus, long-nosed weevil, Lygus, Lygus hesperus, Maconellicoccus hirsutus, Macrodactylus subspinosus, Macrosiphum euphorbiae, coconut hispine beetle, Manduca sexta, Mayetiola hordei, rice water weevil, Meloidogyne spp., Megacopta cribraria, Metcalfa pruinosa, (moth), leek moth, Myzus persicae, Naccobus spp., Nezara viridula, oak processionary, olive fruit fly, Ophiomyia simplex, Opisina arenosella, Opomyza, Opomyza florum, Opomyzidae, Oscinella frit, Ostrinia furnacalis, Oxycarenus hyalinipennis, papaya mealybug, Papilio demodocus, Paratachardina pseudolobata, Pentatomoidea, Phthorimaea operculella, Phyllophaga, Phylloxera, Phylloxeridae, Phylloxeroidea, Pieris brassicae, cotton aphid, Planococcus citri, Platynota idaeusalis, plum curculio, Pratylenchus spp., Prionus californicus, Pseudococcus viburni, Pyralis farinalis, red imported fire ant, red locust, Negusare-senchuu, Nekobuse-senchuu, Radopholus spp., Rotylenchulus spp., Rhagoletis cerasi, Rhagoletis indifferens, Rhagoletis mendax, Rhopalosiphum maidis, Rhyacionia frustrana, Rhynchophorus ferrugineus, Rhynchophorus palmarum, Rhyzopertha, Gaimai-tsuzuriga, rice stink bug, Russian wheat aphid, San Jose scale, Kaigaramushi, Schistocerca americana, Sciaridae, Scirtothrips dorsalis, Scutelleridae, Scutiphora pedicellata, seed gall nematodes, serpentine leaf miner, Shirubaa-riifukonajiram i, Sipha flava, small hive beetle, Southwestern corn borer, soybean aphid, Spodoptera cilium, Spodoptera litura, spotted cucumber beetle, squash vine borer, stem Nematodes, Stenotus binotatus, Strauzia longipennis, Kisujinomihakushi, sunn pest, sweetpotato bug, Sabiiro-mekuragame, Azami-uma, Thrips angusticeps, Thrips palmi, Toxoptera citricida, Trichodorus spp., Trioza erytreae, Kaburayaga, Tuta absoluta, Tylenchulus spp., including Hime Marukatsuo Bugs, Virachola isocrates, waxworm, Western corn rootworm, Asian citrus psyllid, wheat fly, wheat weevil, aphid, winter moth, and Xiphenema spp.

[0119] For example, the insect or helminth pathogen can be an army worm, Spodoptera litura, European corn borer, Ostrinia furnacalis, cutworm, Callosobruchus maculatus, lesser cornstalk borer, maize billbug, seed corn maggot, webworm, southern cornstalk borer, southern corn rootworm, southern potato wireworm, stalk borer, sugarcane beetle, the larva of Anoplophora glabripennis, cabbage looper, Plutella xylostella, yellow striped armyworm, cereal leaf beetle, Oulema oryzae, aphid, beet armyworm, bean weevil, soybean looper, soybean stem borer, or a combination thereof.

[0120] Proteins and peptides that enhance stress tolerance in plants The present invention also relates to a fusion protein containing a targeting sequence, an exosporium protein, or an exosporium protein fragment, and at least one protein or peptide that enhances stress tolerance in plants.

[0121] For example, a protein or peptide that enhances stress tolerance in plants contains an enzyme that degrades stress-related compounds. Stress-related compounds include, but are not limited to, aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins, and phenols. Specific reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide. Enzymes that degrade stress-related compounds may contain superoxide dismutase, oxidase, catalase, aminocyclopropane-1-carboxylic acid deaminase, peroxidase, antioxidant enzymes, or antioxidant peptides.

[0122] A protein or peptide that enhances stress tolerance in plants may also contain a protein or peptide that defends the plant from environmental stress. Environmental stress includes, for example, drought, flooding, high temperature, freezing, salt, heavy metals, low pH, high pH, or combinations thereof. For example, a protein or peptide that defends the plant from environmental stress includes ice nucleation protein, prolinase, phenylalanine ammonia-lyase, isochorismate synthase, isochorismate pyruvate lyase, or choline dehydrogenase.

[0123] Plant-binding proteins and peptides The present invention also relates to a targeting sequence, an exosporium protein, or a fusion protein containing an exosporium protein and at least a plant-binding protein or peptide. A plant-binding protein or peptide can be any protein or peptide that can specifically or non-specifically bind to any part of a plant (e.g., the roots of a plant or aerial parts such as, for example, leaves, stems, flowers, or fruits) or plant material. Thus, for example, a plant-binding protein or peptide can be a root-binding protein or peptide or a leaf-binding protein or peptide.

[0124] Suitable plant-binding proteins and peptides include adhesins (e.g., rhicadhesin), flagellin, omptin, lectin, expansin, biofilm structural proteins (e.g., TasA or YuaB), fimbrial proteins, curlus proteins, intimin, invasin, agglutinin, and afimbrial proteins.

[0125] Other fusion proteins The present invention further relates to a fusion protein containing at least one target protein or peptide and an exosporium protein containing an amino acid sequence having at least 85% identity with any one of SEQ ID NOs: 71, 75, 80, 81, 82, 83, and 84. Alternatively, the exosporium protein may contain an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% identity with any one of SEQ ID NOs: 71, 75, 80, 81, 82, 83, and 84.

[0126] The target protein or peptide may contain any protein or peptide. For example, the target protein or peptide may contain any protein or peptide described herein. For example, the target protein or peptide may contain any plant growth-stimulating protein or peptide described herein, any protein or peptide that defends plants from pathogens described herein, any protein or peptide that enhances stress tolerance in plants described herein, or any plant-binding protein or peptide described herein.

[0127] Therefore, when the target protein or peptide contains a plant growth-stimulating protein or peptide, the plant growth-stimulating protein or peptide may contain a peptide hormone, a non-hormonal peptide, or an enzyme involved in the production or activation of a plant growth-stimulating compound. Alternatively, the plant growth-stimulating protein or peptide may contain any enzyme that degrades or modifies the nutrient sources of the bacteria, fungi, or plants described below.

[0128] Members of the recombinant Bacillus cereus family that express a fusion protein The present invention also relates to members of the recombinant Bacillus cereus family that express a fusion protein. The fusion protein may be any of the above-mentioned fusion proteins.

[0129] Members of the recombinant Bacillus cereus family may co-express two or more of the above-mentioned fusion proteins. For example, a member of the recombinant Bacillus cereus family may co-express at least one fusion protein containing a plant-binding protein or peptide with at least one fusion protein containing a plant growth-stimulating protein or peptide, at least one fusion protein containing a protein or peptide that defends plants from pathogens, or at least one protein or peptide that enhances stress tolerance in plants.

[0130] Members of the recombinant Bacillus cereus family may contain Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, or combinations thereof. For example, members of the recombinant Bacillus cereus family may contain Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides, or Bacillus mycoides. In particular, members of the recombinant Bacillus cereus family may contain Bacillus thuringiensis, or Bacillus mycoides.

[0131] To generate a member of the recombinant Bacillus cereus family that expresses a fusion protein, any member of the recombinant Bacillus cereus family may be combined, transduced, or transformed with a vector encoding the fusion protein using standard methods known in the art (e.g., by electroporation). The bacteria may then be screened and transformants identified by any method known in the art. For example, if the vector contains an antibiotic resistance gene, the bacteria may be screened for antibiotic resistance. Alternatively, the DNA encoding the fusion protein may be integrated into the chromosomal DNA of the host of a member of the B. cereus family. A member of the recombinant Bacillus cereus family may then be exposed to conditions under which sporulation is induced. Appropriate conditions for inducing sporulation are known in the art. For example, a member of the recombinant Bacillus cereus family may be placed on an agar plate and incubated at a temperature of about 30°C for several days (e.g., 3 days).

[0132] Any of the above-mentioned types of inactivated strains, non-toxic strains, or genetically engineered strains may be appropriately used. For example, Bacillus thuringiensis lacking the Cry toxin may be used. Alternatively, or further, when spores of a recombinant Bacillus cereus family expressing a fusion protein are produced, they may be inactivated to prevent further germination upon use. Any method known in the art for inactivating bacterial spores may be used. Suitable methods include, but are not limited to, heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (e.g., treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleaching, or any combination thereof), or a combination thereof. Alternatively, spores from toxin-producing strains, or strains that have been genetically or physically inactivated may be used.

[0133] Members of the recombinant Bacillus cereus family having a plant growth stimulating effect and / or other beneficial properties Many strains of members of the Bacillus cereus family have inherent beneficial properties. For example, some strains have a plant growth stimulating effect. Any of the fusion proteins described herein may be expressed in such strains.

[0134] For example, a member of the recombinant Bacillus cereus family may contain a plant growth stimulating bacterial strain.

[0135] The plant growth-stimulating bacterial strain may contain a bacterial strain that produces insecticidal toxins (e.g., Cry toxins), produces antifungal compounds (e.g., β-1,3-glucanase, chitinase, lichenase, or combinations thereof), produces nematicidal compounds (e.g., Cry toxins), produces bactericidal compounds, is resistant to one or more antibiotics, contains one or more free replicating plasmids, binds to the roots of plants, colonizes the roots of plants, forms biofilms, solubilizes nutrients, secretes organic acids, or any combination thereof.

[0136] For example, when a member of the recombinant Bacillus cereus family contains a plant growth-stimulating bacterial strain, the plant growth-stimulating bacterial strain may contain Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), EE128 (NRRL No. B-50917) which is a member of the Bacillus cereus family, Bacillus thuringiensis BT013A (NRRL No. B-50924), or EE349 (NRRL No. B-50928) which is a member of the Bacillus cereus family. Each of these strains was deposited on March 10, 2014 with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS) (address: 1815 North University Street, Peoria, Illinois 61604 U.S.A.) and is identified by the NRRL deposit number shown in parentheses.

[0137] These plant growth-stimulating strains were isolated from the rhizospheres of various vigorous plants and identified via the sequences of 16S rRNA (presented herein as SEQ ID NOs: 104 to 110) and biochemical assays. The strains were identified at least for their genus designation by standard biochemical and morphological indicators. For example, biochemical assays for the determination of Gram-positive strains such as Bacillus include, for example, growth on PEA medium and nutrient agar, microscopic observation, growth on 5% and 7.5% NaCl media, growth at pH 5 and pH 9, growth at 42 °C and 50 °C, the ability to produce acid by fermentation using cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol, and starch; production of fluorescent dyes; hydrolysis of gelatin; nitrate reduction; catalase production, starch hydrolysis; oxidase reaction, urease production, and motility. The identification of these strains and the demonstration of the plant growth-stimulating effect are described in detail in the following examples.

[0138] For example, members of the recombinant Bacillus cereus family containing plant growth-stimulating bacterial strains may contain Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A. Members of the recombinant Bacillus cereus family may express any fusion protein described herein (for example, the targeting sequence of SEQ ID NO: 60 and a non-hormonal peptide (for example, kunitz trypsin inhibitor (KTI)), an enzyme involved in the production or activation of plant growth-stimulating compounds (for example, chitinase), a plant-binding protein or peptide (for example, TasA); a protein or peptide that defends plants from pathogens (for example, TasA), or a fusion protein containing an enzyme that degrades or modifies the nutrient sources of bacteria, fungi, or plants (for example, a phosphatase such as PhoA or phytase, or endoglucanase)).

[0139] Promoter In any member of the recombinant Bacillus cereus family described herein, the fusion protein may be expressed under the control of a promoter specific to the targeting sequence, exosporium protein, or exosporium fragment of the fusion protein. For example, if the fusion protein contains a targeting sequence from B. anthracis sterne BclA (e.g., amino acids 20 - 35 of SEQ ID NO: 1, amino acids 1 - 35 of SEQ ID NO: 1, SEQ ID NO: 1 or SEQ ID NO: 60), or if the fusion protein contains full-length BclA (SEQ ID NO: 2) or a fragment of full-length BclA (SEQ ID NO: 59), the fusion protein may be expressed under the control of a promoter normally associated with the BclA gene in the genome of B. anthracis sterne (e.g., the promoter of SEQ ID NO: 85).

[0140] Alternatively, the fusion protein may be expressed under the control of a high-expression sporulation promoter. In some examples, the promoter specific to the targeting sequence, exosporium protein, or exosporium protein fragment is a high-expression sporulation promoter. In other examples, the promoter specific to the targeting sequence, exosporium protein, or exosporium protein fragment is not a high-expression sporulation promoter. In the latter case, it may be beneficial to replace the native promoter with a high-expression sporulation promoter. Expression of the fusion protein under the control of a high-expression sporulation promoter results in increased expression of the fusion protein on the exosporium protein of a member of the Bacillus cereus family.

[0141] The high-expression sporulation promoter may contain one or more sigma-K sporulation-specific polymerase promoter sequences.

[0142] Examples of high-expression sporulation promoters suitable for the expression of fusion proteins in members of the Bacillus cereus family include those in Table 2 below:

Table 2-1

Table 2-2

Table 2-3

[0143] In the promoter arrays of Table 2 above, the positions of the sigma-K sporulation-specific polymerase promoter arrays are indicated by bold and underlined letters. The Cry1A promoter (B. thuringiensis HD-73; SEQ ID NO: 90) has a total of four sigma-K arrays (two of which overlap each other and are indicated by double underlining in Table 2).

[0144] Preferred high-expression sporulation promoters for use in the expression of fusion proteins in members of the Bacillus cereus family include the BetA promoter (B. anthracis Sterne; SEQ ID NO: 86), the BclA promoter (B. anthracis Sterne; SEQ ID NO: 85), the BclA cluster glycosyltransferase operon 1 and 2 promoters (B. anthracis Sterne; SEQ ID NOs: 101 and 102), and the YVTN β propeller protein promoter (B. weihenstephensis KBAB 4; SEQ ID NO: 89).

[0145] In any recombinant member of the Bacillus cereus family described herein, the fusion protein may be expressed under the control of a sporulation promoter containing a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to any one of the nucleic acid sequences of SEQ ID NOs: 85-103.

[0146] When the spore formation promoter contains a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity with any one of the nucleic acid sequences of SEQ ID NOs: 85 to 103, the sequence(s) of the sigma-K spore formation-specific polymerase promoter is preferably 100% identical to the corresponding nucleotides of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103. For example, as shown in Table 2 above, the BclA promoter (SEQ ID NO: 85) of B. anthracis sterne has nucleotide sequences at positions 24 - 32, 35 - 43, and 129 - 137 that are sigma-K spore formation-specific polymerase promoter sequences. Thus, if the spore formation promoter contains a sequence having at least 90% identity with the nucleic acid sequence of SEQ ID NO: 85, the nucleotides of the spore formation promoter corresponding to the nucleotides at positions 24 - 32, 35 - 43, and 129 - 137 of SEQ ID NO: 85 are preferably 100% identical to the nucleotides at positions 24 - 32, 35 - 43, and 129 - 137 of SEQ ID NO: 85.

[0147] Formulation The present invention also relates to a formulation containing any member of the recombinant Bacillus cereus family examined in the foregoing section and an agriculturally acceptable carrier.

[0148] The agriculturally acceptable carrier can be any carrier suitable for agricultural use. For example, suitable agriculturally acceptable carriers include, but are not limited to, dispersants, surfactants, additives, water, thickeners, anti-freezing agents, residue decomposers, fertilizer conditioners, granular coatings, diatomaceous earth, oils, colorants, stabilizers, preservatives, polymers, coatings, and combinations thereof.

[0149] The additive may contain oil, rubber, resin, clay, polyoxyethylene glycol, terpene, sticky organic matter, fatty acid ester, sulfated alcohol, alkyl sulfonate, sulfated petroleum, alcohol sulfate, sodium alkyl butane diamate, polyester of sodium thiobutanedioate, benzene acetonitrile derivative, proteinaceous substance (e.g., dairy product, wheat flour, soybean meal, blood, albumin, gelatin, or a combination thereof), or a combination of them.

[0150] The thickener may contain long-chain alkyl sulfonate of polyethylene glycol, polyoxyethylene oleate, or a combination of them.

[0151] The surfactant may contain heavy oil, heavy oil distillate, polyol fatty acid ester, polyethoxylated fatty acid ester, arylalkyl polyoxyethylene glycol, alkyl acetic acid amine, aryl alkyl sulfonate, polyhydric alcohol, alkyl phosphate, or a combination of them.

[0152] The anti-freezing agent contains sodium salt, calcium carbonate, diatomaceous earth, or a combination of them. For example, the sodium salt may contain sodium salt of naphthalene monomethyl sulfonate, sodium salt of naphthalene dimethyl sulfonate, sodium sulfite, sodium sulfate, or a combination of them.

[0153] Suitable agriculturally acceptable carriers include vermiculite, charcoal, carbonated press mud from sugar factories, rice husks, carboxymethyl cellulose, peat, perlite, fine sand, calcium carbonate, powder, alum, starch, talc, polyvinylpyrrolidone, or a combination of them.

[0154] The formulation may contain a seed coating formulation, a liquid formulation, or a solid formulation for application to plants or the plant growth environment for application to plants or the plant growth environment.

[0155] For example, a seed coating formulation may contain an aqueous or oily solution for application to seeds. Alternatively, a seed coating formulation may contain a powder or granule formulation for application to seeds.

[0156] A liquid formulation for application to plants or the plant growth environment may contain a concentrated formulation or a ready-to-use formulation.

[0157] A solid formulation for application to plants or the plant growth environment may contain granules or powders.

[0158] Also, any of the above-described formulations may contain, for example, fertilizers, micronutrient fertilizer substances, insecticides, herbicides, plant growth improving substances, fungicides, insect repellents, molluscicides, algicides, bacterial inoculants, fungal inoculants, or combinations thereof.

[0159] The fertilizer may contain a liquid fertilizer.

[0160] The fertilizers include ammonium sulfate, ammonium nitrate, ammonium sulfate nitrate, ammonium chloride, ammonium bisulfate, ammonium polysulfide, ammonium thiosulfide, aqueous ammonia, anhydrous ammonia, ammonium polyphosphate, aluminum sulfate, calcium nitrate, calcium ammonium nitrate, calcium sulfate, calcined magnesite, calcite limestone, calcium oxide, calcium nitrate, dolomitic limestone, slaked lime, calcium carbonate, diammonium phosphate, monoammonium phosphate, magnesium nitrate, magnesium sulfate, potassium nitrate, potassium chloride, potassium magnesium sulfate, potassium sulfate, sodium nitrate, bitter ash limestone, magnesia, urea, urea-formaldehyde, urea ammonium nitrate, sulfur-coated urea, polymer-coated urea, isobutylidene diurea, K 2 SO 4 -2MgSO 4, kainite, sylvinite, kieselguhr, Epsom salt, elemental sulfur, marl, powdered oyster, fish meal, oil cake, fish fertilizer, blood meal, phosphate rock, superphosphate fertilizer, slag, bone meal, wood ash, fertilizer, bat guano, peat moss, compost, raw sand, cottonseed meal, feather meal, crab meal, fish emulsion, humic acid, or combinations thereof.

[0161] The micronutrient fertilizer substances may contain boric acid, borate, boron frit, copper sulfate, copper frit, copper chelate, sodium tetraborate decahydrate, iron sulfate, iron oxide, ammonium iron sulfate, iron frit, iron chelate, manganese sulfate, manganese oxide, manganese chelate, manganese chloride, manganese frit, sodium molybdate, molybdic acid, zinc sulfate, zinc oxide, zinc carbonate, zinc frit, zinc phosphate, zinc chelate, or combinations thereof.

[0162] The insecticide may contain organophosphates, carbamates, pyrethroids, acaricides, alkyl phthalates, boric acid, borate, fluorides, sulfur, haloaromatic substituted ureas, hydrocarbon esters, bio-based insecticides, or combinations thereof.

[0163] The herbicide may contain chlorophenoxy compounds, nitrophenol compounds, nitrocresol compounds, dipyridyl compounds, acetamides, fatty acids, anilides, benzamides, benzoic acid, benzoic acid derivatives, anisic acid, anisic acid derivatives, benzonitrile, benzothiadiazinone dioxide, thiocarbamate, carbamate, carbanylate, chloropyridinyl, cyclohexenone derivatives, dinitroaminobenzene derivatives, fluorodinitrotoluidine compounds, isoxazolidinone, nicotinic acid, isopropylamine, isopropylamine derivatives, oxadiazolinone, phosphates, phthalates, picolinic acid compounds, triazines, triazoles, uracil, urea derivatives, endothal, sodium chlorate, or combinations thereof.

[0164] The fungicide may contain a substituted benzene, a thiocarbamate, an ethylenebisdithiocarbamate, a thiophthalide amide, a copper compound, an organic mercury compound, an organic tin compound, a cadmium compound, anilazine, benomyl, cyclohexamide, dodine, etridiazole, iprodione, metalaxyl, thiamimefon, tripholin, or a combination thereof.

[0165] The fungal inoculant may contain a fungal inoculant of the family Glomeraceae, a fungal inoculant of the family Claroidoglomeraceae, a fungal inoculant of the family Gigasporaceae, a fungal inoculant of the family Acaulosporaceae, a fungal inoculant of the family Sacculosporaceae, a fungal inoculant of the family Entrophosporaceae, a fungal inoculant of the family Pacidsporaceae, a fungal inoculant of the family Diversisporaceae, a fungal inoculant of the family Paraglomeraceae, a fungal inoculant of the family Archaeosporaceae, a fungal inoculant of the family Geosiphonaceae, a fungal inoculant of the family Ambisporaceae, a fungal inoculant of the family Scutellosporaceae, a fungal inoculant of the family Dentiscultataceae, a fungal inoculant of the family Racocetraceae, a fungal inoculant of the phylum Basidiomycota, a fungal inoculant of the phylum Ascomycota, a fungal inoculant of the phylum Zygomycota, or a combination thereof.

[0166] The bacterial inoculant may contain a bacterial inoculant of the genus Rhizobium, a bacterial inoculant of the genus Bradyrhizobium, a bacterial inoculant of the genus Mesorhizobium, a bacterial inoculant of the genus Azorhizobium, a bacterial inoculant of the genus Allorhizobium, a bacterial inoculant of the genus Sinorhizobium, a bacterial inoculant of the genus Kluyvera, a bacterial inoculant of the genus Azotobacter, a bacterial inoculant of the genus Pseudomonas, a bacterial inoculant of the genus Azospirillium, a bacterial inoculant of the genus Bacillus, a bacterial inoculant of the genus Streptomyces, a bacterial inoculant of the genus Paenibacillus, a bacterial inoculant of the genus Paracoccus, a bacterial inoculant of the genus Enterobacter, a bacterial inoculant of the genus Alcaligenes, a bacterial inoculant of the genus Mycobacterium, a bacterial inoculant of the genus Trichoderma, a bacterial inoculant of the genus Gliocladium, a bacterial inoculant of the genus Glomus, a bacterial inoculant of the genus Klebsiella, or a combination thereof.

[0167] The bacterial inoculant may contain a plant growth-stimulating bacterial strain. The plant growth-stimulating bacterial strain may be a bacterial strain that produces an insecticidal toxin (e.g., Cry toxin), a bacterial strain that produces an antifungal compound (e.g., β-1,3-glucanase, chitinase, lichenase, or a combination thereof), a bacterial strain that produces a nematicidal compound (e.g., Cry toxin), a bacterial strain that produces a bactericidal compound, a bacterial strain that is resistant to one or more antibiotics, a bacterial strain that contains one or more free replicating plasmids, a bacterial strain that binds to the roots of plants, a bacterial strain that colonizes the roots of plants, a bacterial strain that forms a biofilm, a bacterial strain that solubilizes nutrients, a bacterial strain that secretes organic acids, or any combination thereof.

[0168] For example, the bacterial inoculant may contain Bacillus aryabhattai CAP53 (NRRL No. B-50819), Bacillus aryabhattai CAP56 (NRRL No. B-50817), Bacillus flexus BT054 (NRRL No. B-50816), Paracoccus kondratievae NC35 (NRRL No. B-50820), Bacillus mycoides BT155 (NRRL No. B-50921), Enterobacter cloacae CAP12 (NRRL No. B-50822), Bacillus nealsonii BOBA57 (NRRL No. NRRL B-50821), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus subtilis EE148 (NRRL No. B-50927), Alcaligenes faecalis EE107 (NRRL No. B-50920), Bacillus mycoides EE141 (NRRL NO. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), EE128 (NRRL No. B-50917), which is a member of the Bacillus cereus family, Bacillus thuringiensis BT013A (NRRL No. B-50924), Paenibacillus massiliensis BT23 (NRRL No. B-50923), EE349 (NRRL No. B-50928), which is a member of the Bacillus cereus family, Bacillus subtilis EE218 (NRRL No. B-50926), Bacillus megaterium EE281 (NRRL No. B-50925), or a combination thereof.Each of these strains was deposited on March 11, 2013 (Bacillus aryabhattai CAP53, Bacillus aryabhattai CAP56, Bacillus flexus BT054, Paracoccus kondratievae NC35, Enterobacter cloacae CAP12, and Bacillus nealsonii BOBA57) or on March 10, 2014 (Bacillus mycoides BT155, Bacillus mycoides EE118, Bacillus subtilis EE148, Alcaligenes faecalis EE107, Bacillus mycoides EE141, Bacillus mycoides BT46-3, EE128 which is a member of the Bacillus cereus family, Bacillus thuringiensis BT013A, Paenibacillus massiliensis BT23, EE349 which is a member of the Bacillus cereus family, Bacillus subtilis EE218, and Bacillus megaterium EE281) with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS) (address: 1815 North University Street, Peoria, Illinois 61604 U.S.A.) and is identified by the NRRL numbers shown in parentheses.

[0169] These plant growth-stimulating strains were isolated from the rhizospheres of various vigorous plants and identified via the sequences of 16S rRNA (presented herein as SEQ ID NOs: 104 to 121) and biochemical assays. The strains were identified at least to their genus designation based on standard biochemical and morphological indicators. For example, as biochemical assays for the identification of Gram-negative strains such as Paracoccus kondratievae, Alcaligenes faecalis, and Enterobacter cloacae, there are, for example, growth on MacConkey medium and nutrient agar, microscopic observation, growth on 5% and 7.5% NaCl media, growth at pH 5 and pH 9, growth at 42 °C and 50 °C, the ability to produce acid by fermentation using cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol, and starch; production of fluorescent pigments; hydrolysis of gelatin; nitrate reduction; starch hydrolysis; oxidase reaction, catalase production, urease production, and motility. Similarly, as biochemical assays for the identification of Gram-positive strains such as Bacillus and Paenibacillus, there are growth on PEA medium and nutrient agar, microscopic observation, growth on 5% and 7.5% NaCl media, growth at pH 5 and pH 9, growth at 42 °C and 50 °C, the ability to produce acid by fermentation using cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol, and starch; production of fluorescent pigments; hydrolysis of gelatin; nitrate reduction; catalase production, starch hydrolysis; oxidase reaction, urease production, and motility. The identification of these strains and the demonstration of the plant growth-stimulating effect are described in detail in the following examples.

[0170] For example, the formulation may contain a plant growth-stimulating bacterial strain containing Paracoccus kondratievae NC35, Bacillus aryabhattai CAP53, or Bacillus megaterium EE281, where the formulation further contains any member of the recombinant Bacillus cereus family described herein (strains of members of the recombinant plant growth-stimulating Bacillus cereus family herein (e.g., recombinant Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A, etc.)). Members of the recombinant Bacillus cereus family may express any fusion protein described herein (e.g., a targeting sequence of SEQ ID NO: 60 and a non-hormonal peptide (e.g., kunitz trypsin inhibitor (KTI)), an enzyme involved in the production or activation of a plant growth-stimulating compound (e.g., chitinase), a plant-binding protein or peptide (e.g., TasA); a protein or peptide that defends plants from pathogens (e.g., TasA), or an enzyme that degrades or modifies the nutrient source of bacteria, fungi, or plants (e.g., a phosphatase such as PhoA or phytase, or endoglucanase)).

[0171] Method for stimulating plant growth The present invention also relates to a method for stimulating the growth of plants. The method for stimulating the growth of plants includes introducing any member of the recombinant Bacillus cereus family described above, or any of the above-described formulations, into the plant growth environment. Alternatively, any member of the recombinant Bacillus cereus family described above, or any of the above-described formulations, may be applied to plants, plant seeds, or the surrounding area of plants or plant seeds. In such a method, the plant growth-stimulating protein or peptide is physically attached to the exosporium of a member of the recombinant Bacillus family.

[0172] Alternatively, the method for stimulating plant growth comprises introducing a member of the recombinant Bacillus cereus family that expresses a fusion protein into the plant growth environment, or applying a member of the recombinant Bacillus cereus family that expresses a fusion protein to a plant, a plant seed, or the surrounding area of the plant or plant seed. The fusion protein contains at least one plant growth-stimulating protein or peptide, and a targeting sequence, an exosporium protein, or an exosporium protein fragment. The plant growth-stimulating protein or peptide is physically attached to the exosporium of a member of the recombinant Bacillus cereus family. The targeting sequence, exosporium protein, or exosporium protein fragment may be any of the targeting sequences, exosporium proteins, or exosporium protein fragments listed in the above

[0005] paragraph.

[0173] Furthermore, the targeting sequence consists of 16 amino acids and has at least about 43% identity with amino acids 20 - 35 of SEQ ID NO: 1, wherein the identity with amino acids 25 - 35 is at least about 54%. Alternatively, the targeting sequence consists of amino acids 1 - 35 of SEQ ID NO: 1, amino acids 20 - 35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60.

[0174] The targeting sequence may contain an amino acid sequence having at least about 50% identity with amino acids 20 - 35 of SEQ ID NO: 1, wherein the identity with amino acids 25 - 35 is at least about 63%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 50% identity with amino acids 20 - 35 of SEQ ID NO: 1, wherein the identity with amino acids 25 - 35 is at least about 63%.

[0175] The targeting sequence may contain an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[0176] The targeting sequence may also contain an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0177] The targeting sequence may contain an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0178] The targeting sequence may contain an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0179] The targeting sequence may also contain an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0180] The targeting sequence may also contain an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 81%.

[0181] The targeting sequence may also contain an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0182] The targeting sequence may also contain an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of 16 amino acids and consists of an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[0183] Alternatively, the exosporium protein or exosporium protein fragment may contain an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84.

[0184] The plant growth-stimulating protein may contain an enzyme. For example, the enzyme may contain an enzyme that decomposes or modifies a bacterial source, a fungal source, or a plant nutrient source. Such enzymes include cellulase, lipase, lignin oxidase, protease, glycoside hydrolase, phosphatase, nitrogenase, nuclease, amidase, nitrate reductase, nitrite reductase, amylase, ammonia oxidase, ligninase, glucosidase, phospholipase, phytase, pectinase, glucanase, sulfatase, urease, xylanase, and siderophore. When introduced into the plant growth environment or applied to a plant, a seed, or the vicinity of a plant or plant seed, a fusion protein containing an enzyme that decomposes or modifies a bacterial source, a fungal source, or a plant nutrient source processes the nutrient source around the plant and results in enhanced uptake of nutrients by the plant or enhanced uptake of nutrients by beneficial bacteria or fungi around the plant.

[0185] Suitable cellulases include endocellulases (e.g., Bacillus subtilis endoglucanase, Bacillus thuringiensis endoglucanase, Bacillus cereus endoglucanase, or Bacillus clausii endoglucanase), exocellulases (e.g., Trichoderma reesei exocellulase), and β-glucosidases (e.g., Bacillus subtilis β-glucosidase, Bacillus thuringiensis β-glucosidase, Bacillus cereus β-glucosidase, or Bacillus clausii B-glucosidase).

[0186] The lipase may contain Bacillus subtilis lipase, Bacillus thuringiensis lipase, Bacillus cereus lipase, or Bacillus clausii lipase.

[0187] Suitable lignin oxidases contain lignin peroxidase, laccase, glyoxal oxidase, ligninase, and manganese peroxidase.

[0188] The protease may contain subtilisin, acid protease, alkaline protease, proteinase, peptidase, endopeptidase, exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, carboxylase, serine protease, glutamic acid protease, aspartic acid protease, cysteine protease, threonine protease, or metalloprotease.

[0189] The phosphatase may contain a phosphomonoester hydrolase, phosphomonoesterase (e.g., PhoA4), a phosphodiester hydrolase, phosphodiesterase, a triphosphate monoester hydrolase, an anhydrous phosphoryl hydrolase, pyrophosphatase, phytase (e.g., Bacillus subtilis EE148 phytase, or Bacillus thuringiensis BT013A phytase), trimetaphosphatase, or triphosphatase.

[0190] The nitrogenase may contain a nitrogenase of the Nif family (e.g., Paenibacillus massiliensis NifBDEHKNXV).

[0191] In any of the above methods of stimulating plant growth, plants grown in a plant growth environment containing a member of the recombinant Bacillus cereus family show enhanced growth compared to growth in the same plant growth environment that does not contain a member of the recombinant Bacillus cereus family.

[0192] In any of the above methods of stimulating plant growth, a member of the recombinant Bacillus cereus family may contain any of the above recombinant plant growth-stimulating bacterial strains.

[0193] In any of the above methods of stimulating plant growth, the fusion protein may be expressed under the control of any of the above promoters.

[0194] Method for protecting plants from pathogens The present invention further relates to a method for protecting plants from pathogens. The method includes introducing any of the above-mentioned recombinant Bacillus cereus family members or any of the above-mentioned formulations into the plant growth environment. Alternatively, the method includes applying any of the above-mentioned recombinant Bacillus cereus family members or any of the above-mentioned formulations to the plant, plant seeds, or the surrounding area of the plant or plant seeds. In these methods, the protein or peptide that protects the plant from pathogens is physically attached to the exosporium of the recombinant Bacillus cereus family member.

[0195] Plants grown in a plant growth environment containing a member of the recombinant Bacillus cereus family are less susceptible to infection by pathogens compared to plants grown in the same plant growth environment that does not contain a member of the recombinant Bacillus cereus family. The high resistance to pathogens may be the result of stimulation of the plant's immune system by the protein or peptide that protects the plant from pathogens, or may be the result of the indirect or direct effect of the protein or peptide that protects the plant from pathogens on the pathogens.

[0196] Method for enhancing stress tolerance in plants The present invention further relates to a method for enhancing stress tolerance in plants. The method includes introducing any of the above-mentioned recombinant Bacillus cereus family members or any of the above-mentioned formulations into the plant growth environment. Alternatively, the method includes applying any of the above-mentioned recombinant Bacillus cereus family members or any of the above-mentioned formulations to the plant, plant seeds, or the surrounding area of the plant or plant seeds. In these methods, the protein or peptide that enhances stress tolerance in plants is physically attached to the exosporium of the recombinant Bacillus cereus family member.

[0197] Plants grown in a plant growth environment containing a member of the recombinant Bacillus cereus family are less susceptible to the effects of stress compared to plants grown in the same plant growth environment that do not contain a member of the recombinant Bacillus cereus family.

[0198] Method for fixing spores of a member of the Bacillus cereus family to a plant The present invention also aims to provide a method for fixing spores of a member of the recombinant Bacillus cereus family to a plant. These methods include introducing any of the above-mentioned members of the recombinant Bacillus cereus family, or any of the above-mentioned formulations, into the plant growth environment. Alternatively, these methods include applying any of the above-mentioned members of the recombinant Bacillus cereus family, or any of the above-mentioned formulations, to a plant, a plant seed, or the surrounding area of a plant or a plant seed. The plant-binding protein or peptide is physically attached to the exosporium of a member of the recombinant Bacillus cereus family.

[0199] By these methods, spores of a member of the Bacillus cereus family can be bound to a plant, whereby the spores are maintained on the plant. For example, by these methods, spores of a member of the Bacillus cereus family can be bound to the roots of a plant, or can be bound to the aerial parts of a plant (e.g., leaves, stems, flowers, or fruits, etc.), whereby the spores are maintained on the root structure of the plant, or on the aerial parts of the plant, without dissipating into the plant growth environment, or into the surrounding environment of the aerial parts of the plant.

[0200] In any method of immobilizing spores of a member of the Bacillus cereus family in a plant, the plant-binding protein or peptide can selectively direct and maintain a member of the Bacillus cereus family to a plant, or a plant structure, or a plant substructure (e.g., a plant root, and a substructure of the plant root, or an aerial part of the plant or a substructure of the aerial part of the plant).

[0201] Plant growth environment In any of the above methods, the plant growth environment is a substance that can support plant growth. The plant growth environment may contain soil, water, aqueous solutions, sand, gravel, polysaccharides, mulch, compost, peat moss, straw, logs, clay, soy meal, yeast extract, or combinations thereof. For example, the plant growth environment contains soil, compost, peat moss, or combinations thereof.

[0202] The plant growth environment, the soil may optionally be supplemented with a substrate for the enzyme. For example, the substrate may be tryptophan, adenosine monophosphate, adenosine diphosphate, adenosine triphosphate (e.g., adenosine-3-triphosphate), indole, trimetaphosphate, ferredoxin, acetoin, diacetyl, pyruvic acid, acetolactic acid, pectin, cellulose, methylcellulose, starch, chitin, pectin, protein foods, cellulose derivatives, phosphoric acid, acetoin, chitosan, an inactive derivative of indole-3-acetic acid, an inactive derivative of gibberellic acid, xylan, choline, choline derivatives, proline, polyproline, proline-enriched foods, proline-enriched proteins, phenylalanine, chorismic acid, arabinoxylan, lipids, waxes, oils, phytic acid, lignin, humic acid, choline, choline derivatives, or combinations thereof.

[0203] Application method In any of the above methods, a member of the recombinant Bacillus cereus family, or a formulation, may be introduced into the plant growth environment, or applied to a plant, a plant seed, or the area surrounding the plant or plant seed.

[0204] For example, the method may include coating seeds with a member of the recombinant Bacillus cereus family or a formulation containing a member of the recombinant Bacillus cereus family before planting.

[0205] Alternatively, the method may include applying a member of the recombinant Bacillus cereus family or a formulation to the aerial parts of the plant (such as branches, leaves, stems, fruits, or flowers, etc.). For example, a member of the recombinant Bacillus cereus family or a formulation may be applied to the leaves or other aerial parts of the plant by spraying, brushing, dipping, or other methods.

[0206] The method may include introducing a member of the recombinant Bacillus cereus family into the plant growth environment by applying a liquid formulation or a solid formulation containing a member of the recombinant Bacillus cereus family to the environment (such as soil, compost, peat moss, or a combination thereof).

[0207] The formulation may be applied to the plant growth environment before, simultaneously with, or after planting seeds, seedlings, cuttings, bulbs, or plants in the plant growth environment.

[0208] Co-application of pesticides Any of the above methods may further include introducing at least one pesticide into the plant growth environment or applying at least one pesticide to the plant or seeds. The pesticide may be any of the above contained in the formulation or a combination thereof.

[0209] Plant The above method can be implemented on various plants. For example, the plant may be a dicotyledonous plant, a monocotyledonous plant, or a gymnosperm.

[0210] For example, when the plant is a dicotyledon, the dicotyledon is a bean, pea, tomato, pepper, pumpkin, alfalfa, almond, anise seed, apple, apricot, arracha, artichoke, avocado, fava bean, beet, bergamot, black pepper, brackwattle, blackberry, blueberry, bitter orange, komatsuna, Brazil nut, pannonoki, broccoli, broad bean, Brussels sprout, buckwheat, cabbage, amaranth, Chinese cabbage, cocoa, cantaloupe, hime-umeki seeds, cardoon, cowpea, carrot, cashew nut, cassava, sesame seed, cauliflower, celeriac, celery, cherry, quince, chickpea, chicory, chili pepper, chrysanthemum, cinnamon, citron, clementine, clove, clover, coffee, cola nut, rape, maize, cotton, cottonseed, soybean, hamana, cranberry, cress, cucumber, dried grape, custard apple, nanban saika chi, American wild bean, eggplant, kiku-dishya, umeki, koro-ha, fig, purple lacewing, hemp, geranium, gooseberry, bottle gourd, grape, grapefruit, guava, hemp, hempseed, henna, hop, horse bean, horseradish, indigo, jasmine, taro, jute, kale, kapok, kenaf, kabu-cabbage, kumquat, lavender, lemon, flat bean, lespedeza, lettuce, lime, licorice, raisin, loquat, lupinus, macadamia nut, mace, mandarin, sugar beet, mango, seiyo karin, melon, mint, mulberry, mustard, nectarine, niger seeds, nutmeg, okra, olive, opium, orange, papaya, parsnip, pea, peach, peanut, apple, pecan nut, persimmon, kidney bean, pistachio, ooba k, plum, pomegranate, pomelo, poppy seed, potato, sweet potato, prune, pumpkin, kebracho, quince, Cinchona trees, quinoa, spring radish, ramie, rapeseed, raspberry, rare, rhubarb, rose, rubber, rutabaga, safflower, igamame, baramonjin, sapodilla, unshu mikan, futana miso, sesame, sia batano ki, soybean, spinach, tuna, strawberry, sugar beet, sugarcane, sunflower, swede, bell pepper, tangerine, tea, teff, tobacco, tomato, shirotsumekusa, aburagiri, turnip, bon-tenka, karasu no endo, walnut, watermelon, yerba mate, fuyu-garas, nazuna, garden cress, peppercress), cress, Gunbai Nazuna, Toushimiiki, Laurel, laurel tree, cinnamon, jamun, Hime Uikyou, tamarind, peppermint, oregano, rosemary, sage, Togebanreishi, Ruriso, Terihaboku genus, bitter gourd, kukui nut, Tahiti Seiyou tochino ki, basil, huckleberry, hibiscus, passion fruit, star apple, sassafras, cactus, Seiyou Oto girisou, Misohagi, Japanese quince, coriander leaves, curry plant, kiwi, thyme, zucchini, Urruko, kudzu, waterleaf, spiny monkey orange, yellow mombin, star fruit, amaranth, wasabi, chili pepper, yellow plum, mashua, Chinese toon, Tsuru na, bower spinach, ugu, Ezo Yomogi Giku, Hakobe, Jocote, Syzygium jambos, paracress, Kesia Azami, Chinese potato, horse parsley, hedge mustard, Senno u, agate, cassod tree, thistle, Dutch Warumokou, star gooseberry, Okahijiki, Atsukeshisou, silver lace fern, collard greens, Sakurasou, Kibanakurinsou, Suberihiyu, Michiyana gi, Tokunoukoh, tree lettuce, wild betel, West African pepper, Santa grass, tarragon, parsley, chervil, land cress, Dutch Warumokou Yukinoshita, honeyherb, butterbur, perilla, willowwort, egoma, Sophora alopecuroides, oca, kampong, Chinese celery, lemon basil, Thai basil, water mimosa, wild carrot, coconut palm, moringa, mauka, kogomi, rice paddy herb, yellow sow thistle, Touki grass, peppergrass, maca, calabash, Fujimame, water spinach, catsear, fishwort, Okinawa spinach, lotus sweetjuice, gallant soldier, culantro, Kibanasukushiro, cardoon, caigua, Mitsuba, chipilin, Samufaiya, mampat, ebolo, ivy gourd, cabbage thistle, Hamanashi, chaya, huauzontle, Ethiopian mustard, magenta spreen, good kinghenry, epazole, lamb‘s quarters, centella, plumed cockscomb, Celosia argentea var. cristata, rapini, Chinese cabbage, mizuna, Chinese kale, kai-lan, mustard green, Malabar spinach, Petasites japonicus, Abelmoschus esculentus, climbing wattle, China jute, paprika, red maple, spearmint, Japanese mint, marjoram, cumin, chamomile, lemon balm, allspice, loquat, cherimoya, wild strawberry, European plum, pitaya, durian, European ivy, Phaseolus, Indian beech, jambul, Chinese date, Physalis alkekengi, purple mangosteen, rambutan, Achras sapota, Brosimum alicastrum, sararberry, satsuma orange, ugli fruit, adzuki bean, black bean, soybean, borlotti bean, common bean, mung bean, kidney bean, green bean, white kidney bean, quail bean, red kidney bean, hyacinth bean, yardlong bean, snap bean, Romanesco, Calabrese, nettle, bell pepper, raddichio, daikon radish, white turnip radish, burdock, tatsoi, broccolini, black turnip radish, burdock root, broad bean, broccoli raab, Fujian bean, Lupinus, Sterculia acuminata, Mucuna, Psophocarpus tetragonolobus, yam bean, maroga, Hieracium pilosella, umbrella bush, tjuntjula, wakalpulka, witchetty bush, wiry wattle, chiya, beech nut, kukui nut, colocynth, Moringa oleifera, Maya nut, Mongongo nut, ogbono nut, paradise nut, and, Chenopodium quinoa, may be selected from the group consisting of.

[0211] Alternatively, dicotyledonous plants include Acanthaceae (acanthus), Aceraceae (maple), Achariaceae, Achatocarpaceae (achatocarpus), Actinidiaceae (Chinese gooseberry), Adoxaceae (moschatel), Aextoxicaceae, Aizoaceae (ice plant), Akaniaceae, Alangiaceae, Alseuosmiaceae, Alzateaceae, Amaranthaceae (amaranth), Amborellaceae, Anacardiaceae (sumac), Ancistrocladaceae, Anisophylleaceae, Annonaceae (sugar apple), Apiaceae (celery), Apocynaceae (oleander), Aquifoliaceae (holly), Araliaceae (ginseng), Aristolochiaceae (birthwort), Asclepiadaceae (milkweed), Asteraceae (aster), Austrobaileyaceae, Balanopaceae, Balanophoraceae (false brome), Balsaminaceae (touch-me-not), Barbeyaceae, Barclayaceae, Basellaceae (basella), Bataceae (sea asparagus), Begoniaceae (begonia), Berberidaceae (barberry), Betulaceae (birch), Bignoniaceae (trumpet creeper), Bixaceae (lipstick tree), Bombacaceae (kapok tree), Boraginaceae (forget-me-not), Brassicaceae (mustard, or Cruciferae), Bretschneideraceae, Brunelliaceae (brunellia), Bruniaceae, Brunoniaceae, Buddlejaceae (butterfly bush), Burseraceae (frankincense), Buxaceae (boxwood), Byblidaceae, Cabombaceae (fanwort), Cactaceae (cactus), Caesalpiniaceae, Callitrichaceae (water starwort),Calycanthaceae (strawberry shrub), Calyceraceae (calycera), Campanulaceae (bellflower), Canellaceae (cinnamon), Cannabaceae (hemp), Capparaceae (caper), Caprifoliaceae (honeysuckle), Cardiopteridaceae, Caricaceae (papaya), Caryocaraceae (souari), Caryophyllaceae (pink), Casuarinaceae (she-oak), Cecropiaceae (cecropia), Celastraceae (staff vine), Cephalotaceae, Ceratophyllaceae (hornwort), Cercidiphyllaceae (katsura tree), Chenopodiaceae (lambsquarters), Chloranthaceae (solitary-wintergreen), Chrysobalanaceae (cocoa plum), Circaeasteraceae, Cistaceae (rockrose), Clethraceae (sweet pepperbush), Clusiaceae (mangosteen, or Guttiferae), Cneoraceae, Columelliaceae, Combretaceae (buttonwood), Compositae (aster), Connaraceae (cannarus), Convolvulaceae (morning glory), Coriariaceae, Cornaceae (dogwood), Corynocarpaceae (karaka), Crassulaceae (stonecrop), Crossosomataceae (crossosoma), Crypteroniaceae, Cucurbitaceae (cucumber), Cunoniaceae (cunonia), Cuscutaceae (dodder), Cyrillaceae (cyrilla), Daphniphyllaceae, Datiscaceae (datisca), Davidsoniaceae, Degeneriaceae, Dialypetalanthaceae, Diapensiaceae (alpine snowbell), Dichapetalaceae, Didiereaceae, Didymelaceae, Dilleniaceae (mock orange),Dioncophyllaceae, Dipentodontaceae, Dipsacaceae (teasel), Dipterocarpaceae (dipterocarp), Donatiaceae, Droseraceae (sundew), Duckeodendraceae, Ebenaceae (ebony), Elaeagnaceae (oleaster), Elaeocarpaceae (elaeocarpus), Elatinaceae (waterwort), Empetraceae (crowberry), Epacridaceae (epacris), Eremolepidaceae (catkin-mistletoe), Ericaceae (heath), Erythroxylaceae (coca), Eucommiaceae, Eucryphiaceae, Euphorbiaceae (spurge), Eupomatiaceae, Eupteleaceae, Fabaceae (pea or legume), Fagaceae (beech), Flacourtiaceae (flacourtia), Fouquieriaceae (ocotillo), Frankeniaceae (frankenia), Fumariaceae (fumitory), Garryaceae (silk tassel), Geissolomataceae, Gentianaceae (gentian), Geraniaceae (geranium), Gesneriaceae (gesneriad), Globulariaceae, Gomortegaceae, Goodeniaceae (goodenia), Greyiaceae, Grossulariaceae (gooseberry), Grubbiaceae, Gunneraceae (gunnera), Gyrostemonaceae, Haloragaceae (watermilfoil), Hamamelidaceae (witch hazel), Hernandiaceae (hernandia), Himantandraceae, Hippocastanaceae (horse chestnut), Hippocrateaceae (hippocratea), Hippuridaceae (mare's tail), Hoplestigmataceae, Huaceae, Hugoniaceae, Humiriaceae, Hydnoraceae, Hydrangeaceae (hydrangea), Hydrophyllaceae (waterleaf),Hydrostachyaceae, Icacinaceae (black laurel), Idiospermaceae, Illiciaceae (star anise), Ixonanthaceae, Juglandaceae (walnut), Julianiaceae, Krameriaceae (rhatany), Lacistemataceae, Lamiaceae (mint, or Labiatae), Lardizabalaceae (fiveleaf akebia), Lauraceae (laurel), Lecythidaceae (Brazil nut), Leeaceae, Leitneriaceae (corkwood), Lennoaceae (lennoa), Lentibulariaceae (bladderwort), Limnanthaceae (meadowfoam), Linaceae (flax), Lissocarpaceae, Loasaceae (loasa), Loganiaceae (spindle tree), Loranthaceae (showy mistletoe), Lythraceae (water caltrop), Magnoliaceae (magnolia), Malesherbiaceae, Malpighiaceae (acerola), Malvaceae (hibiscus), Marcgraviaceae (shingle plant), Medusagynaceae, Medusandraceae, Melastomataceae (false buttonweed), Meliaceae (mahogany), Melianthaceae, Mendonciaceae, Menispermaceae (moonseed), Menyanthaceae (buckbean), Mimosaceae, Misodendraceae, Mitrastemonaceae, Molluginaceae (carpetweed), Monimiaceae (monimia), Monotropaceae (false pinesap), Moraceae (mulberry), Moringaceae (horseradish tree), Myoporaceae (native fuchsia), Myricaceae (bayberry), Myristicaceae (nutmeg), Myrothamnaceae, Myrsinaceae (myrsine), Myrtaceae (eucalyptus), Nelumbonaceae (lotus lily)Nepenthaceae (East Indian pitcherplant), Neuradaceae, Nolanaceae, Nothofagaceae, Nyctaginaceae (Four o'clock), Nymphaeaceae (Water lily), Nyssaceae (sour gum), Ochnaceae (ochna), Olacaceae (olax), Oleaceae (Olive), Oliniaceae, Onagraceae (Evening primrose), Oncothecaceae, Opiliaceae, Orobanchaceae (Broomrape), Oxalidaceae (Wood sorrel), Paeoniaceae (Peony), Pandaceae, Papaveraceae (Poppy), Papilionaceae, Paracryphiaceae, Passifloraceae (Passion flower), Pedaliaceae (Sesame), Pellicieraceae, Penaeaceae, Pentaphragmataceae, Pentaphylacaceae, Peridiscaceae, Physenaceae, Phytolaccaceae (Pokeweed), Piperaceae (Pepper), Pittosporaceae (Mock orange), Plantaginaceae (Plantain), Platanaceae (Plane tree), Plumbaginaceae (Leadwort), Podostemaceae (river weed), Polemoniaceae (Phlox), Polygalaceae (Milkwort), Polygonaceae (Buckwheat), Portulacaceae (Purslane), Primulaceae (Primrose), Proteaceae (Protea), Punicaceae (Pomegranate), Pyrolaceae (Wintergreen), Quiinaceae, Rafflesiaceae (Rafflesia), Ranunculaceae (Buttercup or ranunculus), Resedaceae (Mignonette), Retziaceae, Rhabdodendraceae, Rhamnaceae (Buckthorn), Rhizophoraceae (Mangrove), Rhoipteleaceae, Rhynchocalycaceae, Rosaceae (Rose),Rubiaceae (Cinchona), Rutaceae (Rue), Sabiaceae (Akebia), Saccifoliaceae, Salicaceae (Willow), Salvadoraceae, Santalaceae (Sandalwood), Sapindaceae (Soapberry), Sapotaceae (Sapodilla), Sarcolaenaceae, Sargentodox, It may also be derived from a family selected from the group consisting of Aceraceae, Sarraceniaceae (carnivorous plants), Saururaceae (Houttuynia cordata), Saxifragaceae (Saxifraga stolonifera), Schisandraceae (Schisandra chinensis), Scrophulariaceae (Scrophularia ningpoensis), Scyphostegiaceae, Scytopetalaceae, Simaroubaceae (Quassia amara), Simmondsiaceae (Simmondsia chinensis), Solanaceae (Solanum tuberosum), Sonneratiaceae (Sonneratia apetala), Sphaerosepalaceae, Sphenocleaceae (Sphenoclea zeylanica), Stackhousiaceae (Stackhousia monogyna), Stachyuraceae, Staphyleaceae (Staphylea bumalda), Sterculiaceae (Theobroma cacao), Stylidiaceae, Styracaceae (Styrax japonicus), Surianaceae (Suriana maritima), Symplocaceae (Symplocos paniculata), Tamaricaceae (Tamarix chinensis), Tepuianthaceae, Tetrameristaceae, Theaceae (Camellia sinensis), Theligonaceae, Theophrastaceae (Theophrastus), Thymelaeaceae (Daphne genkwa), Ticodendraceae, Tiliaceae (Tilia japonica), Tovariaceae, Trapaceae (Trapa bispinosa), Tremandraceae, Trigoniaceae, Trimeniaceae, Trochodendraceae, Tropaeolaceae (Tropaeolum majus), Turneraceae (Turnera ulmifolia), Ulmaceae (Ulmus davidiana), Urticaceae (Urtica thunbergiana), Valerianaceae (Valeriana officinalis), Verbenaceae (Verbena officinalis), Violaceae (Viola tricolor), Viscaceae (Christmas mistletoe), Vitaceae (Vitis vinifera), Vochysiaceae, Winteraceae (Drynaria fortunei), Xanthophyllaceae, and Zygophyllaceae (Tribulus terrestris).

[0212] When the plant is a monocotyledonous plant, the monocotyledonous plant may be selected from the group consisting of corn, wheat, oats, rice, barley, millet, banana, onion, garlic, asparagus, ryegrass, foxtail millet, fonio, raishan, nipa grass, turmeric, saffron, galangal, chive, cardamom, coconut palm, pineapple, shallot, leek, spring onion, pea, scallion, chrysanthemum, bamboo, Japanese millet, spotless watermeal, arrowleaf elephant ear, Tahitian spinach, Manila hemp, arrowroot, bajra, arrowroot, broom millet, broom sorghum, Echinochloa crus-galli, coconut, taro, azuki corn, durum wheat, edo, fique, formio, ginger, orchardgrass, African millet, sudangrass, guinea corn, Manila hemp, hennequen, hybrid corn, jowar, lemongrass, calla lily, bulrush millet, Japanese millet, foxtail millet, millet, New Zealand flax, oats, oil palm, palmyra palm, sago palm, Juncus effusus, sisal hemp, sorghum, spelt wheat, sweet corn, sweet sorghum, taro, teff, timothy grass, emmer wheat, vanilla, wheat, and yam taro.

[0213] Alternatively, monocotyledonous plants are Acoraceae (sweet flag), Agavaceae (century plant), Alismataceae (water plantain), Aloeaceae (aloe), Aponogetonaceae (water hawthorn), Araceae (arum), Arecaceae (palm), Bromeliaceae (pineapple), Burmanniaceae (false asphodel), Butomaceae (flowering rush), Cannaceae (canna), Centrolepidaceae, Commelinaceae (spiderwort), Corsiaceae, Costaceae (costus), Cyanastraceae, Cyclanthaceae (panama hat plant), Cymodoceaceae (manatee grass), Cyperaceae (sedge), Dioscoreaceae (yam), Eriocaulaceae (pipewort), Flagellariaceae, Geosiridaceae, Haemodoraceae (bloodroot), Hanguanaceae (hanguana), Heliconiaceae (heliconia), Hydatellaceae, Hydrocharitaceae (tape grass), Iridaceae (iris), Joinvilleaceae (joinvillea), Juncaceae (rush), Juncaginaceae (arrow grass), Lemnaceae (duckweed), Liliaceae (lily), Limnocharitaceae (water poppy), Lowiaceae, Marantaceae (maranta leuconeura), Mayacaceae (mayaca), Musaceae (banana), Najadaceae (water nymph), Orchidaceae (orchid), Pandanaceae (screw pine), Petrosaviaceae, Philydraceae (frog lily), Poaceae (grass), Pontederiaceae (pickerelweed), Posidoniaceae (posidonia), Potamogetonaceae (pondweed), Rapateaceae, Restionaceae, Ruppiaceae (ditchIt may also be derived from a family selected from the group consisting of Poaceae (grass), Scheuchzeriaceae (Holo-myiso), Smilacaceae (Sarsaparilla), Sparganiaceae (Bur-reed), Stemonaceae (False Solomon's Seal), Strelitziaceae, Taccaceae (Tacca), Thurniaceae, Triuridaceae, Typhaceae (Cattail), Velloziaceae, Xanthorrhoeaceae, Xyridaceae (yellow-eyed grass), Zannichelliaceae (horned pondweed), Zingiberaceae (Ginger), and Zosteraceae (Eelgrass).

[0214] When the plant is a gymnosperm, the gymnosperm may be selected from the group consisting of Araucariaceae, Boweniaceae, Cephalotaxaceae, Cupressaceae, Cycadaceae, Ephedraceae, Ginkgoaceae, Gnetaceae, Pinaceae, Podocarpaceae, Taxaceae, Taxodiaceae, Welwitschiaceae, and Zamiaceae.

Example

[0215] The following non-limiting examples are presented to further illustrate the present invention.

[0216] Example 1. Use of a member of the recombinant Bacillus cereus family presenting lipase or endoglucanase for stimulating plant growth in soybeans The lipase and endoglucanase genes of Bacillus subtilis were amplified via polymerase chain reaction (PCR) using the primers shown in Table 3 below.

Table 3

[0217] To construct the fusion construct, the gene encoding the first 35 amino acids of BclA (amino acids 1 to 35 of SEQ ID NO: 1) was fused to the native bclA promoter of Bacillus thuringiensis DNA using splicing by overlapping extension (SOE) technology. The correct amplicon was cloned into pHP13 of the E. coli / Bacillus shuttle vector, and the correct clones were screened by DNA sequence analysis. The correct clones were electroporated into Bacillus thuringiensis (Cry-, plasmid-), and screened for chloramphenicol resistance. The correct transformants were grown overnight at 30 °C in brain heart infusion liquid medium, placed on normal agar plates, and incubated at 30 °C for 3 days. Spores expressing the fusion construct (BEMD spores) were harvested from the plates by washing in phosphate-buffered saline (PBS), purified by centrifugation, and washed again in PBS. Spores of non-transformed control Bacillus thuringiensis (B.t.) were prepared in the same manner.

[0218] Soybeans (cultivar Jake 011-28-04) were planted at a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. Spores were diluted to a concentration of 1 x 10 4 / ml in 50 ml of water and applied to each seed at the time of sowing. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 11 hours per day under temperature conditions controlled between 15.5 and 25.5 °C. The plants were watered well every 3 days during the 2-week test period. At the end of the 2 weeks, the height of each plant was measured and the measurements were normalized against the spores of the control Bacillus thuringiensis. Two independent tests were conducted.

[0219] The results are shown in Table 4 together with the standard error of the mean. In both tests, soybeans grown in the presence of BEMD spores presenting either lipase or endoglucanase grew significantly taller than soybeans treated with the control B.t. spores (statistical analysis using a t-test).

Table 4

[0220] Example 2. Use of a member of the recombinant Bacillus cereus family presenting endoglucanase for stimulating plant growth in maize BEMD spores expressing endoglucanase were prepared in the same manner as in Example 1 above. Maize was planted at a depth of 3.8 cm in 10 cm deep pots filled with standard loam topsoil. Spores, controls, and BEMD expressing endoglucanase were diluted with 50 ml of water to a concentration of 1 x 10 4 / ml and applied to each plant at the time of sowing. A water-only control was also included. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 11 hours per day under temperature conditions controlled between 15.5 - 25.5 °C. The plants were watered thoroughly every three days during the one-week test period. At the end of the one week, the height of each plant was measured and the measurements were normalized against spores of the control Bacillus thuringiensis.

[0221] The results are shown in Table 5 together with the standard error of the mean. Maize grown in the presence of BEMD spores presenting endoglucanase grew significantly larger than both the control B.t. spore-treated soybeans and the water-only control plants (statistical analysis using a t-test).

Table 5

[0222] Example 3. Use of a member of the recombinant Bacillus cereus family presenting endoglucanase or protease for stimulating plant growth in wheat BEMD spores expressing endoglucanase were prepared in the same manner as in Example 1 above. BEMD spores expressing the E. coli protease PtrB were prepared using a method similar to Example 1 above and the following primers: ggatccatgctaccaaaagcc (Forward, SEQ ID NO: 41), and ggatccttagtccgcaggcgtagc (Reverse, SEQ ID NO: 42)

[0223] Winter hard wheat was planted at a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. Spores, controls, and BEMD expressing endoglucanase or protease were diluted to a concentration of 1 x 10 4 / ml with 50 ml of water and applied to each plant at the time of seeding. A water-only control was also included. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 11 hours per day under temperature conditions controlled between 15.5 - 25.5 °C. The plants were watered thoroughly every three days during the one-week test period. At the end of the one week, the height of each plant was measured and the measurements were normalized against the control water-only plants.

[0224] Results are shown in Table 6 along with the standard error of the mean. Wheat grown in the presence of BEMD spores presenting endoglucanase or protease grew significantly larger than both control B.t. spore-treated soybeans and water-only control soybeans (statistical analysis using a t-test).

Table 6

[0225] Example 4. Use of a member of the recombinant Bacillus cereus family presenting endoglucanase to stimulate plant growth in ryegrass BEMD spores expressing endoglucanase were prepared in the same manner as in Example 1 above. Perennial ryegrass was planted at a depth of 6.4 mm in 10 cm deep pots filled with standard loam topsoil. Spores, both controls, and BEMD expressing endoglucanase were diluted to a concentration of 1 x 10 4Diluted to a concentration of / ml and applied to each plant during sowing. A water-only control was also included. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 11 hours per day under temperature conditions controlled between 15.5 - 25.5 °C. During the 2-week test period, the plants were watered thoroughly every 3 days. At the end of the 2 weeks, the height of each plant was measured and the measurements were standardized against the control water-only plants.

[0226] The results are shown in Table 7 along with the standard error of the mean. Ryegrass grown in the presence of BEMD spores presenting endoglucanase grew significantly larger than the control B.t. spore-treated ryegrass and the water-only control ryegrass (statistical analysis using a t-test).

Table 7

[0227] Example 5. Use of a member of the recombinant Bacillus cereus family presenting an enzyme involved in the synthesis or activation of a plant hormone that stimulates plant growth Also, a BEMD system may be used to cause the presentation of an enzyme involved in the synthesis of a plant hormone. For example, the plant hormone indole-3-acetic acid is a powerful growth stimulant in plants. Indole-3-acetic acid is synthesized in vivo from tryptophan by the enzymes tryptophan monooxygenase and indole-3-acetamide hydrolase. Indole-3-acetic acid and other auxin hormones can also be synthesized in vivo from tryptophan and / or indole by the enzymes nitrilase, tryptophan aminotransferase, indole-3-acetaldehyde dehydrogenase, indole-3-pyruvate decarboxylase, amine oxidase, tryptophan decarboxylase, and tryptophan side-chain oxidase.

[0228] Alternatively, a BEMD system that presents an enzyme involved in the modification of a plant growth hormone into its bioactive or inactive form may also be used. For example, nitrilase can be expressed on the BEMD system to catalyze the conversion of indole-3-acetonitrile into bioactive indole-3-acetic acid. Furthermore, an inactive form of a plant hormone (e.g., indole-3-acetonitrile) can be added to the plant growth environment together with BEMD-expressed nitrilase to gradually release the active hormone in the plant growth environment. Many other inactive or low-activity forms of plant hormones can be modified using the corresponding enzymes.

[0229] Related plant growth hormones (auxins) include indole-3-pyruvic acid, indole-3-acetaldoxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3-pyruvate, indole-3-butyric acid, phenylacetic acid, 4-chloroindole-3-acetic acid, and indole-3-acetaldoxime. These hormones are synthesized in vivo from tryptophan and / or indole via the enzymes tryptophan monooxygenase, indole-3-acetamide hydrolase, nitrilase, nitrile hydrolase, acetolactate synthase, alpha-acetolactate decarboxylase, tryptophan aminotransferase, indole-3-acetaldehyde dehydrogenase, indole-3-pyruvate decarboxylase, amine oxidase, tryptophan decarboxylase, and tryptophan side-chain oxidase.

[0230] Cytokinin family growth hormones can also be synthesized by enzymes expressed in the BEMD system. Examples of cytokinins include kinetin, zeatin (cis and trans), 6-benzylaminopurine, dihydroxyzeatin, N6-(D2-isopentenyl)adenine, ribosylzeatin, N6-(D2-isopentenyl)adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosylzeatin,, ribosylzeatin-5-monophosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2'-deoxyzeatin riboside, 4-hydroxy-3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzyladenine, ortho-methyltopolin, and meta-methyltopolin. These plant growth-stimulating compounds are synthesized in vivo from mevalonate or adenosine monophosphate / diphosphate / triphosphate by enzymes including adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5'-ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyl transferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyl transferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, and zeatin reductase.

[0231] Using a method similar to Example 1 above, any of these enzymes can be incorporated into the BEMD system, and when the fusion construct is expressed in a member of the Bacillus cereus family, a targeting sequence that directs the expressed enzyme towards the exosporium and a fusion construct containing the enzyme are prepared, and the enzyme can be displayed on the BEMD spores. Then, a member of the recombinant Bacillus cereus family expressing such a construct can be added to the soil or other plant growth environment or directly applied to the leaves of the plant to stimulate plant growth using a method similar to Example 1 above.

[0232] The precursor or substrate of the enzyme may be supplemented to the plant growth environment. For example, tryptophan, adenosine monophosphatase, adenosine diphosphatase, adenosine triphosphatase, or indole may be supplemented to the plant growth environment. The appropriate concentration of these substrates is 100 nM to 100 μM.

[0233] Example 6. Use of a member of the recombinant Bacillus cereus family presenting a protease or peptidase that cleaves a protein, peptide, proprotein, or preproprotein into a bioactive peptide to stimulate plant growth Proteases and peptidases capable of enzymatically cleaving a protein available in the plant growth environment into a bioactive peptide that can act directly or indirectly on the plant may be expressed in the BEMD system. Examples include the enzymatic cleavage of soy foods, yeast extracts, or other protein-rich foods added to the plant growth environment into bioactive peptides that can directly stimulate plant growth. Bioactive peptides produced by the enzymatic cleavage of protein foods include RHPP and RKN 16D10, which are strong plant root growth stimulants. Furthermore, proproteins or preproproteins may be cleaved into their active forms by proteases and peptidases expressed in BEMD into their bioactive forms. An inactive proprotein or preproprotein may be added to the plant growth environment and gradually cleaved by BEMD protease to sustainably release the bioactive protein.

[0234] Using a method similar to Example 1 above, either of these proteases and peptidases is incorporated into the BEMD system to produce a fusion construct containing a protease or peptidase and a targeting sequence that directs the enzyme expressed into the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family, which may be displayed on the BEMD spores. Then, a member of the recombinant Bacillus cereus family expressing such a construct is added to the soil or other plant growth environment together with soy food, yeast extract, or another protein-rich food, which may stimulate plant growth. The soy food, yeast extract, or other protein-rich food is appropriately added to the plant growth environment in the form of a liquid composition containing the protein food, yeast extract, or other protein-rich food at about 10 μg / L to about 100 mg / L.

[0235] Example 7. Use of BEMD spores expressing protease PtrB for plant growth stimulation BEMD spores expressing E. coli protease PtrB were prepared as described in Example 3. Soybean seeds were planted at a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. The spores, both controls, and BEMD expressing protease were diluted to a concentration of 1x10 4 / ml with 50 ml of water and applied to each plant at sowing. A water-only control was also included. 25 mg / pot of soy food was added to the water at planting. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 13 hours per day under temperature conditions controlled between 15.5 and 25.5 °C. During the one-week test period, the plants were watered well every three days. At the end of two weeks, the height of each plant was measured and the measurements were normalized to the control water-only plants.

[0236] The results are shown in Table 8 as the ratio to the water control, along with the standard error of the mean. Soybeans grown in the presence of BEMD spores presenting protease grew significantly higher than the control B.t. spore-treated soybeans and the water-only control soybeans (statistical analysis using the t-test). Adding soybean food to the water control or B. thuringiensis control plants had little effect. In contrast, in the presence of soybean food and the BEMD protease system, soybean plants showed a response that significantly exceeded all other treatment groups.

Table 8

[0237] Example 8. Use of members of the recombinant Bacillus cereus family presenting proteins or peptides involved in the stimulation of plant growth Also, the BEMD system can be used to present proteins or peptides that are directly involved in promoting plant growth. For example, plant peptide hormones or non-hormonal peptides that stimulate plant growth can be expressed in the BEMD system. For example, non-hormonal peptides that directly bind to and activate plant receptors can be expressed in the BEMD system and directly act on the receptors of the roots of the plant and the target plant. Such peptide hormones and non-hormonal peptides include phytosulfokine, calcalva 3 (CLV3), cystemin, RKN 16D10, Hg-Syv46, eNOD40, NOD family proteins, ZmlGF, SCR / SP11 family proteins and peptidases, RHPP, POLARIS, and KTI. These peptides and related peptides can be expressed in the BEMD system and delivered to the plant growth environment or directly applied to the leaves to stimulate plant growth.

[0238] Using a method similar to Example 1 above, any of these proteins or peptides can be incorporated into the BEMD system to produce a fusion construct containing an enzyme and a targeting sequence that directs the enzyme expressed upon expression of the fusion construct in a member of the Bacillus cereus family to the exosporium, which may then be displayed on the BEMD spores. Then, to stimulate plant growth, a member of the recombinant Bacillus cereus family expressing such a construct can be added to soil or other plant growth environments, or applied directly to the leaves of plants, using a method similar to Example 1.

[0239] Example 9. Use of BEMD spores expressing POLARIS or KTI to stimulate plant growth BEMD spores expressing the plant peptide POLARIS and the soybean peptide KTI were produced by synthesizing the genes encoding the POLARIS or KTI peptides conjugated to the targeting sequence of SEQ ID NO: 60. The gene was then introduced into Bacillus thuringiensis, and the spores were prepared as described in Example 1. Soybean seeds were planted at a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. BEMD spores expressing POLARIS or KTI were diluted to a concentration of 1x10 4 / ml in 50 ml of water and applied to each plant at sowing. A water-only control was also included. Pure POLARIS and KTI peptides were also tested at 0.05 mg / pot for their effect on soybeans. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 13 hours per day under temperature conditions controlled between 15.5 and 25.5 °C. The plants were watered thoroughly every 3 days during the 2-week test period. At the end of the 2 weeks, the height of each plant was measured, the roots were measured, and the measurements were normalized to the control water-only plants.

[0240] The results are shown in Table 9, along with the standard error of the mean, as a percentage of the water control. Soybeans grown in the presence of BEMD spores presenting POLARIS grew taller than the water control soybeans, and there was a slight increase in root development. The presence of the free KTI peptide significantly inhibited plant growth, with the height being 6 - 8% lower, but the root length increased by 15%. Expression of KTI in the BEMD line promoted root growth and there was no inhibitory effect on plant height. Importantly, the presence of the free KTI peptide and the control Bacillus thuringiensis spores did not prevent the growth inhibitory effect of KTI, but BEMD with KTI did not show growth inhibition.

Table 9

[0241] Example 10. Use of a member of the recombinant Bacillus cereus family presenting an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source to stimulate plant growth and / or to process nutrients Also, using the BEMD system, enzymes that beneficially decompose or modify bacteria, fungi, or plant nutrient sources present in soil or other plant growth environments may be presented. Such enzymes decompose products present in soil or other plant growth environments into forms that can be easily taken up by plants and / or beneficial bacteria and / or fungi in the rhizosphere. Examples of such enzymes include glucoside hydrolases that decompose carbohydrate complexes, cellulases that decompose cellulose; lipases that decompose lipids (including oils, fats, and waxes); lignin oxidases that decompose lignin and humic acids; proteases that decompose polypeptides; phospholipases that decompose membranes; amidases and nitrogenases that return nitrogen; amylases that process starch; nucleases that return nucleotides; pectinases that decompose pectin; sulfatases that return sulfur, and xylanases that decompose xylan and arabinoxylan. The resulting products (including monosaccharides, amino acids, fatty acids, and other nutrients) are readily available for direct uptake by plants and / or for stimulation of the growth and proliferation of beneficial bacteria and / or fungi in the plant rhizosphere.

[0242] Furthermore, for plant uptake from various organic and inorganic forms in the soil, enzymes and other biomolecules may be used to release and sequester phosphates, nitrogen, and other important essential nutrients. For example, phosphatases may be used to break down phosphates in the environment into inorganic phosphates available to plants. The phosphates may be phosphates naturally present in the plant growth environment. Alternatively, or in addition, the plant growth environment may be supplemented with, for example, trimetaphosphates, which are standard agronomic amendments. Examples of useful phosphatases include phosphomonoester hydrolases, phosphomonoesterases, phosphodiester hydrolases, phosphodiesterases, trilinoleic acid monoester hydrolases, phosphate anhydride hydrolases, pyrophosphatases, phytases, trimetaphosphatases, and triphosphatases. For example, the enzymes trimetaphosphatase, triphosphatase, and pyrophosphatase continuously break down trimetaphosphate into useful inorganic phosphates.

[0243] The enzyme nitrogenase family can convert atmospheric nitrogen (N 2 ) to ammonia, thereby converting nitrogen inaccessible to plants into an available form. Suitable enzymes include those belonging to the Nif family of nitrogenases.

[0244] Chemical energy can also be added directly to the plant growth environment as adenosine-3-triphosphate, ferredoxin, or additional enzymes that create such energy within the BEMD system. These are cofactors of nitrogenase and are limited in their presence in the soil. Therefore, such cofactors may be added to the soil to enhance the above reactions.

[0245] Other supplements that can be added to the plant growth environment include starch, cellulose and cellulose derivatives, pectin, xylan and arabinoxylan, fats, waxes, oils, phytic acid, lignin, humic acid, and other nutrient sources on which the above enzymes act.

[0246] Using a method similar to the method described in Example 1, any of these enzymes can be incorporated into the BEMD system, and a fusion construct containing a targeting sequence that directs the fusion construct to the exosporium of the enzyme and a member of the Bacillus cereus family can be prepared to display it on the BEMD spores. Then, the fusion construct is expressed in a member of the recombinant Bacillus cereus family, and this member of the recombinant Bacillus cereus family can be added to the soil or other plant growth environment using a method similar to the method described in Example 1 to stimulate plant growth.

[0247] Example 11. Use of BEMD spores expressing phosphatase for plant growth stimulation BEMD spores expressing Bacillus subtilis phosphatase A4 (PhoA4) were prepared by synthesizing a gene encoding PhoA4 linked to the targeting sequence of SEQ ID NO: 60. This gene was then introduced into Bacillus thuringiensis, and the spores were prepared as in Example 1. Maize was planted at a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. BEMD spores expressing PhoA4 were diluted to a concentration of 1 x 10 4 / ml in 50 ml of water and applied to each plant at the time of sowing. A water-only control was also included. Phosphatase was added to the pots at a rate of 0.5 mg / pot in the liquid. The plants were grown under optimal light using a T5 lamp, 54 watts, and exposed to light for 13 hours per day under temperature conditions controlled between 15.5 and 25.5 °C. The plants were watered well every 3 days during the 2-week test period. At the end of 2 weeks, the height of each plant was measured and the measurements were normalized to the control water-only plants.

[0248] The results are shown in Table 10. Maize grown in the presence of BEMD spores presenting PhoA4 showed enhanced growth, especially in the presence of polyphosphate. This effect was stronger than the effect of polyphosphate alone.

Table 10

[0249] Example 12. Use of a member of the recombinant Bacillus cereus family presenting an enzyme involved in the synthesis of 2,3-butanediol, or in the synthesis or activation of gibberellic acid, for the stimulation of plant growth Also, the BEMD system may be used to present an enzyme involved in the synthesis of the plant growth promoting compound 2,3-branediol. In vivo, 2,3-butanediol is synthesized from acetoin, diacetyl, acetolactic acid, or pyruvate by the enzymes acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, and acetoin reductase by beneficial bacteria and beneficial fungi in the rhizosphere.

[0250] Also, the BEMD system may be used to present an enzyme involved in the synthesis or activation of the plant growth promoting compound gibberellic acid. Gibberellic acid can be produced from an inactive or low-activity form by the action of enzymes (including but not limited to hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, and gibberellin 20-oxidase).

[0251] Any of these enzymes may be incorporated into the BEMD system and presented on the BEMD spores using a method similar to the method described in Example 1. A fusion construct may be constructed that contains the enzyme and a targeting sequence that directs the enzyme to the exosporium when the fusion protein is expressed in a member of the Bacillus cereus family. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to the soil, or other plant growth environment, for the stimulation of plant growth.

[0252] To increase the effect of the enzyme presented on the BEMD, the soil may be supplemented with the substrate of the enzyme. For example, the soil or other plant growth environments may be supplemented with acetoin (substrate of acetoin reductase); pyruvic acid (substrate of pyruvate decarboxylase); diacetyl (substrate of diacetyl reductase); and / or acetolactic acid (substrate of acetolactic acid decarboxylase). Alternatively, or additionally, the soil or other plant growth environments may be supplemented with a low-activity or inactive form of gibberellic acid (which is converted to a high-activity form by the above-mentioned enzyme in the soil or other plant growth environments).

[0253] Example 13. Use of a member of the recombinant Bacillus cereus family presenting protease for protecting plants from pathogens Also, using the BEMD system, protease that protects plants from one or more pathogens may be presented. For example, certain bacterial pathogens can communicate with each other among individual members through the secretion of bacterial lactone homoserine or related signaling molecules. Therefore, a protease specific to the bacterial lactone homoserine signaling molecule can protect plants from such bacterial pathogens by inhibiting the communication between bacteria, which is an essential step for bacteria to secrete toxins and upregulate pathogenic factors. Suitable proteases specific to the bacterial lactone homoserine signaling molecule include endopeptidase and exopeptidase.

[0254] A protease specific for a bacterial lactone homoserine signaling molecule may be incorporated into the BEMD system using a method similar to the method described in Example 1. A fusion construct may be prepared that contains the protease and a targeting sequence that directs the protease to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to soil or other plant growth environments. The protease then degrades the bacterial lactone homoserine signaling molecule, inhibiting a process important for the pathogenicity of these organisms, thereby protecting plants from these pathogens. Other proteases and peptidases also effectively exhibit this ability on the BEMD system shown in Examples 6 and 7.

[0255] Example 14. Use of a member of the recombinant Bacillus cereus family presenting antibacterial proteins and peptides for protecting plants from pathogens In addition, the BEMD system may be used to present enzymes that exhibit antibacterial and / or antifungal activity useful for protecting plants from one or more pathogens. For example, bacteriocins, lysozymes (e.g., LysM), siderophores, conalbumin, albumin, lactoferrin (e.g., LfcinB), or antibacterial proteins and peptides such as TasA may all be expressed in the BEMD system and exert their effects on bacterial and fungal pathogens of plants. Bacteriocins, albumin, conalbumin, lysozyme, and lactoferrin exert direct antibacterial activity on their targets, while siderophores bind to essential nutrients required for the pathogen to exhibit pathogenicity. For example, the lactoferrin peptide LfcinB lyses bacterial cells sensitive to lactoferrin peptides in the plant growth environment when expressed on the surface of the BEMD system. These proteins and peptides can act specifically against limited microorganisms and selectively target pathogen populations without affecting all microorganisms in the plant growth environment.

[0256] Any of these proteins or peptides may be incorporated into the BEMD system using a method similar to the method described in Example 1. A fusion construct containing an enzyme and a targeting sequence that directs the enzyme to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family may be prepared. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to soil or other plant growth environments to protect plants from one or more pathogens.

[0257] Example 15. Use of BEMD spores expressing antibacterial peptides for protecting plants from bacteria A gene encoding either of two antimicrobial peptides (LfcinB (derived from bovine lactoferrin) and LysM (derived from chicken lysozyme)) was ligated to a BclA targeting sequence (SEQ ID NO: 60) under the control of a BclA promoter (SEQ ID NO: 85) and synthesized. The gene was introduced into Bacillus thuringiensis BT013A, and the transformed Bacillus was cultured overnight in brain heart infusion broth to grow, placed on a normal agar plate at 30 °C, and grown for 3 days to form spores. The spores were washed away from the plate and washed 3 times with PBS. A Staphylococcus epidermidis culture was grown overnight at 37 °C in TSB liquid medium. Then, the overnight culture was precipitated, washed with PBS, and resuspended in PBS at Abs595 = 0.2. 1x10 4 of BEMD expressing LysM or LfcinB peptide was incubated with S. epidermidis for 3 hours at 37 °C with shaking in PBS. The control sample of S. epidermidis was left untreated (without BEMD spores). After 3 hours of incubation, dilution plates of S. epidermidis were prepared and incubated overnight at 37 °C. The cultures of S. epidermidis were counted the next day, and the killing ratio was quantified. As shown in Table 11 below, the values of killing activity were recorded. The BEMD-expressing peptides killed significantly more S. epidermidis cells. This can be directly applied to the killing of bacteria on the rhizosphere, seeds, or other plant materials. By selecting peptides specific to certain bacteria, the microbiota near plants can be changed to beneficial ones, or important pathogens can be selectively targeted.

Table 11

[0258] Example 16. Use of a member of the recombinant Bacillus cereus family presenting an enzyme for protecting plants from pathogens Alternatively, an enzyme that defends a plant from one or more pathogens may be presented using the BEMD system. For example, yeast and fungal cell walls are degraded by enzymes such as β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, chitinase, chitinase, chitinase-like protein, and lyticase. Bacterial cell walls are degraded by enzymes selected from proteinase, protease, mutanolysin, staphylosin, and lysozyme. Each of these cell wall degrading enzymes may be expressed on the BEMD system for the selective inhibition of pathogenic microorganisms in the rhizosphere and added to the plant growth environment.

[0259] Alternatively, using the BEMD system, an enzyme or protein that defends a plant from insect or worm pathogens may be presented, for example, by suppressing the predation of insects and / or worms of a desired plant. Examples of such proteins and enzymes of interest include endotoxin, Cry toxin, other insecticidal protein toxins, protease inhibitors, cysteine protease, Cry5B protein, Cry21A protein, chitinase, protease inhibitor protein, protease inhibitor peptide, trypsin inhibitor, and papain protease inhibitor.

[0260] Any of these proteins or peptides may be incorporated into the BEMD system using a method similar to the method described in Example 1. An enzyme and a fusion construct containing a targeting sequence that directs the enzyme to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family may be prepared. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to the soil or other plant growth environment to defend the plant from pathogens.

[0261] Example 17. Use of BEMD spores expressing an antifungal enzyme for plant defense and presentation of effectiveness to Sacchromyces A gene encoding an antifungal enzyme, β-1,3-glucanase (derived from Bacillus subtilis), was ligated to a BclA targeting sequence (SEQ ID NO: 60) under the control of a BclA promoter (SEQ ID NO: 85) and synthesized. The gene was introduced into Bacillus thuringiensis BT013A, and the transformed Bacillus was cultured overnight in brain heart infusion broth to grow, placed on a normal agar plate at 30°C, and grown for 3 days to form spores. The spores were washed away from the plate and washed 3 times with PBS. A Saccharomyces cerevisiae culture was grown overnight at 37°C in YZ liquid medium. Then, the overnight culture was precipitated, washed with PBS, and resuspended in PBS at Abs595 = 0.2. 1x10 4 CFU of BEMD expressing β-1,3-glucanase was incubated with Saccharomyces at 37°C for 1 hour with shaking in PBS. The control sample of Saccharomyces was left untreated (without BEMD spores). After 3 hours of incubation, dilution plates of Saccharomyces were prepared and incubated overnight at 37°C. The culture of Saccharomyces was counted the next day, and the killing percentage was quantified. Table 12 below shows the values of the killing activity of BEMD spores expressing β-1,3-glucanase. The BEMD-expressed enzyme killed significantly more Saccharomyces cells. This can be directly applied to the killing of fungal microorganisms on the rhizosphere, seeds, or other plant materials. By selecting peptides specific to certain fungi, the microbiota near plants can be changed to beneficial ones, or important pathogens can be selectively targeted.

Table 12

[0262] Example 18. Use of a member of the recombinant Bacillus cereus family presenting a plant immune system-stimulating peptide or protein for protecting plants from pathogens In addition, the BEMD system may be used to present plant immune system enhancing peptides and proteins. These proteins may be expressed on the outside of the BEMD spores and delivered into the plant growth environment so as to stimulate the plant immune system to defend the plant itself from plant pathogens. Exemplary proteins and peptides include harpin, α-elastin, β-elastin, systemin, phenylalanine ammonia-lyase, elicitin, defensin, cryptogein, as well as fragerin proteins and peptides. Exposure of plants to these proteins and peptides stimulates resistance in plants to many plant pathogens.

[0263] Any of these proteins or peptides may be introduced into the BEMD system and presented on the BEMD spores using a method similar to the method described in Example 1. A fusion construct may be prepared that contains an enzyme and a targeting sequence that directs the enzyme to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to the soil or other plant growth environment to defend the plant from pathogens.

[0264] Example 19. Use of a recombinant member of the Bacillus cereus family presenting a root-binding protein or peptide, or a leaf-binding protein or peptide, for immobilizing the recombinant member of the Bacillus cereus family on the root system or leaves of a plant In addition, proteins and peptides that bind to roots and leaves may be introduced into the BEMD system so that the BEMD spores are immobilized on the root system or leaves of the plant. By presenting such root- or leaf-binding ligands on the BEMD spores, the spores are directed to the root system or lower structures of the root system, or the leaves or lower structures of the leaves of the plant, and the BEMD spores can be maintained in an optimal position for other presented biological molecules and enzymes to be effective.

[0265] For example, rhicadhesin is a root-binding ligand that binds to root hairs. Thus, by presenting rhicadhesin on the surface of BEMD spores, the spores can be directed towards root hairs. Other proteins that can selectively bind to the roots or leaves of plants include adhesin, flagellin, omptin, lectin, fimbrial protein, curlus protein, intimin, invasin, agglutinin, afimbrial protein, TasA, or YuaB.

[0266] Such root- or leaf-binding proteins and peptides may be introduced into the BEMD system using a method similar to the method described in Example 1. A fusion construct containing a root- or leaf-binding protein or peptide and a targeting sequence that directs the protein or peptide to the exosporium when expressed in a member of the Bacillus cereus family may be prepared. The fusion construct containing the root- or leaf-binding ligand is then expressed in a member of the Bacillus cereus family. Such a fusion construct may be co-expressed with one or more additional fusion constructs containing any beneficial enzyme described herein (e.g., an enzyme involved in the synthesis of plant hormones, an enzyme that degrades nutrients, or a protease that defends plants from pathogens). The member of the Bacillus cereus family is added to the soil or other plant growth environment or applied to the leaves of the plant. The root- or leaf-binding ligand directs the member of the Bacillus cereus family towards and immobilizes it on the root system or leaves of the plant, thereby enabling the co-expressed fusion construct to exert its effect in the immediate vicinity of the root or leaf system.

[0267] Example 20. Use of a recombinant member of the Bacillus cereus family that presents a protein or enzyme that enhances plant stress tolerance Proteins, peptides, and enzymes that enhance stress tolerance in plants may be introduced into the BEMD system and delivered to target plants via addition to the roots, leaves, or the plant growth environment. While under stress, plants release stress-related compounds (aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, etc.), thereby negatively affecting plant growth. Using the BEMD system, enzymes that degrade such stress-related compounds (e.g., aminocyclopropane-1-carboxylic acid deaminase, superoxide dismutase, oxidase, catalase, and other enzymes that act on reactive oxygen species, etc.) may be presented. By such enzymes, the amount of these stress-related compounds is reduced, allowing the plant to continue growing and even grow vigorously under stress conditions.

[0268] To present on the BEMD spore, either of these proteins or peptides may be incorporated into the BEMD system using a method similar to the method described in Example 1. A fusion construct containing an enzyme and a targeting sequence that directs the enzyme to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family may be prepared. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to the soil or another plant growth environment, or applied to the leaves of the plant, to enhance the stress tolerance of the target plant.

[0269] Example 21. Preparation of BEMD spores expressing the defense enzyme catalase The gene encoding the defense enzyme catalase (derived from Bacillus cereus) was ligated to the BetA targeting sequence (SEQ ID NO: 61) under the control of the BetA promoter (SEQ ID NO: 86) and synthesized. The gene was introduced into Bacillus thuringiensis BT013A. The transformed Bacillus and the wild-type strain in brain heart infusion broth were cultured overnight for growth, placed on normal agar plates at 30 °C, and grown for 3 days to form spores. The spores were washed away from the plates and washed 3 times with PBS. 3 drops of hydrogen peroxide were added to each spore pellet. The enzyme catalase converts hydrogen peroxide into water and O 2 gas. The control spores do not foam, but the BEMD-catalase spores foam immediately, indicating that there is enzyme activity on the surface of the spores. During stress, other defense enzymes may be presented and delivered to plants in a similar manner to act on the free radicals produced by the plants.

[0270] Example 22. Use of a member of the recombinant Bacillus cereus family that presents a protein or enzyme that defends seeds or plants from environmental stress Proteins, peptides, and enzymes that defend plants from environmental stress may be introduced into the BEMD system and delivered to target plants via addition to the roots, leaves, or plant growth environment. While frozen, plants are damaged by the effects of ice. The BEMD system may be used to present a peptide, protein, or enzyme that defends plants from such effects. For example, the BEMD system may be used to present choline dehydrogenase (which acts by producing a defense product that defends plants or seeds from frost). Also, substrates of these enzymes (such as choline and / or choline derivatives) may be added to the plant growth environment. By adding such substrates, the amount of defense substances (betaines and related chemicals) produced in the plant environment by the BEMD-expressed enzymes can be increased. Betaine derivatives are known to defend seeds from cold stress.

[0271] Any of these proteins or peptides may be incorporated into the BEMD system using a method similar to the method described in Example 1. An enzyme and a fusion construct containing a targeting sequence that directs the enzyme to the exosporium when the fusion construct is expressed in a member of the Bacillus cereus family may be prepared. The fusion construct is then expressed in a member of the Bacillus cereus family, and the member of the Bacillus cereus family is added to soil or other plant growth environments, or applied to the leaves of plants, to protect the plants from environmental stresses and factors.

[0272] Example 23. Enhanced expression of fusion constructs in the BEMD system by using an enhanced or alternative promoter element The BEMD system can present a wide range of proteins, peptides and enzymes using one or more of the targeting sequences described herein. Some of these targeting sequences have a high affinity for the exosporium and are beneficial for the expression of fusion proteins, but the expression level of the fusion proteins is low and thus limited for use on the BEMD system. For such fusion proteins and sequences, an alternative high-expression sporulation promoter may be used instead of the native promoter.

[0273] For example, SEQ ID NO: 13 (amino acids 1-39 of B. weihenstephensis KBAB4 gene 3572) provides an N-terminal sequence that results in very efficient delivery of proteins to the exosporium of members of the Bacillus cereus family (shown in Table 13 below). As described herein, all genes are synthesized in their full form (including the promoter region and the coding region of the fusion protein). When a fusion protein containing the targeting sequence of SEQ ID NO: 13 fused to the β-galactosidase enzyme (from E. coli) was expressed using the native promoter element (SEQ ID NO: 88) for B. weihenstephensis KBAB4 gene 3572, a low level of the fusion protein was expressed, and thus the enzyme activity on the spore surface was low. Enzyme activity was measured by the conversion of 0.5 M o-nitrophenyl galactoside in solution for 10 minutes. Enzyme conversion was measured using a spectrophotometer at ABS 540 The enzyme conversion was measured using a spectrophotometer at ABS. Dramatic increases in spore enzyme activity were observed when the native promoter element of B. weihenstephensis KBAB4 gene 3572 was replaced with the high-expression promoter of SEQ ID NO: 86 (B. anthracis BetA / BAS3290), or the high-expression promoter of SEQ ID NO: 89 (B. weihenstephensis KBAB4 YVTN β-propeller protein). On the other hand, when the native promoter element of B. weihenstephensis KBAB4 gene 3572 was replaced with the native promoter of B. anthracis Sterne BAS1882 (SEQ ID NO: 87), spore enzyme activity decreased. The expression level of the targeting sequence of SEQ ID NO: 13 fused to β-galactosidase was very low (0.38X) when induced by the promoter of BAS1882 (SEQ ID NO: 87), but was greatly improved when induced by the BetA promoter (SEQ ID NO: 86) or the YVTN protein promoter (SEQ ID NO: 89).

Table 13

[0274] Example 24. Isolation and Identification of Plant Growth-Promoting Bacterial Strains Soil samples were collected from the rhizospheres of the healthiest and most resistant potato (Solanum tuberosum), yellow summer squash (Cucurbita pepo), tomato (Solanum lycopersicum), and pole bean (Phaseolus coccineus) plants, diluted with sterile water, and spread on normal agar plates. Bacterial isolates that showed a high growth rate and could be subcultured and propagated were selected for further experiments. The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and glucose 1 g / L (dry weight). The selected strains that were cultured overnight (30 °C) were spun down, the medium was discarded, and they were resuspended in an equal volume of sterile water. Ten lettuce seeds per treatment were planted at a depth of 1 cm in topsoil that had been sieved to remove large debris (Columbia, MO). The seeds were inoculated in 4-cm pots with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2 O. The 10 ml of H 2 O was sufficient to deliver the bacteria to the 3-in 3 (7.62 cm 3 ) soil and was also sufficient to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75 °F (18 - 24 °C) with an 11-hour light exposure per day and were given 5 ml of water every three days. After one week, the plant height, leaf diameter, and overall health of the plants were recorded. The initial screening of the rhizosphere isolates yielded over 200 different species of bacteria and fungi from the rhizospheres of the four plants. Some of the bacterial species are shown in Table 14. The identified strains are shown by their official bacterial names. The other strains are shown by unknown numbers. Inocula that gave results close to the control (+ / - 2%) were not included in the table.

Table 14

[0275] In the initial lettuce tests, the bacterial strains that had the greatest effect on the overall health of the plants and plant height were subjected to the following identification. The bacterial strains were grown in Luria Bertani liquid medium at 37 °C and the overnight cultures were spun down by centrifugation. The medium was discarded and the remaining bacterial pellet was subjected to isolation of chromosomal DNA using the Qiagen Bacterial Chromosomal DNA Isolation kit. The chromosomal DNA was subjected to PCR amplification of the 16S rRNA coding region using primers E338F 5’-ACT CCT ACG GGA GGC AGC AGT-3’ (SEQ ID NO: 122), E1099R A 5’-GGG TTG CGC TCG TTG C-3’ (SEQ ID NO: 123), and E1099R B 5’-GGG TTG CGC TCG TTA C-3’ (SEQ ID NO: 124). The PCR amplicon was purified using the Promega PCR Purification kit, the resulting amplicon was diluted, and sent to the University of Missouri DNA Core for DNA sequence analysis. The DNA sequence was compared to the NCBI BLAST database of bacterial isolates and the genus and species were identified by direct comparison to known strains. The most identified species are shown in Table 14. In many cases, the 16S rRNA DNA sequence was only able to indicate the genus of the selected bacterial strain. When direct identification was not available, additional biochemical analyses were performed using methods standard in the art to discriminate at the species and strain levels and they are shown in Table 15.

Table 15

[0276] Example 25. Isolation and Identification of Additional Plant Growth Promoting Bacterial Strains Soil samples were collected from farms near Gas, Kansas, diluted with sterile water, and spread on normal agar medium. Bacterial isolates that showed a high growth rate and could be subcultured and propagated were selected for further experiments. The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 0 0.013 g, and glucose 1 g / L (dry weight). The selected strains that were cultured overnight (at 30 °C) were spun down, the medium was discarded, and they were resuspended in an equal volume of sterile water. Maize seeds were coated with a commercially available seed polymer (mixed with water alone (total 1.6 μl / seed), or containing the selected bacterial strain (total 1.6 μl / seed)). The coated seeds were planted at a depth of 1 inch (2.54 cm) in topsoil (Columbia, MO) that had been sieved to remove large residues in (3-inch) 7.62 cm diameter pots. The plants were grown at a temperature of 18 - 24 °C (65 - 75 °F) with 11 hours of light per day and given 50 ml of water every three days. After two weeks, the plant height, leaf diameter, and overall plant health were recorded. For the germination assay and measurement of root length on the third day, the seeds were coated as described above and evenly spread with 10 seeds per paper towel. The paper towels were moistened with 10 ml of water, rolled up, placed in small plastic bags, and incubated at 30 °C or placed on a germination heating mat at 27 - 30 °C (80 - 85 °F). Root measurements were recorded after three days. By the initial screening of rhizosphere isolates, more than 100 different species of bacteria and fungi were obtained from the rhizosphere. Some bacterial species are shown in Table 16. The identified strains are shown by their official bacterial names.

Table 16

[0277] The bacterial strains that had the greatest effect on plant health are shown in Table 16. The bacterial strains were grown in Luria Bertani liquid medium at 37°C and the overnight cultures were spun down by centrifugation. The medium was discarded and the remaining bacterial pellet was subjected to isolation of chromosomal DNA using the Qiagen Bacterial Chromosomal DNA Isolation kit. The chromosomal DNA was subjected to PCR amplification of the 16S rRNA coding region using primers E338F 5’-ACT CCT ACG GGA GGC AGC AGT-3’ (SEQ ID NO: 122), E1099R A 5’-GGG TTG CGC TCG TTG C-3’ (SEQ ID NO: 123), and E1099R B 5’-GGG TTG CGC TCG TTA C-3’ (SEQ ID NO: 124). The PCR amplicon was purified using the Promega PCR Purification kit, the resulting amplicon was diluted, and sent to the University of Missouri DNA Core for DNA sequence analysis. The DNA sequence was compared to the NCBI BLAST database of bacterial isolates and the genus and species were identified by direct comparison to known strains. The most identified species are shown in Table 16. In many cases, the 16S rRNA DNA sequence was only able to indicate the genus of the selected bacterial strain. When direct identification was not available, additional biochemical analyses were performed using standard methods in the art to identify at the species and strain levels and the identified strains are shown in Table 17.

Table 17

[0278] Example 26. Verification of Plant Growth-Promoting Bacterial Strains against Alfalfa The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 20.013 g of O, and 1 g / L of glucose (dry weight) and grown. The selected strain was spin - down after overnight culture (30 °C), the medium was discarded, and it was resuspended in an equal volume of sterile water. Ten Zeba - coated alfalfa seeds were planted at a depth of 0.6 cm for each treatment in topsoil (Columbia, MO) that had been sieved to remove large residues. At the time of planting, the seeds were inoculated with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2 O. The 10 ml of H 2 O was sufficient for the bacteria to be delivered to the soil at 3 in 3 (7.62 cm 3 ) and was also sufficient to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75 °F (18 - 24 °C) with an 11 - hour light exposure per day and given 5 ml of water every three days. The alfalfa was grown for one week, and germination and the initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names, and the final height data are shown in Table 18.

Table 18

[0279] Example 27. Verification of Plant - Growth - Promoting Bacterial Strains for Cucumber The selected strain was grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and 1 g / L of glucose (dry weight) and grown. The selected strain was spin - down after overnight culture (30 °C), the medium was discarded, and it was resuspended in an equal volume of sterile water. Ten cucumber seeds were planted at a depth of 1 cm for each treatment in topsoil (Columbia, MO) that had been sieved to remove large residues. At the time of planting, the seeds were inoculated with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2Inoculated along with that mixed into O. 10 ml of H 2 O is sufficient for the bacteria to be delivered to soil that is 3 in 3 (7.62 cm 3 ) and is also sufficient to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75°F (18 - 24°C) with 11 hours of light per day and given 5 ml of water every three days. The cucumbers were grown for two weeks and the germination and initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names and the data on the final height are shown in Table 19.

Table 19

[0280] Example 28. Verification of Plant Growth - Promoting Bacterial Strains for Yellow Squash The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and glucose 1 g / L (dry weight)). The selected strains that were cultured overnight (30°C) were spin - down, the medium was discarded, and they were resuspended in an equal volume of sterile water. Ten yellow squash seeds were planted at a depth of 1 cm for each treatment in topsoil (Columbia, MO) that had been sieved to remove large residues. The seeds were inoculated at the time of planting with 0.5 μl of bacteria resuspended in water mixed into 10 ml of H 2 O. 10 ml of H 2 O is sufficient for the bacteria to be delivered to soil that is 3 in 3 (7.62 cm 3It was sufficient for the bacteria to be delivered to the soil of ), and also sufficient to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75°F (18 - 24°C) with 11 hours of light per day and given 5 ml of water every 3 days. The pumpkins were grown for 2 weeks and the germination and initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names, and the data for the final height and final leaf diameter (by the length of two leaves) are shown in Table 20.

Table 20

[0281] Example 29. Verification of Plant Growth - Promoting Bacterial Strains against Ryegrass The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and glucose 1 g / L (dry weight)). The selected strains that were cultured overnight (at 30°C) were spin - down, the medium was discarded, and they were resuspended in an equal volume of sterile water. Thirty ryegrass seeds were planted at a depth of 0.3 cm for each treatment in topsoil (Columbia, MO) that had been sieved to remove large residues. The seeds were inoculated at the time of planting with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2 O. The 10 ml of H 2 O was such that the bacteria were in 3 in 3 (7.62 cm 3) was sufficient for the delivery of bacteria to the soil and for filling the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75°F (18 - 24°C) with 11 hours of light per day and given 5 ml of water every three days. Ryegrass was grown for 1.5 weeks and germination and the initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names and the final height data are shown in Table 21.

Table 21

[0282] Example 30. Verification of Plant Growth-Promoting Bacterial Strains against Maize The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and glucose 1 g / L (dry weight)). The selected strains that were cultured overnight (at 30°C) were spun down, the medium was discarded, and they were resuspended in an equal volume of sterile water. Ten maize seeds were planted for each treatment at a depth of 2.5 cm in topsoil (Columbia, MO) that had been sieved to remove large residues. The seeds were inoculated at the time of planting with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2 O. The 10 ml of H 2 O was sufficient for the delivery of bacteria to 3 in 3 (7.62 cm 3 ) of soil and for filling the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75°F (18 - 24°C) with 11 hours of light per day and given 5 ml of water every three days. Maize was grown for 2 weeks and germination and the initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names and the final height data are shown in Table 22.

Table 22

[0283] Example 31. Verification of Plant Growth-Promoting Bacterial Strains for Soybeans The selected strains were grown in minimal medium (KH 2 PO 4 3 g, Na 2 HPO 4 6 g, NH 4 Cl 1 g, NaCl 0.50 g, MgSO 4 7H 2 O 0.15 g, CaCl 2 2H 2 O 0.013 g, and glucose 1 g / L (dry weight)). The selected strains were cultured overnight (30 °C), spun down, the medium discarded, and resuspended in an equal volume of sterile water. Ten soybean seeds were planted at a depth of 2.5 cm for each treatment in topsoil (Columbia, MO) sieved to remove large debris. The seeds were inoculated at planting with 0.5 μl of bacteria resuspended in water mixed with 10 ml of H 2 O. When verifying two bacterial strains, 0.5 μl of each resuspended bacteria was mixed with 10 ml of H 2 O. The 10 ml of H 2 O was sufficient for the bacteria to be delivered to the soil at 3 in 3 (7.62 cm 3 ) and to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 75 °F (18 - 24 °C) with an 11-hour light exposure per day and given 5 ml of water every three days. The soybeans were grown for two weeks and analyzed for germination and initial elongation of the plants under the described conditions. The identified strains are shown by their official bacterial names, and the final height data are shown in Table 23. By inoculating with the bacterial strains of the present invention together with members of Bradyrhizobium sp. or Rhizobium sp., plant growth increased compared to each inoculation alone.

Table 23

[0284] Example 32. Member of the Bacillus cereus family having plant growth promoting properties Bacillus mycoides strain BT155, Bacillus mycoides strain EE118, Bacillus mycoides strain EE141, Bacillus mycoides strain BT46-3, member of the Bacillus cereus family strain EE349, Bacillus thuringiensis strain BT013A, and Bacillus megaterium strain EE281 were grown in Luria Bertani liquid medium at 37 °C, the overnight culture was spin-down, the medium was discarded, and it was resuspended in an equal volume of sterile water. Twenty corn seeds were planted at a depth of 2.5 cm for each treatment in topsoil (Columbia, MO) sieved to remove large residues. The seeds were inoculated at the time of planting with 0.5 μl of bacteria resuspended in water mixed with 50 ml of H 2 O. 50 ml of H 2 O was sufficient for the bacteria to be delivered to the soil of 29 in 3 (442.5 cm 3 ) and was also sufficient to fill the soil for proper germination of the seeds. The plants were grown at a temperature of 65 - 72 °F with 13 hours of light per day and given 5 ml of water every 3 days. The seedlings were grown for 2 weeks and the germination and the initial elongation of the plants under the described conditions were analyzed. The identified strains are indicated by their official bacterial names and the final height data are shown in Table 24.

Table 24

[0285] Example 33. Enhanced selection of members of the Bacillus cereus family for screening for plant growth promotion and other beneficial activities as a BEMD expression host For bringing about beneficial agricultural effects, a BEMD system may be used to present a wide range of proteins, peptides, and enzymes using any of the targeted sequences described herein. Additional beneficial effects can be obtained by selecting an expression host that has inherently beneficial properties (e.g., a member of the Bacillus cereus family). Many strains of members of the Bacillus cereus family have the effect of promoting plant growth. Furthermore, many member strains of the Bacillus cereus family have a defensive effect through direct fungicidal activity, insecticidal activity, nematicidal activity, or other defensive activities. By using such strains as the expression host of the BEMD system, the final spore product has multiple beneficial effects in agriculture.

[0286] Table 25 shows the results of experiments in which fusion proteins were expressed in strains of various members of the Bacillus cereus family. All strains expressed a fusion protein containing amino acids 1 to 35 of SEQ ID NO: 1 and the phosphatase PhoA4 derived from Bacillus subtilis, an enzyme beneficial for enhancing phosphate uptake in corn. The gene was synthesized, cloned into the pMK4 vector, and introduced into each of the Bacillus spp. shown in Table 25 below. The strains sporulated by incubating for 3 days at 30 °C on normal agar plates containing 10 μg / ml of chloramphenicol. The spores were collected, washed, and at the time of planting, together with 5 mg of polyphosphoric acid / pot, for each pot with a diameter of 7.62 cm, dissolved in 50 ml of water at 1x10 5It was applied to corn at a ratio of CFU / ml. The corn was grown in silt loam soil for two weeks. The plants were grown under optimal light using a T5 lamp, 54 watts, under temperature conditions controlled between 15.5 and 25.5 °C, with 13 hours of light per day. The plants were watered thoroughly every three days during the two-week test. At the end of two weeks, the height of each plant was measured, and the measurements were standardized against the spores of the control Bacillus thuringiensis. Due to the expression of the SEQ ID NO: 1 - phosphatase fusion protein, the height of the corn increased within two weeks regardless of the selected expression host strain. As shown in Table 25, the use of members of the plant growth-promoting Bacillus cereus family further increased the height of the corn.

Table 25

[0287] Example 34. Use of various targeting sequences for expressing β-galactosidase on the surface of Bacillus thuringiensis Various targeting sequences having a high degree of homology with amino acids 20 - 35 of BclA (amino acids 20 - 35 of SEQ ID NO: 1) may be used to display enzymes, proteins, and peptides on the surface of members of the Bacillus cereus family. Some targeting sequences were compared by creating fusion proteins containing the targeting sequence linked to Bacillus subtilis lipase. The fusion constructs were synthesized using a promoter native to the targeting sequence, cloned into the replicating plasmid pMK4, and introduced into Bacillus thuringiensis BT013A. The strain sporulated by incubating on normal agar plates containing 10 μg / ml of chloramphenicol at 30 °C for three days. The spores were collected, washed, and resuspended in PBS at a ratio of 1x10 8 / ml. For the spores of each fusion construct, 1x10 5 spores were added to 400 μl of dH 2It was suspended in O. The reactants were heated with the reaction components to the desired reaction temperature (40 °C). 200 μl of working buffer was added (solution A: solution B was 9:1). Solution A was 50 mM Tris (pH 10) and 13.6 mM deoxycholic acid, and solution B was 3 mg / ml p-nitrophenyl palmitate dissolved in isopropanol. The reactants were incubated at 40 °C for 10 minutes, placed on ice, centrifuged to remove spores, and the absorbance at 420 nm was measured. The results are shown in Figure 26 below. Activity was normalized to a control fusion protein containing amino acids 1-35 of SEQ ID NO: 1 fused to Bacillus subtilis lipase. [Table 26]

[0288] Several targeting sequences linked to lipase resulted in increased expression levels and activity of the enzyme on the spore surface. In particular, SEQ ID NOs: 60, 62, and 64 (each containing a shorter targeting sequence) resulted in enhanced expression of the fusion on the surface of BEMD spores. All fusion proteins containing the verified targeting sequences presented lipase on the surface.

[0289] Example 35. Use of various exosporium sequences for expressing lipase on the surface of Bacillus thuringiensis, and demonstration of localization of the fusion protein to the exosporium surface Various exosporium proteins can be used to display enzymes, proteins, and peptides on the surface of members of the Bacillus cereus family. Some exosporium proteins were compared by creating fusion proteins containing exosporium proteins linked to Bacillus subtilis lipase as described in Example 34. The fusion constructs were synthesized using promoters that are native to the exosporium proteins shown in Table 27 below, cloned into pMK4 of the replicating plasmid, and introduced into Bacillus thuringiensis BT013A. Spores presenting various exosporium protein - Bacillus subtilis 168 lipase fusions were made by growing the transformed bacteria in brain - heart infusion liquid medium with a selection pressure of 10 μg / ml chloramphenicol, placing them on normal agar plates, and incubating at 30 °C for 3 days. After 3 days, the spores were washed off the plates, purified by centrifugation, and resuspended in PBS at 1 x 10 8 CFU / ml.

[0290] For each fusion construct, 1 x 10 5 spores were resuspended in 400 μl of dH 2 O. The reaction was heated to the desired reaction temperature (40 °C) with the reaction components. 200 μl of working buffer was added (solution A: solution B is 9:1). Solution A is 50 mM Tris (pH 10) and 13.6 mM deoxycholic acid, and solution B is 3 mg / ml p - nitrophenyl palmitate dissolved in isopropanol. The reaction was incubated at 40 °C for 10 minutes, placed on ice, centrifuged to remove the spores, and the absorbance at 420 nm was measured. The results are shown in Figure 27 below. The activity was normalized against SEQ ID NO: 72 linked to the lipase.

Table 27

[0291] By using the exosporium proteins of SEQ ID NOs: 72 and 73, the enzyme activity on the spores was highest. All fusion proteins containing the exosporium protein presented the active Bacillus subtilis 168 lipase on the surface, albeit at different levels.

[0292] Furthermore, another exosporium protein was shown to be able to direct the fusion protein to the exosporium using the fluorescent reporter mCherry. Fusion constructs containing the exosporium proteins of SEQ ID NOs: 74, 83 and 73 linked to the mCherry reporter were generated. Spores were grown for 1.5 days, harvested and resuspended as described above. 7 μl of fluorescent spores were placed on a Nikon E1000 microscope and imaged during late sporulation. The circular localization within the ring is an indicator of the localization of the outer spore layer and its appearance indicates the presence of the exosporium protein. The results of the fluorescence microscopy are shown in Figure 2. Figures 2A, 2B and 2C are fluorescence microscopy images of spores expressing fusion proteins containing the exosporium proteins of SEQ ID NOs: 74, 83 and 73 and the mCherry reporter, respectively. All three fusions showed high levels of fluorescence and exosporium localization, indicating the potential for expressing foreign proteins on the surface of the exosporium.

[0293] Example 36. Use of various targeting sequences and exosporium proteins for expressing phosphatase in Bacillus subtilis spores, and the effect of phosphatase-expressing spores in soybeans BEMD spores expressing Bacillus subtilis EE148 phosphatase A4 (PhoA4) were prepared by gene synthesis of various targeting sequences and genes encoding exosporium proteins under the control of its native promoter linked to PhoA4. The synthesized genes were cloned into pMK4 and introduced into Bacillus thuringiensis BT013A. Spores presenting various exosporium protein - Bacillus subtilis EE148 PhoA4 fusions were prepared by growing the transformed bacteria in brain heart infusion liquid medium with a selection pressure of 10 μg / ml chloramphenicol, placing them on normal agar plates, and incubating at 30 °C for 3 days. After 3 days, the spores were washed off the plates, purified by centrifugation, and resuspended in PBS at 1x10 8 CFU / ml.

[0294] Soybeans were planted at a depth of 2.54 cm in 10 - cm - deep pots filled with standard loam topsoil. PhoA4 - expressing BEMD spores were diluted to a concentration of 1x10 4 / ml with 50 ml of water and applied to each plant at the time of planting. A water - only control was also included. Polyphosphate was added to the pots at a rate of 0.5 mg / pot in the liquid. The plants were grown under optimal light using T5 lamps, 54 watts, at controlled temperature conditions between 15.5 and 25.5 °C, with 13 hours of light per day. The plants were watered thoroughly every 3 days during the 2 - week test. At the end of 2 weeks, the height of each plant was measured, and the measurements were standardized against the control water - only plants.

[0295] The results are shown in Table 28. All soybeans grown in the presence of BEMD spores expressing fusion proteins containing PhoA4 linked to various targeting sequences and exosporium proteins with fusion partners different from PhoA4 showed enhanced growth, but the degree of effect varied depending on the targeting sequence or exosporium protein used.

Table 28

[0296] Example 37. BEMD spores and co-application of seed treatments, liquid fertilizers, and other additives BEMD spores expressing the fusion protein were verified for compatibility with various seed treatments. The BEMD spores expressed a fusion protein containing a phosphatase (PhoA4) from Bacillus subtilis EE148 PhoA4 or a targeting sequence of amino acids 1 to 35 of SEQ ID NO: 1 linked to the POLARIS peptide. The synthesized gene was cloned into pMK4 and introduced into Bacillus thuringiensis BT013A. Spores presenting various exosporium proteins - Bacillus subtilis EE148 PhoA4 or POLARIS fusions were prepared by growing the transformed bacteria in brain heart infusion liquid medium with a selection pressure of 10 μg / ml chloramphenicol, plating on normal agar plates, and incubating at 30 °C for 3 days. After 3 days, the spores were washed off the plates, purified by centrifugation, and resuspended in PBS at 1 x 10 8 CFU / ml.

[0297] Plants were grown under optimal light using T5 lamps, 54 watts, at a controlled temperature between 15.5 and 25.5 °C with 13 hours of light per day. Plants were watered well every 3 days during the 2-week test. At the end of 2 weeks, the height of each plant was measured, and the measurements were standardized against control water-only plants. The results are shown in Table 29 below. Water drench = applied to the soil at 50 ml / pot. Polymer = ACCELERON seed coating polymer only. BEMD spores were added at 1 x 10 4 cells / 50 ml for water drench application. For seed coating application, BEMD spores were 1.3 x 10 4Added to cells / seeds. 10-34-0 and 6-24-6 are standard commercially available starter fertilizer compositions. 10-34-0 is liquid ammonium phosphate. 6-24-6 is a low-salt liquid phosphate fertilizer in an ortho / poly composition. Colorant = Becker Underwood red seed coating colorant. MACHO, APRON, and CRUISER are commercially available antifungal agents used on seeds. MACHO contains imidacloprid as the active ingredient, APRON contains mefenoxam as the active ingredient, and CRUISER contains a mixture of thiamethoxam, mefenoxam, and fludioxonil as the active ingredients. The spores were found to be compatible with many seed applications and to maintain plant growth-promoting activity in corn.

Table 29

[0298] The BEMD spores were found to be compatible with all of the verified seed coating additives tested. When the BEMD PhA4 spores were combined with the colorant and polymer alone, there was a slight decrease in activity, but complete activity was regained by combining the colorant with other antifungal agents. Also, the BEMD spores worked well with liquid fertilizers. Through direct nutrient supplementation, the starter fertilizers are thought to have contributed to plant growth. Since the BEMD spores were combined with both starter fertilizers, it is suggested that phosphatase activity results in enhanced plant growth even in the presence of excess nutrient sources. Combining the BEMD spores with antifungal agents increased plant growth significantly more than the BEMD spores alone, suggesting that young corn plants were protected during the early growth period.

[0299] Example 38. Use of BEMD spores as a foliar application to reduce growth inhibition due to stress on corn Using the BEMD spore display system, it may be possible to deliver enzymes that can alleviate any stress in plants growing in farms or greenhouses. To do this, an enzyme that selectively acts on reactive oxygen species in the soil was selected. Reactive oxygen species are important markers of stress in plants.

[0300] BEMD spores expressing a fusion protein containing the targeting sequence of amino acids 1 to 35 of SEQ ID NO: 1 linked to chitinase, superoxide dismutase, catalase, or β1,3-glucanase (derived from Bacillus thuringiensis BT013A) were prepared. The synthesized gene was cloned into pMK4 and introduced into Bacillus thuringiensis BT013A. Spores presenting various protein fusions were prepared by growing the transformed bacteria in brain heart infusion liquid medium with a selection pressure of 10 μg / ml chloramphenicol, placing them on normal agar plates, and incubating at 30 °C for 3 days. After 3 days, the spores were washed off the plates, purified by centrifugation, and resuspended in PBS at 1x10 8 CFU / ml.

[0301] Three-week-old maize (V5 stage) was grown under optimal light using a T5 lamp, 54 watts, under temperature conditions controlled between 15.5 and 25.5 °C, with 13 hours of light per day. The plants were watered well every 3 days during the test. When the plants reached V5, BEMD spores or a positive control chemical were applied at 1x10 5Either at 1 × 10⁶ BEMD spores / ml or at the concentration recommended for the chemical substance, it was sprayed on the leaves. A total of 1 ml of spray was applied to each plant individually. The plant height was measured shortly before the foliar spray application. Then, the plants were stressed by heating up to 32.2 °C and reducing watering to once a week. The plants were placed under stress conditions for two weeks. At the end of the two weeks, the plant height was measured again and the appearance was recorded. Under stress conditions, plant growth was minimal in the control treatment group. It was recorded that the plants continued to grow even under stress conditions as the plant height increased over two weeks compared to the water-only control. The results are shown in Table 30 below.

Table 30

[0302] Several stress-removing enzymes were applied to maize using the BEMD system as shown in Table 30 above. The control spores had no significant effect (a 1.6% decrease in plant height). The BEMD chitinase enzyme showed a positive effect when combined with its substrate chitosan. The two enzymes that worked best were BEMD β-1,3-glucanase and BEMD superoxide dismutase. BEMD β-1,3-glucanase mainly has antifungal activity but can also have a direct effect on plants. Salicylic acid and BTH were positive controls for the foliar assay, and positive reactions were observed for both. This foliar delivery method is useful for delivering stress-removing enzymes to plants at various times of the season.

[0303] Example 39. Expression levels of fusion proteins using various sigma-K-containing promoters As shown in Example 23 above, replacing the native promoter of a targeting array, an exosporium protein, or an exosporium protein fragment can have a significant impact on the level of the fusion protein expressed on the exosporium of spores of the Bacillus cereus family. For example, by replacing the native BclA promoter with the BclB promoter, the level of the fusion protein on the surface of the spores of members of the Bacillus cereus family is greatly reduced. Alternatively, by replacing the native BclB promoter with the BclA promoter, the level of the fusion protein on the exosporium is dramatically increased.

[0304] The relative promoter expression levels of various exosporium proteins under the control of their native sporulation promoters were obtained from the microarray data of Bergman et al., 2008. The relative expression levels were measured during the late sporulation phase (300 minutes from the start of the experiment, when the sigma K promoter is most active). The sigma K promoter is an important promoter for the expression of exosporium localization genes and related proteins. Relative expression is an increase in the expression level of a gene compared to the average of all other genes on the chromosome at any given time. Table 31 below shows the delivery expression levels of various genes induced by sigma K in members of the Bacillus cereus family.

Table 31

[0305] In view of the above, it will be apparent that several objects of the present invention have been achieved and other beneficial results have also been obtained.

[0306] The above-mentioned fusion proteins, members of the Bacillus cereus family, formulations, and methods are capable of various modifications without departing from the gist of the present invention, and all the contents included in the above description and shown in the accompanying drawings should be construed and interpreted and are not intended to be limiting. In one aspect, the present invention includes the following. (Item 1) A method for protecting a plant from a pathogen, comprising introducing a member of the Bacillus cereus family expressing a fusion protein into a plant growth environment, or applying a member of the Bacillus cereus family expressing a fusion protein to a plant, a plant seed, or an area surrounding the plant or the plant seed, wherein the fusion protein a protein or peptide that protects a plant from at least one pathogen, and a targeting sequence, an exosporium protein or an exosporium protein fragment, where these direct the fusion protein to the exosporium of a member of the Bacillus cereus family, and the protein or peptide that protects the plant from the pathogen is physically attached to the exosporium of a member of the Bacillus cereus family and includes an enzyme.

Claims

1. 1. A method for protecting a plant from a pathogen comprising introducing into the plant's environment or applying to a plant, a plant seed, or an area surrounding a plant or plant seed a recombinant member of the Bacillus cereus family expressing a fusion protein, The recombinant Bacillus cereus family member expressing the fusion protein is selected from Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, and Bacillus weihenstephensis; wherein the fusion protein comprises: at least one protein or peptide that protects a plant from a pathogen, the protein or peptide being selected from the group consisting of harpin, alpha elastin, beta elastin, systemin, elicitin, cryptogein, flagellin protein, flagellin peptide, bacteriocin, lysozyme, lysozyme peptide, conalbumin, albumin, lactoferrin, lactoferrin peptide, TasA, insecticidal bacterial toxins, endotoxins, Cry toxins, protease inhibitor proteins or peptides, chitinase, proteases, lactonases, beta-1,3-glucanases, beta-1,4-glucanases, beta-1,6-glucanases, chitosinases, chitosinase-like enzymes, lyticases, peptidases, proteinases, and mutanolysins; and A targeting sequence, (a) an amino acid sequence consisting of 16 amino acids and having at least 81% identity with amino acids 20 to 35 of SEQ ID NO:1, wherein the identity with amino acids 25 to 35 is at least 90%; (b) amino acids 1 to 35 of SEQ ID NO:1; (c) amino acids 20 to 35 of SEQ ID NO:1; (d) SEQ ID NO:1; or (e) SEQ ID NO: 60, and The method, wherein the pathogen-protecting protein or peptide is physically attached to the exosporium of a recombinant Bacillus cereus family member.

2. 1. A plant seed coated with a seed coating formulation comprising: (i) a recombinant Bacillus cereus family member; and (ii) an agriculturally acceptable carrier, wherein the recombinant Bacillus cereus family member expresses a fusion protein; The recombinant Bacillus cereus family member is selected from Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, and Bacillus weihenstephensis; The fusion protein comprises: at least one protein or peptide that protects a plant from a pathogen, the protein or peptide being selected from the group consisting of harpin, alpha elastin, beta elastin, systemin, elicitin, cryptogein, flagellin protein, flagellin peptide, bacteriocin, lysozyme, lysozyme peptide, conalbumin, albumin, lactoferrin, lactoferrin peptide, TasA, insecticidal bacterial toxins, endotoxins, Cry toxins, protease inhibitor proteins or peptides, chitinase, proteases, lactonases, beta-1,3-glucanases, beta-1,4-glucanases, beta-1,6-glucanases, chitosinases, chitosinase-like enzymes, lyticases, peptidases, proteinases, and mutanolysins; and A targeting sequence, (a) an amino acid sequence consisting of 16 amino acids and having at least 81% identity with amino acids 20 to 35 of SEQ ID NO:1, wherein the identity with amino acids 25 to 35 is at least 90%; (b) amino acids 1 to 35 of SEQ ID NO:1; (c) amino acids 20 to 35 of SEQ ID NO:1; (d) SEQ ID NO:1; or (e) SEQ ID NO: 60, and A plant seed, wherein the protein or peptide that protects the plant against said pathogen is physically attached to the exosporium of a recombinant Bacillus cereus family member.

3. A recombinant Bacillus cereus family member expressing a fusion protein, The recombinant Bacillus cereus family member is selected from Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, and Bacillus weihenstephensis; The fusion protein comprises: at least one protein or peptide that protects a plant from a pathogen, the protein or peptide being selected from the group consisting of harpin, alpha elastin, beta elastin, systemin, elicitin, cryptogein, flagellin protein, flagellin peptide, bacteriocin, lysozyme, lysozyme peptide, conalbumin, albumin, lactoferrin, lactoferrin peptide, TasA, insecticidal bacterial toxins, endotoxins, Cry toxins, protease inhibitor proteins or peptides, chitinase, proteases, lactonases, beta-1,3-glucanases, beta-1,4-glucanases, beta-1,6-glucanases, chitosinases, chitosinase-like enzymes, lyticases, peptidases, proteinases, and mutanolysins; and A targeting sequence, (a) an amino acid sequence consisting of 16 amino acids and having at least 81% identity with amino acids 20 to 35 of SEQ ID NO:1, wherein the identity with amino acids 25 to 35 is at least 90%; (b) amino acids 1 to 35 of SEQ ID NO:1; (c) amino acids 20 to 35 of SEQ ID NO:1; (d) SEQ ID NO:1; or (e) SEQ ID NO: 60, and The protein or peptide that protects plants from pathogens is physically attached to the exosporium of a recombinant Bacillus cereus family member. Recombinant Bacillus cereus family member.

4. 4. The plant seed of claim 2 or the recombinant Bacillus cereus family member of claim 3, wherein the lysozyme peptide comprises LysM or the lactoferrin peptide comprises LfcinB.

5. The method of claim 1, wherein the lysozyme peptide comprises LysM or the lactoferrin peptide comprises LfcinB.

6. The plant seed of claim 2 or the member of the recombinant Bacillus cereus family of claim 3, wherein the protein or peptide that protects plants from pathogens comprises an insecticidal bacterial toxin, the insecticidal bacterial toxin comprising a VIP insecticidal protein; the protein or peptide that protects plants from pathogens comprises a protease inhibitor protein or peptide, the protease inhibitor protein or peptide comprising a trypsin inhibitor or a kwai protease inhibitor; or the protein or peptide that protects plants from pathogens comprises a Cry toxin, the Cry toxin comprising a Cry toxin derived from Bacillus thuringiensis.

7. 7. The plant seed or recombinant Bacillus cereus family member of claim 6, wherein the Cry toxin comprises a Cry toxin derived from Bacillus thuringiensis, and the Cry toxin derived from Bacillus thuringiensis further comprises a Cry5B protein or a Cry21A protein.

8. The method of claim 1, wherein the protein or peptide that protects plants from pathogens comprises an insecticidal bacterial toxin, the insecticidal bacterial toxin comprising a VIP insecticidal protein; the protein or peptide that protects plants from pathogens comprises a protease inhibitor protein or peptide, the protease inhibitor protein or peptide comprising a trypsin inhibitor or a kwai protease inhibitor; or the protein or peptide that protects plants from pathogens comprises a Cry toxin, the Cry toxin comprising a Cry toxin derived from Bacillus thuringiensis.

9. The method of claim 8, wherein the Cry toxin comprises a Cry toxin derived from Bacillus thuringiensis, and the Cry toxin derived from Bacillus thuringiensis further comprises a Cry5B protein or a Cry21A protein.

10. 4. The plant seed of claim 2 or the recombinant Bacillus cereus family member of claim 3, wherein the protein or peptide that protects the plant from pathogens comprises a lactonase, said lactonase comprising 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol lactonase, actinomycin lactonase, deoxylimonate A-ring-lactonase, gluconolactonase L-rhamnono-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase or xylono-1,4-lactonase.

11. 4. The plant seed of claim 2 or the recombinant Bacillus cereus family member of claim 3, wherein the protease comprises an alkaline protease, an acid protease, or a neutral protease.

12. 2. The method of claim 1, wherein the protein or peptide that protects a plant from a pathogen comprises a lactonase, the lactonase comprising 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol lactonase, actinomycin lactonase, deoxylimonate A-ring-lactonase, gluconolactonase L-rhamnono-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase, or xylono-1,4-lactonase.

13. 2. The method of claim 1, wherein the protease comprises an alkaline protease, an acid protease, or a neutral protease.

14. the fusion protein further comprises an amino acid linker between the targeting sequence and the protein or peptide that protects the plant from the pathogen; 14. The method of any one of claims 1, 5, 8, 9, 12 and 13, optionally wherein the linker is a polyalanine linker, a polyglycine linker, or a linker comprising a mixture of both alanine and glycine residues; and / or contains a protease recognition site.

15. the fusion protein further comprises an amino acid linker between the targeting sequence and the protein or peptide that protects the plant from the pathogen; 12. A plant seed according to any one of claims 2, 4, 6, 7, 10 and 11, or a member of the recombinant Bacillus cereus family according to any one of claims 3, 4, 6, 7, 10 and 11, wherein optionally the linker is a polyalanine linker, a polyglycine linker, or a linker comprising a mixture of both alanine and glycine residues; and / or contains a protease recognition site.

16. The members of the recombinant Bacillus cereus family include Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus cereus ...

15. The method of any one of claims 1, 5, 8, 9, 12, 13 and 14, comprising:

17. The members of the recombinant Bacillus cereus family include Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus cereus ...

16. A plant seed according to any one of claims 2, 4, 6, 7, 10, 11 and 15, or a member of the recombinant Bacillus cereus family according to any one of claims 3, 4, 6, 7, 10, 11 and 15, comprising a member of the recombinant Bacillus cereus family, such as Bacillus cereus spp., ...

18. 17. The method of any one of claims 1, 5, 8, 9, 12, 13, 14 and 16, wherein the recombinant Bacillus cereus family member comprises a plant growth-promoting bacterial strain, optionally the plant growth-promoting bacterial strain: produces an insecticidal toxin (optionally a Cry toxin), produces a fungicidal compound (optionally a β-1,3-glucanase, chitosinase, lyticase, or a combination thereof), produces a nematicidal compound (optionally a Cry toxin), produces a bactericidal compound, is resistant to one or more antibiotics, contains one or more free replicating plasmids, binds to plant roots, colonizes plant roots, forms biofilms, solubilizes nutrients, secretes organic acids, or a combination thereof.

19. The recombinant Bacillus cereus family member includes a plant growth-promoting bacterial strain, optionally the plant growth-promoting bacterial strain: produces an insecticidal toxin (optionally a Cry toxin), produces a fungicidal compound (optionally a β-1,3-glucanase, chitosinase, lyticase, or a combination thereof), produces a nematicidal compound (optionally a Cry toxin), produces a bactericidal compound, is resistant to one or more antibiotics, contains one or more free replicating plasmids, binds to plant roots, colonizes plant roots, forms a biofilm, solubilizes nutrients, secretes organic acids, or a combination thereof. A member of the cereus family.

20. Members of the recombinant Bacillus cereus family include Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), Bacillus cereus BA118 (NRRL No. B-50918), Bacillus mycoides ... cereus family member EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924), or Bacillus cereus family member EE349 (NRRL No. B-50928).

21. Members of the recombinant Bacillus cereus family include Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), Bacillus cereus BA118 (NRRL No. B-50918), Bacillus mycoides ... cereus family member EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924), or Bacillus cereus family member EE349 (NRRL No. B-50928).

22. The fusion protein is expressed under the control of a sporulation promoter and / or a highly expressed sporulation promoter native to the targeting sequence of the fusion protein, the exosporium protein, or the exosporium protein fragment, and optionally: The highly expressed sporulation promoter comprises a sigma-K sporulation specific polymerase promoter sequence or the sigma-K sporulation specific polymerase promoter sequence(s) has 100% identity to the corresponding nucleotides of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103; and / or 21. The method of any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18 and 20, wherein the sporulation promoter contains a nucleic acid sequence having at least 95%, at least 98%, at least 99%, or 100% identity to a nucleic acid sequence of any one of SEQ ID NOs: 85-103.

23. The fusion protein is expressed under the control of a sporulation promoter and / or a highly expressed sporulation promoter native to the targeting sequence of the fusion protein, the exosporium protein, or the exosporium protein fragment, and optionally: The highly expressed sporulation promoter comprises a sigma-K sporulation specific polymerase promoter sequence or the sigma-K sporulation specific polymerase promoter sequence(s) has 100% identity to the corresponding nucleotides of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103; and / or 22. The plant seed of claim 2, 4, 6, 7, 10, 11, 15, 17, 19 and 21, or the recombinant Bacillus cereus family member of claim 3, 4, 6, 7, 10, 11, 15, 17, 19 and 21, wherein the sporulation promoter contains a nucleic acid sequence having at least 95%, at least 98%, at least 99%, or 100% identity to a nucleic acid sequence of any one of SEQ ID NOs: 85-103.

24. 23. The method of any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18, 20 and 22, further comprising inactivating the recombinant Bacillus cereus family member prior to introduction into a plant environment or prior to application to a plant, a plant seed, or the area surrounding a plant or plant seed, optionally wherein inactivation is by heat treatment; gamma irradiation; x-ray irradiation; UV-A irradiation; UV-B irradiation; treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, or combinations thereof, or combinations thereof.

25. 25. The method of any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18, 20, 22 and 24, comprising coating a seed with the recombinant Bacillus cereus family member or a formulation containing the recombinant Bacillus cereus family member prior to planting.

26. 25. The method of any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18, 20, 22 and 24, comprising applying said recombinant Bacillus cereus family member or formulation to the aerial parts of a plant.

27. 25. The method of any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18, 20, 22 and 24, wherein introducing the recombinant Bacillus cereus family member into the plant growth environment comprises applying to the environment a liquid or solid formulation containing the recombinant Bacillus cereus family member.

28. further comprising introducing at least one pesticide into the plant's growing environment or applying at least one pesticide to the plant or seed, said pesticide comprising a fertilizer, a micronutrient fertilizer material, an insecticide, a herbicide, a fungicide, a molluscicide, an algicide, a plant growth improver, a bacterial inoculant, a fungal inoculant, or a combination thereof; The fertilizer comprises a liquid fertilizer; the micronutrient fertilizer material contains boric acid, a borate salt, boron frit, copper sulfate, copper frit, copper chelate, sodium tetraborate decahydrate, ferrous sulfate, ferrous oxide, ferrous ammonium sulfate, iron frit, iron chelate, manganese sulfate, manganese oxide, manganese chelate, manganese chloride, manganese frit, sodium molybdate, molybdic acid, zinc sulfate, zinc oxide, zinc carbonate, zinc frit, zinc phosphate, zinc chelate, or combinations thereof; The insecticide comprises an organophosphate, a carbamate, a pyrethroid, an acaricide, an alkyl phthalate, a boric acid, a borate, a fluoride, a sulfur, a haloaromatic substituted urea, a hydrocarbon ester, a biologically based insecticide, or a combination thereof; the herbicide comprises a chlorophenoxy compound, a nitrophenol compound, a nitrocresol compound, a dipyridyl compound, an acetamide, a fatty acid, an anilide, a benzamide, a benzoic acid, a benzoic acid derivative, an anisic acid, an anisic acid derivative, a benzonitrile, a benzothiadiazinone dioxide, a thiocarbamate, a carbamate, a carbanilate, a chloropyridinyl, a cyclohexenone derivative, a dinitroaminobenzene derivative, a fluorodinitrotoluidine compound, an isoxazolidinone, a nicotinic acid, an isopropylamine, an isopropylamine derivative, an oxadiazolinone, a phosphate, a phthalate, a picolinic acid compound, a triazine, a triazole, an uracil, an urea derivative, an endosal, sodium chlorate, or a combination thereof; The fungicide comprises a substituted benzene, a thiocarbamate, an ethylene bis dithiocarbamate, a thiophthalidamide, a copper compound, an organomercury compound, an organotin compound, a cadmium compound, anilazine, benomyl, cyclohexamide, dodine, etridiazole, iprodione, metraxyl, thiamimefone, triforine, or a combination thereof; The fungal inoculant may be a fungal inoculant of the Glomeraceae family, a fungal inoculant of the Claroidglomeraceae family, a fungal inoculant of the Gigasporaceae family, a fungal inoculant of the Acaulosporaceae family, a fungal inoculant of the Sacculosporaceae family, a fungal inoculant of the Enterophosporaceae family, a fungal inoculant of the Pacidosporaceae family, a fungal inoculant of the Diversisporaceae family, raceae family fungal inoculant, Paraglomeraceae family fungal inoculant, Archaeosporaceae family fungal inoculant, Geosiphonaceae family fungal inoculant, Ambisporaceae family fungal inoculant, Scutellosporaceae family fungal inoculant, Dentiscultataceae family fungal inoculant, Racocetraceae family fungal inoculant, Basidiomycota family (phylum a fungal inoculant of Basidiomycota, a fungal inoculant of Ascomycota, a fungal inoculant of Zygomycota, or a combination thereof; The bacterial inoculant may be a bacterial inoculant of the genus Rhizobium, a bacterial inoculant of the genus Bradyrhizobium, a bacterial inoculant of the genus Mesorhizobium, a bacterial inoculant of the genus Azorhizobium, a bacterial inoculant of the genus Allorhizobium, a bacterial inoculant of the genus Schi ... Bacterial inoculant of the genus Sinorhizobium, bacterial inoculant of the genus Kluyvera, bacterial inoculant of the genus Azotobacter, bacterial inoculant of the genus Pseudomonas, bacterial inoculant of the genus Azospirillium, bacterial inoculant of the genus Bacillus a bacterial inoculant, a bacterial inoculant of the genus Streptomyces, a bacterial inoculant of the genus Paenibacillus, a bacterial inoculant of the genus Paracoccus, a bacterial inoculant of the genus Enterobacter, a bacterial inoculant of the genus Alcaligenes, a bacterial inoculant of the genus Mycobacterium, a bacterial inoculant of the genus Trichoderma, a bacterial inoculant of the genus Gliocladium, a bacterial inoculant of the genus Glomus, a bacterial inoculant of the genus Klebsiella, or a combination thereof; and / or The fertilizer is selected from the group consisting of ammonium sulfate, ammonium nitrate, ammonium sulfate nitrate, ammonium chloride, ammonium bisulfate, ammonium polysulfide, ammonium thiosulfide, aqueous ammonia, anhydrous ammonia, ammonium polyphosphate, aluminum sulfate, calcium nitrate, calcium ammonium nitrate, calcium sulfate, calcined magnesite, calcitic limestone, calcium oxide, calcium nitrate, dolomitic limestone, slaked lime, calcium carbonate, diammonium phosphate, monoammonium phosphate, magnesium nitrate, magnesium sulfate, potassium nitrate, potassium chloride urea, potassium magnesium sulfate, potassium sulfate, sodium nitrate, dolomite, magnesia, urea, urea-formaldehyde, urea ammonium nitrate, sulfur coated urea, polymer coated urea, isobutylidenediurea, K2SO4-2MgSO4, kainite, sylvinite, kieselite, epsom salt, elemental sulfur, marl, powdered oyster, fish meal, oil cake, fish fertilizer, blood meal, phosphate rock, superphosphate fertilizer, slag, bone meal, wood ash, manure, bat guano, peat moss, compost, green sand, cottonseed meal, feather meal, crab meal, fish emulsion, humic acid, or combinations thereof; The method according to any one of claims 1, 5, 8, 9, 12, 13, 14, 16, 18, 20, 22 and 24 to 27.

Citation Information

Patent Citations

  • Bacillus based delivery system and methods of use

    US20110281316A1

  • Methods and compositions for developing spore display systems for medicinal and industrial applications

    WO2002000232A2

  • Use of macrolides in pest control

    JP2001527026A

  • Protein containing serum albumin domain

    JP2005245268A

  • Fungicidal active compound combination

    JP2006528148A