Exon Skipping Oligomer Conjugates for Muscular Dystrophy

Abstract

To provide exon skipping oligomer conjugates for muscular dystrophy.SOLUTION: Disclosed herein is an antisense oligomer conjugate that is complementary to a selected target site of human dystrophin gene and induces exon 51 skipping. In one aspect, the disclosure provides an antisense oligomer conjugate comprising an antisense oligomer of 30 subunits in length capable of inducing exon skipping by binding to a selected target site in the human dystrophin gene, where the antisense oligomer comprises a base sequence complementary to an exon 51 target region in a dystrophin pre-mRNA designated as an annealing site; and a cell permeable peptide (CPP) conjugated to the antisense oligomer via a linker moiety.SELECTED DRAWING: None

Description

Technical Field

[0001] Detailed Description of the Invention (Related Information) This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 436,182, filed on December 19, 2016; U.S. Provisional Patent Application No. 62 / 443,476, filed on January 6, 2017; U.S. Provisional Patent Application No. 62 / 479,173, filed on March 30, 2017; and U.S. Provisional Patent Application No. 62 / 562,080, filed on September 22, 2017. The entire contents of the above-referenced provisional patent applications are incorporated herein by reference.

[0002] (Field of the Disclosure) The present disclosure relates to novel antisense oligomer conjugates suitable for exon 51 skipping of the human dystrophin gene and pharmaceutical compositions thereof. The present disclosure also provides methods for inducing exon 51 skipping using the novel antisense oligomer conjugates, methods for producing dystrophin in a subject having a mutation in the dystrophin gene capable of exon 51 skipping, and methods for treating a subject having a mutation in the dystrophin gene capable of exon 51 skipping.

Background Art

[0003] Antisense technology has been developed using a series of chemical properties that affect gene expression at various different levels (transcription, splicing, stability, translation). Much of that research has focused on the use of antisense compounds that correct or compensate for abnormal or disease-related genes in a wide variety of indications. Antisense molecules are capable of specifically inhibiting gene expression, and for this reason, much of the research effort on oligomers as modulators of gene expression has focused on inhibiting the expression of target genes or the function of cis-acting elements. Antisense oligomers are usually directed against the sense strand (e.g., mRNA) or, in the case of some viral RNA targets, the minus strand of RNA. To obtain the desired effect of downregulating a particular gene, oligomers generally promote the degradation of the target mRNA, the inhibition of mRNA translation, or the inhibition of the function of cis-acting RNA elements, thereby efficiently interfering with de novo synthesis of the target protein or the replication of viral RNA.

[0004] However, such techniques are not effective when the goal is to upregulate the production of a native protein or to compensate for mutations such as nonsense or frameshift mutations that induce premature termination of translation. In such cases, the transcript of the defective gene must not be targeted for degradation or steric hindrance, and for this reason, the chemical properties of the antisense oligomer must not promote the degradation of the target mRNA or the inhibition of translation.

[0005] In various genetic diseases, the action of mutations on final gene expression can be regulated through the process of targeted exon skipping during the splicing process. The splicing process is directed by a complex mechanism consisting of multiple components, which brings adjacent exon-intron junctions of pre-mRNA close together, cleaves the phosphodiester bond at the intron terminus, and then reorganizes between the exons that are to be spliced together. This complex and precise process is mediated by relatively short sequence motifs within the pre-mRNA, which are quasi-conserved RNA segments to which various nuclear splicing factors involved in the splicing reaction later bind. By changing the mechanism by which the splicing machinery reads or recognizes the motifs involved in pre-mRNA processing, it is possible to generate mRNA molecules spliced in different forms. So far, most human genes have been found to be selectively spliced during the process of normal gene expression, but the mechanisms involved have not been elucidated. Bennett et al. (U.S. Patent No. 6,210,892) describe antisense regulation of wild-type intracellular mRNA processing using antisense oligomer analogs that do not induce RNaseH-mediated cleavage of the target RNA. This is useful in that it makes it possible to produce mRNA lacking a specific exon that undergoes alternative splicing (see, for example, Sazani, Kole et al., 2007 for the production of soluble TNF superfamily receptors lacking an exon encoding a transmembrane domain).

[0006] When a normally functioning protein is truncated due to a mutation, it is possible to restore the production of some functional proteins by intervening in the splicing process using antisense technology. Also, if it is possible to specifically delete an exon with a pathogenic mutation from some genes, it has been shown that it is possible to produce short proteins that have the same biological properties as the natural protein or have biological activity to an extent that can improve the disease caused by the mutation in the exon (see, for example, Sierakowska, Sambade et al., 1996; Wilton, Lloyd et al., 1999; van Deutekom, Bremmer-Bout et al., 2001; Lu, Mann et al., 2003; Aartsma-Rus, Janson et al., 2004). Kole et al. (U.S. Patent Nos. 5,627,274; 5,916,808; 5,976,879; and 5,665,593) disclose methods of arresting abnormal splicing using modified antisense oligomer analogs that do not promote the decay of the target pre-mRNA. Bennett et al. (U.S. Patent No. 6,210,892) describe antisense regulation of wild-type intracellular mRNA processing using antisense oligomer analogs that also do not induce RNaseH-mediated cleavage of the target RNA.

[0007] The process of targeted exon skipping is thought to be particularly useful for long genes with multiple exons and introns, redundancy in the exon gene composition, or genes where the protein can function even without one or more specific exons. Previous efforts to re-direct gene processing for the treatment of hereditary diseases associated with shortening caused by mutations in various genes have focused on the use of antisense oligomers that (1) overlap in whole or in part with elements involved in the splicing process; or (2) bind to the pre-mRNA at a position close enough to the element to inhibit the binding and function of splicing factors that mediate the specific splicing reaction normally occurring at that element.

[0008] Duchenne muscular dystrophy (DMD) is caused by defects in the expression of the protein dystrophin. Among the genes encoding this protein, 79 exons are scattered over more than 2 million nucleotides of DNA. Exon mutations characterized by a change in the reading frame of the exon, the introduction of a stop codon, or the complete removal of an out-of-frame exon(s) or the duplication of one or more exons can inhibit the production of functional dystrophin and potentially cause DMD.

[0009] Becker muscular dystrophy (BMD), a relatively mild form of muscular dystrophy, is known to occur when translation of the mRNA into protein does not terminate prematurely because mutations, usually deletions of one or more exons, result in an in-frame transcript of dystrophin across the entire length. If the upstream and downstream exons are ligated during processing of the mutant dystrophin pre-mRNA to maintain the in-frame of the correct gene, the result is an mRNA encoding a protein with a short internal deletion and some retained activity, resulting in the Becker phenotype.

[0010] For many years, it has been known that deletions of one or more exons that do not change the reading frame of the dystrophin protein result in the BMD phenotype, whereas exon deletions that cause a frameshift result in DMD (Monaco, Bertelson et al., 1988). In general, DMD occurs when there are dystrophin mutations, including point mutations and exon deletions that change the reading frame and thus interfere with proper protein translation. It should also be noted that some BMD and DMD patients have exon deletions spanning multiple exons.

[0011] Regulation of mutant dystrophin pre-mRNA splicing by antisense oligoribonucleotides has been reported both in vitro and in vivo (see, for example, Matsuo, Masumura et al., 1991; Takeshima, Nishio et al., 1995; Pramono, Takeshima et al., 1996; Dunckley, Eperon et al., 1997; Dunckley, Manoharan et al., 1998; Wilton, Lloyd et al., 1999; Mann, Honeyman et al., 2002; Errington, Mann et al., 2003).

[0012] Antisense oligomers have been specifically designed to target specific regions of the pre-mRNA, usually exons, to induce skipping of DMD gene mutations, thereby returning these out-of-frame mutations to in-frame and allowing the production of internally truncated but functional dystrophin proteins. Such antisense oligomers are known to target either completely within the exon (so-called exon internal sequences) or the splice donor or splice acceptor junctions spanning from the exon into a portion of the intron.

[0013] The discovery and development of antisense oligomers against such DMDs have been in the field of previous research. Such developments include: (1) The University of Western Australia and Sarepta Therapeutics (the assignee of the present application): WO 2006 / 000057; WO 2010 / 048586; WO 2011 / 057350; WO 2014 / 100714; WO 2014 / 153240; WO 2014 / 153220; (2) Academisch Ziekenhuis Leiden / Prosensa Technologies (now BioMarin Pharmaceutical): WO 02 / 24906; WO 2004 / 083432; WO 2004 / 083446; WO 2006 / 112705; WO 2007 / 133105; WO 2009 / 139630; WO 2009 / 054725; WO 2010 / 050801; WO 2010 / 050802; WO 2010 / 123369; WO 2013 / 112053; WO 2014 / 007620; (3) Carolinas Medical Center: WO 2012 / 109296; (4) Royal Holloway: Applications including the patent and US patent applications claiming its benefits, US Patent Application Nos. 61 / 096,073 and 61 / 164,978; for example, US Patent No. 8,084,601 and US Patent Application Publication No. 2017-0204413, etc. (4) JCR Pharmaceuticals and Matsuo: US Patent No. 6,653,466; Applications including the patent and JP 2000-125448 claiming its benefits, for example, US Patent No. 6,653,467, etc.; Applications including the patent and JP 2000-256547 claiming its benefits, for example, US Patent No. 6,727,355, etc.; WO 2004 / 048570; (5) Nippon Shinyaku Co., Ltd.: WO 2012 / 029986; WO 2013 / 100190; WO 2015 / 137409; WO 2015 / 194520; and (6) Association Institut de Myology / Pierre Marie Curie University / University of Bern / CNRS / Synthena AG: such as International Publication No. WO 2010 / 115993; International Publication No. WO 2013 / 053928.

[0014] Eteplirsen is a phosphorodiamidate morpholino oligomer (PMO) designed to skip exon 51 of the human dystrophin gene in DMD patients who are capable of exon 51 skipping to restore the reading frame and produce a functional shorter form of the dystrophin protein. In 2016, the US Food and Drug Administration (FDA) approved Exondys 51 (trademark) (eteplirsen) for the treatment of Duchenne muscular dystrophy (DMD) in patients with confirmed mutations in the DMD gene capable of exon 51 skipping.

[0015] The discovery and development of antisense oligomers conjugated with cell-permeable peptides for DMD is also a research area (International Publication No. WO 2010 / 048586; Wu, B. et al., The American Journal of Pathology, Vol. 181(2):392 - 400, 2012; Wu, R. et al., Nucleic Acids Research, Vol. 35(15):5182 - 5191, 2007; Mulders, S. et al., 19th International Congress of the World Muscle Society, Poster Presentation Berlin, October 2014; Bestas, B. et al., The Journal of Clinical (See Investigation, doi:10.1172 / JCI76175, 2014; Jearawiriyapaisarn, N. et al., Molecular Therapy, Vol. 16(9):1624 - 1629, 2008; Jearawiriyapaisarn, N. et al., Cardiovascular Research, Vol. 85:444 - 453, 2010; Moulton, H.M. et al., Biochemical Society Transactions, Vol. 35(4):826 - 828, 2007; Yin, H. et al., Molecular Therapy, Vol. 19(7):1295 - 1303, 2011; Abes, R. et al., J. Pept. Sci., Vol. 14:455 - 460, 2008; Lebleu, B. et al., Advanced Drug Delivery Reviews, Vol. 60:517 - 529, 2008; McClorey, G. et al., Gene Therapy, Vol. 13:1373 - 1381, 2006; Alter, J. et al., Nature Medicine, Vol. 12(2):175 - 177, 2006; and Youngblood, D. et al., American Chemical Society, Bioconjugate Chem., 2007, 18(1), pp50 - 60).

[0016] Cell - penetrating peptides (CPPs), such as arginine - rich peptide transport moieties, are thought to be effective in increasing the intracellular penetration of, for example, antisense oligomers conjugated with CPPs. Notwithstanding such efforts, there remains a need for improved antisense oligomers targeting exon 51 that are potentially useful in therapies to produce dystrophin and treat DMD, as well as corresponding pharmaceutical compositions.

Prior Art Documents

Patent Documents

[0017]

Patent Document 1

Summary of the Invention

Means for Solving the Problems

[0018] The antisense oligomer conjugate provided herein includes an antisense oligomer portion conjugated to a CPP. In one aspect, the present disclosure an antisense oligomer of 30 subunit length capable of binding to a selected target and inducing exon skipping in the human dystrophin gene, the antisense oligomer comprising a sequence of bases complementary to the exon 51 target region of dystrophin pre-mRNA named the annealing site; and a cell-penetrating peptide (CPP) conjugated to the antisense oligomer by a linker portion is provided, an antisense oligomer conjugate.

[0019] In some embodiments, the annealing site is H51A(+66+95).

[0020] In some embodiments, the bases of the antisense oligomer are bound to a morpholino ring structure, and the morpholino ring structures are linked by a phosphite-containing subunit bond that links the morpholino nitrogen of one ring structure to the 5'-exocyclic carbon of an adjacent ring structure. In certain embodiments, the cell-penetrating peptide is a 6-arginine unit (「R 6 」), and the linker portion is glycine. In some embodiments, the antisense oligomer comprises a sequence of bases named SEQ ID NO: 1.

[0021] In various aspects, the present disclosure provides an antisense oligomer conjugate or a pharmaceutically acceptable salt thereof according to formula (I):

Chemical formula

Chem.

[0022] In another aspect, the present disclosure provides an antisense oligomer conjugate of formula (IV):

Chem.

[0023] In another aspect, the present disclosure provides an antisense oligomer conjugate of formula (IVA):

Chem.

[0024]

[0025] ​In another aspect, the present disclosure provides a method of treating a subject in need of Duchenne muscular dystrophy (DMD), wherein the subject has a mutation in the dystrophin gene that allows exon 51 skipping, and the method comprises administering to the subject an antisense oligomer conjugate of the present disclosure. The present disclosure also relates to the use of an antisense oligomer conjugate of the present disclosure in the manufacture of a medicament for the treatment of Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows exon 51 skipping.

[0026] In another aspect, the present disclosure provides a method of restoring the mRNA reading frame and inducing dystrophin production in a subject having a mutation in the dystrophin gene that allows exon 51 skipping, the method comprising administering to the subject an antisense oligomer conjugate of the present disclosure. In another aspect, the present disclosure provides a method of excluding exon 51 from dystrophin pre-mRNA during mRNA processing in a subject having a mutation in the dystrophin gene that allows exon 51 skipping, the method comprising administering to the subject an antisense oligomer conjugate of the present disclosure. In another aspect, the present disclosure provides a method of binding exon 51 of dystrophin pre-mRNA in a subject having a mutation in the dystrophin gene that allows exon 51 skipping, the method comprising administering to the subject an antisense oligomer conjugate of the present disclosure.

[0027] In another aspect, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in therapy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the treatment of Duchenne muscular dystrophy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the manufacture of a medicament for use in therapy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the manufacture of a medicament for the treatment of Duchenne muscular dystrophy.

[0028] In another aspect, the present disclosure also provides a kit for treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene capable of exon 51 skipping, and the kit comprises at least one antisense oligomer conjugate of the present disclosure packaged in a suitable container and instructions for its use.

[0029] The above and other objects and features will be more fully understood by reading the following detailed description of the present disclosure in conjunction with the drawings. The present invention provides, for example, the following items. (Item 1) An antisense oligomer conjugate of formula (I) [Chemical formula] wherein each Nu is a nucleobase that together forms a targeting sequence; wherein T is T is [Chemical formula] a moiety selected from; R 1 is C 1 ~C 6 alkyl; wherein the targeting sequence is complementary to the exon 51 annealing site of dystrophin pre-mRNA designated H51A(+66+95) An antisense oligomer conjugate or a pharmaceutically acceptable salt thereof. (Item 2) The antisense oligomer conjugate according to Item 1, wherein each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I). (Item 3) The antisense oligomer conjugate according to Item 1, wherein the targeting sequence is SEQ ID NO: 1 (5’-CTCCAACATCAAGGAAGATGGCATTTCTAG-3’), and each thymine (T) is optionally uracil (U). (Item 4) T is

Chemical formula

Chemical formula

Chemical formula

Table 1

Brief Description of the Drawings

[0030]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5-1

Figure 5-2

Figure 6

Figure 7-1

Figure 7-2

Figure 8

Figure 9-1

Figure 9-2

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23-1

Figure 23-2

Figure 23-3

Figure 23-4

Figure 23-5

Figure 24

Figure 25

Figure 26

Modes for Carrying Out the Invention

[0031] Description of Embodiments (Detailed Description of the Disclosure) Embodiments of the present disclosure generally relate to improved antisense oligomer conjugates specifically designed to induce exon skipping in the human dystrophin gene and methods of using the same. Dystrophin plays a critically important role in muscle function, and various muscle-related diseases are characterized by mutant dystrophin genes. Thus, in certain embodiments, the improved antisense oligomer conjugates described herein induce exon skipping in mutant human dystrophin genes, such as the mutant dystrophin genes found in Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD).

[0032] These mutant human dystrophin genes, due to abnormal mRNA splicing events caused by the mutations, either express a defective dystrophin protein or fail to express any measurable dystrophin, and such a pathological condition causes various forms of muscular dystrophy. To treat this pathological condition, the antisense oligomer conjugates of the present disclosure hybridize with a selected region of the pre-processing mRNA of the mutant human dystrophin gene and induce exon skipping and differential splicing in the dystrophin mRNA that would otherwise be abnormally spliced, thereby producing an mRNA transcript encoding a functional dystrophin protein in muscle cells. In certain embodiments, the resulting dystrophin protein is not necessarily "wild-type" dystrophin, but rather is shortened yet still functional dystrophin.

[0033] By increasing the level of functional dystrophin protein within muscle cells, these and related embodiments are useful for the prevention and treatment of muscular dystrophy, particularly forms of muscular dystrophy such as DMD and BMD characterized by the expression of defective dystrophin proteins resulting from abnormal mRNA splicing. The specific antisense oligomer conjugates described herein further have improved dystrophin exon-specific targeting compared to other oligomers, thereby providing advantages in terms of importance and practicality over other treatment methods for related forms of muscular dystrophy.

[0034] Accordingly, the present disclosure provides an antisense oligomer conjugate comprising: an antisense oligomer of 30 subunits in length capable of binding to a selected target and inducing exon skipping in the human dystrophin gene, the antisense oligomer comprising a nucleotide sequence complementary to the exon 51 target region of the dystrophin pre-mRNA, designated as the annealing site; and a cell-permeable peptide (CPP) conjugated to the antisense oligomer by a linker moiety Relates to an antisense oligomer conjugate comprising

[0035] In some embodiments, the annealing site is H51A(+66 + 95).

[0036] In some embodiments, the bases of the antisense oligomer are linked to a morpholino ring structure, and the morpholino ring structures are linked by a phosphite-containing subunit bond that links the morpholino nitrogen of one ring structure to the 5'-exocyclic carbon of an adjacent ring structure. In certain embodiments, the cell-permeable peptide is R 6 and the linker moiety is glycine. In some embodiments, the antisense oligomer comprises the nucleotide sequence designated as SEQ ID NO:1, wherein each thymine base (T) is uracil base (U) as needed.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described. For the purposes of this disclosure, the following terms are defined below.

[0038] I. Definitions "About" means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% from a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0039] As used herein, the term "alkyl" refers to a saturated straight-chain or branched-chain hydrocarbon, unless otherwise specified. In certain embodiments, the alkyl group is a primary, secondary or tertiary hydrocarbon. In certain embodiments, the alkyl group has 1 to 10 carbon atoms, i.e., C 1 ~C10 It contains alkyl. In certain embodiments, the alkyl group has 1 to 6 carbon atoms, i.e., C 1 ~C 6 It contains alkyl. In certain embodiments, the alkyl group is methyl, CF 3 , CCl 3 , CFC1 2 , CF 2 Cl, ethyl, CH 2 CF 3 CF 2 CF 3 , propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl and 2,3-dimethylbutyl. This term encompasses both substituted alkyl groups, including halogenated alkyl groups, and unsubstituted alkyl groups. In certain embodiments, the alkyl group is a fluorinated alkyl group. Non-limiting examples of moieties that can substitute the alkyl group are halogen (fluoro, chloro, bromo or iodo), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfuric acid, phosphonic acid, phosphoric acid or phosphonate, which are either unprotected or, if necessary, protected as known to those skilled in the art, for example, as taught in Greene, et al., Protective Groups in Organic Synthesis, John Wiley and Sons, 2nd Edition, 1991, which is incorporated herein by reference.

[0040] As used herein with respect to a subject or patient, "exon 51 skipping capable" encompasses subjects and patients having one or more mutations in the dystrophin gene, which mutations would cause the reading frame to be out-of-frame if exon 51 of the dystrophin pre-mRNA were not skipped, thereby impairing translation of the pre-mRNA and preventing the subject or patient from producing functional or semi-functional dystrophin. Examples of mutations in the dystrophin gene that are exon 51 skipping capable include, for example, mutations in exons 45-50, 47-50, 48-50, 49-50, 50, 52, and 52-63 (Leiden Duchenne Muscular Dystrophy Mutation Database, Leiden University Medical Center, the Netherlands). Determination of whether a patient has a mutation in the dystrophin gene that is exon skipping capable is well within the understanding of one of ordinary skill in the art (see, for example, Aartsma-Rus et al., (2009) Hum Mutat. 30:293-299; Gurvich et al., Hum Mutat. 2009; 30(4)633-640; and Fletcher et al., (2010) Molecular Therapy 18(6)1218-1223).

[0041] As used herein, the term "oligomer" refers to a series of subunits linked by subunit linkages. In certain instances, the term "oligomer" is used in connection with "antisense oligomers." For antisense oligomers, each subunit consists of: (i) a ribose sugar or a derivative thereof; and (ii) a nucleobase attached thereto, provided that the subunit, the subunit linkage, or both are not naturally occurring, and the order of the base-pairing moieties forms a base sequence complementary to a target sequence in a nucleic acid (usually RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. In certain embodiments, the antisense oligomer is a PMO. In other embodiments, the antisense oligomer is a 2'-O-methyl phosphorothioate. In other embodiments, the antisense oligomers of the present disclosure are bridged nucleic acids (BNAs) such as peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or 2'-O,4'-C-ethylene-bridged nucleic acids (ENAs). Further exemplary embodiments are described herein.

[0042] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each containing a nucleobase sequence) that are related to each other by the laws of Watson-Crick base pairing. For example, the nucleobase sequence "T-G-A (5'→3')" is complementary to the nucleobase sequence "A-C-T (3'→5')". Complementarity can be "partial", in which case a number of nucleobases less than the entirety of a given nucleobase sequence match another nucleobase sequence according to the laws of base pairing. For example, in some embodiments, the complementarity between a given nucleobase sequence and another nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90% or about 95%. Alternatively, there may be "total" or "complete" (100%) complementarity between a given nucleobase sequence and another nucleobase sequence, and examples continue. The degree of complementarity between nucleobase sequences has a great influence on the hybridization efficiency and strength between the sequences.

[0043] The terms "effective amount" and "therapeutically effective amount" are used interchangeably herein and refer to the amount of a therapeutic compound, such as an antisense oligomer, that, when administered to a mammalian subject as a single dose or as part of a series of doses, is effective to obtain the desired therapeutic effect. In the case of antisense oligomers, this effect is usually brought about by inhibition of translation of the selected target sequence or natural splice processing or by production of a clinically significant amount of dystrophin (statistical significance).

[0044] In some embodiments, an effective amount is a composition comprising at least 10 mg / kg or at least 20 mg / kg of an antisense oligomer for a period of time sufficient to treat a subject. In some embodiments, an effective amount that increases the number of dystrophin-positive fibers in a subject to at least 20% of normal is a composition comprising at least 20 mg / kg of an antisense oligomer. In certain embodiments, an effective amount that stabilizes, maintains, or improves a patient's walking distance, e.g., in a 6MWT, from a 20% deficit relative to healthy peers is a composition comprising 10 mg / kg or at least 20 mg / kg of an antisense oligomer. In various embodiments, an effective amount is at least 10 mg / kg to about 30 mg / kg, at least 20 mg / kg to about 30 mg / kg, about 25 mg / kg to about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg. In some embodiments, an effective amount is about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, or about 50 mg / kg. In another aspect, an effective amount is at least about 10 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg over at least 24 weeks, at least 36 weeks, or at least 48 weeks, whereby the number of dystrophin-positive fibers in the subject is increased to at least 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% of normal and the patient's walking distance is stabilized or improved from a 20% deficit relative to healthy peers, e.g., in a 6MWT. In some embodiments, treatment increases the number of dystrophin-positive fibers in a patient to 20-60% or 30-50% of normal.

[0045] "Enhance" or "enhancement", "increase" or "increasing", or "stimulate" or "stimulation" generally refers to the ability of one or more antisense oligomer conjugates or pharmaceutical compositions to cause or produce an increase in the physiological response (i.e., downstream effects) of a cell or subject, compared to the situation without the antisense oligomer conjugate or the response caused by a control compound. Increases in physiological responses can include, among other responses apparent from the understanding in the art and the description herein, an increase in the expression of functional dystrophin protein or an increase in the biological activity associated with dystrophin in muscle tissue. Increases in muscle function can also be measured, including increases or improvements of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of muscle function. The percentage of muscle fibers expressing functional dystrophin can also be measured, including increases of about 1%, 2%, 5%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of dystrophin expression in muscle fibers. For example, it has been shown that if 25-30% of the fibers express dystrophin, an approximately 40% improvement in muscle function can occur (see, e.g., DelloRusso et al., Proc Natl Acad Sci USA 99:12979-12984, 2002). An "increased" or "enhanced" amount is typically a "statistically significant" amount, which can include an increase of 1.1-fold, 1.2-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, or more (e.g., 500-fold, 1000-fold, and any integer and decimal greater than 1, such as 1.5, 1.6, 1.7, 1.8, etc.) over the amount produced in the absence of the antisense oligomer conjugate (in the absence of the agent) or by a control compound.

[0046] Terms such as "function" and "functionality" as used herein refer to biological, enzymatic, or therapeutic functions.

[0047] A "functional" dystrophin protein generally refers to a dystrophin protein that has sufficient biological activity to suppress the progressive muscle tissue breakdown, which is another characteristic of muscular dystrophy, as compared to the variant or "defective" form of dystrophin protein that is typically present in a particular subject having DMD or BMD. In certain embodiments, a functional dystrophin protein can have a biological activity of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including any integer therebetween) of the in vitro or in vivo biological activity of wild-type dystrophin, as measured by routine techniques in the art. As an example, the activity of dystrophin in muscle cultures can be measured in vitro by muscle fiber size, myofibril organization (or disorganization), contractile activity, and spontaneous clustering of acetylcholine receptors (see, e.g., Brown et al., Journal of Cell Science. 112:209-216, 1999). Animal models are also valuable resources for studying the causes of disease and provide a means to test the activity of dystrophin. The two most widely used animal models in DMD research are the mdx mouse and the Golden Retriever muscular dystrophy (GRMD) dog, both of which are dystrophin-negative (see, e.g., Collins and Morgan, Int J Exp Pathol 84:165-172, 2003). The functional activities of various dystrophin proteins can be measured using the above and other animal models. Shortened forms of dystrophin are included, such as those that result after administration of certain exon-skipping antisense oligomer conjugates of the present disclosure.

[0048] The term "mismatch(es)" refers to one or more nucleic acid bases (whether contiguous or separated) within an oligomeric nucleic acid base sequence that do not match the target pre-mRNA according to the law of base pairing. Although perfect complementarity is often desired, some embodiments may include one or more, preferably 6, 5, 4, 3, 2, or 1 mismatch to the target pre-mRNA. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomer conjugates of the present disclosure include variations in the nucleic acid base sequence near the internal terminal variations, which, if present, are typically within about 6, 5, 4, 3, 2, or 1 subunit of the 5' end and / or 3' end.

[0049] The terms "morpholino", "morpholino oligomer" and "PMO" refer to phosphorodiamidate morpholino oligomers having the following general structure described in FIG. 2 of Summerton, J. et al., Antisense & Nucleic Acid Drug Development, 7: 187-195 (1997):

Chemical formula

[0050] In certain embodiments, a morpholino is conjugated to a "tail" portion at the 5' or 3' end of the oligomer to increase its stability and / or solubility. Exemplary tails include:

Chemical formula

[0051] Among the above exemplary tail portions, "TEG" or "EG3" refers to the following tail portion: [Chemical formula] refer to.

[0052] Among the above exemplary tail portions, "GT" refers to the following tail portion: [Chemical formula] refer to.

[0053] As used herein, the terms "-G-R 6 " and "-G-R 6 -Ac" are used interchangeably and refer to the peptide portion conjugated to the antisense oligomer of the present disclosure. In various embodiments, "G" represents a glycine residue conjugated to "R 6 " by an amide bond, and "R" each represents an arginine residue conjugated to each other by an amide bond. Thus, "R 6 " means six (6) arginine residues conjugated to each other by an amide bond. The arginine residues can have any configuration. For example, the arginine residues can be L-arginine residues, D-arginine residues, or a mixture of D-arginine residues and L-arginine residues. In certain embodiments, "-G-R 6 " or "-G-R 6 -Ac" is conjugated to the morpholine ring nitrogen of the most 3'-terminal morpholino subunit of the PMO antisense oligomer of the present disclosure. In some embodiments, "-G-R 6 " or "-G-R 6 -Ac" is conjugated to the 3'-end of the antisense oligomer of the present disclosure and has the following formula: [Chemical formula] is of the following.

[0054] The terms "nucleobase" (Nu), "base-pairing moiety" or "base" are used interchangeably to refer to purine or pyrimidine bases (e.g., uracil, thymine, adenine, cytosine and guanine) that occur naturally or are found in "natural" DNA or RNA, as well as analogs of these naturally occurring purines and pyrimidines. These analogs can result in improved properties such as binding affinity to oligomers. Exemplary analogs include hypoxanthine (the base component of inosine); 2,6-diaminopurine; 5-methylcytosine; C5-propynyl-modified pyrimidines; 10-(9-(aminoethoxy)phenoxazinyl) (G-clamp), etc.

[0055] Further examples of base-pairing moieties include, but are not particularly limited to, uracil, thymine, adenine, cytosine, guanine and hypoxanthine (inosine) in which the amino groups are each protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs such as pseudoisocytosine and pseudouracil, and other modified nucleobases such as 8-substituted purines, xanthine or hypoxanthine (the last two being natural degradation products), etc. Modified nucleobases disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048; Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196; and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313 are also contemplated, and the contents of the above references are incorporated herein by reference.

[0056] As further examples of base pair-forming moieties, although not particularly limited, there may be mentioned nucleobases to which one or more benzene rings are added to increase the size. Nucleobase substitutions described in the Glen Research catalog (www.glenresearch.com); Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner S.A. et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, F.E. et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; and Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627 are contemplated as being useful for the antisense oligomer conjugates described herein, and the contents of the above references are incorporated herein by reference. Examples of nucleobases with increased size include those shown below [Chemical formula] and their tautomers.

[0057] As used herein, the terms "parenteral administration" and "administering parenterally" mean a mode of administration usually by injection other than enteral and topical administration, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injections and infusions.

[0058] For clarity, the structures of the present disclosure, including for example Formula (IV), are continuous from 5' to 3', and for the convenience of illustrating the entire structure in a compact form, various figure interruptions denoted as "Interruption A", "Interruption B", and "Interruption C" are included. As will be understood by those skilled in the art, for example, the designation "Interruption A" indicates that the figure of the structure is continuous at that point. It is understood by those skilled in the art that the same applies to "Interruption B" and "Interruption C" of the above structure respectively. However, none of the figure interruptions are intended to mean that the above structure is actually discontinuous, nor will those skilled in the art understand that the figure interruptions have such a meaning.

[0059] As used herein, a set of brackets used within a structural formula indicates that the structural features between the brackets are repeated. In some embodiments, the brackets used may be "[" and "]", and in certain specific embodiments, the brackets used to indicate the repeated structural features may be "(" and ")". In some embodiments, the number of repetitions of the structural features between the brackets is a number such as 2, 3, 4, 5, 6, 7, etc. shown outside the brackets. In various embodiments, the number of repetitions of the structural features between the brackets is indicated by a variable such as "Z" shown outside the brackets.

[0060] As used herein, a straight or curved bond drawn to a chiral carbon atom or chiral phosphorus atom within a structural formula indicates that the stereochemistry of that chiral carbon or chiral phosphorus is not determined and is intended to include all forms of chiral centers. Examples of such illustrations are shown below.

Chemical formula

[0061] The phrase "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with the other components constituting the formulation and / or the subject to be treated therewith.

[0062] As used herein, the term "pharmaceutically acceptable carrier" means any type of non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material or formulation aid. Some examples of materials that can serve as pharmaceutically acceptable carriers, at the discretion of the formulator, include sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; tragacanth powder; malt; gelatin; talc; suppository waxes such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solution; non-toxic and compatible lubricants such as sodium lauryl sulfate and magnesium stearate; coloring agents; release agents; coating agents; sweetening agents; flavoring agents; perfuming agents; preservatives and antioxidants.

[0063] The term "recovery" with respect to the synthesis or production of dystrophin generally refers to the production of dystrophin protein, including truncated dystrophin, in a muscular dystrophy patient after treatment with the antisense oligomer conjugates described herein. In some embodiments, treatment results in a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% (including any integer therebetween) increase in de novo dystrophin production in the patient. In some embodiments, treatment results in an increase in the number of dystrophin-positive fibers in the subject to at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 95% - 100% of normal. In other embodiments, treatment results in an increase in the number of dystrophin-positive fibers in the subject to about 20% - about 60% or about 30% - about 50% of normal. The percentage of dystrophin-positive fibers in a patient after treatment can be determined by muscle biopsy using known techniques. For example, a muscle biopsy sample can be taken from a suitable muscle such as the biceps brachii of the patient.

[0064] Analysis of the proportion of dystrophin-positive fibers can be performed at multiple time points before and / or after treatment or throughout the treatment process. In some embodiments, a post-treatment biopsy sample is taken from a muscle contralateral to the pre-treatment biopsy. Dystrophin expression analysis before and after treatment can be performed using any assay suitable for dystrophin. In some embodiments, immunohistochemical detection is performed on tissue sections obtained from a muscle biopsy using an antibody such as a monoclonal or polyclonal antibody that serves as a marker for dystrophin. For example, the MANDYS106 antibody, which is a highly sensitive dystrophin marker, can be used. Any suitable secondary antibody can be used.

[0065] In some embodiments, the percentage of dystrophin-positive fibers is calculated by dividing the number of positive fibers by the total number of counted fibers. In normal muscle samples, the dystrophin-positive fibers are 100%. Thus, the percentage of dystrophin-positive fibers can be expressed as a ratio to normal. To control taking into account the presence of trace amounts of dystrophin in the pre-treatment muscle and revertant mutant fibers, when counting dystrophin-positive fibers in the post-treatment muscle, a baseline can be set using a section of the patient's pre-treatment muscle. This can be used as a threshold when counting dystrophin-positive fibers present in a section of the patient's post-treatment muscle. In other embodiments, tissue sections stained with an antibody for dystrophin quantification using Bioquant image analysis software (Bioquant Image Analysis, Nashville, Tennessee) can also be used. The total dystrophin fluorescence signal intensity can be reported as a ratio to normal. Further, the percentage of dystrophin-positive fibers can be determined using Western blot analysis with monoclonal or polyclonal anti-dystrophin antibodies. For example, the anti-dystrophin antibody NCL-Dys1 from Leica Biosystems can be used. The percentage of dystrophin-positive fibers can also be analyzed by determining the expression of components of the sarcoglycan complex (β, γ) and / or neuronal NOS.

[0066] In some embodiments, treatment with the antisense oligomer conjugates of the present disclosure slows or reduces the progressive respiratory muscle dysfunction and / or respiratory muscle insufficiency expected in DMD patients in the absence of treatment. In some embodiments, treatment with the antisense oligomer conjugates of the present disclosure can reduce or eliminate the need for respiratory assistance expected in the absence of treatment. In some embodiments, measurements of maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP), and forced vital capacity (FVC) are included in the assessment of respiratory function measurements for tracking the course of the disease and the potential for therapeutic intervention. MIP and MEP measure, respectively, the levels of pressure that a person can generate during inhalation and exhalation, and are sensitive measures of respiratory muscle strength. MIP is one measure of diaphragmatic muscle strength reduction.

[0067] In some embodiments, MEP can decrease before other pulmonary function test values, including MIP and FVC, change. In certain embodiments, MEP can be an early indicator of respiratory dysfunction. In certain embodiments, FVC can be used to measure the total volume of air exhaled during forced exhalation after a maximal inhalation. In DMD patients, FVC increases with physical growth until the mid-teens. However, when growth rate decline or growth arrest occurs due to disease progression, muscle strength decline progresses, vital capacity enters a decline phase, and declines at an average rate of about 8-8.5 percent per year after age 10-12. In certain embodiments, the predicted percentages of MIP (MIP adjusted for body weight), MEP (MEP adjusted for age), and FVC (FVC adjusted for age and height) are used as adjunctive analyses.

[0068] As used herein, the terms "subject" and "patient" include any animal presenting with a condition treatable with the antisense oligomer conjugates of the present disclosure, or at risk of presenting such a condition, e.g., having DMD or BMD or any condition associated with these pathologies (e.g., reduction of muscle fibers), or at risk of having the same. Suitable subjects (or patients) include laboratory animals (such as mice, rats, rabbits or guinea pigs), domestic and farm animals or pets (such as cats or dogs). Non-human primates, preferably human patients (or subjects) are included. Also included is a method of producing dystrophin in a subject (or patient) having a mutation in the dystrophin gene that allows exon 51 skipping.

[0069] As used herein, the phrases "systemic administration", "administer systemically", "peripheral administration" and "administer peripherally" mean administering a compound, drug or other substance not directly into the central nervous system, but into the whole body of the patient and thus subjecting it to metabolism and other similar processes, e.g., subcutaneous administration.

[0070] The term "targeting sequence" refers to the sequence of nucleobases of an oligomer that is complementary to the sequence of nucleotides in the target pre-mRNA. In some embodiments of the present disclosure, the sequence of nucleotides in the target pre-mRNA is the exon 51 annealing site of the dystrophin pre-mRNA designated H51A(+66+95).

[0071] "Treatment" of a subject (e.g., a mammal such as a human) or a cell is any type of intervention used to alter a natural process of the subject or cell. Treatment includes, but is not particularly limited to, administration of an oligomer or a pharmaceutical composition thereof, and can be carried out as a prophylaxis or after the onset of a pathological event or contact with a pathogen. Treatment includes any desired effect on symptoms or lesions of a disease or condition associated with a dystrophin protein, such as a specific form of muscular dystrophy, and can include, for example, a minimal change or improvement in one or more measurable markers of the disease or condition being treated. Also included is "preventive" treatment that can be directed at reducing the rate of progression of the disease or condition being treated, delaying the onset of that disease or condition, or reducing the severity of its onset. "Treatment" or "prevention" does not necessarily imply complete eradication, cure, or prevention of the disease or condition or its associated symptoms.

[0072] In some embodiments, treatment with the antisense oligomer conjugate of the present disclosure increases new dystrophin production expected in the absence of treatment, delays disease progression, slows or reduces the decline in walking ability, reduces myositis, reduces muscle damage, improves muscle function, reduces the decline in lung function, and / or enhances muscle regeneration. In some embodiments, treatment maintains, delays, or slows disease progression. In some embodiments, treatment maintains walking ability or reduces the decline in walking ability. In some embodiments, treatment maintains lung function or reduces the decline in lung function. In some embodiments, treatment maintains or increases the patient's stable walking distance measured, for example, by the 6-minute walk test (6MWT). In some embodiments, treatment maintains or shortens the time taken to walk / run 10 meters (i.e., the 10-meter walk / run test). In some embodiments, treatment maintains or shortens the time taken to stand up from a supine position (i.e., the stand-up time test). In some embodiments, treatment maintains or shortens the time taken to climb a standard four-step staircase (i.e., the four-step stair climb test). In some embodiments, treatment maintains or reduces the patient's myositis measured, for example, by MRI (e.g., MRI of the leg muscles). In some embodiments, T2 and / or fat content is measured by MRI to confirm muscle degeneration. Changes in the structure and composition of muscle due to inflammation, edema, muscle damage, and fat infiltration can be confirmed by MRI.

[0073] In some embodiments, treatment with the antisense oligomer conjugate of the present disclosure increases new dystrophin production and slows or reduces the decline in walking ability that would be expected in the absence of treatment. For example, treatment can stabilize, maintain, improve, or increase the walking ability of a subject (e.g., stabilization of walking). In some embodiments, treatment maintains or increases the steady-state walking distance of a patient as measured by, for example, the 6-minute walk test (6MWT) described by McDonald et al. (Muscle Nerve, 2010;42:966-74, incorporated herein by reference). Changes in the 6-minute walk distance (6MWD) can be expressed as an absolute value, a percentage change, or a change in % predicted. In some embodiments, treatment maintains or improves the steady-state walking distance of a patient in the 6MWT from a 20% deficit relative to healthy peers. By calculating the % predicted, the performance of DMD patients can be determined relative to the typical performance of healthy peers in the 6MWT. For example, for males, the following equation: 196.72+(39.81×age)-(1.36×age 2 )+(132.28×height (meters)) can be used to calculate the % predicted 6MWD. For females, the following equation: 188.61+(51.50×age)-(1.86×age 2 )+(86.10×height (meters)) can be used to calculate the % predicted 6MWD (Henricson et al., PLoS Curr., 2012, version 2, incorporated herein by reference). In some embodiments, treatment with the antisense oligomer increases the steady-state walking distance of a patient by 3 meters, 5 meters, 6 meters, 7 meters, 8 meters, 9 meters, 10 meters, 15 meters, 20 meters, 25 meters, 30 meters, or more than 50 meters (including any integer in between) from baseline.

[0074] The decline in muscle function in DMD patients can occur against the backdrop of normal pediatric growth and development. In fact, in young children with DMD, despite progressive muscle dysfunction, the walking distance in the 6MWT can increase over a period of about one year. In some embodiments, the 6MWD of DMD patients is compared to existing standard data of control subjects with normal development as well as subjects matched for age and gender. In some embodiments, equations based on age and height are applied to the standard data and can be used to account for normal growth and development. Using such equations, the 6MWD of subjects with DMD can be converted to a percent predicted (% predicted) value. In certain embodiments, the analysis of % predicted 6MWD data provides a way to account for normal growth and development and can show that the increase in function at a young age (e.g., below 7 years) represents stability rather than improvement in the ability of DMD patients (see Henricson et al., PLoS Curr., 2012, version 2, incorporated herein by reference).

[0075] To distinguish different antisense molecules, a nomenclature for antisense molecules has been proposed and published (see Mann et al., (2002) J Gen Med 4, 644-654). This nomenclature has been particularly important when testing multiple antisense molecules that are slightly different but all directed to the same target region shown below: H#A / D(x:y).

[0076] The first letter represents the species (e.g., H: human, M: mouse, C: dog). "#" represents the number of the target dystrophin exon. "A / D" represents the acceptor splice site or donor splice site at the beginning and end of the exon, respectively. (x y) represents the annealing coordinates. In the coordinates, "-" or "+" represents the intron sequence or exon sequence, respectively. For example, A(-6+18) represents the last 6 bases of the intron preceding the target exon and the first 18 bases of the target exon. Since the closest splice site is the acceptor, "A" is described before its coordinates. If the annealing coordinates at the donor splice site are described, it becomes D(+2-18), and in the coordinates, the last 2 exon bases and the first 18 intron bases correspond to the annealing site of the antisense molecule. The annealing coordinates represented by A(+65+85) where the whole is an exon are the site between the 65th nucleotide and the 85th nucleotide from the beginning of the exon.

[0077] II. Antisense oligomer A. Antisense oligomer conjugate designed to induce exon 51 skipping In certain embodiments, the antisense oligomer conjugate of the present disclosure is complementary to the exon 51 target region of the dystrophin gene and induces exon 51 skipping. Specifically, the present disclosure relates to an antisense oligomer conjugate complementary to the exon 51 target region of dystrophin pre-mRNA, named the annealing site. In some embodiments, the annealing site is H51A(+66+95).

[0078] The antisense oligomer conjugate of the present disclosure targets dystrophin pre-mRNA to induce skipping of exon 51, whereby exon 51 is excluded or skipped from the spliced mature mRNA transcript. By skipping exon 51, the disrupted reading frame is restored to an in-frame mutation. DMD consists of various gene subtypes, but the antisense oligomer conjugate of the present disclosure is specifically designed to skip exon 51 of dystrophin pre-mRNA. DMD mutations that allow for exon 51 skipping constitute one subgroup (13%) of DMD patients.

[0079] The nucleobase sequence of the antisense oligomer conjugate that induces exon 51 skipping is designed to be a specific target sequence within exon 51 of dystrophin pre-mRNA. In some embodiments, the antisense oligomer of the antisense oligomer conjugate is a PMO, and each morpholino ring of the PMO is bound to a nucleobase including nucleobases found in, for example, DNA (adenine, cytosine, guanine, and thymine).

[0080] B. Chemical Characteristics of the Oligomer The antisense oligomer conjugates of the present disclosure can utilize various antisense oligomer chemistries. Examples of oligomer chemistries include, but are not limited to, morpholino oligomers, phosphorothioate-modified oligomers, 2’O-methyl-modified oligomers, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorothioate oligomers, 2’O-MOE-modified oligomers, 2’-fluoro-modified oligomers, 2’O,4’C-ethylene-bridged nucleic acids (ENAs), tricyclo-DNAs, tricyclo-DNA phosphorothioate subunits, 2’-O-[2-(N-methylcarbamoyl)ethyl]-modified oligomers, and combinations of any of the foregoing. A 2’O-Me-phosphorothioate backbone can be created by combining phosphorothioate chemistry and 2’-O-Me-modified chemistry. See, for example, PCT International Publications Nos. 2013 / 112053 and 2009 / 008725, which are hereby incorporated by reference in their entirety. Exemplary embodiments of the oligomer chemistries of the present disclosure are further described below.

[0081] 1. Peptide Nucleic Acid (PNA) Peptide nucleic acid (PNA) is a DNA analog in which the backbone is structurally homologous to the deoxyribose backbone and consists of N-(2-aminoethyl)glycine units to which pyrimidine or purine bases are attached. PNA containing natural pyrimidine and purine bases hybridizes with complementary oligomers according to the law of Watson-Crick base pairing and mimics DNA in terms of base pair recognition (Egholm, Buchardt et al., 1993). The backbone of PNA is formed by peptide bonds rather than phosphodiester bonds, and thus PNA is well-suited for antisense applications (see the structure below). Since the backbone is uncharged, PNA / DNA or PNA / RNA duplexes with higher thermal stability than normal are formed. PNA is not recognized by nucleases or proteases. Non-limiting examples of PNA are illustrated below:

Chemical formula

[0082] Despite the radical change in its natural structure, PNA can bind to DNA or RNA in a sequence-specific helical form. The characteristics of PNA include high binding affinity for complementary DNA or RNA, destabilization by single-base mismatches, resistance to nucleases and proteases, hybridization with DNA or RNA independent of salt concentration, and triple-strand formation with homopurine DNA. PANAGENE (trademark) has developed its own Bts PNA monomer (Bts; benzothiazole-2-sulfonyl group) and its own oligomerization process. PNA oligomerization using the Bts PNA monomer consists of repetitive cycles of deprotection, coupling, and capping. PNA can be produced synthetically using any technique known in the art. See, for example, U.S. Patent Nos. 6,969,766; 7,211,668; 7,022,851; 7,125,994; 7,145,006; and 7,179,896. See also U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262 for the preparation of PNA. Further, Nielsen et al., Science, 254:1497-1500, 1991 can be consulted for teachings on PNA compounds. Each of the above is hereby incorporated by reference in its entirety into this specification.

[0083] 2. Locked nucleic acid (LNA) Antisense oligomer conjugates may also include "locked nucleic acid" subunits (LNA). "LNA" is a member of a class of modified nucleic acids called bridged nucleic acids (BNA). BNA is characterized by a covalent bond that locks the conformation of the ribose ring into the C3'-endo (northern) sugar puckering. In LNA, the bridge consists of a methylene between the 2'-O and 4'-C positions. LNA promotes pre-organization of the backbone and base stacking, increasing hybridization and thermal stability.

[0084] The structure of LNA can be seen, for example, in Wengel et al., Chemical Communications (1998) 455; Koshkin et al., Tetrahedron (1998) 54:3607; Jesper Wengel, Accounts of Chem. Research (1999) 32:301; Obika et al., Tetrahedron Letters (1997) 38:8735; Obika et al., Tetrahedron Letters (1998) 39:5401; and Obika et al., Bioorganic Medicinal Chemistry (2008) 16:9230, which are all incorporated herein by reference in their entirety. Non-limiting examples of LNA are illustrated below: [Chem.]

[0085] The antisense oligomer conjugates of the present disclosure may incorporate one or more LNAs; in some cases, the antisense oligomer conjugate may consist entirely of LNAs. Methods for the synthesis of individual LNA nucleoside subunits and their incorporation into oligomers are described, for example, in U.S. Patent Nos. 7,572,582; 7,569,575; 7,084,125; 7,060,809; 7,053,207; 7,034,133; 6,794,499; and 6,670,461, which are all incorporated herein by reference in their entirety. Typical inter-subunit linkers include phosphodiester moieties and phosphorothioate moieties; alternatively, non-phosphorous-containing linkers may be used. Further embodiments include LNA-containing antisense oligomer conjugates in which each LNA subunit is separated by a DNA subunit. Certain antisense oligomer conjugates consist of alternating LNA subunits and DNA subunits, with the inter-subunit linker being phosphorothioate.

[0086] 2’O,4’C-Ethylene-bridged nucleic acid (ENA) is yet another member of the BNA class. Non-limiting examples are illustrated below: [Chemical formula]

[0087] ENA oligomers and their preparation are described in Obika et al., Tetrahedron Lett (1997) 38(50):8735, which is hereby incorporated by reference in its entirety. The antisense oligomer conjugates of the present disclosure may incorporate one or more ENA subunits.

[0088] 3. Unlocked nucleic acid (UNA) The antisense oligomer conjugates may also include unlocked nucleic acid (UNA) subunits. UNA and UNA oligomers are analogs of RNA in which the C2’-C3’ bond of the subunit is cleaved. While LNA is sterically restricted (compared to DNA and RNA), UNA is highly flexible. UNA is disclosed, for example, in International Publication No. WO 2016 / 070166. Non-limiting examples of UNA are shown below. [Chemical formula]

[0089] Typical inter-subunit linkers include phosphodiester moieties and phosphorothioate moieties; alternatively, non-phosphorous-containing linkers may be used.

[0090] 4. Phosphorothioate “Phosphorothioate” (or S-oligo) is a variant in which one of the non-bridging oxygens of normal DNA is replaced by sulfur. Non-limiting examples of phosphorothioate are illustrated below: [Chemical formula]

[0091] Sulfurization of the internucleotide linkage reduces the action of endonucleases and exonucleases, including 5′-to-3′ and 3′-to-5′ DNA POL 1 exonuclease, nuclease S1 and P1, RNase, serum nuclease, and snake venom phosphodiesterase. Phosphorothioates are prepared by two main routes: by the action of a solution of elemental sulfur in carbon disulfide on hydrogen phosphonate, or by sulfurizing triester phosphites with tetraethylthiuram disulfide (TETD) or 3H-1,2-benzodithiol-3-one 1,1-dioxide (BDTD) (see, for example, Iyer et al., J. Org. Chem. 55, 4693-4699, 1990, which is hereby incorporated by reference in its entirety). The latter method avoids the problems of the insolubility of elemental sulfur in most organic solvents and the toxicity of carbon disulfide. Even higher purity phosphorothioates can be obtained by the TETD method and the BDTD method.

[0092] 5. Tricyclic DNA and Tricyclic Phosphorothioate Subunits Tricyclic DNA (tc-DNA) is a class of constrained DNA analogs in which each nucleotide is modified by the introduction of a cyclopropane ring to limit the conformational flexibility of the backbone and optimize the backbone structure of the twist angle γ. Homobasic adenine-containing tc-DNA and thymine-containing tc-DNA form extremely stable A-T base pairs with complementary RNA. Tricyclic-DNA and its synthesis are described in International Patent Application Publication No. 2010 / 115993, which is hereby incorporated by reference in its entirety. The antisense oligomer conjugates of the present disclosure may incorporate one or more tricyclic DNA subunits; in some cases, the antisense oligomer conjugate may consist entirely of tricyclic DNA subunits.

[0093] The tricyclic phosphorothioate subunit is a tricyclic DNA subunit having phosphorothioate subunit linkages. The tricyclic phosphorothioate subunit and its synthesis are described in International Patent Application Publication No. 2013 / 053928, which is hereby incorporated by reference in its entirety. The antisense oligomer conjugates of the present disclosure may incorporate one or more tricyclic DNA subunits; in some cases, the antisense oligomer conjugate may consist entirely of tricyclic DNA subunits. Non-limiting examples of tricyclic DNA / tricyclic phosphorothioate subunits are illustrated below: [Chemical formula]

[0094] 6. 2’O-Methyl, 2’O-MOE and 2’-F oligomers A "2’-O-Me oligomer" molecule has a methyl group at the 2’-OH residue of the ribose molecule. 2’-O-Me-RNA also exhibits the same (or similar) behavior as DNA, but is protected from degradation by nucleases. 2’-O-Me-RNA can also be combined with phosphorothioate oligomers (PTO) for further stabilization. 2’O-Me oligomers (phosphodiester or phosphorothioate) can be synthesized by routine techniques in the art (see, e.g., Yoo et al., Nucleic Acids Res. 32:2008-16, 2004, which is hereby incorporated by reference in its entirety). Non-limiting examples of 2’O-Me oligomers are illustrated below: [Chemical formula]

[0095] 2’-O-methoxyethyl oligomers (2’-O MOE) have a methoxyethyl group at the 2’-OH residue of the ribose molecule and are discussed in Martin et al., Helv. Chim. Acta, 78, 486-504, 1995, which is incorporated herein by reference in its entirety. Non-limiting examples of 2’O-MOE subunits are illustrated below:

Chem.

[0096] In contrast to the aforementioned alkylated 2’OH ribose derivatives, 2’-fluoro (2’-F) oligomers have a fluorine radical at the 2’ position instead of 2’OH. Non-limiting examples of 2’-F oligomers are illustrated below:

Chem.

[0097] 2’O-methyl, 2’O-MOE and 2’F oligomers may also contain one or more phosphorothioate (PS) linkages, as illustrated below:

Chem.

[0098] Furthermore, 2’O-methyl, 2’O-MOE and 2’F oligomers may contain PS subunit-linkages throughout the oligomer, such as in the case of the doripenem of 2’O-methyl PS oligomers illustrated below:

Chem.

[0099] Alternatively, 2’O-methyl, 2’O-MOE and / or 2’F oligomers may contain PS linkages at the termini of the oligomer, as illustrated below:

Chem.

[0100] The antisense oligomer conjugates of the present disclosure may incorporate one or more 2’O-methyl, 2’O-MOE, and 2’F subunits and may use any of the subunit linkages described herein. In some cases, the antisense oligomer conjugates of the present disclosure may consist entirely of 2’O-methyl, 2’O-MOE, or 2’F subunits. One embodiment of the antisense oligomer conjugates of the present disclosure consists entirely of 2’O-methyl subunits.

[0101] 7. 2’-O-[2-(N-methylcarbamoyl)ethyl] oligomer (MCE) MCE is another example of a 2’O-modified ribonucleoside useful for the antisense oligomer conjugates of the present disclosure. Here, the 2’OH is derivatized with a 2-(N-methylcarbamoyl)ethyl moiety to increase nuclease resistance. Non-limiting examples of MCE oligomers are illustrated below:

Chemical formula

[0102] 8. Stereospecific oligomers A stereospecific oligomer is an oligomer in which the stereochemistry of each phosphite-containing bond is fixed by a synthetic method that yields a substantially stereochemically pure oligomer. Non-limiting examples of stereospecific oligomers are illustrated below: [Chemical formula]

[0103] In the above example, each phosphite of the oligomer has the same configuration. Other examples include the above oligomers. For example, LNA, ENA, tricyclic DNA, MCE, 2’O-methyl, 2’O-MOE, 2’-F and morpholino-based oligomers can be prepared by stereospecific phosphite-containing nucleoside internucleotide linkages such as phosphorothioate linkages, phosphodiester linkages, phosphoramidate linkages, phosphorodiamidate linkages or other phosphite-containing nucleoside internucleotide linkages. For stereospecific oligomers, the preparation methods used for such oligomers, chiral control synthesis, chiral design and chiral auxiliaries, see, for example, International Publication Nos. 2017192664, 2017192679, 2017062862, 2017015575, 2017015555, 2015107425, 2015108048, 2015108046, 2015108047, 2012039448, 2010064146, 2011034072, 2014010250, 2014012081, 20130127858 and 2011005761, which are hereby incorporated by reference in their entirety respectively.

[0104] A stereospecific oligomer has an R P configuration or an S PIt may have a phosphite-containing nucleoside internucleoside linkage in a steric configuration. A chiral phosphite-containing linkage with a controlled steric configuration of the linkage is referred to as "stereochemically pure", and a chiral phosphite-containing linkage with an uncontrolled steric configuration of the linkage is referred to as "stereochemically random". In certain embodiments, the oligomers of the present disclosure include a plurality of stereochemically pure linkages and stereochemically random linkages, and thus the resulting oligomers have stereochemically pure subunits at pre-specified positions of the oligomers. Examples of the positions of stereochemically pure subunits are described in FIGS. 7A and 7B of WO 2017 / 062862 (A2). In one embodiment, any chiral phosphite-containing linkages within the oligomer are stereochemically random. In one embodiment, any chiral phosphite-containing linkages within the oligomer are stereochemically pure.

[0105] In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), all n chiral phosphite-containing bonds in the oligomer are sterically random. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), all n chiral phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 10% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 20% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 30% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 40% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 50% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 60% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 70% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure. In one embodiment of an oligomer having n chiral phosphite-containing bonds (where n is an integer of 1 or more), at least 80% (rounded to the nearest integer) of the n phosphite-containing bonds in the oligomer are sterically pure.In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), at least 90% (rounded to the nearest integer) of the n phosphite-containing linkages in the oligomer are stereochemically pure.

[0106] In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 2 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S P configuration). In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 3 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S P configuration). In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 4 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S P configuration). In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 5 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S P configuration). In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 6 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S P configuration). In one embodiment of an oligomer having n chiral phosphite-containing linkages (where n is an integer of 1 or more), the oligomer has at least 6 consecutive stereochemically pure phosphite-containing linkages of the same stereoconfiguration (i.e., either the R P configuration or the S Pcontains at least 7 consecutive stereochemically pure phosphorous acid-containing bonds (any of the orientations). In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 8 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 9 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 10 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 11 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 12 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 13 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S Pcontains at least 14 consecutive stereochemically pure phosphorous acid-containing bonds (any of the orientations). In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 15 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 16 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 17 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 18 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 19 consecutive stereochemically pure phosphorous acid-containing bonds. In one embodiment of an oligomer having n chiral phosphorous acid-containing bonds (n is an integer of 1 or more), the oligomer has the same stereochemistry (i.e., R P orientation or S P orientation, any of them) and contains at least 20 consecutive stereochemically pure phosphorous acid-containing bonds.

[0107] 9. Morpholino oligomer Exemplary embodiments of the present disclosure relate to the following general structure described in FIG. 2 of Summerton, J. et al., Antisense & Nucleic Acid Drug Development, 7: 187-195 (1997): [Chemical formula] to phosphorodiamidate morpholino oligomers. The morpholinos described herein are intended to include all stereoisomers and tautomers of the above general structure. The synthesis, structure, and binding properties of morpholino oligomers are described in detail in U.S. Patent Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,521,063; 5,506,337; 8,076,476; and 8,299,206, and the above patents are incorporated herein by reference.

[0108] In certain embodiments, the morpholino is conjugated to a "tail" moiety at the 5' or 3' end of the oligomer to increase its stability and / or solubility. Exemplary tails include: [Chemical formula] among others.

[0109] In various embodiments, the antisense oligomer conjugate of the present disclosure is of formula (I): [Chemical formula] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together forms a targeting sequence; T is: [Chemical formula] a moiety selected from; R 1 is C 1 ~C6 is alkyl; The targeting sequence is complementary to the exon 51 annealing site of dystrophin pre-mRNA named H51A(+66+95).

[0110] In various embodiments, T is

Chemical formula

[0111] In various embodiments, R 1 is methyl, CF 3 , CCl 3 , CFCl 2 , CF 2 Cl, ethyl, CH 2 CF 3 , CF 2 CF 3 , propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl or 2,3-dimethylbutyl.

[0112] In some embodiments, the antisense oligomer conjugate of formula (I) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the.6HCl salt.

[0113] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U) and hypoxanthine (I).

[0114] In some embodiments, the targeting sequence is SEQ ID NO: 1 (5’-CTCCAACATCAAGGAAGATGGCATTTCTAG-3’), wherein each thymine (T) is uracil (U) as needed.

[0115] In various embodiments, T is

Chemical formula

[0116] In various embodiments, T is

Chemical formula

[0117] For example, in some embodiments including some embodiments of formula (I), the antisense oligomer conjugate of the present disclosure is of formula (II)

Chemical formula

[0118] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0119] In various embodiments, each Nu from 1 to 30 and 5’ to 3’ is (SEQ ID NO: 1):

Table 1

Chemical formula

Chemical formula

[0120] In some embodiments, the antisense oligomer conjugate of formula (II) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the.6HCl salt.

[0121] For example, in some embodiments including some embodiments of formula (II), the antisense oligomer conjugate of the present disclosure has formula (IIA): [Chem.] wherein each Nu is a nucleobase that together forms a targeting sequence complementary to the exon 51 annealing site of dystrophin pre-mRNA designated as H51A(+66+95).

[0122] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0123] In various embodiments, each Nu from 1 to 30 and 5' to 3' is (SEQ ID NO: 1): [Table 2] wherein A is [Chem.] and C is [Chemical formula] and G is [Chemical formula] and X is [Chemical formula] In certain embodiments, each X is [Chemical formula] .

[0124] In some embodiments, including embodiments of the antisense oligomer conjugates of Formula (II) and Formula (IIA), the targeting sequence is SEQ ID NO: 1 (5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3'), wherein each thymine (T) is uracil (U) as needed. In various embodiments, including embodiments of the antisense oligomer conjugates of Formula (II) and Formula (IIA), the targeting sequence is SEQ ID NO: 1 (5'-CTCCAACATCAAGGAAGATGGCATTTCTAG-3').

[0125] In some embodiments, including embodiments of the antisense oligomer conjugates of Formula (I), the antisense oligomer conjugates of the present disclosure are of Formula (III): [Chemical formula] or a pharmaceutically acceptable salt thereof.

[0126] In some embodiments, the antisense oligomer conjugate of Formula (III) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the.6HCl salt.

[0127] In some embodiments, including embodiments of the antisense oligomer conjugate of formula (III), the antisense oligomer conjugate of the present disclosure is of formula (IIIA):

Chemical formula

[0128] In some embodiments of the antisense oligomer conjugate of formula (I) and some embodiments of the present disclosure including embodiments of the antisense oligomer conjugate of formula (III), the antisense oligomer conjugate is of formula (IV):

Chemical formula

[0129] In some embodiments, the antisense oligomer conjugate of formula (IV) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is the.6HCl salt.

[0130] In some embodiments, including embodiments of the antisense oligomer conjugate of formula (IV), the antisense oligomer conjugate of the present disclosure is of formula (IVA):

Chemical formula

[0131] 10. Modification and substitution of nucleobases In certain embodiments, the antisense oligomer conjugates of the present disclosure consist of RNA nucleobases and DNA nucleobases (often simply referred to as "bases" in the art). RNA bases are generally known as adenine (A), uracil (U), cytosine (C), and guanine (G). DNA bases are generally known as adenine (A), thymine (T), cytosine (C), and guanine (G). In various embodiments, the antisense oligomer conjugates of the present disclosure consist of cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).

[0132] In certain embodiments, one or more of the RNA or DNA bases in the oligomer can be modified or replaced with bases other than RNA or DNA bases. Examples of oligomers containing modified or replaced bases include oligomers in which one or more of the most common purine or pyrimidine bases found in nucleic acids are replaced with rare or unnatural bases.

[0133] Purine bases have the following general formula:

Chemical formula

[0134] Pyrimidine bases have the following general formula:

Chemical formula

[0135] Other suitable bases include, but are not particularly limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g., 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine or its derivatives; N 2 -cyclopentylguanine (cPent-G), N 2 -cyclopentyl-2-aminopurine (cPent-AP), and N 2-propyl-2-aminopurine (Pr-AP), pseudouracil or its derivatives; and degenerate bases such as 2,6-difluorotoluene or universal bases or abasic sites such as abasic bases (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences), which is incorporated herein by reference in its entirety. cPent-G, cPent-AP and Pr-AP have been shown to reduce the immunostimulatory effect when incorporated into siRNA (Peacock H. et al., J. Am. Chem. Soc. 2011, 133, 9200). Pseudouracil is a naturally occurring isomeric form of uracil that has a C-glycoside like uridine rather than a normal N-glycoside. Synthetic mRNAs containing pseudouridine can have an improved safety profile compared to mRNAs containing uridine (International Publication No. 2009127230, which is incorporated herein by reference in its entirety).

[0136] Certain nucleobases are particularly useful for increasing the binding affinity of the antisense oligomer conjugates of the present disclosure. Such include 2-aminopropyladenine, 5-propynyluracil, and 5-substituted pyrimidines including 5-propynylcytosine, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines. 5-Methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes by 0.6 - 1.2 °C and is a preferred, and more particularly preferred, base substitution in combination with 2'-O-methoxyethyl sugar modification. Further exemplary modified nucleobases include those in which at least one hydrogen atom of the nucleobase is replaced by fluorine.

[0137] 11. Pharmaceutically Acceptable Salts of Antisense Oligomer Conjugates Certain embodiments of the antisense oligomer conjugates described herein may contain basic functional groups such as amino or alkylamino and can thus form pharmaceutically acceptable salts with pharmaceutically acceptable acids. In this regard, the term “pharmaceutically acceptable salts” refers to relatively non-toxic inorganic or organic acid addition salts of the antisense oligomer conjugates of the present disclosure. These salts can be prepared in situ during the manufacturing process of the dosage form or administration medium, or alternatively, by reacting the purified free base form of the antisense oligomer conjugates of the present disclosure with a suitable organic or inorganic acid and separating the thus formed salt in a purification process. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and laurylsulfonate, among others. (See, e.g., Berge et al., (1977) “Pharmaceutical Salts”, J. Pharm. Sci. 66:1-19).

[0138] Pharmaceutically acceptable salts of the subject antisense oligomer conjugates include conventional non-toxic salts or quaternary ammonium salts of the antisense oligomer conjugates, such as salts derived from non-toxic organic or inorganic acids. For example, such conventional non-toxic salts include salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, etc.; and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isothionic acid, etc.

[0139] In certain embodiments, the antisense oligomer conjugates of the present disclosure can include one or more acidic functional groups and, thus, can form pharmaceutically acceptable salts with pharmaceutically acceptable bases. In this case, the term "pharmaceutically acceptable salts" refers to relatively non-toxic inorganic and organic base addition salts of the antisense oligomer conjugates of the present disclosure. These salts can likewise be prepared in situ in the manufacturing process of the dosage form or administration vehicle or, alternatively, by reacting the purified free acid form of the antisense oligomer conjugate with a suitable base such as a hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, ammonia, or a pharmaceutically acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include lithium salts, sodium salts, potassium salts, calcium salts, magnesium salts and aluminum salts, among others. Representative organic amines useful in the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. (See, e.g., Berge et al., supra).

[0140] III. Formulations and Modes of Administration In certain embodiments, the present disclosure provides formulations or pharmaceutical compositions suitable for the therapeutic delivery of the antisense oligomer conjugates described herein. Thus, in certain embodiments, the present disclosure provides a pharmaceutically acceptable composition comprising a therapeutically effective amount of one or more of the antisense oligomer conjugates described herein formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents. Although it is possible to administer the antisense oligomer conjugates of the present disclosure alone, it is preferred to administer the antisense oligomer conjugates as a pharmaceutical formulation (composition). In one embodiment, the antisense oligomer conjugate of the formulation is according to formula (III).

[0141] Regarding methods for delivering nucleic acid molecules that can be applied to the antisense oligomer conjugates of the present disclosure, see, for example, Akhtar et al., 1992, Trends Cell Bio., 2:139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed., Akhtar 1995, CRC Press; and Sullivan et al., International Publication No. 94 / 02595. These and other protocols can be used for delivering substantially any nucleic acid molecule, including the antisense oligomer conjugates of the present disclosure.

[0142] The pharmaceutical compositions of the present disclosure can be formulated for administration, in particular, in solid or liquid forms, including those adapted for the following: (1) oral administration, for example, aqueous solutions (aqueous or non-aqueous solutions or suspensions), tablets (for buccal, sublingual, or systemic absorption), boluses, powders, granules, pastes applied to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous, or epidural injection or sustained-release formulations as sterile solutions or suspensions; (3) topical application, for example, as creams, ointments, or controlled-release patches or sprays applied to the skin; (4) intravaginal or intrarectal, for example, as pessaries, creams, or foams; (5) sublingual; (6) ocular; (7) transdermal; or (8) nasal.

[0143] Some examples of materials that can serve as pharmaceutically acceptable carriers include, but are not limited to: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) talc; (8) vehicles such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols such as propylene glycol; (11) polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffering solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; and (22) other non-toxic and compatible substances used in pharmaceutical formulations.

[0144] Non-limiting examples of other agents suitable for formulation with the antisense oligomer conjugates of the present disclosure include: PEG-conjugated nucleic acids that can facilitate the entry of drugs into various tissues; lipid-conjugated nucleic acids; nucleic acids containing lipophilic moieties; phosphorothioates; P-glycoprotein inhibitors (such as Pluronic P85); biodegradable polymers, such as poly(D,L-lactide-coglycolide) microspheres for sustained release after implantation (Emerich, D F et al., 1999, Cell Transplant, 8, 47-58) (Alkermes, Cambridge, Massachusetts), etc.; and loaded nanoparticles that can deliver drugs across the blood-brain barrier and can alter the uptake mechanism by neurons, such as those made of polybutylcyanoacrylate (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999), etc.

[0145] The present disclosure also features the use of compositions comprising surface-modified liposomes containing poly(ethylene glycol) (“PEG”) lipids (PEG-modified, branched and unbranched or combinations thereof, or long-circulating liposomes or stealth liposomes). The oligomer conjugates of the present disclosure may also include PEG molecules of various molecular weights covalently attached. These formulations provide a means to increase the accumulation of drugs in target tissues. This class of drug carriers is resistant to opsonization and removal by the mononuclear phagocyte system (MPS or RES), thereby extending the blood circulation time of the encapsulated drug and increasing its exposure to tissues (Lasic et al., Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in angiogenic target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). Long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA compared to conventional cationic liposomes, which are known to accumulate particularly in MPS tissues (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., WO 96 / 10391; Ansell et al., WO 96 / 10390; Holland et al., WO 96 / 10392). Based on the ability of long-circulating liposomes to avoid accumulation in metabolically active MPS tissues such as the liver and spleen, it is also possible that they are more effective than cationic liposomes in protecting drugs from nuclease degradation.

[0146] In further embodiments, the disclosure includes antisense oligomer conjugate pharmaceutical compositions prepared for delivery as described in U.S. Patent Nos. 6,692,911; 7,163,695; and 7,070,807. In this regard, in one embodiment, the disclosure provides the antisense oligomer conjugate of the disclosure in the form of a composition comprising a copolymer of lysine and histidine (HK) (described in U.S. Patent Nos. 7,163,695; 7,070,807; and 6,692,911) alone, or in combination with PEG (e.g., branched or unbranched PEG or a mixture of both), in combination with PEG and a targeting moiety, or in combination with a crosslinking agent. In certain embodiments, the disclosure provides the antisense oligomer conjugate in the form of a pharmaceutical composition comprising gluconic acid-modified polyhistidine or glucosylated polyhistidine / transferrin-polylysine. Those skilled in the art will also recognize that amino acids with properties similar to His and Lys can be substituted within the composition.

[0147] Wetting agents, emulsifying agents and lubricants such as sodium lauryl sulfate and magnesium stearate and coloring agents, releasing agents, coating agents, sweetening agents, flavoring agents and perfuming agents, preservatives, and antioxidants may be present in the composition.

[0148] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.

[0149] The formulations of the present disclosure include formulations suitable for oral administration, nasal administration, topical (including buccal and sublingual) administration, rectal administration, vaginal administration and / or parenteral administration. The formulations may conveniently be provided in unit dosage form and may be prepared by any method well known in the pharmaceutical art. The amount of the active ingredient that can be combined with the carrier material to produce a single dosage form may vary depending on the subject to be treated and the specific mode of administration. The amount of the active ingredient that can be combined with the carrier material to produce a single dosage form will generally be the amount of the active ingredient that produces a therapeutic effect. This amount will generally range from about 0.1 percent to about 99 percent of the active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

[0150] In certain embodiments, the formulations of the present disclosure include an excipient selected from cyclodextrin, cellulose, liposome, micelle former, such as bile acid, and polymeric carrier, such as polyester and polyanhydride; and an antisense oligomer conjugate of the present disclosure. In one embodiment, the antisense oligomer conjugate of the formulation is according to formula (III). In certain embodiments, the above formulations are those that make the antisense oligomer conjugate of the present disclosure orally bioavailable.

[0151] The methods of preparing these formulations and pharmaceutical compositions include combining the antisense oligomer conjugate of the present disclosure with a carrier and optionally one or more auxiliary components. The formulations are generally prepared by uniformly and intimately combining the antisense oligomer conjugate of the present disclosure with a liquid carrier or a micronized solid carrier or both, and then shaping the product if necessary.

[0152] The formulations of the present disclosure suitable for oral administration can be in the form of capsules, cachets, pills, tablets, troches (flavored bases, usually using sucrose and gum arabic or tragacanth), powders, granules, or solutions or suspensions using aqueous or non-aqueous liquids, or water-in-oil or oil-in-water liquid emulsions, or elixirs or syrups, or pastilles (using inert bases such as gelatin and glycerin or sucrose and gum arabic) and / or mouthwashes, etc., each containing a predetermined amount of the antisense oligomer conjugate of the present disclosure as an active ingredient. The antisense oligomer conjugate of the present disclosure may be administered as a bolus, lozenge or paste.

[0153] In the solid dosage forms (capsules, tablets, pills, dragees, powders, granules, trouches, etc.) for oral administration of the present disclosure, the active ingredient is mixed with one or more pharmaceutically acceptable carriers such as sodium citrate or dibasic calcium phosphate and / or any of the following: (1) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol and / or silicic acid, etc.; (2) binders such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and / or gum arabic, etc.; (3) humectants such as glycerol; (4) disintegrants such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate, etc.; (5) dissolution retardants such as paraffin; (6) absorption promoters such as quaternary ammonium compounds and surfactants such as poloxamer and sodium lauryl sulfate; (7) wetting agents such as cetyl alcohol, glycerol monostearate and nonionic surfactants, etc.; (8) adsorbents such as kaolin and bentonite clay; (9) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid and mixtures thereof, etc.; (10) coloring agents; and (11) release control agents such as crospovidone or ethyl cellulose. In the case of capsules, tablets and pills, the pharmaceutical composition may also contain a buffering agent. Solid pharmaceutical compositions of the same type may also be used as fillers in soft and hard shell gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol, etc.

[0154] Tablets can be prepared by compression or molding, optionally with one or more auxiliary components. Compressed tablets can be prepared using a binder (e.g., gelatin or hydroxypropyl methylcellulose), a lubricant, an inert diluent, a preservative, a disintegrant (e.g., sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), a surfactant or a dispersing agent. Molded tablets can be prepared by molding a mixture of the powdered and inert liquid-diluted compound with a suitable machine.

[0155] Tablets and other solid dosage forms of the pharmaceutical compositions of the present disclosure, such as dragees, capsules, pills and granules, etc., can be formulated, if necessary, with a scored line or with coating agents and shells, such as enteric coating agents and other coating agents well-known in the pharmaceutical formulation art. They can be prepared, for example, using various proportions of hydroxypropyl methylcellulose, other polymer matrices, liposomes and / or microspheres such that sustained or controlled release of the active ingredient therein is effected to obtain the desired release profile. They can be formulated for immediate release, for example by lyophilization. They can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating a sterilizing agent in the form of a sterile solid pharmaceutical composition that can be dissolved in sterile water or some other sterile injection medium immediately before use. These pharmaceutical compositions may optionally contain an opacifying agent and may also be compositions in which the active ingredient(s) is / are released, optionally with a delay, alone or preferentially, in a specific part of the digestive tract. Examples of embedding compositions that can be used include polymeric substances or waxes. The active ingredient may be in microencapsulated form, optionally containing one or more of the excipients described above.

[0156] Examples of liquid dosage forms for oral administration of the antisense oligomer conjugates of the present disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage form may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan fatty acid esters and mixtures thereof.

[0157] In addition to the inert diluent, the oral pharmaceutical composition may also contain adjuvants, such as wetting agents, emulsifiers, and suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents, and preservatives.

[0158] In addition to the active compound, the suspension may contain suspending agents, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth and mixtures thereof.

[0159] Formulations for rectal or vaginal administration may be provided as suppositories, which may be prepared by mixing one or more compounds of the present disclosure with one or more suitable non-irritating excipients or carriers, such as cocoa butter, polyethylene glycol, suppository wax, or salicylate, which are solid at room temperature but liquid at body temperature and thus melt in the rectal or vaginal cavity to release the active compound.

[0160] Formulations or dosage forms for local or transdermal administration of the oligomers provided herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active oligomer conjugate can be mixed under aseptic conditions with a pharmaceutically acceptable carrier and any preservatives, buffers or propellants that may be required. Ointments, pastes, creams and gels can contain, in addition to the active compounds of the present disclosure, excipients such as animal and vegetable fats, oils, waxes, paraffins, starches, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc and zinc oxide or mixtures thereof.

[0161] Powders and sprays can contain, in addition to the antisense oligomer conjugate of the present disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate and polyamide powder or mixtures of the above substances. Sprays can further contain conventional propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane.

[0162] Transdermal patches have the additional advantage of providing controlled delivery of the antisense oligomer conjugate of the present disclosure into the body. Such dosage forms can be prepared by dissolving or dispersing the oligomer in a suitable medium. An absorption enhancer can be used to increase the flux of the drug through the skin. Such flux rates can be controlled, among other methods known in the art, by providing a rate controlling membrane or by dispersing the drug in a polymer matrix or gel.

[0163] A pharmaceutical composition suitable for parenteral administration may comprise one or more of the oligomer conjugates of the present disclosure and one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders that can be reconstituted into sterile injectable solutions or dispersions immediately prior to use and that may contain sugars, alcohols, antioxidants, buffers, bacteriostatic agents, solutes that render the formulation isotonic with the blood of the intended beneficiary, or suspending or thickening agents. Examples of suitable aqueous or non-aqueous carriers that may be used in the pharmaceutical compositions of the present disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Suitable fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In one embodiment, the antisense oligomer conjugate of the pharmaceutical composition is according to formula (III).

[0164] These pharmaceutical compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms on the oligomer conjugate of interest can be ensured by including various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol sorbic acid, etc. It may also be desirable to include isotonic agents such as sugars, sodium chloride, etc. in the composition. Furthermore, sustained absorption of the injectable pharmaceutical form can be achieved by including substances that delay absorption, such as aluminum monostearate and gelatin, etc.

[0165] In some cases, it is desirable to reduce the absorption rate of a drug from subcutaneous or intramuscular injection in order to sustain the effect of the drug. This can be achieved, among other methods known in the art, by using a liquid suspension of a crystalline or amorphous substance with low solubility in water. For this reason, the absorption rate of a drug can be affected by its dissolution rate, and in turn, can be affected by the crystal size and crystal form. Alternatively, a delayed absorption of the parenteral drug form can be achieved by dissolving or suspending the drug in an oily medium.

[0166] An injectable depot dosage form can be prepared by forming a microencapsulation matrix of the target oligomer conjugate with a biodegradable polymer such as polylactide-polyglycolide. The release rate of the oligomer can be controlled according to the ratio of the oligomer to the polymer and the properties of the specific polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). The depot injection preparation may also be prepared by encapsulating the drug in liposomes or microemulsions that are compatible with body tissues.

[0167] When the antisense oligomer conjugate of the present disclosure is administered to humans and animals as a pharmaceutical, it can be administered itself or as a pharmaceutical composition containing the antisense oligomer conjugate, for example, in an amount of 0.1 to 99% (more preferably 10 to 30%), together with a pharmaceutically acceptable carrier.

[0168] The formulations or preparations of the present disclosure can be administered orally, parenterally, topically, or rectally. Usually, they are administered in a form suitable for each administration route. For example, they are administered in tablet or capsule form, by injection, inhalation, eye drops, ointment, suppository, or infusion; topically by lotion or ointment; or rectally by suppository.

[0169] Regardless of the selected route of administration, the antisense oligomer conjugates of the present disclosure and / or the pharmaceutical compositions of the present disclosure that can be used in an appropriate hydrated form can be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient in the pharmaceutical compositions of the present disclosure can be varied to an amount of the active ingredient that is effective to obtain the desired therapeutic response without exhibiting unacceptable toxicity to the patient, in a specific patient, composition, and mode of administration.

[0170] The selected dosage level will depend on various factors including the activity of the specific antisense oligomer conjugate of the present disclosure or its ester, salt, or amide used, the route of administration, the time of administration, the rate of excretion or metabolism of the specific oligomer used, the rate and extent of absorption, the duration of treatment, other drugs, compounds, and / or materials used in combination with the specific oligomer being used, the age, sex, weight, physical condition, general health status, and previous medical history of the patient being treated, as well as similar factors well known in the medical arts.

[0171] A physician or veterinarian having ordinary skill can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, it is contemplated that the physician or veterinarian start with a dosage of the antisense oligomer conjugate of the present disclosure used in the pharmaceutical composition at a level lower than that required to obtain the desired therapeutic effect and increase the dosage gradually until the desired effect is obtained. The appropriate daily dosage of the antisense oligomer conjugate of the present disclosure will generally be the amount of the antisense oligomer conjugate that is the minimum dosage effective to obtain some therapeutic effect. Such effective amount will generally depend on the factors described herein. When used to obtain the required effect, the oral, intravenous, intraventricular, and subcutaneous dosages of the antisense oligomer conjugate of the present disclosure to a patient will generally be in the range of about 0.0001 to about 100 mg per kilogram of body weight per day.

[0172] In some embodiments, the antisense oligomer conjugates of the present disclosure are generally administered at a dose of about 10-160 mg / kg or 20-160 mg / kg. In some cases, doses exceeding 160 mg / kg may be required. In some embodiments, the dose for i.v. administration is about 0.5 mg to 160 mg / kg. In some embodiments, the antisense oligomer conjugate is administered at a dose of about 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg or 10 mg / kg. In some embodiments, the antisense oligomer conjugate is administered at a dose of about 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, 160 mg / kg, including any integer in between. In some embodiments, the oligomer is administered at 10 mg / kg. In some embodiments, the oligomer is administered at 20 mg / kg. In some embodiments, the oligomer is administered at 30 mg / kg. In some embodiments, the oligomer is administered at 40 mg / kg. In some embodiments, the oligomer is administered at 60 mg / kg.In some embodiments, the oligomer is administered at 80 mg / kg. In some embodiments, the oligomer is administered at 160 mg / kg. In some embodiments, the oligomer is administered at 50 mg / kg.

[0173] In some embodiments, the antisense oligomer conjugate of formula (III) is generally administered at a dose of about 10 - 160 mg / kg or 20 - 160 mg / kg. In some embodiments, the dose for i.v. administration of the antisense oligomer conjugate of formula (III) is about 0.5 mg - 160 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at a dose of about 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg or 10 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at a dose of about 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, 160 mg / kg, including all integers in between. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 10 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 20 mg / kg.In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 30 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 40 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 60 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 80 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 160 mg / kg. In some embodiments, the antisense oligomer conjugate of formula (III) is administered at 50 mg / kg.

[0174] Optionally, the effective daily amount of the active compound can be administered separately at appropriate intervals throughout the day in two, three, four, five, six or more sub-doses in unit dosage form as needed. In certain circumstances, the administration is a single administration per day. In certain embodiments, the administration is once every two days, three days, four days, five days, six days, seven days, eight days, nine days, ten days, eleven days, twelve days, thirteen days, fourteen days, or once a week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, ten weeks, eleven weeks, twelve weeks or once a month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months as needed to maintain the desired functional dystrophin protein expression. In certain embodiments, the administration is one or more administrations once every two weeks. In some embodiments, the administration is one administration once every two weeks. In various embodiments, the administration is one or more administrations once a month. In certain embodiments, the administration is a single administration per month.

[0175] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg weekly. As used herein, weekly is understood to have the meaning of weekly as recognized in the art.

[0176] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every other week. As used herein, every other week is understood to have the meaning of every other week as recognized in the art.

[0177] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every three weeks. As used herein, every three weeks is understood to mean once every three weeks as recognized in the art.

[0178] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg monthly. As used herein, monthly is understood to mean monthly as recognized in the art.

[0179] As understood in the art, weekly, bi-weekly, every three weeks or monthly administrations can be single or multiple administrations or one or more sub-doses as discussed herein.

[0180] The nucleic acid molecules and antisense oligomer conjugates described herein can be administered to cells by a variety of methods well known to those of skill in the art, including, but not limited to, encapsulation in liposomes, by electroporation, or by incorporation into hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres and other vehicles described herein and known in the art. In certain embodiments, microemulsification techniques can be used to improve the bioavailability of lipophilic (water-insoluble) pharmaceuticals. Examples include Trimetrine (Dordunoo, S.K. et al., Drug Development and Industrial Pharmacy, 17(12), 1685-1713, 1991) and REV5901 (Sheen, P.C. et al., J Pharm Sci 80(7), 712-714, 1991). In particular, microemulsification increases bioavailability by preferentially absorbing into the lymphatic system instead of the circulatory system, thereby bypassing the liver and preventing destruction of the compound during enterohepatic circulation.

[0181] In one aspect of the disclosure, the formulation contains micelles formed from the oligomers provided herein and at least one amphiphilic carrier, the micelles having an average diameter of less than about 100 nm. In a more preferred embodiment, micelles having an average diameter of less than about 50 nm are provided, and in an even more preferred embodiment, micelles having an average diameter of less than about 30 nm or in some cases less than about 20 nm are provided.

[0182] All suitable amphiphilic carriers are contemplated, but currently preferred carriers generally have Generally-Recognized-as-Safe (GRAS) status, solubilize the antisense oligomer conjugates of the present disclosure, and microemulsify the antisense oligomer conjugates when the solution contacts a complex aqueous phase (such as those found in the human gastrointestinal tract) at a later stage. Amphiphilic components that meet these requirements typically have a hydrophilic-lipophilic balance (HLB) value of 2 to 20 and contain linear aliphatic radicals in the range of C-6 to C-20 in their structure. Examples include polyethylene glycolated fatty glycerides and polyethylene glycols.

[0183] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycolated fatty acid glycerides, such as those obtained from various vegetable oils that are fully hydrogenated or partially hydrogenated. Such oils consist of triglycerides, diglycerides, and monoglycerides of fatty acids, and dipoly(ethylene glycol) esters and monopoly(ethylene glycol) esters of the corresponding fatty acids, and are advantageously in that they have a particularly preferred fatty acid composition containing 4-10% capric acid, 3-9% capric acid, 40-50% lauric acid, 14-24% myristic acid, 4-14% palmitic acid, and 5-15% stearic acid. Another useful class of amphiphilic carriers includes sorbitan and / or sorbitol (SPAN series) partially esterified with saturated or monounsaturated fatty acids and / or their ethoxylated analogs corresponding thereto (TWEEN series).

[0184] Commercially available amphiphilic carriers, including Gelucire series, Labrafil, Labrasol or Lauroglycol (all manufactured and distributed by Gattefosse of Saint-Priest, France), PEG-mono-oleate, PEG-di-oleate, PEG-mono-laurate and di-laurate, lecithin, polysorbate 80, etc. (manufactured and distributed by numerous companies in the United States and the world), may be particularly useful.

[0185] In certain embodiments, to introduce the pharmaceutical compositions of the present disclosure into suitable host cells, delivery can be effected by use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like. Specifically, to deliver the pharmaceutical compositions of the present disclosure, it can be formulated by encapsulating it in any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, and the like. Formulation and the use of such delivery media can be carried out using known prior art.

[0186] Hydrophilic polymers suitable for use in the present disclosure are readily water-soluble, can covalently bond to lipids that form vesicles, have no toxic effects and are tolerated in vivo (i.e., are biocompatible). Suitable polymers include poly(ethylene glycol) (PEG), poly(lactic acid) (also called polylactide), poly(glycolic acid) (also called polyglycolide), polylactic acid-polyglycolic acid copolymers, and polyvinyl alcohol. In certain embodiments, the polymer has a weight average molecular weight of from about 100 or 120 Daltons to about 5,000 or 10,000 Daltons, or from about 300 Daltons to about 5,000 Daltons. In other embodiments, the polymer has a weight average molecular weight of from about 100 to about 5,000 Daltons or is a poly(ethylene glycol) having a weight average molecular weight of from about 300 to about 5,000 Daltons. In certain embodiments, the polymer is a poly(ethylene glycol) having a weight average molecular weight of about 750 Daltons, such as PEG(750). A polymer can also be defined by the number of monomers contained therein; in preferred embodiments of the present disclosure, a polymer consisting of at least about 3 monomers is used, and such a PEG polymer consisting of 3 monomers has a molecular weight of about 132 Daltons.

[0187] Other hydrophilic polymers that may be suitable for use in the present disclosure include polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.

[0188] In certain embodiments, the formulations of the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolide, polysiloxanes, polyurethanes and their co-polymers, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylate, and blends, mixtures or co-polymers thereof.

[0189] Cyclodextrins are cyclic oligosaccharides consisting of 6, 7, or 8 glucose units and are named with the Greek letters α, β, or γ, respectively. The glucose units are linked by α-1,4-glucoside bonds. Because the sugar units are in a chair conformation, all of the secondary hydroxyl groups (at C-2 and C-3) are located on one side of the ring, and all of the primary hydroxyl groups at C-6 are located on the other side. As a result, the outer surface becomes hydrophilic, making cyclodextrin water-soluble. In contrast, the cavity of cyclodextrin is hydrophobic because it is covered by the hydrogens and ether-like oxygens of the C-3 and C-5 atoms. These matrices enable complex formation with a variety of relatively hydrophobic compounds, including steroid compounds such as 17α-estradiol (see, for example, van Uden et al., Plant Cell Tiss. Org. Cult. 38:1-3-113 (1994)). Complex formation occurs through van der Waals interactions and hydrogen bond formation. For an overview of the chemical properties of cyclodextrins, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994).

[0190] The physicochemical properties of cyclodextrin derivatives are greatly influenced by their type and degree of substitution. For example, their solubility in water ranges from insoluble (e.g., triacetyl-β-cyclodextrin) to 147% soluble (w / v) (G-2-β-cyclodextrin). Furthermore, they are soluble in many organic solvents. This property of cyclodextrin makes it possible to control the solubility of various pharmaceutical ingredients by increasing or decreasing its solubility.

[0191] Numerous descriptions of cyclodextrins and their preparation methods exist. For example, Parmeter (I) et al. (U.S. Patent No. 3,453,259) and Gramera et al. (U.S. Patent No. 3,459,731) describe electrically neutral cyclodextrins. Other derivatives include cyclodextrins with cationic properties [Parmeter (II), U.S. Patent No. 3,453,257], insoluble cross-linked cyclodextrins (Solms, U.S. Patent No. 3,420,788), and cyclodextrins with anionic properties [Parmeter (III), U.S. Patent No. 3,426,011]. Examples of cyclodextrin derivatives with anionic properties include those obtained by adding carboxylic acid, phosphorous acid, phosphinic acid, phosphonic acid, phosphoric acid, thiophosphonic acid, thiosulfinic acid, and sulfonic acid to the parent cyclodextrin [Parmeter (III), see above]. Furthermore, sulfoalkyl ether cyclodextrin derivatives have been described by Stella et al. (U.S. Patent No. 5,134,127).

[0192] Liposomes consist of at least one lipid bilayer membrane surrounding an aqueous internal compartment. Liposomes can be characterized by the type and size of the membrane. Small unilamellar vesicles (SUVs) have a single membrane and usually have a diameter in the range of 0.02 - 0.05 μm; large unilamellar vesicles (LUVs) are usually larger than 0.05 μm. Oligolamellar large vesicles and multilamellar vesicles usually have multiple concentric membrane layers and are usually larger than 0.1 μm. Liposomes with multiple non-concentric membranes, i.e., those containing multiple smaller vesicles within a larger vesicle, are called multivesicular vesicles.

[0193] One aspect of the present disclosure relates to a formulation in which a liposome containing an antisense oligomer conjugate of the present disclosure is formulated such that a liposome with increased transport ability is obtained. Alternatively, or in addition, the antisense oligomer conjugate of the present disclosure may be included in the liposome bilayer of the liposome or adsorbed on the liposome bilayer. The antisense oligomer conjugate of the present disclosure may be aggregated with a lipid surfactant and transported into the internal space of the liposome; in such a case, the liposome membrane is formulated to be resistant to the disruptive action of the active agent-surfactant aggregate.

[0194] In one embodiment of the present disclosure, lipids derivatized with poly(ethylene glycol) (PEG) are included in the lipid bilayer of the liposome such that the PEG chains extend into the internal space surrounded by the liposome from the inner surface of the lipid bilayer and extend into the surrounding environment from the outside of the lipid bilayer.

[0195] The active agent contained in the liposome of the present disclosure is in solubilized form. Aggregates of a surfactant and an active agent (such as an emulsion or micelle containing the active agent of interest) may be encapsulated within the internal space of the liposome according to the present disclosure. The surfactant exhibits the action of dispersing and solubilizing the active agent and may be selected from any suitable aliphatic, alicyclic or aromatic surfactant, including biocompatible lysophosphatidylcholine (LPG) with various chain lengths (e.g., about C14 to about C20), although not particularly limited. Polymer-derivatized lipids such as PEG lipids exhibit the action of inhibiting micelle / membrane fusion and can also be used for micelle formation because the addition of the polymer to the surfactant molecule decreases the CMC of the surfactant and promotes micelle formation. Preferred are surfactants having a CMO within the micromolar range, but micelles encapsulated within the liposome of the present disclosure may also be prepared using surfactants with a higher CMC.

[0196] The liposomes according to the present disclosure can be prepared by any of a variety of techniques known in the art. For example, see U.S. Patent No. 4,235,871; International Publication No. 96 / 14057; New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pages 33-104; and Lasic DD, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, the liposomes of the present disclosure can be prepared by dispersing lipids derivatized with a hydrophilic polymer in a pre-formed liposome at a lipid concentration corresponding to the final molar percentage of the desired derivatized lipid in the liposome, such as by exposing the pre-formed liposome to micelles composed of lipid-grafted polymers. Liposomes containing a hydrophilic polymer can also be formed by homogenization techniques, lipid region hydration techniques, or extrusion techniques known in the art.

[0197] In yet another exemplary formulation method, first, the active agent is dispersed by sonication in lysophosphatidylcholine or other low CMC surfactants (including polymer-grafted lipids) that readily solubilize hydrophobic molecules. Then, the resulting micellar suspension of the active agent is used to rehydrate a dry lipid sample containing an appropriate molar percentage of polymer-grafted lipid or cholesterol. Then, the suspension of lipid and active agent is made into liposomes using extrusion techniques known in the art, and the resulting liposomes are separated from the unencapsulated solution by standard column chromatography.

[0198] In one aspect of the present disclosure, liposomes are prepared to have a substantially uniform size within a selected size range. In one effective sizing method, an aqueous suspension of liposomes is extruded through a series of polycarbonate membranes having a selected uniform pore size; the pore size of the membrane approximately corresponds to the maximum size of the liposomes obtained by extrusion through the membrane. See, for example, U.S. Patent No. 4,737,323 (April 12, 1988). In certain embodiments, reagents such as DharmaFECT® and Lipofectamine® can be used to introduce polynucleotides or proteins into cells.

[0199] The release characteristics of the formulations of the present disclosure depend on the encapsulating material, the concentration of the encapsulated drug, and the presence of the release regulator. For example, the release can be manipulated to be pH-dependent using a pH-sensitive coating agent that releases only at a low pH such as in the stomach or a high pH such as in the intestine. An enteric coating agent can be used to prevent release until it passes through the stomach. A mixture of multiple coating agents or cyanamide encapsulated in various materials can be used to release first in the stomach and then in the intestine. The release can also be manipulated by including a salt or pore-forming agent that can increase the release of the drug by water uptake or diffusion from the capsule. The release rate can also be controlled using an excipient that regulates the solubility of the drug. An agent that promotes the degradation of the matrix or release from the matrix can also be incorporated. These can be added to the drug, either as a compound, as a separate phase (i.e., as fine particles), or co-dissolved in the polymer phase, depending on the compound. In most cases, the amount should be 0.1 to 30 percent (w / w polymer). Types of degradation promoters include inorganic salts such as ammonium sulfate and ammonium chloride, organic acids such as citric acid, benzoic acid, and ascorbic acid, inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide, and organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine, as well as surfactants such as Tween® and Pluronic®. A pore-forming agent that gives a microstructure to the matrix (i.e., water-soluble compounds such as inorganic salts and sugars) is added as fine particles. The range is usually 1 to 30 percent (w / w polymer).

[0200] Uptake can also be manipulated by varying the residence time of the particles within the digestive tract. This can be achieved, for example, by coating the particles with a mucoadhesive polymer or by selecting a mucoadhesive polymer as the encapsulating material. Examples include most polymers having free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (as used herein, polyacrylates refer to polymers including acrylate groups and modified acrylate groups such as cyanoacrylate and methacrylate).

[0201] Antisense oligomer conjugates can be formulated to fit within a surgical or medical device or implant, or adapted to be released by a surgical or medical device or implant. In certain embodiments, the implant can be coated with an antisense oligomer conjugate or otherwise treated with an antisense oligomer conjugate. For example, the implant can be coated with a pharmaceutical composition of the present disclosure using a hydrogel or other polymer, such as a biocompatible polymer and / or a biodegradable polymer (i.e., by using a hydrogel or other polymer, the composition can be adapted for use in a medical device). Polymers and copolymers for coating medical devices with drugs are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, artificial organs, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, pacemakers, implantable defibrillators, IV needles, pins, screws, plates, and other devices for bone fixation and formation, as well as other devices and artificial tissue matrices for wound healing.

[0202] In addition to the methods provided herein, the antisense oligomer conjugates used in accordance with the present disclosure can be formulated for administration in any manner convenient for use in human or veterinary medicine, similar to other pharmaceuticals. The antisense oligomer conjugates and their corresponding formulations can be administered alone or in combination with other therapeutic strategies for treating muscular dystrophy, such as myoblast transplantation, stem cell therapy, administration of aminoglycoside antibiotics, proteasome inhibitors, and upregulation therapies (e.g., upregulation of utrophin, an autosomal paralog of dystrophin).

[0203] In some embodiments, an additional therapeutic agent can be administered before, simultaneously with, or after administration of the antisense oligomer conjugates of the present disclosure. For example, the antisense oligomer conjugates can be administered in combination with steroids and / or antibiotics. In certain embodiments, the antisense oligomer conjugates are administered to patients receiving background steroid therapy (e.g., intermittent or long-term / continuous background steroid therapy). For example, in some embodiments, the patient has received treatment with corticosteroids prior to administration of the antisense oligomer and continues to receive that steroid treatment. In some embodiments, the steroid is glucocorticoid or prednisone.

[0204] Since a person skilled in the art can easily determine the optimal administration route and any dosage for any specific animal and pathological condition, the described administration routes are merely guidelines. Multiple methods have been attempted to newly introduce functional genetic material into cells in vitro and in vivo (Friedmann (1989) Science, 244: 1275 - 1280). These methods include incorporating the gene to be expressed into a modified retrovirus (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.: 5074S - 5079S); incorporation into a non - retroviral vector (e.g., adeno - associated virus vector) (Rosenfeld et al. (1992) Cell, 68: 143 - 155; Rosenfeld et al. (1991) Science, 252: 431 - 434); or delivery of the transgene linked to a heterologous promoter - enhancer element by liposomes (Friedmann (1989), supra; Brigham et al. (1989) Am. J. Med. Sci., 298: 278 - 281; Nabel et al. (1990) Science, 249: 1285 - 1288; Hazinski et al. (1991) Am. J. Resp. Cell Molec. Biol., 4: 206 - 209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84: 7851 - 7855); delivery of the transgene linked to a ligand - specific cation - based transport system (Wu and Wu (1988) J. Biol. Chem., 263: 14621 - 14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra; Wolff et al. (1990) Science, 247: 1465 - 1468). If the transgene is directly injected into the tissue, only local expression occurs (Rosenfeld (1992) supra; Rosenfeld et al. (1991) supra; Brigham et al. (1989) supra; Nabel (1990) supra; and Hazinski et al. (1991) supra).The group of Brigham et al. (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991) 39 (abstract)) reported that in vivo transfection occurs only in the lungs when DNA liposome complexes are administered intravenously or intratracheally to mice. A review on methods of human gene therapy is Anderson, Science (1992) 256:808-813.

[0205] In a further embodiment, the pharmaceutical composition of the present disclosure may further comprise a carbohydrate, as described in Han et al., Nat. Comms. 7, 10981 (2016), which is incorporated herein by reference in its entirety. In some embodiments, the pharmaceutical composition of the present disclosure may comprise 5% hexose carbohydrate. For example, the pharmaceutical composition of the present disclosure may comprise 5% glucose, 5% fructose or 5% mannose. In certain embodiments, the pharmaceutical composition of the present disclosure may comprise 2.5% glucose and 2.5% fructose. In some embodiments, the pharmaceutical composition of the present disclosure may comprise a carbohydrate selected from arabinose present in an amount of 5% by volume, glucose present in an amount of 5% by volume, sorbitol present in an amount of 5% by volume, galactose present in an amount of 5% by volume, fructose present in an amount of 5% by volume, xylitol present in an amount of 5% by volume, mannose present in an amount of 5% by volume, a combination of glucose and fructose each present in an amount of 2.5% by volume, and a combination of glucose present in an amount of 5.7% by volume, fructose present in an amount of 2.86% by volume and xylitol present in an amount of 1.4% by volume.

[0206] IV. Method of Use Restoration of Dystrophin Reading Frame Using Exon Skipping A promising treatment for DMD caused by out-of-frame mutations in the dystrophin gene is suggested by a relatively mild form of dystrophinopathy known as BMD, which is caused by in-frame mutations. If out-of-frame mutations could be converted to in-frame mutations, hypothetically, the mRNA reading frame would be preserved and a functional dystrophin protein, albeit internally truncated, could be produced. The antisense oligomer conjugates of the present disclosure are designed to achieve this.

[0207] When the PMO hybridizes with the target pre-mRNA sequence, the formation of the pre-mRNA splicing complex is inhibited and exon 51 is deleted from the mature mRNA. The structure and conformation of the antisense oligomer conjugates of the present disclosure enable sequence-specific base pairing with complementary sequences. For example, eteplirsen, a PMO designed to skip exon 51 of the dystrophin pre-mRNA, enables sequence-specific base pairing with the complementary sequence contained in exon 51 of the dystrophin pre-mRNA by a similar mechanism.

[0208] Normal dystrophin protein is produced from normal dystrophin mRNA that contains all 79 exons. The figure in FIG. 1 shows a small section of the dystrophin pre-mRNA and mature mRNA from exon 47 to exon 53. The shape of each exon shows how the codons are split between exons; note that each codon consists of three nucleotides. The rectangular exons start and end with complete codons. The arrow-shaped exons start with complete codons but end with split codons that contain only nucleotide #1 of the codon. Nucleotides #2 and #3 of this codon are contained in the next exon that starts with a chevron.

[0209] Typically, DMD occurs when there is dystrophin mRNA with the entire exon lost from the dystrophin gene. The figure in Figure 2 shows the type of gene mutation (deletion of exon 50) known to cause DMD. Since exon 49 ends with a complete codon and exon 51 starts with the second nucleotide of the codon, the reading frame after exon 49 shifts, resulting in an out-of-frame mRNA reading frame and the incorporation of incorrect amino acids downstream of the mutation. As a result, an unstable dystrophin protein is produced lacking the functional C-terminal dystroglycan-binding domain.

[0210] Eteplirsen skips exon 51 to restore the mRNA reading frame. Since exon 49 ends with a complete codon and exon 52 starts with the first nucleotide of the codon, deletion of exon 51 restores the reading frame, resulting in the production of a dystrophin protein with an intact dystroglycan-binding site and a shortened internal region, similar to the "in-frame" BMD mutation (Figure 3).

[0211] Preclinical studies have supported the feasibility of improving the DMD phenotype by restoring the dystrophin mRNA open reading frame using exon skipping. Multiple studies using dystrophin animal models of DMD have shown that dystrophin restoration by exon skipping reliably restores muscle strength and function (Sharp 2011; Yokota 2009; Wu 2008; Wu 2011; Barton-Davis 1999; Goyenvalle 2004; Gregorevic 2006; Yue 2006; Welch 2007; Kawano 2008; Reay 2008; van Putten 2012). One compelling example of this is a study that compared dystrophin levels after exon skipping (using PMO) therapy with muscle function in the same tissue. In dystrophin mdx mice, the tibialis anterior (TA) muscle treated with a mouse-specific PMO maintained approximately 75% of its maximum tolerable load after stress-induced contraction, whereas the untreated contralateral TA muscle only maintained approximately 25% of its maximum tolerable load (p<0.05) (Sharp 2011). In another study, exon skipping therapy using a PMO specific to the gene mutation was performed once a week for 5-7 weeks or once every two weeks for 22 weeks in three 2- to 5-month-old dystrophin CXMD dogs. When exon skipping therapy was performed, robust expression of dystrophin was observed in the skeletal muscles throughout the body in all three dogs, and maintenance or improvement of walking ability (15m walk test) was observed compared to baseline. In contrast, in age-matched untreated CXMD dogs, a marked decline in walking ability was observed throughout the study period (Yokota 2009).

[0212] PMO has been shown to have higher exon skipping activity than phosphorothioate at equimolar concentrations in both mdx mice and a humanized DMD (hDMD) mouse model that expresses the entire human DMD transcript (Heemskirk 2009). Reverse transcription polymerase chain reaction (RT-PCR) and Western blot (WB) were used in normal human skeletal muscle cells or muscle cells derived from DMD patients with various mutations that allow exon 51 skipping in In in vitro experiments, eteplirsen (PMO) was shown to be a potent inducer of exon 51 skipping. Eteplirsen-induced exon 51 skipping has been confirmed in vivo in the hDMD mouse model (Arechavala-Gomeza 2007).

[0213] Clinical outcomes for analyzing the effect of an antisense oligomer conjugate that is complementary to the target region of exon 51 of human dystrophin pre-mRNA and induces exon 51 skipping include percent dystrophin-positive fibers (PDPF), six-minute walk test (6MWT), loss of ambulation (LOA), North Star Ambulatory Assessment (NSAA), pulmonary function test (PFT), ability to rise without assistance (from supine position), de novo dystrophin production, and other functional measurements.

[0214] In some embodiments, the present disclosure provides a method of producing dystrophin in a subject having a mutation in the dystrophin gene that permits exon 51 skipping, the method comprising administering to the subject the antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof. In certain embodiments, the present disclosure provides a method of restoring the mRNA reading frame and inducing dystrophin protein production in a subject having Duchenne muscular dystrophy (DMD) with a mutation in the dystrophin gene that permits exon 51 skipping. Protein production can be measured by reverse transcription polymerase chain reaction (RT-PCR), Western blot analysis, or immunohistochemistry (IHC).

[0215] In some embodiments, the present disclosure provides a method of treating the DMD of a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that is amenable to exon 51 skipping, and the method comprises administering to the subject an antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof. In various embodiments, the treatment of the subject is measured by delay of disease progression. In some embodiments, the treatment of the subject is measured by maintaining the subject's walking ability or suppressing the decline of the subject's walking ability. In some embodiments, the 6-minute walk test (6MWT) is used to measure the walking ability. In certain embodiments, the North Star Ambulatory Assessment (NSAA) is used to measure the walking ability.

[0216] In various embodiments, the present disclosure provides a method of maintaining or suppressing the decline of pulmonary function in a subject having DMD, wherein the subject has a mutation in the DMD gene that is amenable to exon 51 skipping, and the method comprises administering to the subject an antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof. In some embodiments, the pulmonary function is measured as the maximum expiratory pressure (MEP). In certain embodiments, the pulmonary function is measured as the maximum inspiratory pressure (MIP). In some embodiments, the pulmonary function is measured as the forced vital capacity (FVC).

[0217] In further embodiments, the pharmaceutical compositions of the present disclosure can be co-administered with carbohydrates in the same formulation or in separate formulations as described in Han et al., Nat. Comms. 7, 10981 (2016), which is hereby incorporated by reference in its entirety. In some embodiments, the pharmaceutical compositions of the present disclosure can be co-administered with 5% hexose carbohydrates. For example, the pharmaceutical compositions of the present disclosure can be co-administered with 5% glucose, 5% fructose, or 5% mannose. In certain embodiments, the pharmaceutical compositions of the present disclosure can be co-administered with 2.5% glucose and 2.5% fructose. In some embodiments, the pharmaceutical compositions of the present disclosure can be co-administered with carbohydrates selected from arabinose present in an amount of 5% by volume, glucose present in an amount of 5% by volume, sorbitol present in an amount of 5% by volume, galactose present in an amount of 5% by volume, fructose present in an amount of 5% by volume, xylitol present in an amount of 5% by volume, mannose present in an amount of 5% by volume, a combination of glucose and fructose each present in an amount of 2.5% by volume, and a combination of glucose present in an amount of 5.7% by volume, fructose present in an amount of 2.86% by volume, and xylitol present in an amount of 1.4% by volume.

[0218] In various embodiments, the antisense oligomer conjugates of the present disclosure are co-administered with a therapeutically effective amount of a non-steroidal anti-inflammatory compound. In some embodiments, the non-steroidal anti-inflammatory compound is an NF-kB inhibitor. For example, in some embodiments, the NF-kB inhibitor can be CAT-1004 or a pharmaceutically acceptable salt thereof. In various embodiments, the NF-kB inhibitor can be a conjugate of a salicylate and DHA. In some embodiments, the NF-kB inhibitor is CAT-1041 or a pharmaceutically acceptable salt thereof. In certain embodiments, the NF-kB inhibitor is a conjugate of a salicylate and EPA. In various embodiments, the NF-kB inhibitor is [Chemical Formula] or a pharmaceutically acceptable salt thereof.

[0219] In some embodiments, the non-steroidal anti-inflammatory compound is a TGF-β inhibitor. For example, in certain embodiments, the TGF-β inhibitor is HT-100.

[0220] In certain embodiments, the antisense oligomer conjugates described herein for use in therapy are described. In certain embodiments, the antisense oligomer conjugates described herein for use in the treatment of Duchenne muscular dystrophy are described. In certain embodiments, the antisense oligomer conjugates described herein for use in the manufacture of a medicament for use in therapy are described. In certain embodiments, the antisense oligomer conjugates described herein for use in the manufacture of a medicament for the treatment of Duchenne muscular dystrophy are described.

[0221] V. Kit The present disclosure also provides a kit for treating a patient having a genetic disease, the kit comprising at least one antisense molecule (e.g., an antisense oligomer conjugate comprising the antisense oligomer described in SEQ ID NO: 1) packaged in a suitable container together with instructions for its use. The kit may also include certain peripheral reagents such as buffers, stabilizers, etc. Those skilled in the art should understand that the application of the above methods has a wide range of applications in the identification of antisense molecules suitable for use in the treatment of many other diseases. In one embodiment, the kit comprises an antisense oligomer conjugate according to formula (III).

[0222] (Examples) The above disclosure has been described in some detail by way of figures and examples for the purpose of clear understanding. However, based on the teachings of the present disclosure, it will be readily apparent to those skilled in the art that certain modifications and alterations can be made to the present disclosure without departing from the spirit or scope of the appended "claims". The following examples are for illustrative purposes only and not for purposes of limitation. Those skilled in the art will readily recognize various less important parameters that can be modified or altered to obtain substantially the same results.

[0223] Materials and Methods Cell and Tissue Culture Conditions Exon skipping was measured using differentiated human muscle cells (ZenBio). Specifically, myoblasts (ZenBio, SKB-F) were grown in growth medium (SKB-M; ZenBio) at 37 °C and 5% CO 2 until 80 - 90% confluence. Differentiation was initiated by replacing the growth medium with differentiation medium (SKM-D; ZenBio). To assay exon 51 skipping, 1×10 4 differentiated cells were seeded into a 24-well plate, and 1 mL of differentiation medium (SKM-D; ZenBio) containing various concentrations of PMO or PPMO was added to each well and incubated for 96 hours.

[0224] Western Blot Analysis For Western blot analysis, tissues were homogenized using a homogenization buffer (4% SDS, 4 M urea, 125 mM Tris-HCl (pH 6.8)) at a ratio of 133 μL of buffer per 9 - 18×20 μm tissue section with a diameter of approximately 5 mm. The corresponding lysates were collected and subjected to protein quantification using the RC DC Protein Assay Kit (BioRad, catalog number 500 - 0122) according to the manufacturer's instructions. Tissue extraction samples were diluted 1:10 using the homogenization buffer to fall within the range of the BSA standard curve. 25 μl of protein lysate, 7 μl of NuPAGE LDS Sample Buffer (Life Technologies, catalog number NP0008, Carlsbad, California, USA), and 3 μl of NuPAGE Reducing Agent (10×) (Life Technologies, catalog number NP0004) were used to prepare 35 μl of sample so that the desired amount of protein was contained in the sample. After heating the protein sample at 95°C for 5 minutes, the sample was centrifuged, and the supernatant was loaded onto a NuPAGE Novex 10-well, 1 mm, mini 3 - 8% polyacrylamide Tris-acetate gel (Life Technologies, catalog number EA0375) with a maximum total protein loading of 50 μg per lane. The gel was electrophoresed at 150 volts at room temperature until the dye front ran off the gel. The resulting protein gel was transferred to a PVDF membrane (Life Technologies, catalog number LC2007) at room temperature for 75 minutes at 30 volts using NuPAGE transfer buffer (Life Technologies, NP006 - 1), 10% methanol, and 0.1% NuPAGE antioxidant (Life Technologies, NP0005).

[0225] After protein transfer, the PVDF membrane was immersed in TTBS buffer (1×TBS (Amresco, catalog number J640-4L), 0.1% (v / v) tween-20). The membrane was transferred to blocking buffer (5% (w / v) non-fat dry milk (Lab Scientific, catalog number M0841) in TTBS) and immersed at 4°C overnight with gentle shaking. After blocking, the membrane was incubated in DYS1 (Leica, catalog number NCL-DYS1) diluted 1:20 with blocking buffer for 60 minutes at room temperature, or in anti-α-actinin antibody (Sigma-Aldrich, catalog number NA931V) diluted 1:100,000 with blocking buffer for 20 minutes at room temperature, and then washed 6 times (5 minutes each time with TTBS). Horseradish peroxidase-conjugated anti-mouse IgG (GE Healthcare, catalog number NA931V) was diluted 1:40,000 with blocking buffer and added to the membrane for 45 minutes (DYS1) or 15 minutes (α-actinin), and then washed 6 times again. Using the ECL Prime Western Detection Kit (GE Healthcare, catalog number RPN2232), the film was exposed to the gel and developed appropriately. The developed film was scanned and analyzed using ImageQuant TL Plus software (version 8.1), and linear regression analysis was performed using Graphpad software.

[0226] The Western blot gels each contained a 4-point or 5-point dystrophin standard curve prepared using total protein extracted from normal tissues (mouse quadriceps, diaphragm or heart) diluted, for example, to 64%, 16%, 4%, 1% and 0.25% (see, for example, FIGS. 5A and 5B) and added to DMD tissue (e.g., quadriceps, diaphragm or heart of mdx mouse, or quadriceps, diaphragm or smooth muscle (GI) of NHP) extracts. The standard curve samples were processed as described above. By comparing the band intensity of dystrophin with the gel standard curve, the dystrophin protein level was determined as a percentage (%WT) relative to the wild-type dystrophin level.

[0227] RT-PCR analysis For RT-PCR analysis, RNA was isolated from cells using an Illustra GE spin kit according to the manufacturer's protocol. The concentration and purity of the RNA were determined using a NanoDrop. Exon 51 skipping was measured by RT-PCR using a forward primer that binds to exon 49, SEQ ID NO: 5 (5'-CCAGCCACTCAGCCAGTGAAG-3') and a reverse primer that binds to exon 52, SEQ ID NO: 6 (5'-CGATCCGTAATGATTGTTCTAGCC-3'). An amplicon of 246 bp was obtained from skipped exon 51, and an amplicon of 478 bp was obtained from non-skipped exon 51.

[0228] Mouse exon 23 skipping was measured by RT-PCR using a forward primer, SEQ ID NO: 7 (5'-CACATCTTTGATGGTGTGAGG-3') and a reverse primer, SEQ ID NO: 8 (5'-CAACTTCAGCCATCCATTTCTG-3').

[0229] After subjecting the RNA to RT-PCR, the samples were analyzed using a Caliper instrument that uses gel capillary electrophoresis. The percentage of exon skipping was calculated using the following equation: (area under the curve of the skipped band) / (sum of the areas under the curves of the skipped and non-skipped bands) × 100.

[0230] Immunohistochemistry: Dystrophin staining: Dystrophin was detected using 10 micron frozen tissue sections of mouse quadriceps muscle and a dystrophin primary antibody (dilution ratio 1:250, rabbit, Abcam, catalog number ab15277) dissolved in 10% goat serum + 1% BSA in PBS and a secondary antibody, Alexa-Fluoro 488 goat anti-rabbit (dilution ratio 1:1000) dissolved in 10% goat serum + 1% BSA.

[0231] Preparation of morpholino subunits [Chem.]

[0232] Referring to Scheme 1 where B represents the base pairing moiety, as shown in the figure, the morpholino subunit can be prepared from the corresponding ribinucleoside (1). Optionally, the morpholino subunit (2) can be protected by reaction with a suitable protecting group precursor, such as trityl chloride. As will be described in more detail below, the 3'-protecting group is generally removed during the process of solid-phase oligomer synthesis. The base pairing moiety can be protected by a method suitable for solid-phase oligomer synthesis. Suitable protecting groups include benzoyl for adenine and cytosine, phenylacetyl for guanine, and pivaloyloxymethyl for hypoxanthine (I). The pivaloyloxymethyl group can be introduced at the N1 position of the hypoxanthine heterocyclic base. Unprotected hypoxanthine subunits can be used, but the yield of the activation reaction is much better when the base is protected. Other suitable protecting groups include those disclosed in U.S. Patent No. 8,076,476, which is hereby incorporated by reference in its entirety.

[0233] Reaction of 3 with the activated phosphorus compound 4 gives a morpholino subunit having the desired linking moiety 5.

[0234] The compound of structure 4 can be prepared using a number of methods known to those skilled in the art. Then, coupling with the morpholino moiety proceeds as outlined above.

[0235] For the preparation of oligomers including subunit couplings, the compound of Structure 5 can be used in solid-phase oligomer synthesis. Such methods are well known in the art. Briefly, the 5'-end of the compound of Structure 5 can be modified to include a linker to a solid support. After being supported, the protecting group of 5 (e.g., trityl at the 3'-end) is removed, and the free amine is reacted with the activated phosphorus moiety of a second compound of Structure 5. This sequence is repeated until an oligomer of the desired length is obtained. The protecting group at the terminal 3'-end may be removed or left if 3'-modification is desired. The oligomer can be cleaved from the solid support by a number of methods or by an exemplary treatment using a base that cleaves the bond to the solid support.

[0236] The preparation of morpholino oligomers in general and of the specific morpholino oligomers of the present disclosure will be described in more detail in the examples.

[0237] Preparation of Morpholino Oligomers The preparation of the compounds of the present disclosure is carried out using the following protocol according to Scheme 2:

Chemical Formula

[0238] Preparation of trityl piperazine phenylcarbamate 35: An aqueous solution of potassium carbonate (3.2 eq) (4 mL / g potassium carbonate) was added to a cooled suspension of compound 11 in dichloromethane (6 mL / g 11). A dichloromethane solution of phenyl chloroformate (1.03 eq) (2 g / g phenyl chloroformate) was slowly added to this two-phase mixture. The reaction mixture was warmed to 20 °C. At the end of the reaction (1 - 2 hours), the layers were separated. The organic layer was washed with water and dried over anhydrous potassium carbonate. The product 35 was isolated from acetonitrile by crystallization.

[0239] Preparation of alcohol carbamate 36: Sodium hydride (1.2 eq) was suspended in 1-methyl-2-pyrrolidinone (32 mL / g sodium hydride). Triethylene glycol (10.0 eq) and compound 35 (1.0 eq) were added to this suspension. The resulting slurry was heated to 95 °C. At the end of the reaction (1 - 2 hours), the mixture was cooled to 20 °C. 30% Dichloromethane / methyl tert-butyl ether (v:v) and water were added to this mixture. The organic layer containing the product was successively washed with an aqueous NaOH solution, an aqueous succinic acid solution, and a saturated aqueous sodium chloride solution. Product 36 was isolated from dichloromethane / methyl tert-butyl ether / heptane by crystallization.

[0240] Preparation of succinic acid 37: Anhydrous succinic acid (2.0 eq) and DMAP (0.5 eq) were added to a tetrahydrofuran solution of compound 36 (7 mL / g 36). The mixture was heated to 50 °C. At the end of the reaction (5 hours), the mixture was cooled to 20 °C and adjusted to pH 8.5 with an aqueous NaHCO3 solution. Methyl tert-butyl ether was added and the product was extracted into the aqueous layer. Dichloromethane was added and the mixture was adjusted to pH 3 with an aqueous citric acid solution. The organic layer containing the product was washed with a mixture of a citric acid buffer at pH = 3 and a saturated aqueous sodium chloride solution. The dichloromethane solution of this 37 was used for the preparation of compound 38 without isolation.

[0241] Preparation of 38: To a solution of compound 37 were added N-hydroxy-5-norbornene-2,3-dicarboximide (HONB) (1.02 eq), 4-dimethylaminopyridine (DMAP) (0.34 eq), and then 1-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) (1.1 eq). The mixture was heated to 55 °C. At the end of the reaction (4 - 5 h), the mixture was cooled to 20 °C and washed successively with 1:1 0.2 M citric acid / brine and brine. Solvent exchange of the dichloromethane solution into acetone and then into N,N-dimethylformamide was carried out, and the product was isolated by precipitation from acetone / N,N-dimethylformamide into saturated aqueous sodium chloride solution. The crude product was reslurried several times with water to remove residual N,N-dimethylformamide and salts.

[0242] Synthetic Method A of PMO: Use of Disulfide Anchor By the method used for the incorporation of subunits in the solid-phase synthesis process, the introduction of an activated "tail" onto the resin carrying the anchor was carried out in dimethylimidazolidinone (DMI).

[0243]

Chemical formula

[0244] This method was carried out in a silanized jacketed peptide vessel (ChemGlass, New Jersey, USA) equipped with a coarse porosity (40 - 60 μm) glass frit for bubbling N2 through frit or vacuum extraction, an overhead stirrer, and a three-way Teflon stopcock.

[0245] The resin treatment / washing stage of the following method consists of two basic operations: resin fluidization or a stirred bed reactor and solvent / solution extraction. In resin fluidization, the valve was positioned so that N2 flowed upward through the frit, and a specified resin treatment / washing agent was added to the reactor and allowed to penetrate the resin to completely wet it. Next, mixing was initiated and the resin slurry was mixed for a specified period of time. In solvent / solution extraction, the mixing and N2 flow were stopped, the vacuum pump was started, and then the valve was positioned to discharge and discard the resin treatment / washing agent. Unless otherwise stated, the volume of the resin treatment / washing agent was 15 mL per 1 g of resin.

[0246] Aminomethylpolystyrene resin (100 - 200 mesh; loading amount based on nitrogen substitution of approximately 1.0 mmol / g; 75 g, 1 eq, Polymer Labs, UK, part number 1464 - X799) in a silane - treated jacketed peptide vessel was added with 1 - methyl - 2 - pyrrolidinone (NMP; 20 ml / g resin), and the resin was mixed for 1 - 2 hours to swell it. After discharging the swelling solvent, the resin was washed with dichloromethane (2×1 - 2 minutes), 5% diisopropylethylamine in 25% isopropanol / dichloromethane (2×3 - 4 minutes), and dichloromethane (2×1 - 2 minutes). After discharging the last washing agent, the resin was treated with a 1 - methyl - 2 - pyrrolidinone solution of disulfide anchor 34 (0.17 M; 15 mL / g resin, approximately 2.5 eq), and the resin / reagent mixture was heated at 45 °C for 60 hours. At the end of the reaction, heating was stopped, the anchor solution was discharged, and the resin was washed with 1 - methyl - 2 - pyrrolidinone (4×3 - 4 minutes) and dichloromethane (6×1 - 2 minutes). The resin was treated with a 10% (v / v) dichloromethane solution of diethyl dicarbonate (16 mL / g; 2×5 - 6 minutes), and then washed with dichloromethane (6×1 - 2 minutes). The resin was dried under N2 flow for 1 - 3 hours and then under vacuum until a constant weight (±2%) was achieved. Yield: 110 - 150% of the original resin weight.

[0247] Determination of the loading amount of aminomethylpolystyrene-disulfide resin: The loading amount of the resin (the number of reactive sites considered to be available), is determined by a spectroscopic assay for the number of triphenylmethyl (trityl) groups per gram of resin.

[0248] Transfer a known weight of dry resin (25 ± 3 mg) to a 25 mL volumetric flask treated with silane, and add approximately 5 mL of a dichloromethane solution of 2% (v / v) trifluoroacetic acid. Gently stir the contents to mix, and then let stand for 30 minutes. Make up the volume to 25 mL with additional 2% (v / v) trifluoroacetic acid dichloromethane solution, and mix the contents well. Using a positive displacement pipette, transfer a fixed amount of the trityl-containing solution (500 μL) to a 10 mL volumetric flask, and make up the volume to 10 mL with methanesulfonic acid.

[0249] Measure the trityl cation content in the final solution by UV absorbance at 431.7 nm, and calculate the loading amount of the resin as trityl groups per gram of resin (μmol / g) using the appropriate volume, dilution factor, extinction coefficient (ε: 41 μmol-1 cm-1), and resin weight. The assay is performed in triplicate, and the average loading amount is calculated.

[0250] In the resin loading method of this example, the loading amount of the resin is about 500 μmol / g. When the disulfide anchor incorporation step is carried out at room temperature for 24 hours, a loading amount of 300 - 400 μmol / g is obtained.

[0251] Tail loading: Using the same apparatus and volume as for the preparation of aminomethylpolystyrene-disulfide resin, the tail can be introduced onto the solid support. First, the anchor-loaded resin was deprotected under acidic conditions, and the resulting material was neutralized prior to coupling. In the coupling step, a 38 DMI solution (0.2 M) containing 4-ethylmorpholine (NEM, 0.4 M) was used instead of the disulfide anchor solution. After 2 hours at 45 °C, the resin 39 was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and once with DCM. A solution of benzoic anhydride (0.4 M) and NEM (0.4 M) was added to the resin. After 25 minutes, the reactor jacket was cooled to room temperature, and the resin was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and eight times with DCM. The resin 40 was filtered and dried under high vacuum. The loading of the resin 40 is defined as the loading of the original aminomethylpolystyrene-disulfide resin 39 used for tail loading.

[0252] Solid-phase synthesis: Morpholino oligomers were prepared in 2 mL Gilson polypropylene reaction columns (part number 3980270) using a Gilson AMS-422 Automated Peptide Synthesizer. When placing the column in the synthesizer, an aluminum block with channels for water flow was placed around it. Alternatively, the AMS-422 adds reagent / wash solutions, holds them for a specified time, and empties the column using vacuum.

[0253] For oligomers in the range up to about 25 subunits in length, aminomethylpolystyrene-disulfide resin with a resin loading of about 500 μmol / g is preferred. For larger oligomers, aminomethylpolystyrene-disulfide resin with a resin loading of 300 - 400 μmol / g is preferred. If a molecule with a 5' tail is desired, the resin with the loaded tail is selected using the same loading guidelines.

[0254] The following reagent solutions were prepared: ·Trityl removal solution: 10% cyanoacetic acid (w / v) in 4:1 dichloromethane / acetonitrile; ·Neutralization solution: 5% diisopropylethylamine in 3:1 dichloromethane / isopropanol; and ·Coupling solution: 0.18 M (or 0.24 M for oligomers extended longer than 20 subunits) activated morpholino subunit and 0.4 M N-ethylmorpholine of the desired base and binding type dissolved in 1,3-dimethylimidazolidinone.

[0255] Dichloromethane (DCM) was used as the transfer detergent to separate different reagent solution washings.

[0256] In the synthesis apparatus, the block was set at 42 °C, 2 mL of 1-methyl-2-pyrrolidinone was added to each column containing 30 mg of aminomethylpolystyrene-disulfide resin (or tail resin), and the mixture was allowed to stand at room temperature for 30 minutes. After washing twice with 2 mL of dichloromethane, the following synthesis cycle was used:

Table 3

[0257] The sequences of the individual oligomers were programmed so that the appropriate coupling solutions (A, C, G, T, I) entered each column in the appropriate order. When the last subunit of the oligomer in the column was fully incorporated, the column was removed from the block and the last cycle was performed manually using a coupling solution consisting of 4-methoxytriphenylmethyl chloride (0.32 M in DMI) containing 0.89 M 4-ethylmorpholine.

[0258] Cleavage from the resin and removal of the base and the backbone protecting group: After methoxytritylation, the resin was washed eight times with 2 mL of 1-methyl-2-pyrrolidinone. 1 mL of a cleavage solution consisting of 0.1 M 1,4-dithiothreitol (DTT) and 0.73 M triethylamine in 1-methyl-2-pyrrolidinone was added, the column was capped, and the mixture was allowed to stand at room temperature for 30 minutes. Thereafter, the solution was poured into a 12 mL Wheaton vial. The greatly shrunk resin was washed twice with 300 μL of the cleavage solution. 4.0 mL of concentrated aqueous ammonia solution (stored at -20 °C) was added to the solution, the vial was tightly capped (with a screw cap lined with Teflon), and the mixture was stirred to mix the solution. The vial was placed in an oven at 45 °C for 16 - 24 hours to effect cleavage of the base and the backbone protecting group.

[0259] Purification of the crude product: The ammonia-decomposed solution in the vial was taken out of the oven and cooled to room temperature. The solution was diluted with 20 mL of 0.28% aqueous ammonia solution and passed through a 2.5×10 cm column containing Macroprep HQ resin (BioRad). Methoxytrityl containing the peak was eluted using a salt gradient (A: 0.28% ammonia and B: 1 M sodium chloride in 0.28% ammonia; 0 - 100% of B in 60 minutes). The combined fractions were pooled and further processed according to the desired product.

[0260] Demethoxytritylation of the morpholino oligomer: The fractions pooled by purification with Macroprep were treated with 1 M H 3 PO 4 to lower the pH to 2.5. After the initial mixing, the sample was allowed to stand at room temperature for 4 minutes, and at that point the sample was neutralized to pH 10 - 11 using 2.8% ammonia / water. The product was purified by solid phase extraction (SPE).

[0261] Filling and conditioning of SPE column: Fill a 20 mL frit column (BioRad Econo-Pac chromatography Columns (732-1011)) with Amberchrome CG-300M (Rohm and Haas; Philadelphia, Pennsylvania) (3 mL), and rinse the resin with 3 mL of the following: 0.28% NH 4 OH / 80% acetonitrile; 0.5 M NaOH / 20% ethanol; water; 50 mM H 3 PO 4 / 80% acetonitrile; water; 0.5 NaOH / 20% ethanol; water; 0.28% NH 4 OH.

[0262] SPE purification: Apply the solution obtained by de-methoxytritylation to the column, and rinse the resin three times with 3 - 6 mL of 0.28% aqueous ammonia solution. Place a Wheaton vial (12 mL) under the column, and elute the product by washing twice with 2 mL of 45% acetonitrile in 0.28% aqueous ammonia solution.

[0263] Isolation of the product: Freeze the solution with dry ice, place the vial in a freeze dryer to obtain a fluffy white powder. Dissolve the sample in water, filter it through a 0.22 micron filter (Pall Life Sciences, Acrodisc 25 mm syringe filter with 0.2 micron HT Tuffryn membrane) using a syringe, measure the absorbance (OD) with a UV spectrophotometer to determine the OD units of the oligomers present, and aliquot the sample for analysis. Then, return the solution to a Wheaton vial and freeze-dry it.

[0264] Analysis of Morpholino Oligomers by MALDI: Using MALDI-TOF mass spectrometry, the composition of the fractions obtained by purification was clarified, and evidence indicating the identity (molecular weight) of the oligomers was obtained. The sample was diluted with a solution of the matrix 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid), 3,4,5-trihydroxyacetophenone (THAP), or alpha-cyano-4-hydroxycinnamic acid (HCCA), and then flowed.

[0265] Synthesis Method B of PMO: Use of NCP2 Anchor Synthesis of NCP2 Anchor: 1. Preparation of Methyl 4-Fluoro-3-nitrobenzoate (1)

Chemical formula

[0266] 2. Preparation of 3-Nitro-4-(2-oxopropyl)benzoic Acid A. (Z)-Methyl 4-(3-Hydroxy-1-methoxy-1-oxobuta-2-en-2-yl)-3-nitrobenzoate (2)

Chemical formula

[0267] B. 3-Nitro-4-(2-oxopropyl)benzoic acid

Chemical formula

[0268] 3. Preparation of N-tritylpiperazine succinate (NTP)

Chemical formula

[0269] The remaining organic layer was cooled to 18 °C, and a solution prepared by dissolving 847 g of succinic acid in 10.87 kg of purified water was gradually added dropwise to the organic layer little by little. The mixture was stirred at 20 ± 5 °C for 1.75 hours. The mixture was filtered, and the solid was washed with 2 kg of TBME and 2 kg of acetone and then dried on a funnel. The filter cake was triturated twice with 5.7 kg of acetone each time, filtered, and washed with 1 kg of acetone between triturations. After the solid was dried on a funnel, it was transferred to a tray and dried at room temperature in a vacuum oven until a constant weight of 2.32 kg of NTP was obtained. Yield 80%.

[0270] 4. Preparation of (4-(2-Hydroxypropyl)-3-nitrophenyl)(4-tritylpiperazin-1-yl)methanone A. Preparation of 1-(2-Nitro-4(4-tritylpiperazine-1-carbonyl)phenyl)propan-2-one

Chemical formula

[0271] B. Preparation of (4-(2-Hydroxypropyl)-3-nitrophenyl)(4-tritylpiperazin-1-yl)methanone (5)

Chemical formula

[0272] Preparation of 5.2,5-dioxopyrrolidin-1-yl (1-(2-nitro-4-(4-tritylpiperazine-1-carbonyl)phenyl)propan-2-yl) carbonate (NCP2 anchor)

Chemical Structure

[0273] The combined solids were placed in a 100 L jacketed flask, dissolved in 28 kg of DCM, and washed with a solution of 900 g of potassium carbonate dissolved in 4.3 kg of water. After 1 hour, the layers were separated and the aqueous layer was removed. The organic layer was washed with 10 kg of water, separated, and dried over 3.5 kg of sodium sulfate. The DCM was filtered off, evaporated, and dried under vacuum until 6.16 kg of NCP2 anchor was obtained (yield 114%).

[0274] Synthesis of NCP2 Anchor-Supported Resin Approximately 52 L of NMP and 2300 g of aminomethylpolystyrene resin were placed in a 75 L solid-phase synthesis reactor equipped with a Teflon stopcock. The resin was stirred in NMP for about 2 hours to swell and then drained. The resin was washed twice with about 4 L of DCM each time, then twice with 39 L of neutralization solution each time, and then twice with 39 L of DCM each time. The NCP2 anchor solution was gradually added to the stirred resin solution, stirred at room temperature for 24 hours, and drained. The resin was washed four times with 39 L of NMP each time and six times with 39 L of DCM each time. The resin was treated with half of the DEDC capping solution for 30 minutes with stirring and drained, then treated with the other half of the DEDC capping solution for 30 minutes with stirring and drained. After washing the resin six times with 39 L of DCM each time, it was dried in an oven until a constant weight of 3573.71 g of anchor-supported resin was obtained.

[0275] Preparation of Morpholino Oligomers Using NCP2 Anchor 50 L Solid-Phase Synthesis of Eteplirsen (PMO#1) Crude Drug Substance 1. Raw Materials

Table 4

[0276] Chemical structure of the starting material: A. Activated EG3 tail

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

[0277]

Table 5

[0278] 2. Synthesis of eteplirsen crude drug A. Resin swelling 750 g of the anchor-bearing resin and 10.5 L of NMP were placed in a 50-L silane-treated reactor and stirred for 3 hours. The NMP was discharged, and the anchor-bearing resin was washed twice with 5.5 L of DCM each time and then washed twice with 5.5 L of 30% TFE / DCM each time.

[0279] B. Cycle 0: Coupling of the EG3 Tail The anchor-bearing resin was washed three times with 5.5 L of 30% TFE / DCM each time, discharged, washed with 5.5 L of the CYFTA solution for 15 minutes, discharged, washed again with 5.5 L of the CYTFA solution for 15 minutes, and without discharging, 122 mL of 1:1 NEM / DCM was added, and the suspension was stirred for 2 minutes and then discharged. The resin was washed twice with 5.5 L of the neutralization solution for 5 minutes each time and discharged, and then washed twice with 5.5 L of DCM each time and discharged. A solution prepared by dissolving 706.2 g of the activated EG3 tail (MW 765.85) and 234 mL of NEM in 3 L of DMI was added to the resin, stirred at room temperature for 3 hours, and then discharged. The resin was washed twice with 5.5 L of the neutralization solution for 5 minutes each time and once with 5.5 L of DCM and discharged. A solution prepared by dissolving 374.8 g of benzoic anhydride and 195 mL of NEM in 2680 mL of NMP was added, stirred for 15 minutes, and then discharged. After the resin was stirred with 5.5 L of the neutralization solution for 5 minutes, it was washed once with 5.5 L of DCM and then washed twice with 5.5 L of 30% TFE / DCM each time. The resin was suspended in 5.5 L of 30% TFE / DCM and held for 14 hours.

[0280] C. Subunit Coupling Cycles 1 - 30 i. Pretreatment before Coupling Before each coupling cycle described in Figure 23, the resin was: 1) washed with 30% TFE / DCM; 2) a) treated with the CYTFA solution for 15 minutes and discharged, b) treated with the CYTFA solution for 15 minutes, 1:1 NEM / DCM was added thereto, stirred, and discharged; 3) stirred three times with the neutralization solution; 4) washed twice with DCM. See Figure 23.

[0281] ii. Post-treatment after Coupling After discharging each sub-unit solution as described in Figure 23, the resin was: 1) washed with DCM; 2) washed twice with 30% TFE / DCM. When the resin was held for a certain period of time before the next coupling cycle, the second TFE / DCM wash solution was not discharged and the resin was held in the TFE / DCM wash solution. Refer to Figure 23.

[0282] iii. Activation subunit coupling cycle The coupling cycle was carried out as described in Figure 23.

[0283] iv. Final IPA wash After carrying out the final coupling step as described in Figure 23, the resin was washed 8 times with 19.5 L of IPA each time and dried at room temperature under vacuum for about 63.5 hours until it reached a weight of 5,579.8 g.

[0284] C. Cleavage The Eteplisen crude drug bound to the above resin was divided into two lots, and each lot was treated as follows. The resin of the 2,789.9 g lot was: 1) stirred with 10 L of NMP for 2 hours and then the NMP was discharged; 2) washed 3 times with 10 L of 30% TFE / DCM each; 3) treated with 10 L of CYTFA solution for 15 minutes; 4) treated with 10 L of CYTFA solution for 15 minutes, then 130 ml of 1:1 NEM / DCM was added thereto, stirred for 2 minutes and discharged. The resin was treated 3 times with 10 L of neutralization solution each, washed 6 times with 10 L of DCM and washed 8 times with 10 L of NMP each. The resin was treated with a cleavage solution prepared by dissolving 1530.4 g of DTT and 2980 of DBU in 6.96 L of NMP for 2 hours to detach the Eteplirsen crude drug from the resin. The cleavage solution was discharged and held in another container. The reactor and the resin were washed with 4.97 L of NMP and this was combined with the cleavage solution.

[0285] D. Deprotection The combined cleavage solution and NMP wash solution were transferred to a pressure vessel and cooled to a temperature of -10 °C to -25 °C in a freezer. NH 4 OH(NH 3 ·H 239.8 L of O)39.8L was added. The pressure vessel was sealed and heated at 45 °C for 16 hours, and then cooled to 25 °C. This deprotected solution containing the Eteplirsen crude drug substance was diluted 3:1 with purified water, the pH was adjusted to 3.0 with 2M phosphoric acid, and then the pH was adjusted to 8.03 with NH 4 OH. HPLC (C18) 73 - 74%.

[0286] Purification of Eteplirsen (PMO#1) Crude Drug Substance The deprotected solution containing the Eteplirsen crude drug substance obtained in part D above was applied to a column of ToyoPearl Super-Q 650S anion exchange resin (Tosoh Bioscience) and eluted with a gradient of 0 - 35% B for 17 column volumes (Buffer A: 10 mM sodium hydroxide; Buffer B: 1 M sodium chloride in 10 mM sodium hydroxide), and the fractions with acceptable purity (C18 and SCX HPLC) were pooled to obtain a purified formulation solution. HPLC: 97.74% (C18), 94.58% (SCX).

[0287] The purified drug substance solution was desalted and freeze-dried until 1959 g of purified Eteplirsen drug substance was obtained. Yield 61.4%; HPLC: 97.7% (C18), 94.6% (SCX).

[0288]

Table 6

[0289] Conjugation of CPP

Chemical Structure

[0290] Dimethyl sulfoxide (DMSO, 20 mL) was added to a mixture of PMO#1 (1.82 g, 0.177 mmol, freshly dried by freeze-drying for 2 days), Ac-L-Arg-L-Arg-L-Arg-L-Arg-L-Arg-L-Arg-Gly-OH hexafluorophosphate (614.7 mg, 0.354 mmol), and 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU, 134.4 mg, 0.354 mmol). The mixture was stirred at room temperature for 3 hours, and then N,N-diisopropylethylamine (DIPEA, 68.5 mg, 0.530 mmol) was added. After 5 minutes, the turbid mixture became a clear solution. The reaction was monitored by SCX-HPLC. After 2 hours, 20 mL of 10% ammonium hydroxide solution (2.8% NH 3 ) was added. The mixture was stirred at room temperature for an additional 2 hours. The reaction was stopped by adding 400 mL of water. 2.0 mL of trifluoroethanol was added to this solution.

[0291] The solution was divided into two parts, and each part was purified using a WCX column (10 g of resin per column). First, each WCX column was washed with a 20% aqueous acetonitrile solution (v / v) to remove the PMO#1 starting material. The washing was stopped when the signal of PMO#1 was no longer detected by MALDI-TOF mass spectrometry analysis (225 mL for each column). Next, each column was washed with water (100 mL per column). The desired product PPMO#1 was eluted with 2.0 M guanidine HCl (140 mL for each column). After pooling the purified PPMO#1 solutions together, they were divided into two parts and each was desalted using an SPE column (10 g of resin for each column).

[0292] First, the SPE column was washed with a 1.0 M aqueous NaCl solution (100 mL for each column) to obtain the hexahydrochloride of PPMO#1. Next, each SPE column was washed with water (200 mL for each column). The final desalted PPMO#1 was eluted with a 50% aqueous acetonitrile solution (v / v, 150 mL for each column). Acetonitrile was removed by evacuation under reduced pressure. The resulting aqueous solution was lyophilized to obtain the desired conjugate PPMO#1 hexahydrochloride (1.93 g, yield 94.5%).

[0293] Example 1: PMO#1 PMO#1 was synthesized using the protocol of PMO synthesis method B described above:

Chemical formula

Table 7

Chemical formula

Chemical formula

Chemical formula

[0294] Example 2: PPMO#1 Using the above protocol, PPMO#1 was synthesized from PMO#1: [Chemical formula] In the formula, each Nu of 1 to 30 and 5' to 3' is as follows: [Table 8] In the table, A is [Chemical formula] and C is [Chemical formula] and G is [Chemical formula] and T is [Chemical formula] .

[0295] In the SCX-HPLC analysis, it can be seen that the purity is 93.3% by integration of the main peak and 99.69% by integration of the whole PPMO#1. MALDI-TOF mass spectrum: C 404 H 647 N 202 O 130 P 30 m / z calculated for [M + 1]+: 11342.25; measured value: 11342.12.

[0296] Example 3: Exon 51 skipping in vitro (muscle cells) Both of the two compounds, PMO#1 and PPMO#1, targeting human dystrophin exon 51 described in the table below were assembled into the same sequence, and their ability to induce exon 51 skipping was evaluated.

[0297] [Table 9]

[0298] Specifically, using differentiated human muscle cells, the ability of the above compounds to induce exon 51 skipping at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) was determined. After differentiating the cells, they were incubated with the compounds for 96 hours, then RNA isolation was performed, and exon 51 skipping was measured by RT-PCR as described above. The results showing that PPMO#1 significantly increased exon 51 skipping compared to PMO#1 are shown in the table below and Figure 4: [Table 10]

[0299] Example 4: mdx Mouse Test mdx mice contain a mutation in exon 23 of the dystrophin gene and are well-characterized models recognized as animal models of Duchenne muscular dystrophy (DMD). The M23D antisense sequence (SEQ ID NO: 2) has been found to induce exon 23 skipping and restore the expression of functional dystrophin. Six- to seven-week-old mdx mice were injected once via the tail vein with PPMO4225 or PMO4225 in the table below at a dose of 40 mg / kg, or were injected once with physiological saline.

[0300] [Table 11] PMO4225 and PPMO4225 were prepared by the above PMO method A and CPP conjugation method, respectively.

[0301] Seven days, 30 days, 60 days, and 90 days after a single-dose injection, the treated mice were sacrificed (n = 6 per group). The diaphragm, heart, and right quadriceps were used for Western blot analysis to measure the production of dystrophin protein and RT-PCR analysis to measure the rate of exon skipping, and the left quadriceps was processed for immunohistochemistry and H / E staining as described above.

[0302] As described above, dystrophin protein recovery was quantified by Western blot, and the rate of exon 23 skipping was measured by RT-PCR.

[0303] The results of RT-PCR are shown in Figures 5A - 10B and the table below. Surprisingly, PPMO4225 induced significantly higher and sustained levels of dystrophin recovery and exon 23 skipping compared to PMO4225, with a maximum level observed 30 days after injection. Even more surprisingly, PPMO4225 increased the heart dystrophin level even though PMO4225 did not; no dystrophin and exon skipping were observed in the heart at any time point with PMO4225.

[0304] [Table 12]

[0305] [Table 13]

[0306] The results of immunohistochemistry are shown in Figure 11. From the figure, dystrophin has recovered throughout the quadriceps with PPMO4225, while a "patchy" expression pattern is seen with 4225. Since a uniform distribution of dystrophin is seen with treatment with PPMO4225, it can be seen that it is possible to target skeletal muscle over a wide range. The in vivo delivery of PPMO4225 is significantly improved compared to PMO4225.

[0307] Example 5: Exon 51 Skipping in NHP To further clarify the effectiveness of exon skipping by PPMO antisense oligomers, non-human primates were used. Specifically, PPMO#1, PMO#1 (from Example 2), or physiological saline was injected intravenously into cynomolgus monkeys with intact muscle tissue according to the administration schedule in the following table: [Table 14]

[0308] At 20 mg / kg, 40 mg / kg, and 80 mg / kg, the individuals in Groups 1 - 5 showed tolerance to all four administrations. At 160 mg / kg, no tolerance was observed after the third administration, resulting in the euthanasia of two individuals on the day of administration and one individual on the following day. Weight loss was observed in these individuals.

[0309] At the time of autopsy or euthanasia in a moribund state incorporated into the schedule, diaphragmatic, duodenal, esophageal, and aortic smooth muscle, quadriceps, deltoid, biceps, and heart sections were collected and snap-frozen each time. Percent exon 51 skipping was determined using RT-PCR as described above. The results are shown in Figures 12 - 15 and the following table.

[0310] [Table 15]

[0311] Surprisingly, in PPMO#1, a deep level of exon skipping was observed in the intact tissues tested compared to PMO#1. Specifically, in the administration of PMO#1, skipping was not detected in any of the tissues collected, whereas in PPMO#1, for example, at a dosage level of 80 mg / kg, exon skipping exceeding 90% was observed in the quadriceps and diaphragm, and skipping exceeding 60% was observed in the duodenum. Particularly surprising was the level of exon skipping observed in the heart, for example, at 80 mg / kg, where the exon skipping exceeded 60%. While not wishing to be bound by a particular theory, the systemic administration of PPMO#1 and delivery into intact non-dystrophic NHP muscle tissue, as well as the achievement of exon 51 skipping particularly in the myocardium by PPMO#1, could not be predicted from the mdx mice of Example 4 above. Rather, a difference was observed between delivery to healthy tissue and dystrophic tissue in NHP.

[0312] For Groups 7 and 8, percent exon 51 skipping was determined using RT-PCR as described above. The results are shown in Figure 22 and the table below.

[0313]

Table 16

[0314] As can be seen from the results, exon skipping showed higher values at 30 days than at 60 days in each muscle analyzed, indicating that the efficiency of exon skipping decreased over time after a single administration.

[0315] Example 6: Dosage Response Test in mdx Mice The above PPMO4225 or PMO4225 was injected once into the tail vein of 6 - 7 week-old mdx mice at dosages of 40 mg / kg, 80 mg / kg, or 120 mg / kg (n = 6 per group).

[0316] Thirty days after injection, the treated mice were sacrificed. Diaphragm, quadriceps and heart were processed for Western blot analysis to measure the production level of dystrophin protein, which was modified as follows based on the above Western blot protocol (e.g., that used in Example 4):

Table 17

[0317] Dystrophin protein recovery expressed as a percentage of wild type is shown in the table below and Figures 16 - 19.

[0318]

Table 18

[0319] Surprisingly, the data shows that in mdx mice, a single administration of PPMO4225 significantly and substantially increases dystrophin levels in a dose - dependent manner compared to PMO4225.

[0320] Example 7: IHC Test on Diaphragm and Heart of mdx Mice PPMO4225 was injected once via the tail vein of 6 - 7 - week - old mdx mice at a dose of 80 mg / kg, or saline was injected once, and saline was injected once into 6 - 7 - week - old wild - type mice. Thirty days after the single - dose injection, the treated mdx mice, saline mdx mice and wild - type mice were sacrificed (n = 4 per group). The results of immunohistochemistry are shown in Figure 24. From the results of the figure, it can be seen that in mdx mice treated with PPMO4225, dystrophin in tissues related to the morbidity and mortality rates of DMD increases uniformly.

[0321] Example 8: Exon 51 Skipping in vitro (Myoblasts) The skipping of DMD exon 51 by two antisense oligomer conjugates, PMO#1 and PPMO#1, which target human dystrophin (DMD) exon 51 and contain the same sequence, was evaluated in normal human myoblasts.

[0322]

Table 19

[0323] Specifically, normal human myoblasts (passages 5 - 6, SKB - F - SL purchased from Zen - Bio) were plated at approximately 40% confluence and treated with PMO#1 or PPMO#1 at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) in SKM - M medium (Zen - Bio). After incubation for 96 hours, the myoblasts were washed with PBS and lysed with RA1 lysis buffer using the Illustra GE RNAspin 96 kit (catalog number 25 - 055 - 75, GE Healthcare Bio - Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40 μL of RNase - free water was used for RNA elution.

[0324] To determine exon 51 skipping by both compounds, two - step endpoint RT - PCR was performed. Specifically, first, 11 microliters of total RNA was reverse - transcribed into cDNA using the SuperScript IV First - Strand Synthesis kit (catalog number 18091200, Invitrogen) with random hexamers according to the manufacturer's instructions. 9 μL of cDNA was used in Platinum Taq DNA polymerase PCR PCR was performed by adding primers targeting human DMD exons 49 and 52 [forward primer (SEQ ID NO: 5): CCAGCCACTCAGCCAGTGAAG; reverse primer (SEQ ID NO: 6): CGATCCGTAATGATTGTTCTAGCC] to Supermix High Fidelity (Catalog No. 12532024, Invitrogen). PCR amplification was carried out using a BioRad CFX96 real-time thermocycler with the program shown in the table below. 32 μL of the PCR product was applied to a LabChip GX system, and the expression of skipped or non-skipped PCR products was evaluated using a DNA High Sensitivity Reagent Kit (CLS760672, Perkin Elmer). The skipping ratio of DMD exon 51 was calculated as the ratio of the molar concentration (nmol / l) of the band with exon 51 skipping (246 bp) compared to the total molar concentration of the skipped band (246 bp) and the non-skipped band (478 bp).

[0325] The unpaired two-sided Student's t-test (equal variance) was used to evaluate whether there were statistically significant differences between the mean values of the two groups at each dose. A P-value < 0.05 was considered statistically significant.

[0326]

Table 20

[0327] The results are described in the table and Figure 25 below.

[0328]

Table 21

[0329] From these in vitro results, it can be seen that in human myoblasts, PPMO#1 significantly increases DMD exon 51 skipping compared to PMO#1.

[0330] Example 9: Exon 51 Skipping in vitro (Muscle Tubes) DMD exon 51 skipping by two antisense oligomer conjugates, PMO#1 and PPMO#1, targeting human dystrophin (DMD) exon 51 and containing the same sequence was evaluated in healthy human muscle tubes.

[0331]

Table 22

[0332] Specifically, healthy human myoblasts (passages 5 - 6, SKB - F - SL purchased from Zen - Bio) were cultured in SKM - M medium until they reached 80 - 90% confluence, and then differentiation was initiated by incubating in low - serum medium (SKM - D, Zen - Bio). Five days after differentiation, mature muscle tubes were incubated with PMO#1 or PPMO#1 at various concentrations (i.e., 40μm, 20μm, 10μm, 5μm, 2.5μm, and 1.25μm). After incubating for 96 hours, the muscle tubes were washed with PBS and lysed with RA1 lysis buffer using the Illustra GE RNAspin 96 kit (catalog number 25 - 055 - 75, GE Healthcare Bio - Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40μL of RNase - free water was used for RNA elution.

[0333] To determine DMD exon 51 skipping by PMO#1 or PPMO#1, two - step endpoint RT - PCR was performed. Specifically, first, 11 microliters of total RNA was reverse - transcribed into cDNA using the SuperScript IV First - Strand Synthesis kit (catalog number 18091200, Invitrogen) with random hexamers according to the manufacturer's instructions. 9μL of cDNA was used with Platinum Taq PCR was performed by adding primers targeting human DMD exons 49 and 52 [forward primer (SEQ ID NO: 5): CCAGCCACTCAGCCAGTGAAG; reverse primer (SEQ ID NO: 6): CGATCCGTAATGATTGTTCTAGCC] to DNA Polymerase PCR Supermix High Fidelity (Catalog No. 12532024, Invitrogen). PCR amplification was carried out using a BioRad CFX96 real-time thermocycler with the program shown in the table below. 32 μL of the PCR product was applied to a LabChip GX system, and the expression of the skipped and non-skipped PCR products was evaluated using a DNA High Sensitivity Reagent Kit (CLS760672, Perkin Elmer). The ratio of exon 51 skipping of DMD was calculated as the ratio of the molar concentration (nmol / l) of the band with exon 51 skipping (246 bp) compared to the total molar concentration of the skipped band (246 bp) and the non-skipped band (478 bp).

[0334] The corresponding two-sided Student's t-test (equal variance) was used to evaluate whether there were statistically significant differences between the mean values of the two groups at each dose. A P-value < 0.05 was considered statistically significant.

[0335]

Table 23

[0336] The results showing that PPMO#1 significantly increased DMD exon 51 skipping compared to PMO#1 are shown in the table and Figure 26 below.

[0337]

Table 24

[0338] All publications and patent applications cited herein are hereby incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

[0339] (References) Aartsma-Rus,A.,A.A.Janson,et al.(2004).“Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense.” Am J Hum Genet 74(1):83-92. Abes,R.,et al.(2008).“Arginine-rich cell penetrating peptides:design,structure-activity,and applications to alter pre-mRNA splicing by steric-block oligonucleotides.” J Pept.Sci. 14:455-460. Alter,J.,et al.(2006).“Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology.” Nat.Med. 12(2):175-177. Bestas,B.,et al.(2014).“Splice-correcting ligonucleotides restore BTK function in X-linked agammaglobulinemia model.” J.Clin.Invest. Cirak,S.,V.Arechavala-Gomeza,et al.(2011).“Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment:an open-label,phase 2,dose-escalation study.” Lancet 378(9791):595-605. Dunckley,M.G.,I.C.Eperon,et al.(1997).“Modulation of splicing in the DMD gene by antisense oligoribonucleotides.” Nucleosides & Nucleotides 16(7-9):1665-1668. Dunckley,M.G.,M.Manoharan,et al.(1998).“Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides.” Hum Mol Genet 7(7):1083-90. Errington,S.J.,C.J.Mann,et al.(2003).“Target selection for antisense oligonucleotide induced exon skipping in the dystrophin gene.” J Gene Med 5(6):518-27. Goemans,N.M.,M.Tulinius,et al.(2011).“Systemic Administration of PRO051 in Duchenne’s Muscular Dystrophy.” N Engl J Med . Jearawiriyapaisarn,N.,H.M.Moulton,et al.(2008).“Sustained Dystrophin Expression Induced by Peptide-conjugated Morpholino Oligomers in the Muscles of mdx Mice.” Mol Ther . Jearawiriyapaisarn,N.,et al.(2010).“Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers.” Cardiovascular Research 85:444-453. Kinali,M.,V.Arechavala-Gomeza,et al.(2009).“Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy:a single-blind,placebo-controlled,dose-escalation,proof-of-concept study.” Lancet Neurol 8(10):918-28. Leblue,B.,et al.(2008).“Cell penetrating peptide conjugates of steric block oligonucleotides.” Adv.Drug Deliv.Rev. 60:517-529. Lu,Q.L.,C.J.Mann,et al.(2003).“Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse.” Nat Med 9(8):1009-14. Mann,C.J.,K.Honeyman,et al.(2002).“Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy.” J Gene Med 4(6):644-54. Marshall, N.B., S.K. Oda, et al. (2007). “Arginine-rich cell-penetrating peptides facilitate delivery of antisense oligomers into murine leukocytes and alter pre-mRNA splicing.” Journal of Immunological Methods 325(1 - 2):114 - 126. Matsuo, M., T. Masumura, et al. (1991). “Exon skipping during splicing of dystrophin mRNA precursor due to an intraexon deletion in the dystrophin gene of Duchenne muscular dystrophy kobe.” J Clin Invest 87(6):2127 - 31. McClory, G., et al. (2006). “Antisense oligonucleotide-induced exon skipping restored dystrophin expression in vitro in a canine model of DMD.” Gene Therapy 13:1373 - 1381. Monaco, A.P., C.J. Bertelson, et al. (1988). “An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus.” Genomics 2(1):90 - 5. Moulton, H.M., (2007). “Cell-penetrating peptide-morpholino conjugates alter pre-mRNA splicing of DMD (Duchenne muscular dystrophy) and inhibit murine coronavirus replication in vivo.” Biochem.Society Trans 35(4):826-828. Pramono,Z.A.,Y.Takeshima,et al.(1996).“Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence.” Biochem Biophys Res Commun 226(2):445-9. Sazani,P.,R.Kole,et al.(2007).Splice switching oligomers for the TNF superfamily receptors and their use in treatment of disease. PCT WO2007058894 ,University of North Carolina Sierakowska,H.,M.J.Sambade,et al.(1996).“Repair of thalassemic human beta-globin mRNA in mammalian cells by antisense oligonucleotides.” Proc Natl Acad Sci U S A 93(23):12840-4. Summerton,J.and D.Weller(1997).“Morpholino antisense oligomers:design,preparation,and properties.” Antisense Nucleic Acid Drug Dev 7(3):187-95. Takeshima,Y.,H.Nishio,et al.(1995).“Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe.” J Clin Invest 95(2):515-20. van Deutekom,J.C.,M.Bremmer-Bout,et al.(2001).“Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells.” Hum Mol Genet 10(15):1547-54. van Deutekom,J.C.,A.A.Janson,et al.(2007).“Local dystrophin restoration with antisense oligonucleotide PRO051.” N Engl J Med 357(26):2677-86. Wilton,S.D.,A.M.Fall,et al.(2007).“Antisense oligonucleotide-induced exon skipping across the human dystrophin gene transcript.” Mol Ther 15(7):1288-96. Wilton,S.D.,F.Lloyd,et al.(1999).“Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides.” Neuromuscul Disord 9(5):330-8. Wu, B., H. M. Moulton, et al. (2008). “Effective rescue of dystrophin improves cardiac function in dystrophin - deficient mice by a modified morpholino oligomer.” Proc Natl Acad Sci U S A 105(39):14814 - 9. Wu, B., et al. (2012). “Long - term rescue of dystrophin expression and improvement in muscle pathology and function in dystrophic mdx mice by peptide - conjugated morpholino.” The Am.J.Pathol. 181(2):392 - 400. Wu, P., et al. (2007) “Cell - penetrating peptides as transporters for morpholino oligomers: effects of amino acid composition on intracellular delivery and cytotoxicity.” Nucleic Acids Research 35(15):5182 - 5191. Yin, H., H. M. Moulton, et al. (2008). “Cell - penetrating peptide - conjugated antisense oligonucleotides restore systemic muscle and cardiac dystrophin expression and function.” Hum Mol Genet 17(24):3909 - 18. Yin, H., et al. (2011). “Pip5 transduction peptides direct high efficiency oligonucleotide - mediated dystrophin exon skipping in heart and phenotypic correction in mdx mice.” Mol.Ther 19(7):1295-1303. Youngblood,D.,et al.(2006).“Stability of cell-penetrating peptide-morpholino oligomer conjugates in human serum and in cells.” Am.Chem.Soc.

[0340]

Table 25

Claims

1. A pharmaceutical composition for use in the treatment of Duchenne muscular dystrophy (DMD) in a subject, comprising an antisense oligomer conjugate, wherein the pharmaceutical composition is administered to a subject in need thereof, and the subject has a mutation in the dystrophin gene that allows exon 51 skipping, characterized in that the antisense oligomer conjugate is of formula (IV): 【Chemical Formula 3A】 An antisense oligomer conjugate or a pharmaceutically acceptable salt thereof, which is a pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the antisense oligomer conjugate is in the form of a pharmaceutically acceptable salt.

3. The pharmaceutical composition according to claim 2, wherein the antisense oligomer conjugate is of formula (IVA): 【Chemical Formula 4A】 An antisense oligomer conjugate, which is the pharmaceutical composition according to claim 2.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 30 mg / kg of the antisense oligomer conjugate.

5. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 40 mg / kg of the antisense oligomer conjugate.

6. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 60 mg / kg of the antisense oligomer conjugate.

7. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 80 mg / kg of the antisense oligomer conjugate.

8. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 20 mg / kg of the antisense oligomer conjugate.

9. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 10 mg / kg of the antisense oligomer conjugate.

10. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 5 mg / kg of the antisense oligomer conjugate.

11. The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is administered to the subject at a dose of 2 mg / kg of the antisense oligomer conjugate.

12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the pharmaceutical composition is administered to the subject weekly.

13. The pharmaceutical composition according to any one of claims 1 to 11, wherein the pharmaceutical composition is administered to the subject every other week.

14. The pharmaceutical composition according to any one of claims 1 to 11, wherein the pharmaceutical composition is administered to the subject every three weeks.

15. The pharmaceutical composition according to any one of claims 1 to 11, wherein the pharmaceutical composition is administered to the subject monthly.

Images