481 results about "Suppressor cell" patented technology

A composition of matter includes an antisense phosphorodiamidate morpholino oligomer (MO) that includes an MO base sequence. The MO base sequence is arranged to bind a corresponding complementary base sequence of messenger RNA (mRNA) transcribed from one or more genes for the beta subunit of human chorionic gonadotropin (hCG-β). An inventive method, for suppressing intracellular synthesis of a beta subunit of human chorionic gonadotropin (hCG-β), includes introducing such an MO into one or more cells.

The invention belongs to the technical field of biomedicine, and particularly relates to an anti-inflammatory peptide LRKRKR and application thereof. The invention provides an anti-inflammatory peptide or a salt thereof. The amino acid sequence of the anti-inflammatory peptide is LRKRKR. The anti-inflammatory peptide is simple in synthesis mode, small in molecular weight, easy to absorb, good in safety, capable of remarkably inhibiting inflammatory reaction in cells and reducing the release amount of an inflammatory factor TNF-alpha, good in anti-inflammatory biological activity and wide in application prospect in development of anti-inflammatory products.

The invention discloses application of a tripterygium wilfordii exosome in preparation of an anti-cervical cancer medicine and a tumor angiogenesis inhibiting medicine, and relates to the field of biological medicine. The medicinal plant exosome derived from tripterygium wilfordii is successfully separated, and it is proved that the medicinal plant exosome can regulate related pathways through delivery of functional nucleic acid molecules to inhibit proliferation and migration of cervical cancer cells and promote active oxygen related apoptosis so as to be used for tumor treatment. The tripterygium wilfordii exosome can further act on vascular endothelial cells in a tumor microenvironment, the migration function of Hela cells is inhibited, and then the effect of resisting cell proliferation in the tumor microenvironment is achieved. The tripterygium wilfordii exosome has the advantages of being simple in preparation method, remarkable in tumor growth resistance and tumor cell migration inhibition effect, good in biocompatibility, high in delivery efficiency and the like, and can be used as a novel nano-drug for tumor treatment.

The invention belongs to the technical field of microbial pharmacy, and discloses a polyketone macrolide compound generated by genetically engineered streptomyces as well as a preparation method and application thereof. The polyketone macrolide compound disclosed by the invention is a cinnamyl streptomycin derivative, has cell proliferation inhibition activity better than that of a natural product Cinnamomycin A-D, can exert anti-tumor activity by inhibiting activity of human exonucleotide pyrophosphatase / phosphodiesterase 1 (ENPP1) and activating an inherent immune pathway, can be prepared into a medicine or a medicinal composition, and can be used for preparing medicines or medicinal compositions. The compound is used for treating tumors and related diseases.

There is a modified coronavirus spike antigen protein and uses therefor. The spike antigen protein of coronavirus exhibits suppression of cell membrane fusion ability and improves safety by modifying two protein cleavage sites present in the coronavirus spike protein. In addition, inoculation with a vaccine having the antigen protein induces production of a large number of neutralizing antibodies to inhibit invasion of coronavirus into cells, thereby suppressing viral proliferation.

This invention discloses a NK cell culture kit, its culture method, and its application. The kit includes an amplification medium, a high-efficiency induction medium, an NK-A coating solution, an NK-B mixture, and an NK-C mixture. The amplification medium contains basal medium, NAD+, human serum albumin, transferrin, β-glucan, glutathione, β-mercaptoethanol, and linoleic acid. The high-efficiency induction medium, in addition to the amplification medium components, contains soybean peptides, nicotinamide, inulin, and N-acetyl-L-cysteine. The NK-A coating solution contains heparin sodium, monoclonal antibodies, and antibodies. The NK-B mixture contains Inbakicept, IL-2, and IL-15. The NK-C mixture contains linolenic acid, IL-2, and IL-18. The Inbakicept factor in the kit can activate NK cells and enhance their cytotoxicity; linolenic acid can inhibit T cell proliferation, increase NK cell purity, and enhance cell efficacy.

The invention provides a method for treating AR negative TNBC through combination of quercetin and enzalutamide, the quercetin up-regulates the AR expression level by inhibiting a high-expression solute carrier SLC7A5, so that tumor cells which are not sensitive to enzalutamide originally obtain drug sensitivity again; the combined use of an AR antagonist enzalutamide (1-80 [mu] M) can cooperatively block an AR signal channel and significantly inhibit cell proliferation (the inhibition rate of drug combination is 70%, Plt, 0.01 higher than that of a single drug). In-vitro experiments prove that the scheme has a synergistic effect (the effect is optimal when the mass ratio is 1: 1-5: 1) in MDA-MB-231 cells, and an animal model shows that the tumor volume inhibition rate reaches 70% or above. Safety evaluation shows that the drug combination does not cause abnormity of serum biochemical indexes (ALT / AST / BUN / CREA) or damage of main organs and tissues. The invention further provides a preparation method of an oral preparation (tablets / capsules / nanoparticles) containing quercetin (50-500 mg / day) and enzalutamide (40-160 mg / day), and a new strategy is provided for reversing AR-TNBC drug resistance.

UBAS is a critical El-activating enzyme in the UFMylation pathway, a post-translational modification process implicated in neurodegenerative diseases and cancers. Here, a high-throughput screening (HTS) assay was developed to identify inhibitors of UBAS from various compound libraries. Eighteen novel UBAS inhibitors were identified, belonging to several distinct chemical scaffolds with low micromolar IC50 values. These inhibitors demonstrated selectivity for UBAS over other El enzymes, including UBA1, and showed efficacy in inhibiting endogenous UFMylation in HEK293T cells. The identified inhibitors not only provided valuable tools for studying UFMylation but also represented potential therapeutic candidates for diseases associated with dysregulated UFMylation, such as Alzheimer's disease and cancer.

The invention belongs to the technical field of compound application, and particularly relates to coriaria lactone compounds, a preparation method thereof and application of the coriaria lactone compounds in oxidative stress resistance. The coriaria lactone compound can significantly inhibit oxidative stress damage of SH-SY5Y cells, and the cell survival rate of the coriaria lactone compound is increased to 79.6%. Meanwhile, the nematode anti-aging activity is achieved, generation of nematode lipofuscin is inhibited, and the highest inhibition rate is 45%. In an extreme oxidative stress experiment, the service life of the nematodes is prolonged, so that the coriaria lactone compound has an application prospect of treating and resisting aging diseases.

The invention provides a p53 fusion protein based on a targeted colorectal cancer marker CEA and application of the p53 fusion protein in preparation of medicines for inhibiting colorectal cancer, and relates to the field of biological medicines. The fusion protein comprises any one of the following components: p28-p53, MBP-TEV-p14ARF (1-63)-linker-p28, p28-p53-CEABP1, CEABP1-p28-p53, and CEABP2-p28-p53, and the fusion protein comprises any one component selected from the group consisting of the following components: a protein A, a protein B, a protein A, a protein B, a protein C and a protein B, according to the application, p53 and p14 ARF proteins for inhibiting cell proliferation in a human body, cell-penetrating peptide and designed protein CEABP1 or CEABP2 of a targeted binding colorectal cancer marker CEA are fused for the first time, and cell experiments and mouse experiments prove that the protein has a relatively high function of inhibiting growth of colorectal cancer cells, does not influence normal cell growth and has a wide application value.

The invention discloses an amplification culture solution of TILs cells and a culture method thereof. The amplification culture solution comprises a complete culture medium, and an anti-BTLA antibody with the final concentration of 0.1-10 [mu] g / mL, penicillin with the final concentration of 50-500 [mu] g / mL, streptomycin with the final concentration of 50-500 [mu] g / mL, gentamicin with the final concentration of 10-100 [mu] g / mL and amphotericin with the final concentration of 1-50 [mu] g / mL are added into the complete culture medium. The anti-BTLA antibody component in the culture solution can relieve inhibition of BTLA on T cells by blocking combination of BTLA and a ligand HVEM of BTLA, so that the anti-tumor capability of TILs is enhanced; meanwhile, after the BTLA is combined with the ligand HVEM, T cell activation and proliferation can be inhibited, and rapid proliferation of TILs is promoted; the irradiation PBMC added in the TILs cell culture process can provide an activation signal for the TILs and drive rapid proliferation of the TILs cells.

The invention relates to the technical field of biological medicines, in particular to application of dauricine in preparation of medicines for inhibiting ovarian cancer SKOV3 cell proliferation and treating ovarian cancer. The invention finds that dauricine has a remarkable inhibition effect on drug-resistant ovarian cancer cells, the dauricine has a clear dose-dependent relationship on the inhibition activity of the ovarian cancer cells SKOV3 in a concentration range of 1-50 mu M, and the IC50 value is 2 mu M. Meanwhile, the effect of inhibiting SKOV3 cell proliferation of the dauricine can be remarkably improved by combining the dauricine with paclitaxel or 5-fluorouracil. Therefore, dauricine can be used for preparing medicines for inhibiting ovarian cancer SKOV3 cell proliferation and improving ovarian cancer multidrug resistance, and has a good clinical application prospect.

Disclosed herein are methods of treating ALS in a subject by administering to the subject a therapeutically effective amount of a composition comprising, for example, EV derived from nerve cells, such as neural progenitor cells. The EVs may be administered distally or peripherally to the CNS such that these EVs cross the blood-brain barrier and exert their therapeutic function in the CNS. The methods may reduce inflammation (e.g., NLRP3 inflammatory pathway signaling), reduce disease activity or progression, and / or improve motor or neurological performance, signs or symptoms associated with ALS, or survival in an ALS subject as compared to a control ALS subject. Also provided are methods of inhibiting necroptosis in a cell by contacting the cell with a therapeutically effective amount of a composition comprising EV.

Provided are double-stranded RNAs for inhibiting the expression of angiotensinogen (AGT) in a cell, vectors and cells comprising their encoding nucleotides, and methods of using the dsRNAs, vectors or cells to treat diseases or symptoms mediated or associated with the expression of AGT in a subject.

The invention relates to application of WDR74 and / or ALYREF as molecular targets in esophageal squamous cell carcinoma diagnosis and treatment, and belongs to the technical field of biological medicine. Aiming at the problem that the esophageal squamous cell carcinoma lacks an effective targeted treatment means, the invention discovers that the expression quantity of WDR74 in tumor tissues is obviously higher than that in para-carcinoma tissues, and the high expression of WDR74 prompts poor prognosis of a patient, and reveals that WDR74 protein and ALYREF protein have specific binding, and the mRNA stability of EGFR is enhanced through ALYREF-mediated m5C RNA epigenetic modification, so that STAT3 phosphorylation is activated, and the treatment effect of the esophageal squamous cell carcinoma is enhanced. Further, the STAT3 is combined with the promoter region of the apoptosis-inhibiting gene MCL1, and finally cell apoptosis is inhibited and tumor formation is promoted. The invention provides a new molecular target and a solution for developing a WDR74 and ALYREF targeting medicine for treating esophageal squamous cell carcinoma and related diagnosis and prognosis evaluation products.

The invention relates to compounds which inhibit Cyclin-Dependent Kinases such as CDK2 (Cyclin-Dependent Kinase 2 or Cell Division protein Kinase 2) and CDK4 (Cyclin-Dependent Kinase 4 or Cell Division protein Kinase 4), and to processes for the preparation of said compounds, pharmaceutical compositions comprising said compounds, and use of said compounds in the treatment of conditions, diseases and disorders mediated by CDK2 and / or CDK4.

The invention discloses jellyfish polypeptide with tyrosinase inhibitory activity and application of the jellyfish polypeptide, and belongs to the technical field of biology. A jellyfish crude polypeptide is prepared, a jellyfish polypeptide GEPINPEAWLWYYKYVG is identified and optimized from the jellyfish crude polypeptide, and experiments prove that the jellyfish polypeptide provided by the invention can inhibit the activity of tyrosinase in vitro, can inhibit melanin secretion of B16-F10 mouse melanoma cells, and can inhibit the activity of tyrosinase in the cells. Therefore, the jellyfish polypeptide can be used as a tyrosinase inhibitor and an anti-melanin synthesis agent and is applied to the fields of cosmetics, medical treatment and the like. Experiments prove that the jellyfish polypeptide provided by the invention has no cytotoxicity, is derived from ocean, and has no disease risks and religious barriers of terrestrial animals.

The present invention provides novel compounds of Formula (I) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers, isotopically labeled derivatives, and compositions thereof. Also provided are methods and kits involving the compounds or compositions for treating or preventing proliferative diseases in a subject, wherein the proliferative diseases include cancer, benign neoplasm, angiogenesis, inflammatory disease, autoinflammatory disease, and autoimmune disease, and the cancer includes leukemia, melanoma, multiple myeloma. Treatment of a subject having a proliferative disease with the compounds or compositions of the present invention can inhibit abnormal activity of cyclin-dependent kinase 7, thus inducing apoptosis and / or inhibiting transcription in the subject.

The invention belongs to the technical field of biological medicines, and particularly relates to application of cardiac glycoside medicines or pharmaceutically acceptable salts or derivatives thereof in preparation of products for inhibition, relief, adjuvant therapy or treatment of cancers and medicines. The invention provides application of cardiac glycoside drugs or pharmaceutically acceptable salts or derivatives of the cardiac glycoside drugs in preparation of products for inhibition, alleviation, adjuvant therapy or treatment of cancers and the drugs, and the cardiac glycoside drugs comprise deacetylated chaenoside, deacetylated chaenoside, deacetylated chaenoside, deacetylated chaenoside, deacetylated chaenoside, deacetylated chaenoside, deacetylated chaenoside and deacetylated chaenoside. According to the application disclosed by the invention, the effects of inhibiting, relieving, assisting in treating or treating cancers and potential mechanisms of the Deslanoside are researched in SH-SY5Y and SK-N-SH neuroblastoma cell lines, and results show that the Deslanoside can be used for inhibiting proliferation of SH-SY5Y cells and SK-N-SH cells, promoting apoptosis and respectively inducing a cell cycle to stop at a G0 / G1 phase; and G1 / S and G2 / M periods.

The invention provides an application of 2-indolecarboxylic acid in preparation of a tumor targeted therapy drug. Through computer-aided drug design and molecular docking optimization, 2-indolecarboxylic acid shows high binding energy to an HER2 kinase structural domain. In HER2 positive NCI-N87 gastric cancer cells, the 2-indolecarboxylic acid significantly inhibits cell proliferation and induces G0 / G1 phase arrest and apoptosis. The mechanism research shows that the 2-indoleformic acid can play a role by regulating and controlling the HER2 / Akt / beta-catenin pathway (Western blot verification). In an NCI-N87 cell tumor-bearing nude mouse model, 2-indolecarboxylic acid (15 mg / kg) significantly inhibits tumor growth, and does not cause obvious weight loss or organ toxicity. Immunohistochemical analysis shows that the positive rate of a tumor tissue proliferation marker Ki-67 in a treatment group is remarkably reduced, and apoptosis detection shows that the proportion of TUNEL positive cells is remarkably increased, which indicates that 2-indolecarboxylic acid inhibits tumor cell proliferation and promotes apoptosis at the same time. The invention provides a lead compound with clinical transformation potential for HER2 targeted therapy.

The invention discloses an application of a grifola frondosa extract in preparation of a medicine for inhibiting myeloid-derived suppressor cells. The polysaccharide extract is a grifola frondosa sporocarp polysaccharide extract, and the molecular weight range of the polysaccharide extract is 0.5 * 10 < 4 >-149 * 10 < 4 > Da. The grifola frondosa extract inhibits the spleen of a tumorigenic mouse from generating MDSCs, inhibits the proportion and quantity of MDSCs in the blood and tumor tissue of the tumorigenic mouse, and improves the content and activity of CD3 + T and CD8 + T lymphocytes, so that the immune response ability of the body is improved, and the grifola frondosa extract is not only suitable for preparing anti-tumor drugs, but also suitable for treating inflammatory-mediated tissue damage, infectious diseases and other diseases. And preparing medicines for treating MDSCs related diseases such as autoimmune diseases and the like.

Relates to the technical field of nucleic acid drugs, and particularly provides a double-stranded oligonucleotide for inhibiting complement factor B (CFB) gene expression, the double-stranded oligonucleotide comprises a sense strand and an antisense strand, the positive-sense strand comprises at least 15 continuous nucleotides in any sequence as shown in SEQ ID NO: 1-SEQ ID NO: 255 in a table 1 or a nucleotide sequence which is different from the at least 15 continuous nucleotides by not more than 3 nucleotides; and / or the antisense strand comprises at least 15 contiguous nucleotides in any sequence as shown in SEQ ID NO: 256-SEQ ID NO: 510 in the table 1 or a nucleotide sequence which is different from the at least 15 contiguous nucleotides by not more than 3 nucleotides. The double-stranded oligonucleotide can inhibit CFB gene expression in cells and achieve the effects of relieving, treating and / or preventing diseases or symptoms mediated by CFB gene expression abnormity.

This invention provides the application of a small molecule compound targeting PGK1 K131 in the treatment of intrahepatic cholangiocarcinoma. It is the first time that the lactation modification site of PGK1 K131 has been identified as an effective new target for iCCA. The first highly active small molecule targeting this site, ZINC000150392143, has been discovered and verified. It can inhibit the proliferation, migration and invasion of iCCA cells in vitro and significantly inhibit the growth of in situ liver tumors in vivo. This provides a new broad-spectrum anti-tumor strategy to overcome the limitations of existing iCCA therapeutic targets.

We provide compositions and methods to enhance the anti-cancer specificity of chimeric antigen receptor natural killer cells (CAR-NK) by activating them against cancer antigens while inhibiting them against human leukocyte antigen DR (HLA-DR). HLA-DR is reportedly lost or downregulated in a substantial proportion of hematologic malignancies. An anti-HLA-DR inhibitory CAR (iCAR) is provided to effectively suppress NK cell activation against HLA-DR-expressing cells. Dual CAR-NK cells, which co-express the anti-CD19 or anti-CD33 activating CAR and the anti-HLA-DR iCAR, can preferentially target HLA-DR-negative cells over HLA-DR-positive cells in vitro. The HLA-DR-mediated inhibition is positively correlated with both iCAR and HLA-DR densities. Surrounding cells that express HLA-DR do not affect the target selectivity of the dual CAR-NK cells. We have confirmed that HLA-DR-positive cells are resistant to dual CAR-NK cell-mediated killing in a xenograft mouse model. This can be used for enhancing CAR-NK and CAR-T cell specificity against malignancies with HLA-DR loss.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The application is suitable for the field of biological medicine technology, and provides a siRNA-PSMA conjugate targeting a LEPR gene, a preparation method and application thereof. The siRNA-PSMA conjugate realizes specific targeted delivery of CRPC cells through a PSMA inhibitor target head, effectively reduces off-target toxicity, combines with a high-interference-efficiency M3 modified LEPR siRNA screened, can efficiently silence LEPR gene expression, block a leptin-LEPR signal pathway, and then inhibit CRPC cell proliferation, invasion and drug resistance related biological functions; the preparation process is stable and controllable, the purity of the finished product after purification can reach more than 95%, meets the quality requirements of drug development, and the activity verification method has strong specificity and reliable results, fills the blank of CRPC targeted therapy drugs in the prior art, provides a new precise targeting strategy for CRPC treatment, and has important clinical application value and broad conversion prospect.

The invention provides a small molecule compound for targeted degradation of STAT6 protein, a preparation method of the small molecule compound and application of the small molecule compound in prevention and / or treatment of immune diseases, inflammatory diseases and cancers. The compound can effectively degrade and / or inhibit STAT6 protein in cells, and can be used for preparing drugs for treating and / or preventing related diseases or symptoms caused by STAT6 mediation.

The application discloses a kind of pentapeptide-based supramolecular assembly particles and its application as drug delivery carrier, belong to the field of biological assembly material.The TGCP of the present application, TGCP / nHA are prepared from TP5, HA and GA into carrier particles with drug loading performance and potential anti-inflammatory performance, it has spontaneous fluorescence performance, and can exist stably in neutral and alkaline environment, can be decomposed in acidic environment, can be loaded with small molecules with different solubility, and has certain programmed response performance at physiological and pathological pH.The present application is found through in-vitro experiment exploration that the carrier particles have good biocompatibility, and for in-vitro induced inflammatory cell experiment, it is found that TGCP and TGCP / nHA both have certain anti-inflammatory activity, can inhibit the expression of cell inflammatory factor IL-6, and play the role of inhibiting inflammation.

The present application relates to a kind of antitumor small molecule compounds and its preparation method and application, the small molecule compound has the structure shown in the following formula I.This new antitumor small molecule compound can inhibit LLC cell proliferation in vitro, and has good drugability, at animal level, no obvious toxic character to mouse, has better tumor inhibiting effect, and can enhance the inhibiting effect of PD-L1 antibody to non-small cell lung cancer, the combined administration of both can synergistically improve the treatment effect, safe and effective, can be used to prepare the drug for treating non-small cell lung cancer.

The present invention relates to products and compositions and their uses. In particular, the invention relates to nucleic acid products that interfere with the expression of the LPA gene or inhibit its expression, preferably for use as a treatment / treatment, prevention or reduction of the risk of (an individual) suffering from cardiovascular disease such as coronary heart disease or aortic stenosis or stroke or any other disorder, pathology or syndrome associated with elevated levels of Lp(a) particles.