Recombinant microorganism with enhanced production ability of recombinant silk protein and method for producing high molecular weight recombinant silk protein using the same

Abstract

The present invention relates to a recombinant microorganism having improved recombinant silk protein production capability and a method for producing a high molecular weight recombinant silk protein using the same, more specifically, to a recombinant microorganism having improved spider silk protein production capability by introducing a recombinant vector containing a sequence encoding a synthetic sRNA that suppresses the expression of the eno gene into a microorganism capable of producing a recombinant silk protein. The recombinant silk protein derived from the recombinant strain according to the present invention has a high molecular weight similar to that of the dragline silk protein produced from spiders, can be mass-produced, and has physical properties similar to or superior to those of natural silk protein when produced as fiber, and is therefore very useful in various industrial fields such as biotechnology and / or medicine, where spider web fiber is expected to be applied.

Description

Technical Field

[0001] The present invention relates to a recombinant microorganism having an improved ability to produce a recombinant silk protein and a method for producing a high-molecular-weight recombinant silk protein using the same. More specifically, the present invention relates to a recombinant microorganism in which the expression of the eno gene is suppressed and the ability to produce a spider silk protein is improved in a microorganism having the ability to produce a recombinant silk protein.

Background Art

[0002] Natural silk protein materials have been used as typical clothing materials for a long time. Recently, due to the excellent biocompatibility, excellent stretchability and physical strength of natural silk proteins, and the ability to be formed into various forms such as powders, films, porous bodies, and gels, and the ability to be chemically modified as natural proteins, etc., there is a very high possibility of being utilized as next-generation high-functional industrial materials.

[0003] Currently, silk proteins are mainly said to be produced from silkworms and spiders.

[0004] In the case of silkworm silk proteins, silkworms can be cultured, and 300 m 2Because it is possible to produce up to 5 kg from the area of [the silk gland of Bombyx mori] and about 1.5 million silkworms, it has been widely used in traditional textile manufacturing. In addition, natural silk fibroin protein has been presented as a potential material for industrial applications such as cosmetics, enzyme immobilization carriers, cell culture materials, and artificial skin because it is free from immune and allergic reactions and is gentle on the body. However, silk fibroin protein has some deficiencies in terms of physical properties, specifically strength, and there are still some limitations in its use as an industrial material. Therefore, various studies are currently being conducted to improve the physical properties of silk fibroin protein. For example, studies on the separation by molecular weight and functionality of silk fibroin, the main component of silk fibroin protein, studies on the production of fine powders of silk fibroin protein and their skin affinity, studies on improving physical properties by blending silk fibroin protein with chemically synthesized polymers, and studies on mixing silk fibroin protein with natural carbohydrate-based polymer compounds, among others.

[0005] In the case of spider silk protein, recently, since it has been revealed that the physical properties of spider silk protein obtained from nature are extremely excellent in terms of strength and elasticity, research for its use as an industrial material has been actively conducted. However, due to the cannibalistic nature of spiders, it is impossible to breed them, and the amount of silk protein produced by spiders is very small. It is said that it is practically impossible to isolate and produce natural proteins like silk fibroin protein for use. Therefore, research related to spider silk protein mainly focuses on introducing the spider silk protein gene into various protein expression systems to produce recombinant proteins. Various attempts have been made to mass-produce spider silk protein using Escherichia coli, yeast, plant cells, animal cells, transgenic animals, etc. Overall, research on spider silk protein has recently reported some excellent research results mainly due to intensive research and investment since the 2000s. However, unique characteristics such as the repetitive DNA sequence of the spider silk protein gene and the repetition of specific amino acid sequences such as glycine, alanine, and serine act as limitations in recombinant production of silk protein materials existing in nature.

[0006] Dragline spider silk used as the lifeline of spiders and used to form a radial spider web has high strength and elasticity. Spider silk has a strength five times that of steel per unit mass and is three times harder than high-quality human-made Kevlar fibers (Gosline, J. M. et al., J. Exp. Biol., 202:3295, 1999; Vollrath, F. & Knight, D. P., Nature 410: 541, 2001). Moreover, because it has biodegradable properties, it can be applied to the biomedical field such as sutures and scaffolds, because it has anti-inflammatory functions, it can be applied as an antibacterial material, and because it has excellent moisturizing power, it can also be used as various cosmetic materials. Therefore, dragline spider silk has attracted much attention as a material with various industrial applications.

[0007] However, unfortunately, spiders have a strong territorial protection instinct and are aggressive, so natural dragline spider silk cannot be easily obtained in spider cultivation, etc. Therefore, there have been many efforts to produce recombinant dragline silk proteins (Lazaris, A. et al., Science, 295:472, 2002; Teule, F. et al., Nat. Protoc., 4: 341, 2009; Arcidiacono, S. et al., Macromolecules, 35: 1262, 2002; Brooks, A. E. et al. Biomacromolecules, 9: 1506, 2008; Heim, M., Keerl, D. & Scheibel, T., Angew.Int.Ed. Engl., 48: 3584, 2009; Fahnestock, S. R. et al.).

[0008] All spiders studied to date have naturally produced dragline silk proteins with high molecular weights of 250 - 320 kDa. Dragline silk proteins synthesized from Escherichia coli have molecular weights of 163 kDa (Fahnestock S.R. & Irwin S.L., Appl. Microbiol. Biotechnol., 47:23, 1997), 284.9 kDa (KR 10-1317420, Xia, Xiao-Xia, et al. Proceedings of the National Academy of Sciences, Vo.107(32), pp. 14059-44063, 2010), and protein production of 386.8 kDa using rpnA gene expression inhibition (KR 10-101765255) and 556 kDa using split intein mediated ligation (Christopher H. Bowen et al., Biomacromolecules, Vol. 19, 9, pp. 3853-3860, 2018) have been reported, but there is a problem that both sufficient protein yield for commercial use and good quality fiber assembly could not be achieved.

[0009] Therefore, there is a need for a strain that can produce high-purity, high-molecular-weight recombinant silk proteins in large quantities.

[0010] Therefore, the inventors of the present invention made intensive efforts to solve the above problems and develop a strain that can produce high-purity, high-molecular-weight recombinant silk proteins in large quantities. As a result, when suppressing the expression of the target gene confirmed by MOMA simulation using sRNA, it was confirmed that high-purity, high-molecular-weight recombinant silk proteins can be produced in large quantities, and the present invention was completed.

Summary of the Invention

[0011] An object of the present invention is to provide a recombinant strain capable of producing high-molecular-weight recombinant silk proteins.

[0012] Another object of the present invention is to provide a method for producing a high-purity, high-molecular-weight recombinant silk protein using the strain.

[0013] To achieve the above object, the present invention provides a recombinant microorganism in which the expression of the eno gene is suppressed and the production ability of spider silk protein is improved in a microorganism having the ability to produce a recombinant silk protein.

[0014] The present invention also provides a method for producing a recombinant silk protein, comprising: (a) culturing the recombinant microorganism to produce a recombinant silk protein; and (b) recovering the produced recombinant silk protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1 is a conceptual diagram explaining the mechanism of action of the synthetic sRNA of the present invention.

[0016] (A) of FIG. 2 is a conceptual diagram showing the sRNA cassette of the eno gene selected according to an embodiment of the present invention, and (B) is a vector map containing the cassette.

[0017] FIG. 3 is a vector map containing the sRNA cassette of a gene further selected according to an embodiment of the present invention.

[0018] (A) of FIG. 4 is a result of confirming the expression level according to the length of the target binding site of the eno gene selected according to an embodiment of the present invention, (B) is a result of calculating the binding energy, and (C) is a graph showing the relationship between the binding energy and the expression level.

[0019] (A) and (B) of FIG. 5 are results of analyzing the expression level of the recombinant silk protein in an existing known strain, and (C) is a result of comparing the expression level of the recombinant silk protein by suppressing the expression of the eno gene selected according to an embodiment of the present invention.

[0020] Figure 6 shows the results of confirming the expression levels of the additional candidate genes selected according to an embodiment of the present invention.

[0021] Figure 7 shows the results of confirming the expression levels of the additional candidate genes selected according to an embodiment of the present invention.

[0022] Figure 8 shows the results of confirming the expression levels of the additional candidate genes selected according to an embodiment of the present invention.

[0023] (A) of Figure 9 shows the results of confirming the expression levels of the genes selected in the primary selection among the additional candidate genes selected according to an embodiment of the present invention, and (B) is a graph quantifying the results.

[0024] (A) of Figure 10 shows the results of confirming the expression levels according to the length of the target binding site of the ychM gene selected according to an embodiment of the present invention, (B) shows the results of calculating the binding energy, and (C) is a graph calculating the relationship between the binding energy and the expression level.

[0025] (A) of Figure 11 is a schematic diagram predicting the modified metabolic pathways of the strains in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed, (B) shows the expression level of the recombinant silk protein of the strains in which the expression of the eno gene and the ychM gene selected according to an example of the present invention is suppressed, which was measured and confirmed at the 6th hour after 1 mM IPTG induction when OD600 reached 100 at 30°C by fed-batch fermentation of the strains, and (C) shows the results of confirming the expression level of the recombinant silk protein produced when the expression of the candidate genes was further inhibited in the strains in which the expression of the eno gene was inhibited.

[0026] Figure 12 shows the results of RNA-seq analysis of a strain in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed. The left panel is a list of the genes most up-regulated, and the right panel is a list of the genes most down-regulated.

[0027] Figure 13 is a heatmap for the DEG list using RNA-seq of a strain in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed, indicating that various genotypes have changed compared to existing recombinant silk protein strains.

[0028] (A) in Figure 14 shows the results of confirming the expression changes of glycine, alanine, and serine-related genes in a strain in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed, (B) shows the results of confirming the expression changes of transcription- and translation-related genes, and (C) shows the results of confirming the amplification results of glycine, alanine, and serine tRNAs.

[0029] Figure 15 shows the results of optimizing the concentration of ammonium peroxydisulfate in the salting-out method for the separation and purification of a strain in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed.

[0030] The left panel in Figure 16 shows the results of confirming the purity of the recombinant silk protein separated and purified before performing microfiltration, and the right panel shows the results of confirming the purity after performing microfiltration.

[0031] (A) in Figure 17 shows the 30L fermentation results of a strain in which the expression of the eno gene and the ychM gene selected according to an embodiment of the present invention is suppressed, and (B) shows the 300L fermentation results.

[0032] The left panel of Figure 18 shows the result of 8% SDS-PAGE of the recombinant protein separated and purified after 30L fermentation of the strain according to an embodiment of the present invention, and the right panel shows the result of 15% SDS-PAGE of the separated and purified recombinant protein.

BEST MODE FOR CARRYING OUT THE INVENTION

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

[0034] The definitions of the main terms used in the detailed description of the present invention and the like are as follows.

[0035] As used in the present invention, the term "silk protein" means a protein biosynthesized by a recombinant protein production method as a synthetic silk protein having a molecular and structural profile similar to that of a natural silk protein, and examples thereof include dragline silk, silk fibroin, and flagelliform silk. Further, as used in the present invention, the term "silk-like protein" means a protein biosynthesized by a recombinant protein production method or the like, which contains a peptide having a glycine content of 10% or more similar to that of a silk protein as a repeating unit, and examples thereof include elastin, byssus, and collagen.

[0036] As used in the present invention, the term "spider web fiber" means a fiber similar to a natural spider web fiber produced using a synthesized recombinant silk protein, and the term "spider web-like fiber" means a fiber having physical properties similar to those of a spider web fiber produced using a synthesized recombinant silk-like protein.

[0037] As used herein, the term "recombinant protein" refers to a protein encoded by a nucleic acid sequence inserted into a vector, i.e., a self-replicating plasmid, virus, etc., or inserted into the genomic DNA of a host cell, or inserted so as to exist in the form of a separate molecule within the host, and means a protein expressed from said nucleic acid sequence.

[0038] As used herein, the term "host cell" means any cell capable of expressing a functional gene and / or gene product derived from another cell or organ.

[0039] As used herein, the term "sRNA (small RNA)" refers to a short-length RNA having a normal nucleotide sequence length of 200 or less that is not translated into a protein and effectively inhibits the translation of a specific mRNA through complementary binding.

[0040] As used herein, the term "ribosome binding site" refers to the site on mRNA to which a ribosome binds for transcription of mRNA.

[0041] As used herein, the term "gene" should be considered in the broadest sense and can encode a structural protein or a regulatory protein. At this time, regulatory proteins include transcription factors, heat shock proteins, or proteins involved in DNA / RNA replication, transcription, and / or translation. In the present invention, the target gene to be suppressed in expression may exist as an extrachromosomal component.

[0042] In the present invention, in order to develop a strain capable of producing a large amount of high-molecular-weight recombinant silk protein by manipulating the metabolic pathway from an existing high-molecular-weight recombinant silk protein-producing strain, a candidate gene group was selected using an sRNA library capable of inhibiting the expression of each gene, and then, when comparing the production amounts of these recombinant silk proteins to select an optimal gene combination, it was confirmed that a high-purity high-molecular-weight recombinant silk protein could be produced.

[0043] That is, in one embodiment of the present invention, after introducing an sRNA library capable of knocking down all genes of Escherichia coli into an existing recombinant silk protein-producing strain (KR 10-1317420), a candidate gene group expected to increase the production amount of recombinant silk protein was selected through substance metabolism pathway simulation by two or more gene knockdown regulations, and when suppressing the expression of this using sRNA, it was confirmed that the production amount of recombinant silk protein increased (FIGS. 2, 4, and 5).

[0044] Furthermore, when testing other candidate gene groups in the same method and suppressing the expression of additional genes in the genes selected at the above stage, it was confirmed that the production amount of recombinant silk protein increased dramatically (FIG. 11).

[0045] Therefore, from one aspect, the present invention relates to a recombinant microorganism in which the expression of the eno gene is suppressed and the production ability of spider silk silk protein is improved in a microorganism having the production ability of recombinant silk protein.

[0046] In the present invention, the suppression of the expression of the eno gene can be performed using any method known to an ordinary technician, and preferably, it is characterized by being performed by one or more methods selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that suppresses the expression of the gene, a method of changing a promoter, a method of introducing an antisense RNA, and a method of introducing siRNA, but is not limited thereto.

[0047] In the present invention, the recombinant microorganism is characterized in that the expression of one or more genes selected from the group consisting of gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB, and pykA is further suppressed.

[0048] In the present invention, the gene is characterized in that it is pstI, asnA, ychM, tesB, dhaK, guaA, pck, or purT, and more preferably, it is ychM or pstI.

[0049] In the present invention, the suppression of the expression of the gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB, or pykA gene can be carried out using any method known to those skilled in the art. Preferably, it is carried out by one or more methods selected from the group consisting of a method in which a sequence encoding a synthetic sRNA that suppresses the expression of the gene is introduced, a method of changing a promoter, a method of introducing an antisense RNA, and a method of introducing an siRNA, but is not limited thereto.

[0050] In the present invention, the information of the gene is the information of the gene described in https: / / www.uniprot.org / , but is not limited thereto.

[0051] In the present invention, the microorganism having the ability to produce the recombinant silk protein is characterized in that a gene encoding a recombinant silk protein in which the peptide having the amino acid sequence of SEQ ID NO: 1 is repeated 1 to 160 times, preferably 8 to 160 times, more preferably 16 to 160 times, or a recombinant vector containing the gene and a recombinant vector containing a nucleotide sequence encoding tRNA are introduced.

[0052] In the present invention, the microorganism having the ability to produce the recombinant silk protein is Escherichia coli BL21(DE3) ((F- ompT hsdSB(rB- mB-) gal dcm (DE3) pTet-glyVXY(CmR) pSH16a, 32, 64, 96(KanR))), but is not limited thereto.

[0053] In the present invention, the nucleotide sequence encoding the tRNA is characterized in that it is a nucleotide sequence encoding glycine tRNA.

[0054] In the present invention, the peptide is characterized in that it is a repeating unit peptide constituting a dragline silk protein.

[0055] In the present invention, a peptide having a glycine content of 10% or more in the silk protein or silk-like protein is a repeating unit peptide constituting a protein selected from the group consisting of dragline silk, elastin, silk fibroin, byssus, flagelliform silk, and collagen. The amino acid sequences of SEQ ID NOs: 1 to 4 are repeating unit peptides of dragline silk protein, the amino acid sequences of SEQ ID NOs: 5 to 7 are repeating unit peptides of elastin, the amino acid sequence of SEQ ID NO: 8 is a repeating unit peptide of silk fibroin, the amino acid sequence of SEQ ID NO: 9 is a repeating unit peptide of byssus, the amino acid sequence of SEQ ID NO: 10 is a repeating unit peptide of flagelliform silk, and SEQ ID NOs: 11 and 12 are repeating unit peptides of collagen. SEQ ID NO: 1: NH -SGRGGLGGQGAGMAAAAAMGGAGQGGYGGLGSQGT-COOH 2 SEQ ID NO: 2: NH -GPGQQQ-COOH 2 SEQ ID NO: 3: NH -GPGGY-COOH 2 SEQ ID NO: 4: NH -GGYGPGS-COOH 2 SEQ ID NO: 5: NH -GVGVP-COOH 2 SEQ ID NO: 6: NH -VPGG-COOH 2 SEQ ID NO: 7: NH -APGVGVGV-COOH 2 SEQ ID NO: 8: NH -GAGAGS-COOH 2 SEQ ID NO: 9: NH -GPGGG-COOH 2 SEQ ID NO: 10: NH -GPGGX-COOH 2 SEQ ID NO: 11: NH -GAPGAPGSQGAPGLQ-COOH 2 SEQ ID NO: 12: NH-GAPGTPGPQGLPGSP-COOH 2

[0056] In the present invention, a recombinant silk protein (hereinafter referred to as "48mer") produced to contain the amino acid sequence shown in SEQ ID NO: 1 as a repeating unit 48 times has a molecular weight of about 147 kDa, and has been confirmed to exhibit a significantly superior production amount compared to the production amounts of conventional recombinant silk protein strains. Furthermore, in the case of a recombinant silk protein (hereinafter referred to as "96mer") produced to contain the amino acid sequence shown in SEQ ID NO: 1 as a repeating unit 96 times, its molecular weight reaches 284.9 kDa, and a recombinant silk protein having a high molecular weight almost the same as that of the natural silk protein (250 to 320 kDa) obtained from spiders has also been confirmed to have a dramatic improvement in terms of production amount and purity compared to existing strains.

[0057] However, when the peptide sequence is contained in repeating units of 160 times or more, since it is outside the protein synthesis range of Escherichia coli, the recombinant silk or silk-like protein according to the present invention is characterized by having a structure in which the peptide is repeated 16 to 160 times, preferably 48 to 160 times, and more preferably 96 to 160 times.

[0058] In the present invention, the amino acid sequence used as the repeating unit is not limited to the exact sequences of SEQ ID NOS: 1 to 12. Also, the amino acid sequence here includes variants. Therefore, the amino acid sequence of the protein of the present invention also includes all sequences that are changed by insertions, deletions, and substitutions.

[0059] Preferably, the "substitution" of an amino acid is the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties, i.e., a conservative amino acid replacement. Amino acid substitutions may be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the relevant residues. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0060] The "insertion" or "deletion" within the repeating unit is typically in the range of about 1 to 5 amino acids, preferably about 1, 2, or 3 amino acids. At this time, the addition of amino acids increased by the addition of amino acids inserted into the repeating unit is typically less than 100, preferably less than 80, more preferably less than 50, and most preferably less than 20 amino acids, and is inserted into the repeating unit of the present invention and inserted into and / or added to the protein. It should be noted that in the present invention, only such additions that do not adversely affect the required properties of the proteins described herein are considered.

[0061] Permissible modifications may be determined experimentally by systematically performing amino acid insertions, deletions, or substitutions in a protein using recombinant DNA techniques and analyzing the activity of the resulting recombinant variants. This does not require more than routine experimentation by those skilled in the art.

[0062] Therefore, the present invention is characterized by including, as a repeating unit, an amino acid sequence having at least 90% or more homology with SEQ ID NO: 1. In the present invention, "having at least 90% or more homology" means showing 91, 91.5, 92, 92.5, 93, 93.5, 94, 94.5, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99, 99.5% identity with the sequence of SEQ ID NO: 1, and "homology" means the degree of similarity between two amino acid sequences. Having homology means being similar in sequence and function. Homology comparison can be performed visually, but usually, the percentage of homology between two or more sequences can be calculated using readily accessible sequence comparison software (Wilbur, W. J. & Lipman, D. J., Proc. Natl. Acad. Sd. USA., 80:726, 1983).

[0063] In the present invention, the synthetic sRNA is characterized by including an Hfq binding site derived from any one of MicC, SgrS, and MicF sRNAs, and a region that forms a complementary bond with the target gene mRNA.

[0064] In the present invention, the sequence encoding the synthetic sRNA that suppresses the expression of the eno gene can be represented by the nucleotide sequence of SEQ ID NO: 16. SEQ ID NO: 16 (eno): ATGTCCAAAATCGTAAAA

[0065] In the present invention, the sequences encoding the synthetic sRNAs that suppress the expression of the pstI, asnA, ychM, tesB, dhaK, guaA, pck, or purT genes can be represented by the nucleotide sequences of SEQ ID NOs: 17 to 24. SEQ ID NO: 17 (pstI): ATGATTTCAGGCATTTTAGCATCC SEQ ID NO: 18 (asnA): ATGAAAACCGCTTACATTGCCAAA SEQ ID NO: 19 (ychM): GTGAACAAAATATTTTCCTC Sequence number 20 (tesB): ATGAGTCAGGCGCTAAAAAAAATTTA Sequence number 21 (dhaK): ATGAAAAAAAATTGATCAATGATGTG Sequence number 22 (guaA): ATGACGGAAAACATTCATAAGCAT Sequence number 23 (pck): ATGCGCGTTAACAATGGTTTGACC Sequence number 24 (purT): ATGACGTTATTAGGCACTGCGCTG

[0066] In the present invention, the method for introducing a sequence encoding a synthetic sRNA that suppresses the expression of the target gene into a microorganism can utilize any method known to an ordinary technician. Preferably, a recombinant vector containing a sequence encoding a synthetic sRNA that suppresses the expression of the target gene can be utilized, or a method of directly injecting a sequence encoding a synthetic sRNA that suppresses the expression of the target gene into the chromosome of the microorganism can be utilized. More preferably, a method of utilizing a recombinant vector containing a sequence encoding a synthetic sRNA that suppresses the expression of the target gene can be used, but is not limited thereto.

[0067] In the present invention, the recombinant vector containing a sequence encoding a synthetic sRNA that inhibits the expression of the target gene can include an Hfq binding site derived from any one of the sRNAs of MicC, SgrS, and MicF, which are promoters, a region that forms a complementary bond with the target gene mRNA, and a terminator.

[0068] In the present invention, any type of promoter that can induce the expression of sRNA can be used as the promoter. Preferably, it can be selected from the group consisting of tac, trc, T7, BAD, λPR, and the Anderson synthetic promoter, and can be represented by the nucleotide sequence of SEQ ID NO: 13. SEQ ID NO: 13: 5'- taacaccgtgcgtgcgtgttgactattttacctctggcggcggtgataatggttgc-3'

[0069] In the present invention, the Hfq binding site is preferably derived from MicC and can be represented by the nucleotide sequence of SEQ ID NO: 14. SEQ ID NO: 14: 5'-tttctgttgggccattgcattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttttt-3'

[0070] In the present invention, as the terminator, any type of terminator capable of terminating the transcription of sRNA can be used. Preferably, it can be a T1 / TE terminator, and most preferably, it can be represented by the nucleotide sequence of SEQ ID NO: 15. SEQ ID NO: 15: 5'- ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtttttatctgttgttgtttgtcggtgaacgctctctctactagagagtcacactggctcaccttcgggtgggcctttttctgcgtttata-3'

[0071] In the present invention, "complementary binding" means forming base pairs with each other between nucleic acid sequences, and the sequences of the regions that form complementary binding with a partial region of the mRNA of the target gene and the target gene mRNA are about 70-80% or more, preferably about 80-90% or more, more preferably about 95-99% or more complementary to each other.

[0072] In the present invention, the term "vector" means a DNA preparation comprising a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. When transformed into a suitable host, the vector can replicate and function independently of the host genome or, in some cases, integrate into the genome itself. Currently, since plasmids are the most commonly used form of vectors, in the specification of the present invention, the terms "plasmid" and "vector" are sometimes used interchangeably. For the purposes of the present invention, it is preferred to use plasmid vectors. A typical plasmid vector that can be used for this purpose has a structure comprising (a) an origin of replication that allows efficient replication such that several to several hundred plasmid vectors are included per microorganism, (b) an antibiotic resistance gene that allows selection of the microorganism transformed with the plasmid vector, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even in the absence of a suitable restriction enzyme cleavage site, ligation of the vector and the foreign DNA can be easily achieved using synthetic oligonucleotide adaptors or linkers by conventional methods. After ligation, the vector must be transformed into a suitable microorganism. Transformation can be easily achieved using methods such as the calcium chloride method or electroporation (Neumann, et al. EMBO J., 1:841, 1982). As the vector used for the expression of sRNA according to the present invention, expression vectors known in the art can be used.

[0073] In the present invention, a base sequence is "operably linked" when arranged in a functional relationship with another nucleic acid sequence. This is a gene and regulatory sequence(s) that are linked such that appropriate molecules (e.g., transcription activating proteins) can enable gene expression when bound to the regulatory sequence(s). For example, DNA for a pre-sequence or a secretion leader is operably linked to DNA for a polypeptide when expressed as a precursor protein involved in the secretion of the polypeptide, and a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence, or a ribosome binding site is operably connected to a coding sequence when it affects the transcription of the sequence, or a ribosome binding site is operably connected to a coding sequence when arranged to facilitate translation. Generally, "operably linked" means that the linked DNA sequences are in contact and, in the case of a secretion leader, are in contact and present in the reading frame. However, an enhancer does not need to be in contact. The connection of these sequences is done by ligation at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used by conventional methods.

[0074] In the present invention, the microorganism is characterized by being selected from the group consisting of Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, cyanobacterium and Cyclobacterium.

[0075] On the other hand, in another embodiment of the present invention, when the recombinant silk protein is produced using the strain and then separated and purified using the salting-out method, it was confirmed that a high-purity recombinant silk protein can be obtained (Figure 16).

[0076] Therefore, from another aspect, the present invention relates to a method for producing a recombinant silk protein, comprising: (a) culturing the recombinant microorganism to produce a recombinant silk protein; and (b) recovering the produced recombinant silk protein.

[0077] In the present invention, the step (b) is characterized by including a salting out step.

[0078] Preferably, the step of obtaining the recombinant silk protein can be carried out by the following steps, but is not limited thereto. (a) After subjecting the fermentation broth to Cell down (4000 rpm / 30 min), performing cell resuspension using a solution obtained by adding 8 M urea and 2 M thiourea to a Buffer A (1 mM Tris-HCl (pH 8.0), 20 mM NaH2PO4) solution; (b) Mixing the cell suspension at 25°C for 6 hours using a magnet; (c) Adjusting the pH to 4.0 using glacial acetic acid and mixing at 25°C for 2 hours using a magnet; (d) Centrifuging at 10000 rpm for 20 minutes; (e) Obtaining the supernatant, injecting (NH4)2SO4 to a concentration of 0.85 M, mixing for 6 hours, and precipitating; (f) Centrifuging at 100000 rpm for 20 minutes; (g) Obtaining the supernatant and precipitating using 1.3 M (NH4)2SO4; (h) Obtaining the precipitate and dissolving it using a solution added with Buffer A and 8 M Urea; (i) Dialyzing for 12 hours using a solution obtained by mixing 1.5 M Urea and Buffer A; (j) Dialyzing for 12 hours using Buffer A, and (k) Freeze-drying the pellet obtained by centrifugation.

[0079] In the present invention, the centrifuged pellet can be concentrated by various known methods and then freeze-dried.

Example

[0080] Hereinafter, the present invention will be described in more detail by way of examples. It will be apparent to those skilled in the art that these examples are merely for illustrative purposes of the present invention, and the scope of the present invention should not be construed as being limited by these examples.

[0081] Example 1. Preparation and introduction of sRNA tailored to a recombinant silk protein-producing strain An sRNA (Na, Dokyun, et al. Nature biotechnology, 31.2, pp. 170-174, 2013) system, which was constructed to be able to knockdown each E. coli gene in a known recombinant silk protein-producing strain (KR 10-1317420), was newly introduced according to the spider silk protein-producing strain. A new sRNA platform was prepared using the pColA-Sm vector with Streptomycin (hereinafter referred to as Sm) as a marker and the pACYC184-Cm vector with Chloramphenicol (hereinafter referred to as Cm) as a marker so as not to overlap with the marker (Kanamycin, denoted as Km) of the spider silk protein production vector and the replication origin ColE.

[0082] The synthetic regulatory sRNA used in the present invention utilized the MicC scaffold and the T1 / TE terminator based on the PR promoter. The two synthetic regulatory sRNA platform plasmids were prepared through Gibson assembly from three DNA fragments consisting of an sRNA fragment, an antibiotic marker (antibiotic resistance gene) fragment, and a replication origin fragment (D.G. Gibson et al., Nature Methods (2009), 6(5), 343-345).

[0083] Example 2. Target gene selection To screen for effective gene deletion targets for increasing the production of spider silk protein, MOMA (minimization of metabolic adjustment) simulation was introduced. To conduct the MOMA simulation, a metabolic network model of spider silk protein production was constructed using the reaction relationships of genes, proteins, and biochemistry. Using the glycine and serine production pathways that form the core of the spider silk protein structure, a metabolic network model of microorganisms was constructed. Using the constructed model, metabolic characteristics such as metabolic flux were analyzed, and deletion target pairs that improve the production ability of spider silk protein upon knockdown were screened using simulations based on metabolic flux analysis.

[0084] The deletion target screening method according to the present invention is different from the conventional linear method and was obtained by introducing quadratic programming (Segre et al. Proc. Nat.l Acad. Sci. 99: 15112-15117. 2002). Therefore, based on the effects of knocking down various targets on the expression of the target product simultaneously, rather than a single target, deletion targets can be efficiently predicted.

[0085] As a result, as shown in Table 1, 30 or so gene pairs were selected from 20 or so reaction pairs predicted to be the most effective targets, and the eno gene was commonly selected in all 30 or so corresponding gene pairs. The eno gene was preferentially knocked down and an attempt was made to optimize it.

[0086]

Table 1

[0087] Example 3. Verification of the knockdown effect of the primary selected eno gene Based on the pColA-Sm vector, a synthetic regulatory sRNA was constructed to knockdown the eno gene by utilizing the pR promoter, MicC scaffold, and T1 / TE terminator (Table 3). In the case of the eno gene, since it is an essential gene indispensable for the growth of Escherichia coli, if it is completely knocked out or knocked down with high efficiency, it will impede the growth of cells. Therefore, the length of the target binding site, which is the site where the sRNA binds to the gene, was adjusted from 15-nt to 24-nt (Table 2) in an attempt to obtain an optimal knockdown effect.

[0088] At this time, in order to calculate the binding energy, UNAFOLD (Unified Nucleic Acid Folding.) software, which can calculate the binding energy based on the length and sequence information of nucleotides, was used (Markham, Nicholas R., and Michael Zuker. Bioinformatics. Humana Press, 2008).

[0089] As a result, as described in Figure 4, it was confirmed that as the length of the binding site increased, the binding energy became lower and the knockdown effect became stronger. Also, through experiments, it was confirmed that the knockdown effect decreased at binding sites of 15-16 nt, and when binding sites of 22-nt or more were used, the growth of cells was severely inhibited due to an overly high knockdown effect. Finally, as a result of confirming the expression level of the spider silk protein with the repeat sequence repeated 48 times depending on the length of the binding site by SDS-PAGE and Bradford assay (Biorad, USA), it was confirmed that the expression was the best at a binding site length of 18-nt.

[0090] The silk expression ability of the Eno knockdown strain produced using this was compared with that of the existing silk yield-increasing strains, namely, the glyA doubling strain and the RnpA expression-inhibiting strain. As a result, in the eno knockdown regulatory group that utilized the length of the 18-nt binding site, an improvement in expression similar to or slightly higher than that of the existing yield-increasing strains was confirmed (Figure 5).

[0091] Accordingly, knockdown experiments were conducted on additional targets in order to obtain strains with even more significantly increased production than the existing system through additional engineering based on eno knockdown.

[0092]

Table 2

[0093]

Table 3

[0094] Example 4. Selection of additional target genes A synthetic regulatory sRNA for knocking down additional target genes was produced using the pR promoter, micC scaffold, and T1 / TE terminator based on the pACYC184-Cm vector (Table 5). Since there were essential genes among the additional targets, screening was based on the length of the 20-nt binding site, and an attempt was made to optimize the length of the target binding site for the group with the best expression.

[0095] From approximately 30 gene pairs selected from approximately 20 reaction pairs selected through MOMA simulation, the expression levels of the silk protein repeated 48 times were confirmed by SDS-PAGE and Bradford assay (Biorad, USA). As a result, after the primary screening (n = 3), improved expression similar to or better than the conventional level was confirmed in eight gene groups, namely, the pstI, asnA, ychM, tesB, dhaK, guaA, pck, and purT groups (Figures 6 to 8).

[0096] The expression of the above eight gene groups was reconfirmed, and secondary screening was performed. As a result, significantly improved protein expression was confirmed in the ychM and pstI groups (Figure 9). Among them, the best growth and protein expression were confirmed in the ychM group, which was selected as the final group, and the knockdown efficiency of this group was optimized (Table 4).

[0097] At this time, in order to calculate the binding energy, UNAFOLD (Unified Nucleic Acid Folding.) software, which can calculate the binding energy based on the length and sequence information of nucleotides, was used (Markham, Nicholas R., and Michael Zuker. Bioinformatics. Humana Press, 2008).

[0098] Thereby, it was confirmed that the longer the length of the binding site, the lower the binding energy and the stronger the knockdown effect. Finally, the expression level of the spider silk protein with the repeat sequence repeated 48 times according to the length of the binding site was confirmed by SDS-PAGE and Bradford assay (Biorad, USA). As a result, it was confirmed that the expression was the best with the length of the 20-nt ychM binding site (Figure 10).

[0099]

Table 4

[0100]

Table 5

[0101] Example 5. Confirmation of the recombinant silk protein production amount of the final strain Among the 30 target pairs finally selected by MOMA simulation, the group in which eno and ychM were knocked down was selected as the group showing the best expression. As a result of confirming the transpiration results of the strain through 5L Fed-batch fermentation, when cultured at 30 °C and OD 600 reached 120, the highest expression was shown 6 hours after induction with 1 mM IPTG. At this time, the 48-mer high molecular weight spider web showed a high expression level corresponding to about 16% in terms of band intensity in the SDS-PAGE results. As a result of analysis by Bradford assay, it was confirmed that this corresponded to about 10.5 g / L (Figure 11). This is a result of about 10-fold improvement compared to the existing highest titer (Xia, 2009, PNAS).

[0102] Example 6. Final gene selection and analysis of improved strains After the final gene selection, RNA Seq was performed to analyze the improved strain. For this purpose, sampling was performed 6 hours after induction with 1 mM IPTG when OD 600 reached 0.4 in a 50 ml baffled flask culture at 30 °C for the spider silk protein production strain, and the spider silk protein production strain in which the expression of eno and ychM genes was suppressed was normalized to OD 600 4, and RNA Seq was carried out via Macrogen.

[0103] As a result of checking the heat map for the DEG list using the RNA-seq of the selected strain in which the expression of eno gene and ychM gene was suppressed, it was confirmed that various genotypes changed compared to the existing recombinant silk protein strain (Figure 12, Figure 13). Among them, the expression changes of glycine, alanine and serine related genes, the expression changes of transcription and translation related genes, and the amplification results of glycine, alanine and serine tRNA were confirmed (Figure 14).

[0104] In addition, as a result of comparing the metabolic pathways of a general wild-type strain with those of a strain in which eno and ychM were knocked down, it was confirmed that in the strain in which eno and ychM were knocked down, the process of converting from Glyceraldehyde 3-phosphate to pyruvate was inhibited, and the production pathways of proteins forming major structures such as serine, glycine, and alanine were further activated. Also, the action of fumaric acid and succinic acid efflux transporters was suppressed, the progress of the TCA cycle was suppressed, and similarly, it was predicted that the production pathways of proteins forming major structures such as serine, glycine, and alanine would be further activated (Figure 11, A).

[0105] Example 7. Confirmation of mass production of recombinant silk protein using an improved strain In order to industrially utilize spider silk silk protein, an attempt was made to optimize the separation and purification process, which is one of the major challenges in recombinant protein production. Precipitation using salting out was performed to separate the protein from a large amount of fermentation broth relatively easily and efficiently. Usually, such a method is often used for protein concentration, but in the case of the produced high-molecular-weight spider silk, it has a very large size of 147 kDa, and there are not many proteins with a size larger than that in E. coli. Therefore, it was expected that by optimizing the precipitation method using such characteristics, the desired target could be purified easily and efficiently.

[0106] Therefore, as a result of separating and purifying the fermentation broth at various primary and secondary precipitation concentrations, it was confirmed that when ammonium persulfate was added at 1.0 M for the primary and 1.3 M for the secondary, the purification efficiency was the best at a purity of about 75% (Figure 15).

[0107] In addition, after performing microfiltration using a 50 kDa membrane filter and checking the purified sample (Figure 16), other proteins except for the very large-sized spider silk silk protein were filtered out, and a higher purity corresponding to about 80% or more was obtained. This was also confirmed to give the same result at a purity of about 85% in a large amount of separation and purification performed under the same conditions after the progress of 30 L of large-scale fermentation (Figure 18).

[0108] As described above, specific parts of the content of the present invention have been described in detail. However, it will be apparent to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention thereby. Therefore, it can be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

Industrial Applicability

[0109] The recombinant silk protein derived from the recombinant strain according to the present invention has a high molecular weight similar to that of the dragline silk protein produced by spiders, while enabling mass production, and has physical properties similar to or superior to those of natural silk proteins when manufactured as fibers. Therefore, it can be used in various industrial fields such as the field of biotechnology and / or the pharmaceutical field where the application of spider web fibers is expected, and is very useful.

Claims

1. A recombinant microorganism having an improved ability to produce spider silk protein due to suppression of the expression of the eno gene in a microorganism having the ability to produce a recombinant silk protein, wherein the microorganism having the ability to produce the recombinant silk protein is a microorganism having the ability to produce a recombinant silk protein into which a gene encoding a recombinant silk protein in which a peptide having the amino acids of SEQ ID NO: 1 is repeated 1 to 160 times, or a recombinant vector containing the gene, and a recombinant vector containing a nucleotide sequence encoding tRNA have been introduced, the suppression of the expression of the eno gene is characterized by being carried out using a synthetic sRNA that suppresses the expression of the eno gene and has a binding site length of 17 to 21 nt, the suppression of the expression of the eno gene is characterized by being lower in expression than the recombinant microorganism that is the parental strain in which the expression of the eno gene was not suppressed, the improvement in the ability to produce the spider silk protein is characterized by being improved compared to the recombinant microorganism that is the parental strain in which the expression of the eno gene was not suppressed. A recombinant microorganism.

2. A recombinant microorganism having an improved ability to produce spider silk protein according to claim 1, characterized in that the expression of one or more additional genes selected from the group consisting of gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB and pykA is further suppressed.

3. The suppression of the expression of the additional gene is carried out by one or more methods selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that suppresses the expression of the gene, a method of changing a promoter, a method of introducing an antisense RNA, and a method of introducing an siRNA. The recombinant microorganism having an improved ability to produce spider silk protein according to claim 2.

4. The additional gene is pstI, asnA, ychM, tesB, dhaK, guaA, pck or purT. The recombinant microorganism according to claim 2.

5. The recombinant microorganism according to claim 1 or 3, wherein the synthetic sRNA contains an Hfq binding site derived from any one of MicC, SgrS, and MicF, and a region that forms a complementary bond with the eno gene mRNA.

6. The recombinant microorganism according to claim 1, wherein the microorganism is selected from the group consisting of Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, cyanobacterium, and Cyclobacterium.

7. The recombinant microorganism according to claim 1, wherein the peptide is a repeating unit peptide constituting a dragline silk protein.

8. A method for producing a recombinant silk protein, comprising: (a) culturing a recombinant microorganism according to any one of claims 1 to 7 to produce a recombinant silk protein; and (b) recovering the produced recombinant silk protein. **Claim 9** The method for producing a recombinant silk protein according to claim 8, wherein the step (b) includes a salting out step.

Images