Transpiration inhibitor using jasmonic acids

Jasmonic acids, particularly prohydrojasmon, are used to reversibly suppress transpiration in rice, addressing issues related to climate change and maintaining crop yield and quality.

JP7695687B2Active Publication Date: 2025-06-19NAT AGRI & FOOD RES ORG

Patent Information

Application Number
JP2021048882
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-03-23
Publication Date
2025-06-19
Estimated Expiration
2041-03-23

AI Technical Summary

Technical Problem

Climate change caused by global warming leads to issues such as leaf transplant shock, drought damage, and reduced yield and quality in rice due to excessive transpiration during high temperatures, which existing transpiration suppressants fail to address effectively.

Method used

The use of jasmonic acids, specifically prohydrojasmon, to rapidly and reversibly suppress transpiration in plants like rice, thereby preventing the negative impacts of transplant shock, drought, and excessive heat-related transpiration.

Benefits of technology

This approach effectively suppresses transpiration by up to 80% in rice, is reversible, and can be flexibly applied to respond to changing weather conditions, thereby maintaining yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007695687000004
    Figure 0007695687000004
  • Figure 0007695687000005
    Figure 0007695687000005
  • Figure 0007695687000006
    Figure 0007695687000006
Patent Text Reader

Abstract

To provide a transpiration suppressing composition.SOLUTION: Provided is a composition for suppressing transpiration of plant body or part thereof that contains jasmonic acid or the like. The present disclosure also provides a method for suppressing transpiration of plant body or part thereof, comprising applying a jasmonic acid derivative to the plant or part thereof. Jasmonic acid or the like can include, but is not limited to, prohydrojasmonic acid. Target plant can include, but is not limited to, emergent plant or wet plant.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to transpiration suppression technology. More specifically, the present disclosure relates to a reversible transpiration suppression technology using jasmonic acids.

Background Art

[0002] Climate change caused by global warming is a serious problem in the agricultural field. In rice, problems such as leaf transplant shock, drought damage during transplantation, and reduced yield and quality due to excessive transpiration caused by high temperatures during ripening have become issues. One solution to the problem is the suppression of excessive transpiration by applying a transpiration suppressant.

Summary of the Invention

Means for Solving the Problems

[0003] The present disclosure enables the rapid suppression of transpiration in plants (e.g., rice) by applying jasmonic acids, and prevents the reduction of quality and yield due to transplant shock, drought damage, and excessive transpiration caused by high temperatures during ripening. Although not wishing to be bound by theory, the present disclosure solves the problem that since it physically closes the stomata, it is difficult to reversibly increase transpiration again, and the yield and quality may decrease depending on the application timing and weather conditions.

[0004] The agent used in the present disclosure induces temporary stomatal closure by application, resulting in transpiration suppression, but it is a reversible reaction, and it is possible to flexibly respond to changes in weather conditions and the like for transpiration suppression.

[0005] In the present invention, it is intended that one or more of the above features can be provided in further combinations in addition to the explicitly stated combinations. Further embodiments and advantages of the present invention will be recognized by those skilled in the art upon reading and understanding the following detailed description as necessary.

Effects of the Invention

[0006] This disclosure has solved significant problems in the agricultural field caused by climate change due to global warming. For example, in rice, problems such as leaf transplant shock, drought damage during transplantation, and reduced yield and quality due to excessive transpiration caused by high temperatures during ripening have been solved. This disclosure has solved the problem of suppressing excessive transpiration by applying a transpiration inhibitor. In particular, this disclosure enables, for example, by applying jasmonic acids such as prohydrojasmon, to rapidly suppress the transpiration of plants such as rice, and prevent the reduction of quality and yield due to transplant shock, drought damage, and excessive transpiration caused by high temperatures during ripening.

[0007] The transpiration suppression effect of this disclosure in plants such as rice has the characteristic that the effect appears reversibly compared to existing transpiration inhibitors.

Brief Description of the Drawings

[0008]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Mode for Carrying Out the Invention

[0009] Hereinafter, the present disclosure will be described. Throughout this specification, it should be understood that singular expressions include the concepts of their plurals unless otherwise specified. Therefore, singular articles (for example, "a", "an", "the", etc. in English) should be understood to include the concepts of their plurals unless otherwise specified. Also, the terms used in this specification should be understood to be used in the meanings commonly used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical terms and scientific and technological terms used in this specification have the same meanings as commonly understood by those skilled in the art to which the present disclosure pertains. In case of contradiction, this specification (including the definitions) shall prevail.

[0010] (Definition) In this specification, "about" indicates plus or minus 10% of the subsequent numerical value unless otherwise specified.

[0011] In this specification, "transpiration suppression" means that when applied to all or part of a plant body (for example, leaves, spikes, etc.), water transpiration is suppressed compared to the case where it is not applied. The effect of transpiration suppression may be direct based on its components, or in the case where the component is a gene or the like, it may be realized by a gene product or the like expressed as a result of being applied to or incorporated into a plant.

[0012] As used herein, "reversible transpiration suppression" means that the transpiration suppression effect is reversible, i.e., once the transpiration suppression effect is achieved, it can return to its original state (the transpiration suppression effect disappears or decreases).

[0013] In one embodiment, the transpiration evaluated by the method for confirming the transpiration suppression effect in the present disclosure is suppressed to 80% or less, preferably 50% or less, more preferably 35% or less, and most preferably 20% or less compared to the transpiration of plants without using the transpiration suppression component of the present invention. Examples of the dosage form of the transpiration suppression component include liquid, fine powder, paste, etc. However, as long as it does not impair the stability of the active ingredient contained in the transpiration suppression component of the present disclosure and can be used in the usage examples described later, other dosage forms can also be adopted.

[0014] As used herein, "jasmonic acids" include jasmonic acid and jasmonic acid derivatives. Jasmonic acid includes free jasmonic acid and salts of jasmonic acid. The salts of jasmonic acid are not particularly limited, and examples include sodium salt, potassium salt, magnesium salt, and calcium salt. Examples of jasmonic acid derivatives include methyl jasmonate, prohydrojasmon, glucosyl jasmonate, epi-jasmonic acid, methyl epi-jasmonate, dihydrojasmonic acid, tuberonic acid, and amino acid derivatives of jasmonic acid. Examples of amino acid derivatives of jasmonic acid include isoleucine jasmonate, phenylalanine jasmonate, and valine jasmonate. These jasmonic acid-related compounds may be included alone as a transpiration suppression component or in any combination.

[0015] As used herein, "prohydrojasmon" is registered as propyl=(1RS,2RS)-(3-oxo-2-pentylcyclopentyl)acetate containing 10±2% of propyl=(1RS,2SR)-(3-oxo-2-pentylcyclopentyl)acetate for pesticide registration and is known as a plant growth regulator of jasmonic acid derivatives. For the purposes of the present disclosure, this ratio can be arbitrary. Prohydrojasmon is an artificially produced jasmonic acid derivative commonly used as a plant growth regulator for various fruits and rice seedlings. Prohydrojasmon has been confirmed to affect various biological processes in a manner similar to jasmonic acid. Prohydrojasmon promotes the accumulation of anthocyanins in grapes and apples, improves the hand-picking efficiency of Satsuma mandarins, induces a defense response against the corn borer in corn, and also has an effect on the phenolic compounds, anthocyanin accumulation, and antioxidant activity of Komatsuna and lettuce. It is also a growth regulator that suppresses germination and root growth in both indica and japonica varieties of rice.

[0016] In the present disclosure, the effect of prohydrojasmon (also denoted as PDJ) on transpiration was investigated in comparison with commercially available microcrystalline wax and paraffin agents. Takarikari is a high-yield indica variety that exhibits a higher transpiration rate than common japonica varieties (Fukuda et al., 2018). In some embodiments of the present disclosure, PDJ activity was shown to prevent transpiration in rice using Takarikari. According to the results of the examples of the present application, it was shown that PDJ functions in a manner different from commercially available agents and can be used to reduce excessive transpiration in rice.

[0017] In this specification, "plant spraying" means that the target component is directly sprayed onto the plant. For plant spraying, it is only necessary that the target component is mainly sprayed onto the plant, and a small amount of the component may be incidentally sprayed into the environment. In plant spraying, for example, the effects intended by the present disclosure can be achieved by directly applying the target component to the plant. Examples of the method of plant spraying include, but are not limited to, applying a direct transpiration inhibitor component, scattering the target component so that it also adheres to the back side of the leaf surface, and wetting the entire plant including the ear with a transpiration inhibitor component if it is after the heading stage. Specifically, plant spraying can be said to be a concept including foliar spraying, flower surface spraying, flower spike spraying, standing tree spraying, etc.

[0018] In this specification, "environmental spraying" means that the target component is sprayed into the environment surrounding the plant. For environmental spraying, it is only necessary that the target component is mainly sprayed into the environment, and a small amount of the component may be incidentally sprayed onto the plant. In environmental spraying, for example, the effects intended by the present disclosure can be achieved by spraying the target component into the environment. Examples of the method of environmental spraying include spraying into the environment of the plant, and in addition, soil treatment by directly applying it into the soil in advance and stock base application by spraying it on the stock base, but are not limited to these. Environmental spraying can be said to be a concept including water surface spraying, soil spraying, stock base spraying, irrigation water spraying, etc.

[0019] In this specification, "coating" means applying a drug or an active ingredient to the target site.

[0020] In the present disclosure, any dosage form that can be used as a pesticide can be used. For example, powders, DL powders, FD agents (flowable dusts), granules, jumbo agents, powder granules, fine granules, powders, wettable powders, flowable concentrates (SC), granule wettable powders, dry flowable water-soluble agents, granule water-soluble agents, emulsions, EW agents, liquid agents, ME liquid agents, oil agents, surfactants, aerosols, paste agents, puffing fumigants, puffing vaporizers, microcapsule agents, pack agents can be used.

[0021] In this specification, "liquid agent" means a drug provided in a liquid state at normal temperature.

[0022] In this specification, "powder formulation" refers to a formulation obtained by diluting and increasing the amount of the active ingredient of the agricultural chemical with fine powder of minerals such as clay, adding a decomposition inhibitor or the like as necessary, and formulating it into fine powder of, for example, 45 μm or less. It refers to the one used as it is. In order to reduce drift, a formulation using an extender with less fine powder of 10 μm or less and further aggregating the fine powder mixed therein with a flocculant to make it less likely to scatter is also called DL powder formulation. DL is an abbreviation of DRIFT LESS. A formulation made into ultrafine powder of 2 μm or less to increase the time of floating in the air and designed to be uniformly distributed inside the house when sprayed from outside the house is also called FD agent or flowable dust.

[0023] In this specification, "granule formulation" refers to a drug that is solid at normal temperature and provided in a granular state. Under the Agricultural Chemicals Control Law, it is fine granules with a particle size of 300 to 1700 μm and is used as it is. There are various shapes depending on the manufacturing method, such as a type (mainly cylindrical) in which the active ingredient of the agricultural chemical is kneaded into minerals such as clay, and a type (mainly fine sand-like) in which the active ingredient is impregnated into porous minerals. There are also those with a larger particle size than this, such as pellets and tablets. In this specification, "jumbo formulation" corresponds to granule formulation in terms of registration under the Agricultural Chemicals Control Law. There are tablets (tablet-shaped) of 50 g each or pack formulations in which granules, tablets, and powders are wrapped in a 50 g water-soluble film, and it is a formulation in which 10 to 20 pieces per 10 a are thrown into paddy fields from the field edge. Since no spraying equipment is used, it has excellent labor-saving properties. There are mainly many herbicides.

[0024] In this specification, "wettable powder" refers to a powdery formulation that is compatible with water, is suspended in water for use, and precipitates when the prepared liquid is allowed to stand. In this specification, "flowable formulation" refers to a formulation in which the active ingredient is made into fine particles (average particle size 1 to 5 μm) and dispersed in a liquid by an appropriate surfactant.

[0025] In this specification, "water-soluble formulation" refers to water-soluble powdery, granular, etc. formulations, which are dissolved in water for use. Since the active ingredient is completely soluble in water, the prepared liquid does not precipitate.

[0026] In this specification, the term "emulsion concentrate" refers to an oily liquid formulation in which a poorly water-soluble agricultural chemical active ingredient is dissolved in an organic solvent and an emulsifier is added. It is used in an emulsified state by diluting it with water.

[0027] In this specification, "microcapsules" refers to preparations containing micro-sized capsules in which the target ingredient is coated with a polymer membrane or the like. By microencapsulating, the drug's effectiveness is increased and inhalation toxicity, drug damage, and paint contamination are reduced. The appearance of the preparation is liquid, similar to that of a flowable preparation.

[0028] In this specification, "aerosol" refers to a spray agent in a can (cylinder) that sprays the target ingredient by the internal gas pressure. It has the advantage of being easy to use.

[0029] As used herein, the term "plant body" is used in the broadest sense in the art and refers to an entity that exhibits life phenomena, including those that perform photosynthesis and live without movement. Typically, a plant body has various characteristics such as cell structure, proliferation (self-reproduction), growth, regulation, metabolism, and repair ability. Usually, it has as its basic attributes growth involving the control of heredity by nucleic acids and the control of metabolism by proteins. It can be any cell of an angiosperm or gymnosperm, any cell of a dicotyledon or monocotyledon, and can also be either a herbaceous plant or a woody plant. Examples of herbaceous plants include cereal plants, turfgrasses, or vegetables, and examples of woody plants include evergreen broad-leaved trees and deciduous broad-leaved trees. Specifically, examples include agricultural and horticultural crops such as rice, wheat, barley, corn, grapes, apples, pears, peaches, apricots, persimmons, citrus fruits, soybeans, kidney beans, strawberries, potatoes, cabbages, lettuces, tomatoes, cucumbers, eggplants, watermelons, sugar beets, spinach, green beans, pumpkins, sugarcane, tobacco, bell peppers, sweet potatoes, taro, konjac, cotton, sunflowers, tulips, chrysanthemums, and grasses, but are not limited thereto. Further, the "plant body" as referred to in the present invention includes all parts constituting the plant individual. In this specification, preferably, such a plant body can be fertile. More preferably, such a plant body can produce seeds. It is understood that the compositions and methods of the present disclosure can be applied to any plant having leaves.

[0030] As used herein, a "part of a plant body" may be, for example, a specific part of a plant body such as a stem, leaf, root, seed, flower, or fruit, or may be a combination of a plurality of organs including a stem, leaf, seed, etc. Parts of a plant body may include above-ground parts (e.g., leaves, stems, nodes, or leaves, stems, nodes, ears) and underground parts.

[0031] As used herein, the term "seed" refers to those that store nutrients for the germination of young plants and are used for agricultural propagation. Specifically, it includes grains such as rice, corn, cottonseed, wheat, barley, etc., and miscellaneous grains of the Poaceae family such as foxtail millet, millet, panicum miliaceum, Japanese millet, barnyard grass, green foxtail, sorghum, adlay, timothy grass, rye grass, etc., sunflower seeds, pumpkin seeds, legumes, rapeseed seeds, etc. Alternatively, the present disclosure may be directed to the edible parts of crops (seeds of grains and fruits of fruit trees).

[0032] As used herein, the term "aboveground part" refers to a part of the plant body, which includes leaves and stems during the vegetative growth period, and includes leaves, stems, flower stems, and flowers during the reproductive growth period. For example, the "aboveground part" of a Poaceae plant during the vegetative growth period is the part consisting of leaves, stems, and nodes, and the "aboveground part" during the reproductive growth period is the part consisting of leaves, stems, nodes, and ears (branches and spikelets).

[0033] In the present disclosure, the plant body may be a part of the plant body that is used for consumption other than seeds. For example, a part of the plant body may be the fruits of vegetables such as tomatoes, cucumbers, eggplants, green beans, pumpkins, and bell peppers. Alternatively, a part of the plant body may be leafy vegetables such as spinach, mizuna, and wild mustard. A part of the plant body may also be those that use the underground parts such as taro, potato, sweet potato, konjac, lotus root, and lily root for consumption. The plant body and a part thereof used in the present disclosure may also not be for consumption. The plant body or a part thereof may be bulbs such as seed tubers, lilies, tulips, or seed bulbs such as Chinese artichoke.

[0034] As used herein, the term "aquatic plant" refers to a plant whose roots are immersed in water during its normal life cycle. For example, it includes floating plants, floating-leaved plants, submerged plants, emergent plants, and hygrophytes, regardless of whether they are freshwater, brackish water, or marine, with freshwater being preferred. The term "floating plant" refers to a plant that does not attach its roots to the bottom of the water but exposes itself in the water and floats the entire plant body on the water surface. For example, plants of the family Lemnaceae such as Lemna aoukikusa and Lemna minor, and plants of the family Pontederiaceae such as Eichhornia crassipes are applicable. The term "floating-leaved plant" refers to a plant that attaches its roots to the bottom of the water and floats its leaves on or near the water surface. For example, plants of the family Nymphaeaceae such as Nymphaea tetragona and Brasenia schreberi, plants of the family Trapaceae such as Trapa japonica, and plants of the family Menyanthaceae such as Nymphoides peltata are applicable. The term "submerged plant" refers to a plant that attaches its roots to the bottom of the water and the entire plant body is below the water surface. For example, plants of the family Hydrocharitaceae such as Hydrilla verticillata, plants of the family Potamogetonaceae such as Potamogeton crispus, and algae of the class Charophyceae such as Chara braunii are applicable.

[0035] As used herein, the term "emergent plant" refers to a plant that attaches its roots to the bottom of the water and extends the upper part of the plant body such as leaves and stems above the water surface. For example, plants of the family Poaceae such as Oryza sativa, Zizania latifolia, and Phragmites australis, plants of the family Nelumbonaceae such as Nelumbo nucifera, plants of the family Nymphaeaceae such as Nuphar japonicum, and plants of the family Typhaceae such as Typha latifolia are applicable. In this specification, the term "hygrophyte" refers to a plant that inhabits a wetland or a place where its roots can be immersed in water, such as the periphery of a river or a pond, and most of the plant body excluding the roots and rhizomes is not immersed in water. For example, plants of the family Lythraceae such as Lythrum anceps, plants of the family Orchidaceae such as Habenaria radiata, and plants of the family Iridaceae such as Iris pseudacorus are applicable.

[0036] In this specification, the term "stomatal closure" refers to the closing of stomata in a plant body, which can be observed by microscopic observation.

[0037] In this specification, the term "transplant shock" refers to the damage that occurs when planting or transplanting seedlings of a plant body (e.g., rice, vegetables), including cases where growth temporarily stops or leaves fall due to the roots being cut.

[0038] In this specification, the term "drought damage" refers to the damage that occurs when an appropriate amount of rain does not fall at appropriate intervals due to drought or light rain, resulting in a lack of soil moisture, and at the same time, no countermeasures such as irrigation are taken, or when the necessary amount of water is not supplied to the plant body due to meteorological conditions such as high temperature and drought.

[0039] In this specification, the term "quality of the harvested product" refers to the quality of the target agricultural product (e.g., rice in the case of rice).

[0040] In this specification, the term "yield (of the harvested product)" refers to the yield of the target agricultural product (e.g., rice in the case of rice), and is usually expressed as the yield per unit of cultivated area (e.g., per 10 ares in the case of rice).

[0041] (Preferred Embodiment) Preferred embodiments of the present disclosure will be described below. It should be understood that the embodiments provided below are for a better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate modifications within the scope of the present disclosure with reference to the descriptions in this specification. Also, it is understood that the following embodiments of the present disclosure can be used alone or in combination with each other.

[0042] Note that all of the embodiments described below are illustrative of comprehensive or specific examples. The numerical values, shapes, materials, components, arrangement positions and connection forms of the components, steps, order of steps, etc. shown in the following embodiments are merely examples and are not intended to limit the scope of the claims. Also, among the components in the following embodiments, the components not described in the independent claims indicating the most general concept are described as optional components.

[0043] (Transpiration inhibitor) In this aspect, the present disclosure provides a composition for suppressing transpiration of a plant body.

[0044] In one aspect, the present disclosure provides a composition for reversibly suppressing transpiration of a plant body or a part thereof, which contains jasmonic acids. In the present disclosure, when jasmonic acids are applied to a plant body, transpiration of the plant body can be suppressed, which can preferably be performed reversibly. The composition of the present disclosure may be provided in a form that can be used as it is as a dilution, or may be provided as a concentrate or a concentrate (also referred to as a stock solution in this specification) intended to be diluted before or during use. Therefore, when the composition of the present disclosure is provided as a stock solution, it can be provided as a dilution by diluting it with an appropriate diluting medium (for example, water, an organic solvent (such as alcohol), a mixture thereof, etc.).

[0045] The jasmonic acids used in the present disclosure can be jasmonic acid, jasmonic acid derivatives, or mixtures thereof (for example, a mixture of jasmonic acid and one or more jasmonic acid derivatives, or a mixture of two or more different jasmonic acid derivatives). In a preferred embodiment, the jasmonic acid derivative includes prohydrojasmon. Alternatively, the prohydrojasmon or its derivative that can be used in the present disclosure can be methyl jasmonate, prohydrojasmon, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, glucoside jasmonate, epi-jasmonic acid, methyl epi-jasmonate, and the like. In a preferred embodiment, the jasmonic acid derivative is prohydrojasmon.

[0046] The present disclosure can be used for any plant body, but preferably can be directed to monocotyledonous plants. In a preferred embodiment, the subject of the present disclosure may be cereals. Alternatively, the present disclosure may be a gramineous plant (for example, rice, preferably paddy rice), and the like.

[0047] In one embodiment, the subject of the present disclosure may be the above-ground part, the edible part of the crop, or the like, or the seed. The present disclosure can provide reversible transpiration suppression. If the transpiration suppression is irreversible, the absorption of water and elements that become nutrients using the transpiration flow also decreases, leading to a decrease in the yield and quality of the crop. Therefore, it is desirable that it is transient and reversible.

[0048] The plants targeted by the present disclosure have any vegetation, but are preferably aquatic plants, and more preferably can be, but are not limited to, pumping plants or hygrophytic plants.

[0049] The compositions of the present disclosure can take any dosage form, which can be powder, DL powder, FD agent (flow dust), granule, jumbo agent, powder granule, microgranule, fine granule, powder, wettable powder, flowable sol (SC), granule wettable powder, dry flowable water-soluble agent, granule water-soluble agent, emulsion, EW agent, liquid agent, ME liquid agent, oil agent, surf agent, aerosol, paste agent, smoking agent, steaming agent, microcapsule agent or pack agent, and preferably can be liquid agent, granule, flowable agent, jumbo agent, emulsion, granule wettable powder, powder, microcapsule agent or aerosol.

[0050] In one embodiment, the jasmonic acids may be prohydrojasmon. When prohydrojasmon is applied, it is particularly used for suppressing transpiration during a period of 0.5 hours or more and less than 2 days after application.

[0051] For transpiration suppression, it is conceivable to use natural or artificially synthesized plant hormones and their derivatives that promote adaptation to abiotic and biotic stresses such as heat and water deficiency. Transpiration suppressants can be used to prevent excessive transpiration because they close stomata, reduce the amount of transpiration, and as a result increase the leaf temperature under heat stress.

[0052] The technology of the present disclosure solves concerns about serious water shortages in agricultural production and food supply caused by global warming. Water shortages have been reported to affect crop production in Europe, India, South America, and the United States. Rising temperatures lead to an increase in transpiration in plants due to the upregulation of stomatal conductance and the decrease in leaf water potential. The present disclosure solves these problems. According to the technology of the present disclosure, as a solution for improving the water deficiency tolerance of rice, a transpiration suppressant can be used to delay excessive transpiration. Conventional commercially available microcrystalline wax and paraffin wax agents used for this purpose have the drawback that they can physically cover the leaf surface and reduce water loss, but the effect is irreversible. However, according to the technology of the present disclosure, reversible transpiration suppression can be achieved.

[0053] In one embodiment, the present disclosure shows that prohydrojasmon (PDJ) has an advantage in suppressing transpiration in the indica rice cultivar Takanari in a greenhouse compared to commercially available microcrystalline waxes and paraffin agents. The microcrystalline waxes and paraffin agents suppressed transpiration by about 30 - 50% 3 hours after application, and the suppression of transpiration lasted for 7 days after treatment depending on the concentration and the agent used, while PDJ suppressed transpiration by about 40 - 80% compared to the control 0.5 hours after treatment, and the effect lasted for 1 day. However, the effect almost disappeared 7 days after the treatment. Therefore, PDJ affects transpiration in a different manner from commercially available products and can be used to reduce excessive transpiration in rice, especially when transient and reversible suppression is required in the initial stage.

[0054] In the present disclosure, the composition of the present disclosure functions to inhibit transpiration in a manner different from the physical inhibition caused by microcrystalline waxes and paraffin wax agents. For example, the transpiration suppression component used in the present disclosure physically seals the stomata or the leaf surface when applied, and the effect can disappear 3 hours after the treatment or at the longest 7 days after the treatment, indicating a short - to medium - term effect and also being reversible.

[0055] Jasmonic acids, such as its methyl ester (MeJA), are said to induce water stress tolerance in some plant species including soybean and barley, and 12 - oxo - phytodienoic acid (12 - OPDA) is also known to function as a regulator of stomatal closure together with ABA in Arabidopsis thaliana. In view of these reports, JA, its derivatives and precursors play important roles in the adaptation to drought stress through stomatal closure, but the effective concentration and timing vary depending on the compound and the plant species.

[0056] The composition of the present disclosure can use the active ingredient PDJ, etc. at any concentration, and the range is 0.01 to 1000 (μmol / L), preferably 0.1 to 500 (μmol / L), more preferably 10 to 100 (μmol / L). For example, PDJ acts quickly and is active in relatively small amounts. The effects of PDJ, etc. can be observed from 0.5 hours to 2 days after application when applied at about 10 μmol / L.

[0057] Since the composition of the present disclosure is mediated through a hormonal response, its effect is reversible. The closure of stomata is controlled by various signals such as light, humidity, and sugar breakdown. The long-term inhibitory effect of the external application of PDJ is unstable, and negative feedback control can be induced depending on the PDJ concentration and the application time.

[0058] Due to the initial transient and reversible inhibition, the composition of the present disclosure can be used as an inhibitor of excessive transpiration in target plants such as rice. These characteristics are important in the adaptation to transient heat stress and water deficiency such as the fayne phenomenon, and for normal growth and harvest, early recovery from the state of transpiration inhibition is required.

[0059] Thus, according to the present disclosure, by applying a plant hormone derivative as a transpiration-inhibiting component, stomatal closure can be transiently induced to cause transpiration inhibition. Since this transpiration inhibition is a reversible reaction, effective transpiration inhibition is possible by flexibly responding to changes in weather conditions, etc. and applying.

[0060] The present disclosure can be used, for example, in rice cultivation sites. The present disclosure can also suppress excessive transpiration in response to sudden high temperature prediction, etc. and can be used for suppressing the translocation of heavy metals, etc.

[0061] (Method for inhibiting transpiration of plant body) The present disclosure also provides a method for inhibiting transpiration of a plant body. Preferably, this transpiration inhibition can be reversible.

[0062] In one aspect, the present disclosure provides a method for suppressing transpiration of a plant body, including the step of applying jasmonic acids to the plant body. The method of the present disclosure can adopt any embodiments and features described in this specification, particularly in the section of (transpiration inhibitor), in combination as needed. In one embodiment, the present disclosure provides a composition containing jasmonic acids directly as a liquid that can be used as is (also referred to as a dilution liquid in this specification), and the jasmonic acids may be applied as is. Alternatively, in another exemplary embodiment, when jasmonic acids are provided as a concentrated liquid in the present disclosure, it may include the step of diluting with an appropriate diluting medium (such as water, an organic solvent (such as alcohol), a mixture thereof, etc.) during or before use.

[0063] The application in the present disclosure can be any method such as spraying, coating, addition to the cultivation environment (also referred to as environmental spraying). Spraying can consider not only spraying on the plant body but also environmental spraying.

[0064] In the case of plant body spraying, it is effective to spray on the back side of the leaf with many stomata. In the case of leaf surface spraying, it may contain an auxiliary agent that can be retained on the leaf surface. Such an auxiliary agent can include a surfactant.

[0065] In the case of environmental spraying, mainly expecting absorption from the roots, it can be carried out by methods such as manual spraying from a product bag, a manual spray-type sprayer, mechanical spraying using a power sprayer, an unmanned helicopter or a drone, soil treatment, or application to the stock base.

[0066] (Reducing transplant shock of the plant body) The composition or method of the present disclosure can reduce or eliminate the transplant shock of the plant body. Transplant shock refers to the obstacles that occur when planting or replanting seedlings of a plant body (such as rice, vegetables), where the growth temporarily stops or the leaves fall off due to the roots being cut, etc. By using the technology of the present disclosure, such obstacles can be suppressed or eliminated.

[0067] To reduce or eliminate transplanting pain, it is effective to use it 0.5 - 24 hours before transplantation or planting. When drought, light rain, high temperature, dryness, etc. are predicted before transplanting seedlings, it is possible to reduce or eliminate transplanting pain by using it before the occurrence of these phenomena is predicted.

[0068] (Reduction of drought damage to plants) The composition or method of the present disclosure can reduce or eliminate drought damage to plants. Drought damage refers to the damage that occurs to plants (e.g., rice, vegetable seedlings) during water shortage. Drought damage is, for example, damage caused by water shortage such as drought, and occurs when an appropriate amount of rain does not fall at appropriate intervals and at the same time no measures such as irrigation are taken. The composition or method of the present disclosure can suppress or eliminate such damage.

[0069] To reduce or eliminate drought damage, it is effective to use it 0.5 - 24 hours before drought, light rain, high temperature and dryness, etc. are predicted. When drought, light rain, high temperature and dryness, etc. are predicted, it is possible to reduce or eliminate drought damage by using it before the occurrence of these phenomena is predicted.

[0070] (Reduction of the decrease in the quality or yield of the harvested product of plants) The composition or method of the present disclosure can also reduce the decrease in the quality or yield of the harvested product or improve the quality. The suppression of the decrease in quality and yield can be confirmed by methods such as grain discrimination, the number of grains per panicle (dividing the total number of grains by the number of panicles), and the 1000-grain weight of brown rice (calculated by measuring the number of grains in 20 g of polished brown rice). When cultivated in an environment where transplanting pain and drought damage occur, when the present disclosure is used, it can be said that it is a remarkable effect that the decrease in the quality and / or yield of the harvested product (e.g., rice in the case of rice) can be suppressed or improved.

[0071] In the reproductive growth stage, for rice plants, especially when drought, light rain, high temperature, dryness, hot and dry winds (Föhn) are predicted during the ripening period from 1 week before heading to 3 weeks after heading, by applying the product 0.5 to 24 hours before the occurrence of these phenomena, it is possible to reduce or eliminate the deterioration of the quality or yield of the harvest. If the above weather conditions continue, several applications may be carried out every 3 - 7 days.

[0072] (For pesticide use) Due to transient and reversible inhibition, the composition of the present disclosure can be used as an inhibitor of excessive transpiration in plants (e.g., rice). The composition of the present disclosure can be used at the early growth stage of plants. These characteristics are important in adapting to transient heat stress and water deficiency such as the Föhn phenomenon. For normal growth and harvest, since early recovery from the state of suppressed transpiration is required, transient and reversible inhibition is particularly useful.

[0073] For example, when drought, light rain, high temperature, dryness, etc. are predicted before transplanting seedlings, by applying the product 0.5 to 24 hours before transplanting, the drying damage that occurs during transplanting can be reduced. Also, in the reproductive growth stage, for rice plants, especially when drought, light rain, high temperature, dryness, hot and dry winds (Föhn) are predicted during the ripening period from 1 week before heading to 3 weeks after heading, by applying the product 0.5 to 24 hours before the occurrence of these phenomena, not only can the deterioration of quality and yield be reduced, but also an improvement in quality and yield is expected depending on the application conditions. In the case where light rain, high temperature, dryness, hot and dry winds (Föhn), etc. are predicted throughout the cultivation period, spray and apply 0.5 to 24 hours before.

[0074] (Cultivation method) In this specification, plant cultivation can be carried out by any method known in the art. Cultivation methods of plants are described, for example, in the Rice Cultivation Guidelines (Agriculture, Forestry and Fisheries Department of Niigata Prefecture), etc., which can be appropriately referred to in the present disclosure, and if necessary, the necessary descriptions (preferably the whole) are incorporated herein by reference.

[0075] (Note) In this specification, "or" is used when "at least one or more" of the items listed in the text can be adopted. The same applies to "or else". When it is specified in this specification that it is "within the range of two values", the range includes the two values themselves.

[0076] References such as scientific literature, patents, patent applications, etc. cited in this specification are incorporated herein by reference in their entirety to the same extent as each is specifically described.

[0077] As described above, the present disclosure has been described by showing preferred embodiments for ease of understanding. Hereinafter, the present disclosure will be described based on examples. However, the above description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. Hereinafter, the present invention will be described more specifically with reference examples, examples, and test examples. However, they are provided for illustrative purposes only, and the present disclosure is not limited thereto. The compound names shown in the following reference examples and examples do not necessarily follow the IUPAC nomenclature. For the sake of brevity of description, abbreviations may be used, and these abbreviations have the same meaning as the above description. The scope of the present disclosure is not limited to the specific embodiments and examples described in this specification, but is limited only by the scope of the claims.

Example

[0078] If necessary, the handling of organisms used in the following examples was carried out in accordance with the standards established by the Japanese government or the National Agriculture and Food Research Organization. Also, for the reagents, the products specifically described in the examples were used, but equivalents from other manufacturers (SIGMA-ALDRICH, Wako Pure Chemical Industries, Nacalai Tesque, Kanto Chemical, etc.) can also be substituted.

[0079] ( Comparison Example 1: Rice (Comparison between a conventional transpiration inhibitor and PDJ) This Comparison example shows a comparison between a conventional transpiration inhibitor and PDJ.

[0080] (Materials and Methods) (Plant growth conditions) Seeds of the indica rice variety Takanari were sterilized with 5% ipconazole and 4.6% copper hydroxide, and then germinated by immersing them in 1 / 10 MS medium containing MS vitamins under continuous white fluorescent conditions at 25.0°C. The germinated seeds were raised in a seedling culture soil containing nitrogen, phosphorus, and potassium for 10 to 14 days under the same conditions as above, and 5 seedlings were transplanted into pots (150 mm × 150 mm) containing 350 g of soil. They were cultivated in a greenhouse under natural day length conditions of 25°C / 20°C (day / night) until 5 to 6 weeks, which is around the maximum tillering stage.

[0081] (Application of chemicals) To evaluate the suppression of transpiration, 100 ml of PDJ diluted 2,000-fold or 20,000-fold (5 wt% PDJ, final concentrations of 98.3 μM and 9.83 μM respectively, jasmonate; Meiji Seika Pharma Co., Ltd., Japan), a microcrystalline wax agent diluted 5-fold or 10-fold (Greener; 10% microcrystalline wax, Greener Co., Ltd., JP), or a paraffin wax agent diluted 100-fold or 200-fold (Abion C; 36% paraffin wax, Abion Co., Ltd., Japan) was sprayed onto 20 plants using a plastic spray bottle according to the instructions of the manufacturer of each chemical. As control plants, plants sprayed with a 2,000-fold dilution of the solvent in the case of PDJ and tap water used for dilution in the other cases were used.

[0082] (Measurement of transpiration amount) Evapotranspiration was measured as described above using a porometer (AP4, Delta-T, UK) 0.5 hours, 1 day, 2 days, and 7 days after the PDJ treatment, and 3 hours, 2 days, and 7 days after the paraffin wax agent and microcrystalline wax agent treatments. At the same time, thermal images were acquired using a thermal camera (Thermal Shot F30S, NEC / Avio) 0 hours, 0.5 hours, 2 days, and 7 days after the PDJ treatment, and 2 days and 7 days after the paraffin wax agent and microcrystalline wax agent treatments. The thermal images were analyzed using image analysis software (NS9500LT, Avio, Japan). Two independent and similar experiments were conducted.

[0083] (Results) This Comparison In this example, first, the experimental conditions were examined using a microcrystalline wax agent commonly used to suppress transpiration in various plants including rice. Stomatal conductance was measured using a porometer on the expanded leaves of the indica rice cultivar Takanari sprayed with the microcrystalline wax agent. The transpiration amount was suppressed by approximately 50% 3 hours after spraying a 5-fold or 10-fold dilution of the microcrystalline wax agent. Regardless of the drug concentration, the effect persisted for 2 days. The effect was also observed 7 days after the treatment (Table 1). [Table 1]

[0084] The suppression of transpiration in the leaf group can also be monitored by the leaf group temperature (Fukuda et al., 2018, Iseki and Olaleye, 2020). Therefore, thermal images were taken using a thermal camera. It was also found that the leaf group temperature of the control plants was lower than that of the plants sprayed with the microcrystalline wax agent 2 days after the treatment. The difference between the treatment group and the control group was also observed 7 days after the treatment (Figure 1).

[0085] The 100-fold or 200-fold diluted paraffin wax agent reduced the evaporation amount by approximately 35% - 50% 3 hours after spraying, regardless of the drug concentration. This effect lasted for 2 days and could still be detected 7 days after the treatment (Table 2).

Table 2

[0086] However, the leaf group temperatures in the thermal images 2 days and 7 days after the treatment were not significantly different from those in the control image (Figure 2).

[0087] In the plants sprayed with the paraffin wax agent, transpiration could not be monitored by thermal imaging, but it was clearly suppressed. The reason why the leaf group temperature could not reflect the inhibitory effect of the paraffin agent is unknown, but it may be due to the presence of a surfactant in the solvent.

[0088] These drugs physically coat the leaf surface, and their effects cannot be measured with a porometer until they dry and form a wax-like coating. Therefore, the initial response was not detected by the porometer. Thus, when thermal images of the plants sprayed with the microcrystalline wax agent or the paraffin wax agent were taken 0.5 hours later, no clear difference was initially shown compared to the plants sprayed with these drugs (Figures 3 and 4).

[0089] This Comparison example did not clearly show the difference between the microcrystalline wax agent and the paraffin wax agent, but both drugs were clearly able to inhibit transpiration in the greenhouse under natural light conditions.

[0090] Using the method used to confirm the application effects of the microcrystalline wax agent and paraffin wax agent, a 2,000-fold or 20,000-fold dilution of the PDJ solution was applied to fully developed leaves to investigate the transpiration inhibitory effect of PDJ. The PDJ treatment reduced transpiration by approximately 40% - 80% 0.5 hours after spraying, regardless of the concentration. Inhibition with PDJ was observed 1 day after spraying and disappeared 2 days and 7 days after spraying with the 20,000-fold dilution. The disappearance of the inhibitory effect observed 1 day after spraying with the 2,000-fold dilution was earlier than that with the 20,000-fold dilution (Table 3).

Table 3

[0091] This result indicates that the concentration in the 20,000-fold dilution is sufficient to inhibit transpiration, and the 2,000-fold dilution may have induced a negative feedback response earlier than the 20,000-fold dilution. Therefore, the concentration of PDJ should be selected according to its intended use. Canopy temperature was monitored 0.5 hours and 3 hours after the PDJ treatment, and 2 days and 7 days later. Although the difference in the concentration of sprayed PDJ was unclear, in the control plants, the canopy temperature decreased 0.5 hours after treatment compared to the plants sprayed with PDJ. The effect of PDJ was not observed 2 days and 7 days later. This is consistent with the stomatal conductance measurement data (Figure 5).

[0092] PDJ suppressed transpiration in rice early and transiently compared to other agents, so the Comparison results of this example suggest that PDJ functions to inhibit transpiration in a manner different from the physical inhibition caused by commercially available microcrystalline wax agents and paraffin wax agents. These agents physically seal the stomata or leaf surface, and their effects were observed 3 hours after treatment, up to 7 days after treatment at the longest. This result shows that the transpiration inhibitory effect by the microcrystalline wax agent and paraffin wax agent is not transient and the effect continues for about one week.

[0093] Since PDJ is a derivative of JA, it functions partially like JA. Classically, the methyl ester of JA (MeJA) induces water stress tolerance in some plant species including soybean and barley (Horton, 1991; Wang et al., 2020). 12-oxo-phytodienoic acid (12-OPDA), a precursor of JA, functions as a regulator of stomatal closure together with ABA in Arabidopsis thaliana (Savchenko, et al., 2014). In view of these reports, JA, its derivatives and precursors play important roles in the adaptation to drought stress through stomatal closure, but the effective concentration and timing vary depending on the compound and plant species. PDJ acts rapidly and is active at relatively low amounts. Its effect was detected 0.5 hours after spraying a 20,000-fold dilution of PDJ (a 20,000-fold dilution of a solution with a PDJ concentration of 5% by weight (9.8 μM)) and was observed 1 day after spraying, but disappeared 2 days after spraying (Table 3, Figure 5).

[0094] Naturally, the hormonal response is reversible, and stomatal closure is controlled by various signals such as light, humidity, and glycolysis (Daszkowska-Golec and Szarejko, 2013, Lawson and Matthews, 2020). Therefore, the long-term inhibitory effect of the external application of PDJ is unstable, and negative feedback control can be induced depending on the PDJ concentration.

[0095] In summary, PDJ can be used as an inhibitor of excessive transpiration in rice, especially due to its initial transient and reversible inhibition. These characteristics are important in the adaptation to transient heat stress and water deficiency such as the fayne phenomenon. On the other hand, for normal growth and harvesting, early recovery from the suppressed state of transpiration is required. However, MeJA has been reported to inhibit the development of stomata in Arabidopsis thaliana (Deng et al., 2020).

[0096] (Example 2: Suppression of transplanting pain at the time of seedling transplantation) (Method) When drought, light rain, high temperature, dryness, etc. are predicted before transplanting the seedlings, if it is rice, spray and apply PDJ diluted 20,000 times, or in some cases 2,000 times, 0.5 to 24 hours before transplanting. (Result) Spray application of PDJ can suppress the planting pain during seedling transplantation.

[0097] (Example 3: Suppression of yield and quality reduction due to excessive transpiration caused by drought damage and high temperature during ripening) (Method) During the reproductive growth period, if it is rice, especially when drought, light rain, high temperature, dryness, high temperature and dry wind (Föhn), etc. are predicted during the ripening period from 1 week before heading to 3 weeks after heading, spray and apply PDJ diluted 20,000 times, or in some cases 2,000 times, 0.5 to 24 hours before. At this time, if the above weather conditions continue, several applications may be carried out every 3 - 7 days. (Result) Spray application of PDJ can suppress the reduction of yield and quality due to excessive transpiration caused by drought damage and high temperature during ripening.

[0098] (Example 4: Suppression of rice leaf blight (Nagasaki Prefecture) and white ear (Niigata Prefecture) caused by high temperature and dry wind (Föhn)) (Method) When light rain, high temperature, dryness, high temperature and dry wind (Föhn), etc. are predicted throughout the cultivation period, spray and apply PDJ diluted 20,000 times, or in some cases 2,000 times, 0.5 to 24 hours before. At this time, if the above weather conditions continue, several applications may be carried out every 3 - 7 days. (Result) Spray application of PDJ can suppress rice leaf blight and white ear caused by high temperature and dry wind (Föhn).

[0099] (Example 5: Agent) The composition of the present disclosure can be provided as any agent, for example, it can be provided as the following liquid agents. These can be manufactured by mixing each of the presented components. Jasmonate liquid agent stock solution Propyl = 3 - oxo - 2 - pentylcyclopentyl acetate (Generic name: Prohydrojasmon) 1.0 to 10.0 w / v% (e.g., 5.0 w / v%) 1-Propanol 30.0 to 40.0 w / v% (e.g., 33.0 w / v%) Surfactant 25.0 to 35.0 w / v% (e.g., 30.0% w / v%) Water balance When in use, an instruction manual can be attached to indicate that it should be used at an appropriate dilution ratio (e.g., diluted 2000-fold (e.g., final concentration of PDJ 100 μM)).

[0100] (Example 6: Gene expression analysis) The general cultivar Hinohikari, which was grown under conventional cultivation, was transplanted into a 1 / 5000a Wagner pot at the young panicle differentiation stage, and on the 7th day after heading, 20 mL of PDJ (Jasmomate, Meiji Seika Pharma Co., Ltd., Japan) diluted 2000-fold was sprayed onto each pot. Total RNA was extracted from the spikelets that were left standing for one day and night in an artificial climate chamber set at 32 / 28°C (day / night), and RNAseq analysis was performed. As a control plant, a plant sprayed with a 2000-fold dilution of the solvent was used.

[0101] The RNAseq analysis is as follows. Total RNA was extracted from spikelets that had been statically placed for one day and night after PDJ treatment, and a library was created using the KAPA Stranded mRNA-Seq Kit (KAPABIOSYSTEMS). At that time, amplification by PCR was performed for 14 cycles, and an adapter of the Fast Gene Adapter Kit (Fast Gene) was used. The quality of the prepared library was confirmed using the Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical Technologies), and sequencing was performed under the condition of 2x76bp using the NextSeq500. The obtained reads were subjected to quality check using Sickle (ver. 1.33), bases with a value less than 20 were removed, and reads with a fragment length of 30 bases or less and their paired reads were discarded. The filtered reads were mapped to the reference sequence (The Rice Annotation Project Database http: / / rapdb.dna.affrc.go.jp / download / irgsp1.html) using Hisat2 (ver. 2.1.0), and a bam file was obtained using Samtools (ver. 1.3). The read sequences mapped on the gene region were counted using feature Counts (ver. 1.5.0p3). After normalization using the iDEGES normalization method, differentially expressed genes were identified using DESeq.

[0102] The sequences of the primers used are as follows. (Primer sequences used for library preparation) (Index ligation) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATGAAGCGTTGCAACTCCTTGGCTCACA (SEQ ID NO: 1) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACGTGCGATCCCAACTCCTTGGCTCACA (SEQ ID NO: 2) MGI Tech Co.,Ltd Tech. Support Centre Field Application Support Team Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCGGAAGGCACAACTCCTTGGCTCACA (SEQ ID NO: 3) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACCGATGTCGCCAACTCCTTGGCTCACA (SEQ ID NO: 4) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTTAGAATGCAACTCCTTGGCTCACA (SEQ ID NO: 5) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCCAAGCCTGCAACTCCTTGGCTCACA (SEQ ID NO: 6) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGACGATGATCAACTCCTTGGCTCACA (SEQ ID NO: 7) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGTCTCGTGTCAACTCCTTGGCTCACA (SEQ ID NO: 8) Ad153Ω_Bottom_2: TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 9) (Amplification by PCR) Ad153_PCR2_2:TGTGAGCCAAGGAGTTG (SEQ ID NO: 10) Ad153_PCR2_1: / 5Phos / GAACGACATGGCTACGA (SEQ ID NO: 11) (Sequencing) Read 1 sequencing primer: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 12) Read 2 sequencing primer: TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 13) (Adapter sequence) Read1 side: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO: 14) Read2 side: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG (SEQ ID NO: 15)

[0103] The results are shown in Fig. 6. For each gene, the expression level of the control is shown as 1. From the above results, it was shown that the gene products related to transpiration were suppressed.

[0104] (Note) As described above, the present invention has been illustrated using preferred embodiments of the present invention. However, it is understood that the scope of the present invention should be construed only by the claims. It is understood that patents, patent applications, and other documents cited herein should be incorporated by reference herein as if the contents thereof were specifically set forth herein.

Industrial Applicability

[0105] The present disclosure can be used in agriculture, particularly in the cultivation of cereals.

Sequence Listing Free-Text

[0106] SEQ ID NO: 1: Index ligation primer sequence SEQ ID NO: 2: Index ligation primer sequence SEQ ID NO: 3: Index ligation primer sequence SEQ ID NO: 4: Index ligation primer sequence Accession number 5: Primer sequence for index ligation Accession number 6: Primer sequence for index ligation Accession number 7: Primer sequence for index ligation Accession number 8: Primer sequence for index ligation Accession number 9: Primer sequence for index ligation Accession number 10: Primer sequence for PCR amplification Accession number 11: Primer sequence for PCR amplification Accession number 12: Primer sequence for sequencing Accession number 13: Primer sequence for sequencing Accession number 14: Adapter sequence Accession number 15: Adapter sequence

Claims

1. A composition for suppressing transient heat stress by transient and reversible suppression of transpiration of a plant body or a part thereof, which contains prohydrojasmon.

2. The composition according to claim 1, wherein the plant body is a monocotyledon.

3. The composition according to claim 1 or 2, wherein the plant body is a cereal.

4. The composition according to any one of claims 1 to 3, wherein the plant body is a gramineous plant.

5. The composition according to any one of claims 1 to 4, wherein the plant body is an aquatic plant.

6. The composition according to claim 1, wherein the plant body is a pumping plant or a hygrophytic plant.

7. The composition according to claim 1, wherein the plant body is rice.

8. The composition according to any one of claims 1 to 7, which is in a dosage form selected from the group consisting of a liquid agent, a granule agent, a flowable agent, a jumbo agent, an emulsion, a granule wettable powder, a powder agent, a microcapsule agent and an aerosol.

9. The composition according to any one of claims 1 to 3, wherein the prohydrojasmon is used after being diluted to 10 μM to 100 μM.

10. The composition according to any one of claims 1 to 9, wherein the prohydrojasmon is used for suppressing transpiration for 0.5 hours or more and less than 2 days after application.

11. A method for suppressing transient heat stress by transiently and reversibly suppressing transpiration of a plant body, which includes the step of applying prohydrojasmon to the plant body.

12. The method according to claim 11, wherein the plant body is a monocotyledon.

13. The method according to claim 11 or 12, wherein the plant body is a cereal.

14. The method according to any one of claims 11 to 13, wherein the plant body is a gramineous plant.

15. The method according to any one of claims 11 to 14, wherein the plant body is an aquatic plant.

16. The method according to claim 11, wherein the plant body is a pumping plant or a hygrophytic plant.

17. The method according to claim 11, wherein the plant body is rice.

18. The method according to any one of claims 11 to 17, wherein the prohydrojasmon is used after being diluted to 10 μM to 100 μM.

19. The method according to any one of claims 11 to 18, wherein the prohydrojasmon is used for suppressing transpiration for 0.5 hours or more and less than 2 days after application.

20. A composition for imparting adaptability to transient heat stress to a plant body or a part thereof, comprising prohydrojasmon.

21. A method for imparting adaptability to transient heat stress to a plant body or a part thereof, the method comprising the step of applying prohydrojasmon to the plant body.

Citation Information

Patent Citations

  • Agent for preventing flower abscission and fluid drop for plant and method for preventing drop of flower and fruit

    JP2002047104A

  • Dihydrojasmonate and its use in agriculture

    JP2007533720A

  • Plant growth adjustment composition and plant growth adjustment method

    JP2020110130A

Cited By

  • Transpiration suppressing agent using jasmonic acid or the like

    JP2025105689A