Optimized Lentiviral Vectors for XLA Gene Therapy

Abstract

To provide therapeutic methods for treating, suppressing or alleviating X-linked agammaglobulinemia (XLA).SOLUTION: Described herein are a composition and method for treating, inhibiting or ameliorating X linked agammaglobulinemia (XLA) in a subject that has been identified or selected as one who would benefit from a therapy to treat, inhibit, or ameliorate XLA. Exemplary embodiments include constructs and methods for gene therapy, which restore or increase Bruton's tyrosine kinase (BTK) expression.SELECTED DRAWING: None

Description

Technical Field

[0001] Citation by reference to prior applications This application claims priority based on U.S. Provisional Patent Application No. 62 / 488,523, filed on April 21, 2017. The content disclosed in this application is hereby expressly incorporated by reference in its entirety into this specification.

[0002] Statement regarding federal funds This invention was made with government support under Grant No. AI084457 awarded by the National Institute of Allergy and Infectious Diseases, National Institutes of Health.

[0003] Reference to sequence listing This application was filed with an electronic sequence listing. This sequence listing was provided as a 140 kb file created on April 17, 2018, with the file name Sequence Listing SCRI.148WO.txt. The information described in this electronic sequence listing is hereby incorporated by reference in its entirety into this specification.

[0004] Aspects of the invention relate to compositions and methods for treating, suppressing, or alleviating X-linked agammaglobulinemia (XLA) in a subject identified or selected as a subject who may benefit from the benefits of a treatment method for treating, suppressing, or alleviating XLA. Representative aspects include gene therapy constructs and methods of gene therapy that restore or increase the expression of Bruton's tyrosine kinase (BTK).

Background Art

[0005] X-linked agammaglobulinemia (XLA) is a rare X-linked genetic disorder caused by mutations in the Bruton's tyrosine kinase (BTK) gene. In individuals with mutations in the BTK gene, mature B cells do not develop, and the arrested mature B cells do not respond to the binding of the B cell antigen receptor or other cellular signals. Males affected by XLA are unable to mount a response with infection-defense antibodies against pathogen attacks and ultimately die from viral or bacterial infections. Current treatment methods have not changed in the past 50 years, and treatment consists of immunoglobulin replacement therapy and targeted antimicrobials. Even with this treatment, XLA patients frequently suffer from chronic infections and have an increased risk of various complications that can cause or endanger the disease. Rarely, stem cell transplantation is performed on XLA patients without conditioning or with reduced-intensity conditioning, but the outcome is not consistent. There is a need for additional treatment methods to suppress, treat, or alleviate XLA. Summary of the Invention Means for Solving the Problems

[0006] Repeatedly designing and testing each candidate for promoters, insulators, and enhancers, as well as the codon-optimized human BTK cDNA construct, and based on this result, a novel vector construct using a lentivirus (LV) capable of maintaining BTK expression in B cells and myeloid cells derived from (mouse or human) hematopoietic stem cells was identified and produced. This novel vector construct is described in the embodiments of the present invention. When the vector construct according to the embodiments of the present invention was transduced and transplanted into BTK-deficient hosts ex vivo, surprisingly, it was shown that BTK expression was maintained and B cell development was restored. As shown in any of the representative embodiments described herein, the constructs described herein utilize a truncated ubiquitous chromatin opening element (UCOE) and a conserved enhancer element derived from the intron region of the human BTK locus associated with the human BTK proximal promoter, and can induce the expression of codon-optimized human BTK cDNA.

[0007] The lentivirus (LV) vector using this construct was shown to maintain BTK expression in B cells and myeloid cells and restore B cell development and function without observing virus-induced toxicity in primary and secondary transplant recipients of mouse gene therapy experiments. Therefore, this construct is a unique LV vector for gene therapy for treating, suppressing, or alleviating human XLA.

[0008] In a first aspect, there is provided a polynucleotide for maintaining the expression of Bruton's tyrosine kinase (BTK), the polynucleotide comprising: a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the UCOE has a length (kb) within a range defined by 2 kb, 1.5 kb, 1 kb, 0.75 kb, 0.5 kb or 0.25 kb, or any two of these numerical values. In some embodiments, the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the BTK promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the promoter is a B cell-specific promoter. In some embodiments, the B cell-specific promoter comprises the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence comprises the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the polypeptide further comprises one or more enhancer elements. In some embodiments, the one or more enhancer elements comprise at least one DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region comprises the sequence shown in SEQ ID NO: 3. In some embodiments, the one or more enhancer elements comprise at least one intron region.In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the at least one intron region is intron 4, intron 5, and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5), and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4, SEQ ID NO: 14, or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward orientation. In some embodiments, the UCOE is in the forward orientation. In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further comprises a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0009] In a second aspect, there is provided a vector for maintaining the expression of BTK in cells, the vector comprising: a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the first sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence comprises the sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the vector further comprises a B cell-specific promoter. In some embodiments, the B cell-specific promoter comprises the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence comprises the sequence set forth in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the vector further comprises one or more enhancer elements. In some embodiments, the one or more enhancer elements comprise at least one intron region. In some embodiments, the one or more enhancer elements comprise a DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region comprises the sequence set forth in SEQ ID NO: 3. In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter.In some embodiments, the at least one intron region is intron 4, intron 5 and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5) and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequences shown in SEQ ID NO: 4, SEQ ID NO: 14 or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward orientation. In some embodiments, the UCOE is in the forward orientation. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34. + Is a hematopoietic stem cell. In some embodiments, the one or more enhancer elements comprise the sequences shown in SEQ ID NO: 16, the sequences shown in SEQ ID NO: 17, the sequences shown in SEQ ID NO: 18, the sequences shown in SEQ ID NO: 19, and / or the sequences shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further comprises a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer comprises the sequences shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, the 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequences shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0010] In a third aspect, there is provided a cell for BTK expression, the cell comprising a polynucleotide comprising a first sequence encoding UCOE, a second sequence encoding a promoter, and a third sequence encoding BTK. In some embodiments, the polynucleotide is incorporated into a vector. In some embodiments, the vector is a lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 + hematopoietic stem cell. In some embodiments, 0.7UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0011] In a fourth aspect, a method for promoting or enhancing the survival, proliferation, and / or differentiation of B cells in a subject in need thereof, the method comprising administering to the subject a cell according to any one of the embodiments of the present invention, or a polynucleotide according to any one of the embodiments of the present invention or a cell comprising a vector according to any one of the embodiments of the present invention; optionally, prior to administering the cell, identifying or selecting the subject as a subject who may benefit from a therapy that can promote the survival, proliferation, and / or differentiation of B cells; and / or optionally, after administering the cell, measuring the survival, proliferation, and / or differentiation of B cells in the subject or a biological sample obtained from the subject. In some embodiments, the cell is obtained from the subject and the cell is genetically engineered by introducing a polynucleotide according to any one of the embodiments of the present invention or a vector according to any one of the embodiments of the present invention. In some embodiments, the administration is by adoptive cell transfer. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 + hematopoietic stem cell. In some embodiments, the subject is male. In some embodiments, the subject has X-linked agammaglobulinemia (XLA). In some embodiments, the subject is selected as a subject who should receive immunoglobulin replacement therapy. In some embodiments, the subject is selected as a subject who should receive a targeted antimicrobial agent. In some embodiments, 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0012] In a fifth aspect, there is provided a method for treating, suppressing or alleviating X-linked agammaglobulinemia (XLA) or symptoms associated with XLA in a subject in need thereof, the method comprising administering to the subject a cell according to any one of the embodiments of the present invention, or a polynucleotide according to any one of the embodiments of the present invention or a cell comprising a vector according to any one of the embodiments of the present invention, optionally identifying or selecting the subject as a subject who may benefit from a treatment regimen for XLA or symptoms associated with XLA, and / or optionally measuring an improvement in the progression of XLA or an improvement in symptoms associated with XLA in the subject. In some embodiments, the cell is obtained from the subject and the cell is genetically engineered by introducing a polynucleotide according to any one of the embodiments of the present invention or a vector according to any one of the embodiments of the present invention. In some embodiments, the administration is by adoptive cell transfer. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 + hematopoietic stem cell. In some embodiments, the subject is male. In some embodiments, the subject is a subject selected as a subject to receive immunoglobulin replacement therapy. In some embodiments, the subject is a subject selected as a subject to receive a targeted antimicrobial agent. In some embodiments, the 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4. BRIEF DESCRIPTION OF THE DRAWINGS

[0013]

Figure 1

[0014]

Figure 2

[0015]

Figure 3

[0016]

Figure 4

[0017]

Figure 5

[0018]

Figure 6

[0019]

Figure 7

[0020]

Figure 8

[0021]

Figure 9

[0022]

Figure 10

[0023]

Figure 11

[0024]

Figure 12

[0025]

Figure 13

[0026]

Figure 14

[0027]

Figure 15

[0028]

Figure 16

[0029]

Figure 17

[0030]

Figure 18

[0031]

Figure 19

[0032]

Figure 20

[0033]

Figure 21

[0034]

Figure 22

[0035]

Figure 23

[0036]

Figure 24

[0037]

Figure 25

[0038]

Figure 26

[0039]

Figure 27

[0040]

Figure 28

[0041]

Figure 29

[0042]

Figure 30

[0043]

Figure 31

[0044]

Figure 32

[0045]

Figure 33

[0046]

Figure 34

[0047]

Figure 35

[0048]

Figure 36

[0049]

Figure 37

[0050]

Figure 38

[0051]

Figure 39

[0052]

Figure 40

[0053]

Figure 41

[0054]

Figure 42

[0055]

Figure 43

[0056]

Figure 44

[0057]

Figure 45

[0058]

Figure 46

[0059]

Figure 47

[0060]

Figure 48

[0061]

Figure 49

[0062]

Figure 50

[0063]

Figure 51

[0064]

Figure 52

[0065]

Figure 53

[0066]

Figure 54

[0067]

Figure 55

[0068]

Figure 56

[0069]

Figure 57

[0070]

Figure 58

[0071]

Figure 59

[0072]

Figure 60

[0073]

Figure 61

[0074]

Figure 62

[0075]

Figure 63

[0076]

Figure 64

[0077]

Figure 65

[0078]

Figure 66

[0079]

Figure 67

[0080]

Figure 68

[0081]

Figure 69

[0082]

Figure 70

[0083]

Figure 71

[0084]

Figure 72

[0085]

Figure 73

[0086]

Figure 74

[0087]

Figure 75

[0088]

Figure 76

[0089]

Figure 77

[0090]

Figure 78

[0091]

Figure 79

[0092]

Figure 80

[0093]

Figure 81

[0094]

Figure 82

[0095]

Figure 83

[0096]

Figure 84

[0097]

Figure 85

[0098]

Figure 86

[0099]

Figure 87

[0100]

Figure 88

[0101]

Figure 89

[0102]

Figure 90

[0103]

Figure 91

[0104]

Figure 92

[0105]

Figure 93

[0106]

Figure 94

[0107]

Figure 95

[0108]

Figure 96

[0109]

Figure 97

[0110]

Figure 98

[0111]

Figure 99

[0112]

Figure 100

[0113]

Figure 101

[0114]

Figure 102

[0115]

Figure 103

[0116]

Figure 104

[0117]

Figure 105

[0118]

Figure 106

[0119]

Figure 107

[0120]

Figure 108

[0121]

Figure 109

[0122]

Figure 110

[0123]

Figure 111

BEST MODE FOR CARRYING OUT THE INVENTION

[0124] Definition of terms Unless otherwise indicated, the technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the technical field to which this invention belongs.

[0125] As used herein, "a" or "an" may mean one or more than one.

[0126] As used herein, "about" when referring to a measured value means including a variation of ±20% or ±10% from a predetermined value, more preferably a variation of ±5%, still more preferably a variation of ±1%, and still more preferably a variation of ±0.1%.

[0127] As used herein, the term "polynucleotide" refers to "nucleic acid" or "nucleic acid molecule", for example, deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotide, fragment obtained by polymerase chain reaction (PCR), fragment obtained by any of ligation, cleavage, endonuclease action and exonuclease action, and the like. The nucleic acid molecule may be composed of natural nucleotide monomers (such as DNA, RNA, etc.), monomers composed of analogs of natural nucleotides (such as enantiomers of natural nucleotides), or combinations thereof. The modified nucleotide may have modifications in the sugar moiety and / or the pyrimidine base moiety or purine base moiety. Examples of modifications of the sugar moiety include substitution of one or more hydroxyl groups by halogen, alkyl group, amine or azide group, and the sugar moiety may be etherified or esterified. Further, the entire sugar moiety may be substituted with a structurally similar structure or an electronically similar structure, and examples of such structures include azasugars and carbocyclic sugar analogs. Examples of the modified base moiety include alkylated purines, alkylated pyrimidines, acylated purines, acylated pyrimidines, and other known heterocyclic substituents. Nucleic acid monomers can be linked by phosphodiester bonds or bonds similar thereto. Bonds similar to phosphodiester bonds include phosphorothioate bonds, phosphorodithioate bonds, phosphorosenoate bonds, phosphorodiselenoate bonds, phosphoroanilothioate bonds, phosphoranilidate bonds, phosphoramidate bonds, and the like. The "nucleic acid molecule" also includes so-called "peptide nucleic acids", which contain natural or modified nucleobases attached to a polyamide backbone. The nucleic acid may be single-stranded or double-stranded. In some embodiments, a nucleic acid sequence encoding a fusion protein is provided. In some embodiments, the nucleic acid is RNA or DNA.

[0128] As used herein, the term "encode" has its ordinary and customary meaning and includes, but is not limited to, the property that a specific nucleotide sequence in a polynucleotide such as a gene, cDNA, mRNA, etc. functions as a template for synthesizing another macromolecule such as a predetermined amino acid sequence. Thus, when mRNA corresponding to a specific gene is transcribed and translated to produce a protein in a cell or other biological system, it can be said that the gene encodes the protein.

[0129] As used herein, the term "Bruton's tyrosine kinase (BTK)" has its ordinary and customary meaning and includes, but is not limited to, for example, the enzyme encoded by the BTK gene in humans. BTK is a kinase that plays an important role in B cell development. For example, BTK plays an important role in B cell maturation and also plays an important role in the activation of mast cells via the high-affinity IgE receptor. Mutations in the BTK gene are involved in X-linked agammaglobulinemia (Bruton's agammaglobulinemia), which is a primary immunodeficiency disease (sometimes abbreviated as XLA). The pre-B cell population in the bone marrow of patients with XLA is normal, but these pre-B cells cannot mature and cannot enter the circulatory system.

[0130] "X-linked agammaglobulinemia (XLA)" described in this specification is a genetic disorder that affects the body's ability to fight infections. Since agammaglobulinemia is X-linked, it often occurs in males. In people with XLA, mature B cells do not develop during the formation process of white blood cells, resulting in a complete or almost complete deficiency of proteins (such as antibodies) called gamma globulins in the bloodstream. X-linked agammaglobulinemia (XLA) is characterized by recurrent bacterial infections in affected male infants up to 2 years old. The most common infection seen before diagnosis is recurrent otitis media. Conjunctivitis, paranasal sinus and lung infections, diarrhea, and skin infections are also frequently seen. When life-threatening severe infections (such as pneumonia, empyema, meningitis, sepsis, cellulitis, septic arthritis, etc.) occur, it is recognized that there is immunodeficiency, and XLA patients with immunodeficiency reach about 60%.

[0131] A "promoter" is a DNA region that initiates the transcription of a specific gene. The promoter may be located near the gene transcription start site or upstream (5' region of the sense strand) within the same DNA strand. The promoter may be a conditional-inducible promoter or a constitutive promoter. The promoter may be specific for protein expression in bacterial cells, mammalian cells, or insect cells. In some embodiments, when a nucleic acid encoding a fusion protein is provided, the nucleic acid further comprises a promoter sequence. In some embodiments, the promoter is specific for protein expression in mammals. In some embodiments, the promoter is a conditional-inducible promoter or a constitutive promoter.

[0132] As used herein, the "ubiquitous chromatin opening element (UCOE)" is a regulatory factor derived from a promoter-containing CpG island of a ubiquitously expressed housekeeping gene. Since regulatory factors derived from such promoters have chromatin remodeling functions, it has been proposed that they maintain chromatin within an acceptable structure and consistently highly express neighboring genes. UCOE is originally a relatively large factor (up to 16 kb), but it is thought that a new synthetic UCOE smaller than this can be used to highly express a transgene. The ubiquitous chromatin element and its function are shown in FIG. 1. In some embodiments, 0.7 UCOE contains the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer contains the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0133] As used herein, the term "codon optimization" has its ordinary and general meaning, and includes, for example, but is not limited to, a design process of changing a specific codon to another codon known to maximize the expression efficiency of a protein. In some embodiments, it is preferable to optimize for expression in humans, and this codon optimization can be carried out by using an algorithm known to those skilled in the art to produce a synthetic gene transcript optimized to produce mRNA and protein in high yields in humans. Programs containing algorithms for optimizing human codons are readily available. Examples of such programs include, for example, the OptimumGene TM algorithm and the GeneGPS (registered trademark) algorithm. Furthermore, human sequences with optimized codons are available commercially, for example, from Integrated DNA Technologies.

[0134] By optimization, the formation of the secondary structure of the polynucleotide can also be reduced. In some embodiments of the method of the present invention, by optimizing the sequence contained in the vector, the total GC / AT ratio can also be reduced. If codon optimization is carried out strictly, undesirable results may occur, such as the formation of an undesirable secondary structure or a high GC content leading to the formation of a secondary structure. The secondary structure itself affects the transcription efficiency. By using a program such as GeneOptimizer after codon usage optimization, the formation of the secondary structure can be avoided or the GC content can be optimized. Such additional programs can be used to further optimize or troubleshoot after the initial codon optimization, thereby limiting the formation of secondary structures that may occur after the first optimization. Another program for optimization is also readily available. In some embodiments of the method, the vector comprises a sequence optimized to avoid the formation of a secondary structure and / or a sequence optimized to reduce the total GC / AT ratio and / or a sequence optimized for expression in humans. In some embodiments of the present invention, the gene encoding BTK is codon-optimized. In some embodiments, the codon-optimized BTK comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[0135] As used herein, an "enhancer element" is a short DNA region to which a protein (activator) can bind, and binding of the activator to the enhancer element can increase the likelihood of transcription of a specific gene. An activator is also called a transcription factor. An enhancer may be cis-acting or trans-acting (acting at a position distant from the gene), may be located up to 1 Mbp (1,000,000 bp) away from the target gene, may be located upstream or downstream of the transcription start site, and may be in either the forward or reverse direction. The size of the enhancer may be 50 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1100 bp, 1200 bp, 1300 bp, 1400 bp or 1500 bp, or may be a length (bp) within the range defined by any two of these numerical values.

[0136] As used herein, the "DNase I hypersensitive region" refers to a chromatin region that is readily cleaved by the DNase I enzyme. In this specific region within the genome, the aggregated chromatin structure is lost, and the DNA is exposed, facilitating access to the DNA. As a result, it becomes possible to degrade the DNA with enzymes such as DNase I. Since such chromatin remodeling is required for the binding of proteins such as transcription factors, the aforementioned accessible chromatin regions are functionally related to transcriptional activity. In embodiments of the present invention, the "Dnase I hypersensitive region 4" (DHS4) is described. DHS4 is an enhancer located at -18 kb from the ε-globin promoter, and may contain binding sites for erythroid-specific proteins and ubiquitous proteins, and plays an important role as a regulatory factor. In some of the embodiments of the present invention, the vector for BTK expression comprises at least one DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5).

[0137] As used herein, the "intron" refers to any nucleotide sequence that is removed by RNA splicing during the maturation process of the final RNA product in a gene. In some of the embodiments of the vector of the present invention, the vector comprises at least one intron region. In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter.

[0138] "Vector", "expression vector", or "construct" is a nucleic acid used to introduce heterologous nucleic acids into cells and can contain various regulatory elements, enabling the expression of heterologous nucleic acids in cells. Vectors include, but are not limited to, plasmids, minicircles, yeast, and viral genomes. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector.

[0139] As used herein, "B cell" is a type of white blood cell belonging to the lymphocyte subtype. B cells are also known as B lymphocytes. B cells can function as a component of humoral immunity in the acquired immune system by secreting antibodies. Additionally, B cells present antigens (B cells are also classified as professional antigen-presenting cells (APCs)) and secrete cytokines. In some of the cell embodiments provided herein, the cell is a B cell.

[0140] As used herein, the term "myeloid cells" has its ordinary and customary meaning and includes, for example, granulocyte progenitor cells or monocyte progenitor cells found in the bone marrow or spinal cord, and cells similar thereto found in the bone marrow or spinal cord, but is not limited thereto. The myeloid cell lineage includes monocytes circulating in peripheral blood, and cell populations that have matured, differentiated, and / or been activated from these monocytes. Such cell populations include myeloid cells that are not terminally differentiated, myeloid-derived immunosuppressive cells, and differentiated macrophages. Differentiated macrophages include unpolarized macrophages, polarized macrophages, resting macrophages, and activated macrophages. The myeloid cell lineage further includes, but is not limited to, granulocyte progenitor cells, polymorphonuclear leukocyte-derived immunosuppressive cells, differentiated polymorphonuclear leukocytes, neutrophils, granulocytes, basophils, eosinophils, monocytes, macrophages, microglia, myeloid-derived immunosuppressive cells, dendritic cells, and erythrocytes. Microglia can, for example, differentiate from myeloid progenitor cells. In some of the cell embodiments provided herein, the cell is a myeloid cell.

[0141] As used herein, the term "hematopoietic stem cell" or "HSC" refers to a progenitor cell that can differentiate into myeloid cells, and examples of such myeloid cells include macrophages, monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells, and lymphoid cells (e.g., T cells, B cells, NK cells, etc.). HSC is a heterogeneous cell population containing three types of stem cells, and these three types of stem cells are distinguished by the ratio (L / M) of lymphoid progeny cells to myeloid progeny cells in the blood. In some of the cell embodiments provided herein, the cells are hematopoietic stem cells. As used herein, the terms "subject" or "patient" have their ordinary and customary meanings in light of this specification, and include, for example, any organism that may use or be administered the embodiments described herein for purposes such as experimentation, diagnosis, prevention, and / or treatment, but are not limited thereto. Examples of subjects or patients include, for example, animals. In some embodiments, the subject is a mouse, rat, rabbit, non-human primate, and human. In some embodiments, the subject is a cow, sheep, pig, horse, dog, cat, primate, or human. In some embodiments, the subject is a human male.

[0142] As used herein, the term "adoptive cell therapy" or "adoptive cell transfer" refers to the transfer of cells, and most commonly refers to the transfer of immune system cells back to the same patient, or the transfer of immune system cells to a new recipient host for the purpose of transferring immune function and immune characteristics to the new host. In some embodiments, adoptive cell therapy or adoptive cell transfer includes administering BTK-expressing cells to a subject in need thereof.

[0143] BTK is expressed in B cells and myeloid cells and contributes to normal functional responses in these cell lineages. The absence of BTK expression leads to the development of XLA. On the other hand, overexpression of activated BTK or wild-type BTK may cause cell transformation and / or arrest of cell development (“Early arrest in B cell development in transgenic mice that express the E41K Bruton’s tyrosine kinase mutant under the control of the CD19 promoter region” J Immunol. 1999 Jun 1;162(11):6526-33; “Correction of B-cell development in Btk-deficient mice using lentiviral vectors with codon-optimized human BTK.” Leukemia. 2010 Sep;24(9):1617-30; these references are incorporated herein by reference in their entirety). In addition, dysregulation of wild-type BTK expression can promote the production of autoantibodies and increase the risk of autoimmunity (“Enhanced Expression of Bruton’s Tyrosine Kinase in B Cells Drives Systemic Autoimmunity by Disrupting T Cell Homeostasis.” J Immunol. 2016 Jul 1;197(1):58-67; this reference is incorporated herein by reference in its entirety). Therefore, to successfully achieve safe clinical gene therapy in XLA, it is necessary to restore BTK expression in each cell lineage that normally expresses immune proteins and to tightly control expression so as not to cause overexpression in each subset of the developmental process that normally does not express immune proteins. Such expression control may also promote modification of cell function.To address this issue, as described in embodiments of the present invention, a comprehensive evaluation of viral vector candidates was performed in a novel human cell model and a mouse XLA animal model using hematopoietic stem cells (HSCs) obtained from a human subject with XLA. By repeating the design and testing of each candidate for promoters, insulators, and enhancers, as well as the codon-optimized human BTK cDNA construct, and based on these results, transduction and transplantation into BTK-deficient hosts ex vivo were performed to identify a novel vector construct using a lentivirus (LV) capable of maintaining BTK expression in B cells and myeloid cells derived from (mouse or human) hematopoietic stem cells. This novel vector construct is described in embodiments of the present invention. This unique construct according to embodiments of the present invention utilizes a truncated ubiquitous chromatin opening element (UCOE) and a conserved enhancer element derived from the intron region of the human BTK locus associated with the human BTK proximal promoter, and can induce the expression of codon-optimized human BTK cDNA. This optimal lentivirus (LV) vector according to any one of the representative embodiments is designated 0.7 UCOE.DHS4.BTKpro.coBTK. In part of the studies described in embodiments of the present invention, a series of unexpected and surprising results leading to the selection of this construct were obtained. These are described below. 1) As shown in some embodiments, lentiviruses containing only the BTK minimal promoter were insufficient to restore B cell development or its function. 2) As shown in some embodiments, lentiviruses utilizing the Eμ enhancer element (including B cell lineage-specific promoters or the BTK minimal promoter) induced the production of high-titer autoantibodies such as pathogenic IgG isotypes that had undergone class switching, indicating that significant safety concerns arise when using this enhancer. 3) In a plurality of lentiviral platform candidates used in secondary recipient animals, silencing of lentiviral vector expression was observed. Therefore, a UCOE element that is resistant to such silencing was utilized. 4) When using a large UCOE element, the titer decreased. Therefore, a novel 0.7 kb truncated terminal element that can improve the titer and function while maintaining resistance to silencing was designed and tested. 5) Using bioinformatics tools, multiple enhancer candidates derived from the BTK locus were identified and tested. After further performing a significance test, DHS4 was identified as the optimal element that can increase the expression of BTK in vivo without reducing the viral titer. 6) Multiple codon-optimized human BTK cDNAs were tested, and constructs that can most favorably restore the expression of BTK were identified. 7) Hematopoietic stem cells (HSCs) were collected from multiple adult subjects with XLA and transplanted into immunodeficient NSG mice. As a result, the developmental disorder of B cells observed in XLA subjects was reproduced by these HSCs. 8) In some of the embodiments of the present invention, it was shown that when using the optimized new lentiviral construct described herein, HSCs derived from XLA patients can be efficiently transduced.

[0144] X-linked agammaglobulinemia (XLA) is a genetic X-linked immunodeficiency disorder caused by mutations in the BTK (Bruton tyrosine kinase) gene. This disease occurs at a rate of approximately 1 in 100,000 males. Clinical symptoms include the deficiency of mature B cells and immunoglobulins in the serum; susceptibility to pulmonary infections, sinus infections, and skin infections caused by encapsulated bacteria; the risk of sudden death due to bacterial sepsis; chronic and systemic infections caused by enteroviruses; chronic inflammatory bowel disease; and an increased risk of malignant tumors (such as colorectal cancer and other types of cancer).

[0145] As currently available treatment methods for XLA, it can be mentioned that pooled human immunoglobulins (intravenous immunoglobulin therapy (IVIg) or subcutaneous immunoglobulin preparations (SCIg)) are administered every 3 to 4 weeks throughout life. However, these treatment methods are costly, and even with such current treatment methods, there are risks of infectious diseases and sudden death.

[0146] As candidates for subjects to undergo gene therapy, subjects with hematopoietic disorders caused by a single gene can be mentioned.

[0147] Bruton tyrosine kinase (BTK) is a non-receptor protein tyrosine kinase found intracellularly and mainly functions as a signal transduction pathway of the B cell receptor. BTK promotes the survival, proliferation, and differentiation of B cells. In addition, BTK can sustain the maintenance of calcium signals induced by the binding of BCR (B cell receptor), thereby promoting the activation of NF-κB. Furthermore, BTK also plays a certain role in the signal transduction pathways of cytokines, growth factors, and TLRs. The role of BTK is shown in Figure 21. In this figure, it is shown that BTK induces the development of B cells. Also, as shown in the figure, in XLA, the development of B cells stops at the pre-B cell stage. BTK is expressed in B cell lineages and myeloid cell lineages but not in T cells. The expression profile of endogenous BTK is shown in Figure 16.

[0148] There has been no report to date on the investigation of the use of the BTK promoter in a lentiviral vector and further modifications according to embodiments of the present invention in relation to BTK.In past studies on the function of the promoter, partial evaluations have been made regarding the BTK promoter and the first intron of BTK, but there has been no research group that has reported or tested enhancer candidates (such as the DHS4 element) derived from the human BTK locus (“Analysis of the Bruton’s tyrosine kinase gene promoter reveals critical PU.1 and SP1 sites.” Blood. 1996 Feb 1;87(3):1036-44;“Cell specific expression of human Bruton’s agammaglobulinemia tyrosine kinase gene (Btk) is regulated by Sp1- and Spi-1 / PU.1-family members.” Oncogene. 1996 Nov 7;13(9):1955-64;“Large-scale comparative sequence analysis of the human and murine Bruton’s tyrosine kinase loci reveals conserved regulatory domains.” Genome Res. 1997 Apr;7(4):315-29.;“Synergistic activation of the human Btk promoter by transcription factors Sp1 / 3 and PU.1.” Biochem Biophys Res Commun. 1999 Jun 7;259(2):364-9;“Btk expression is controlled by Oct and BOB.1 / OBF.1.” Nucleic Acids Res. 2006 Mar 31;34(6):1807-15;“Proteasome-dependent autoregulation of Bruton tyrosine kinase (Btk) promoter via NF-kappaB.” Blood. 2008 May 1;111(9):4617-26.; all of these documents are hereby expressly incorporated by reference in their entirety).

[0149] The codon-optimized BTK cDNA isolated alone has been identified in the past (“Correction of B-cell development in Btk-deficient mice using lentiviral vectors with codon-optimized human BTK.” Leukemia. 2010 Sep;24(9):1617-30; this reference is incorporated herein by reference in its entirety). The use of the UCOE element alone in lentiviral vectors, or in combination with lineage-specific or ubiquitous promoters, has been investigated by other researchers, but no researchers have applied this technique to BTK (“Lentiviral vectors containing an enhancer-less ubiquitously acting chromatin opening element (UCOE) provide highly reproducible and stable transgene expression in hematopoietic cells.” Blood. 2007 Sep 1;110(5):1448-57.; “A ubiquitous chromatin opening element (UCOE) confers resistance to DNA methylation-mediated silencing of lentiviral vectors.” Mol Ther. 2010 Sep;18(9):1640-9; “Physiological regulation of transgene expression by a lentiviral vector containing the A2UCOE linked to a myeloid promoter.” Gene Ther. 2012 Oct;19(10):1018-29; “Correction of murine Rag2 severe combined immunodeficiency by lentiviral gene therapy using a codon-optimized RAG2 therapeutic transgene.” Mol Ther. 2012 Oct;20(10):1968-80;“Promoter and lineage independent anti-silencing activity of the A2 ubiquitous chromatin opening element for optimized human pluripotent stem cell-based gene therapy.” Biomaterials. 2014 Feb;35(5):1531-42.;“A ubiquitous chromatin opening element prevents transgene silencing in pluripotent stem cells and their differentiated progeny.” Stem Cells. 2013 Mar;31(3):488-99;“Lentiviral MGMT(P140K)-mediated in vivo selection employing a ubiquitous chromatin opening element (A2UCOE) linked to a cellular promoter.” Biomaterials. 2014 Aug;35(25):7204-13;“Detailed comparison of retroviral vectors and promoter configurations for stable and high transgene expression in human induced pluripotent stem cells.” Gene Ther. 2017 Mar 27; All of these documents are hereby expressly incorporated by reference in their entirety).

[0150] The optimized lentiviral vector described in the embodiments of the present invention is used in gene therapy for subjects with X-linked agammaglobulinemia (XLA) and is designed to enable long-term curative treatment for this disease. Representative embodiments in the development of an optimal BTK lentiviral vector for gene therapy are shown in FIG. 22. This lentiviral vector provides a safe viral delivery platform and can express a desired cell lineage with optimal protein expression levels.

[0151] In some embodiments, the optimized BTK lentiviral vector includes a ubiquitous chromatin opening element (UCOE). This UCOE can induce stable expression of the transgene regardless of the integration site and can confer resistance to silencing on adjacent promoters (see FIG. 1).

[0152] Furthermore, the optimized lentiviral vector for BTK expression has been shown to increase the expression of BTK in cells. Some of the representative vectors used in some embodiments are shown in FIG. 23. As shown in FIG. 24, a lentiviral vector containing the EμBTKp promoter also increased the expression of BTK in myeloid cells.

[0153] BTK expression was tested in cells transduced with DKO mock, BTKp, UCOE.BTKp or Eμ.BTKp. As shown in the results of the FACS assay, incorporating Eμ into the lentiviral vector for BTK expression also showed that the expression of BTK was most enhanced in B cells and myeloid cells compared to when only the BTKp promoter was used or when the BTKp promoter and UCOE element were used in combination (FIG. 25). As shown in FIG. 26 comparing knockout cells and wild-type cells for B cells and monocytes, the expression of BTK in transduced cells is comparable to that of wild-type cells that naturally express BTK.

[0154] This lentiviral vector is considered to enable a radical therapy, particularly in the radical therapy for XLA gene therapy.

[0155] The gene delivery platform described in the embodiments herein is specialized for XLA therapy. This gene delivery platform can restore the expression of endogenous BTK in B cells and myeloid cells, and can restore the immune response in subjects suffering from XLA. Furthermore, the safety profile of the vector was also evaluated. Lentiviral vectors for XLA studied in the past included promoter elements and transcriptional elements such as the minimal promoter of BTK, the immunoglobulin heavy chain μ intron enhancer, and the 1.5 kb ubiquitous chromatin opening element. However, as shown in the embodiments of the present invention, further improvement was required to enhance the expression of BTK in B cells and myeloid cells.

Examples

[0156] Optimization of gene delivery platforms for XLA As shown in the embodiments of this specification, several steps were carried out to improve the lentiviral (LV) vector for gene therapy. First, 1) the size of the UCOE element was reduced to 0.7 kb to improve the viral titer. Next, 2) a transcriptional element within endogenous human BTK that can improve expression in B cells and myeloid cells was identified, and a test was conducted to express it together with the conserved non-coding sequence (CNS) contained upstream of the BTK promoter (Figure 1). As lentiviral vectors tested in preclinical models in the embodiments described in this specification, 0.7UCOE.BTKp.BTK and 0.7UCOE.I-4,5.BTKp.BTK can be mentioned (see Figure 2). As shown in Figure 3, blood was collected from XLA mice, and Lin-negative cells were recovered. Next, these cells were transduced using LC-huBTK-LV. Next, the transduced cells were administered to XLA mice, and the mice were analyzed 20 to 25 weeks after cell transfer. The expression of BTK was analyzed by flow cytometry. In addition, to allow long-term engraftment of the stem cells, secondary cell transfer was performed (see Figure 3). A schematic diagram of a preclinical mouse model for considering XLA gene therapy is shown in Figure 3.

[0157] Both vectors (0.7UCOE and 0.7UCOE-I4,5) expressing human BTK restored the expression of BTK in affected hematopoietic cells, restored B cell development and function, and restored the immune response (Figures 4 to 7). On the other hand, 0.7UCOE.I-45.BTIpBTK was shown to express BTK as effectively as 0.7UCOE.BTKp.BTK, but to have a lower number of viral integrations (Figure 8). From the above, several conclusions were obtained.

[0158] A lentiviral (LV) vector containing a conserved BTK regulatory element associated with endogenous BTK (derived from intron 4 and intron 5 of BTK) can improve the expression of BTK per viral integration. Also, the 0.7UCOE.I4,5.BTKpBTK lentiviral vector contains an efficient candidate for XLA gene therapy.

[0159] In further expanded preclinical trials, a) construction of a mouse model for sufficient evaluation of toxicity, safety, and efficacy (including implementation of secondary transplantation and analysis of the integration site); b) immortalization assay and transactivation assay in vitro; c) scrutiny of genetic factors within intron 4 and intron 5 that can enhance the expression of BTK in B cells and myeloid cells; and d) evaluation of 0.7UCOE.I-4,5.BTKp.BTK in vitro or in NSG recipient mice using CD34+ stem cells obtained from healthy controls or XLA subjects is carried out.

[0160] Improvement of the safety and efficacy of lentiviral gene therapy in a murine XLA model by using UCOE as an insulator for the BTK promoter To optimize the safety and efficacy of lentiviral gene therapy in mice, experiments were conducted using a BTK promoter with UCOE as an insulator. In this experiment, WT Mock, KO Mock, BTKp, 1.5.UCOE.BTKp, and Eμ.BTKp were used as vector constructs.

[0161] The expression profiles of four lentiviral (LV) constructs and the recovery of B cell development and function in primary recipient mice are shown in Figure 9. As vector constructs, BTKpro.BTK, 1.5UCOE.BTKpro.BTK, 1.5UCOE.BTKpro.coBTK (codon-optimized human BTK), and Eμ.BTKpro.BTK were used. As shown in Figure 9, the Eμ.BTKp.hBTK vector was shown to increase the expression of BTK in any cell. Also, as shown in Figure 10, the Eμ.BTKp.hBTK vector was shown to increase the expression of IgG in any cell. Furthermore, as shown in Figure 11, the Eμ.BTKp.hBTK vector was shown to increase the expression of BTK in granulocytes, bone marrow B cells, and spleen B cells. Also, the 1.5kbUCOE.BTKp vector and the 1.5kbUCOE.BTKp.co vector were shown to maintain the expression of BTK even with a low copy number in primary recipients and secondary recipients (Figure 11).

[0162] In mice treated with gene therapy using the 0.7 kb UCOE.BTKpro.coBTK lentivirus, restoration of BTK expression was observed in affected hematopoietic cell lineages, and B cells were generated (Figure 12).

[0163] Also, in gene therapy using the 0.7.UCOE.BTK.co lentivirus, increased proliferation of B cells and increased secretion of IgM and IgG were observed in the cells of primary recipients (Figure 12).

[0164] Furthermore, in gene therapy using the 0.7.UCOE.Bkp.co lentivirus, reconstitution of B cell function was observed in primary recipients (Figure 13).

[0165] Bone marrow cells treated with gene therapy were transplanted continuously into secondary recipients as TBK - / - Even after transplantation, viral copy number and BTK expression were maintained (Figure 14). As shown in the figure, cells transduced with 0.7UCOE.BTKp.co expressed BTK in neutrophils, monocytes, and B cells in the bone marrow and spleen. DNA methylation, a modification that suppresses gene transcription, was also measured.

[0166] The 0.7UCOE.BTKp.co vector was shown to sustain BTK expression at low copy numbers in CD34 cells affected by XLA (Figure 15). CD34 cells affected by XLA and control CD34 cells were transduced with 0.7UCOE.BTKp.co at various multiplicities of infection (MOI) and cultured in vitro for 15 days. As shown in the figure, cells affected by XLA showed a survival rate similar to that of healthy control cells after transduction.

[0167] Using the BTK promoter contained in the lentiviral vector, the expression of BTK in wild-type mice was evaluated. As shown in the figure, the BTK promoter mimics the expression pattern of endogenous BTK in mice (Figure 16).

[0168] Next, the Eμ promoter was tested for enhanced expression in the lentiviral vector. As shown in Fig. 17A, two vectors with the Eμ promoter were tested (vectors containing wild-type or human codon-optimized human BTK cDNA fused to GFP linked to T2A and the Eμ enhancer). Chicken BTK− / − DT40 cells were transduced with the BTK-GFP construct or the coBTK-GFP construct. The histograms show the expression of GFP and BTK (Fig. 17B). BTK-GFP-transduced cells and coBTK-GFP-transduced cells were stained with Indo-1 ester AM fluorescent dye and stimulated with anti-IgM. Calcium mobilization was observed by flow cytometry. As shown in the figure, the lentiviral construct containing the Eμ enhancer and human BTK cDNA and under the control of the BTK promoter regulated the expression of BTK-GFP in chicken cells.

[0169] Furthermore, the expression of BTK in B cells and myeloid cells in peripheral blood obtained from KO mice treated with gene therapy was analyzed by flow cytometry and shown in representative plots (Figure 18). The vectors tested were WT Mock, KO Mock, BTKp, 1.5kb.UCOE.BTKp, 1.5kb.UCOE.BTKp.co, and Eμ.BTKp. A representative flow cytometry plot of bone marrow cells from mice treated with gene therapy stained with early B cell development markers is shown in Figure 18C. A graph showing the percentage of B cells (%) included in fraction I (IgMlo, IgDhi), fraction II (IgMhi, IgDhi), and fraction III (IgMhi, IgDlo) (in this order, the maturity decreases) according to Hardy classification is shown in Figure 18D. Each ring in each layer represents one mouse, and the average value (%) of the percentage of B cells in each fraction is shown in the pie chart. The data represent the mean ± SEM of 11 independent experiments, with n = 18 (WT Mock), n = 14 (KO Mock), n = 7 (BTKp), n = 43 (1.5kb.UCOE.BTKp), n = 18 (1.5kb.UCOE.BTKp.co), and n = 23 (Eμ.BTKp). As shown in the graph, high expression of BTK and increased secretion of IgG were achieved in both B cells and myeloid cells by the vector containing the Eμ enhancer.

[0170] Also, as shown in Figure 19, the survival rate of Eμ.BTKp primary transplanted mice was extended compared to control XLA mice treated with cells transduced with the Mock vector.

[0171] Serum obtained from mice treated with cells transduced with the WT Mock vector, 1.5kb.UCOE.BTKp vector, or Eμ.BTKp vector was analyzed using a self-antigen array to examine the levels of IgM and IgG reactive to 88 mouse antigens. The data for each row were converted to Z scores. In the Z score, the colorimetric quantification scale shows from the lowest reactivity (red) to the highest reactivity (blue). As shown in Figure 20, the serum showing the highest reactivity was obtained from mice treated with cells transduced with the lentiviral vector containing the Eμ promoter (Eμ.BTKp).

[0172] Design of vectors for increasing the expression of BTK in B cells and monocytes Furthermore, the effect of the B cell-specific promoter on the production of BTK was investigated. According to a representative embodiment, a lentiviral vector containing the B cell-specific promoter B29 and the Eμ enhancer element fused to the gene encoding human BTK (huBTK) was prepared (Figure 27). As shown in the figure, this vector increased the expression of BTK in B cells. In contrast, the expression of BTK in monocytes was comparable to that in knockout cells (Figure 27).

[0173] Also, in order to evaluate the effect of the BTK promoter contained in the lentiviral vector on the expression of BTK, the BTK promoter region was examined in another embodiment. As shown in Figure 28, a lentiviral vector containing the BTK promoter (BTKpro) fused to the gene encoding human BTK (huBTK) was prepared. As shown in the figure, the BTK promoter increased the expression of BTK in B cells, but did not reach the expression level in wild-type cells. In monocytes, this lentiviral vector containing the BTK promoter region could not increase the expression of BTK, and the expression of BTK was comparable to that in knockout cells.

[0174] A lentiviral vector containing the BTK promoter (BTKpro) and the ubiquitous chromatin opening element fused to the gene encoding human BTK was prepared (Figure 29). As shown in the figure, these enhancer elements and the promoter cooperated to increase the expression of BTK in both B cells and monocytes. However, this expression did not reach the expression level in wild-type cells.

[0175] A lentiviral vector containing the BTK promoter (BTKpro) and the Eμ enhancer fused to the gene encoding human BTK was constructed (Figure 30). As shown in the figure, these enhancer elements and the promoter worked together to increase the expression of BTK in both B cells and monocytes. As a result of the experiment, it was shown that the expression level of BTK in these transduced cells exceeded the expression level of BTK in wild-type cells. The data showed that most of the expression of BTK from the tested vectors was due to the Eμ enhancer.

[0176] Representative constructs used herein are shown below. 1. 0.7UCOE.BTKp.coBTK. 2. 0.7UCOEfwd.BTKp.coBTK 3. 0.7UCOE.DHS4.BTKp.coBTK 4. 0.7UCOEfwd.DHS4.BTKp.coBTK 5. 0.7UCOE.IE.BTKp.coBTK 6. 0.7UCOEfwd.IE.BTKp.coBTK 7. 0.7UCOE.BTKp.co2BTK 8. 0.7UCOEfwd.BTKp.co2BTK 9. 0.7UCOE.DHS4.BTKp.co2BTK 10. 0.7UCOEfwd.DHS4.BTKp.co2BTK 11. 0.7UCOE.IE.BTKp.co2BTK 12. 0.7UCOEfwd.IE.BTKp.co2BTK Generally, these constructs contain three elements (0.7UCOE, enhancer or BTK coding sequence; the BTK promoter is the same in all constructs) in various combinations. [Table 1]

[0177] Human-codon-optimized BTK The human codons of the gene encoding BTK were optimized. The optimization of human codons can be carried out by using algorithms known to those skilled in the art to produce synthetic gene transcripts optimized to produce mRNA and proteins at high yields in humans. As shown in Figure 17, two constructs were tested for their ability to increase the expression of BTK in cells. These lentiviral constructs contained the Eμ element and the BTK promoter region. As the gene to be expressed, BTK or codon-optimized BTK was used, and both were fused to the GFP gene transcript. As shown in Figure 17, GFP increased (MFI: 2288) with codon-optimized BTK in human cells, and GFP also increased.

[0178] Expression profile of the BTK lentiviral vector The expression profiles of several types of vectors were examined. As vectors, WT Mock, DKO Mock, BTKp (BTK promoter), UCOE.BTKp (ubiquitous chromatin opening element + BTK promoter), UCOE.BTKp.co (ubiquitous chromatin opening element + BTK promoter + codon-optimized human BTK), and Eμ.BTKp (Eμ element + BTK promoter) were used. As shown in Figures 31 and 32, the expression of BTK was highest in B cells and myeloid cells obtained from bone marrow, spleen, and peritoneal cavity when transduced with a lentiviral vector for BTK expression containing the Eμ element and the BTK promoter.

[0179] B cell development and recovery of mature B cell subsets Furthermore, for the cells transfected with each vector, the recovery of mature B cell subsets was examined. As vectors, WT Mock, DKO Mock, BTKp (BTK promoter), UCOE.BTKp (ubiquitous chromatin opening element + BTK promoter), UCOE.BTKp.co (ubiquitous chromatin opening element + BTK promoter + codon-optimized BTK), and Eμ.BTKp (Eμ element + BTK promoter) were used. In XLA, B cell development arrests at the pre-B cell stage. Based on this, B cells were further examined for development after the pre-B cell stage. Development after the pre-B cell stage depends on the amount of BTK. As shown in the figure, when transfected with a lentiviral vector for BTK expression containing the Eμ element and the BTK promoter, cells with the characteristics of the mature B cell population in the periphery were obtained, indicating that the mature B cell subsets of mice are restored according to the amount of BTK produced from the transfected cells (Figure 33).

[0180] In addition, BTK-expressing cells were administered to BTK-deficient mice, and the cell numbers of each reconstituted B cell population were examined. Each vector was introduced into the cells. As vectors, WT Mock, DKO Mock, BTKp (BTK promoter), UCOE.BTKp (ubiquitous chromatin opening element + BTK promoter), UCOE.BTKp.co (ubiquitous chromatin opening element + BTK promoter + codon-optimized human BTK), and Eμ.BTKp (Eμ element + BTK promoter) were used. Figure 34 shows data summarizing the findings obtained from 40 recipient mice administered transfected cells to express BTK. In mice administered cells transfected with a BTK expression vector containing UCOE.BTKp.co, Eμ.BTKp, or UCOE.BTKp, the development of mature B cells was observed in the bone marrow, spleen, and peritoneal cavity. Therefore, an aspect of the present invention relates to a lentiviral vector containing a ubiquitous chromatin opening element, a BTK promoter, and codon-optimized human BTK, and this vector can be used in a method for promoting the development of mature B cells in a subject suffering from XLA.

[0181] Moreover, mice treated with cells transduced with a lentiviral vector containing a skewed chromatin opening element and a BTK promoter (UCOE.BTKp) or a lentiviral vector containing an Eμ element fused to the BTK promoter region (Eμ.BTKp) also showed B cell proliferation (Figure 35). WT Mock cells and DKO Mock cells were used as controls. Fluorescence-activated cell sorting of each cell was performed using an anti-IgM antibody. As shown in the figure, cells expressing BTK from two lentiviral vectors, UCOE.BTKp and Eμ.BTKp, expressed IgM, a basic antibody produced by B cells.

[0182] Furthermore, each cell was treated with PMA and ionomycin. PMA is used for the activation of protein kinase C (PKC), and ionomycin is used for the induction of calcium release required for NFAT signal transduction (Figure 35).

[0183] As shown in Figure 36, when cells transduced with either of the two lentiviral vectors, UCOE.BTKp and Eμ.BTKp, were treated with anti-IgM or PMA / ionomycin, cell division increased compared to the wild type. Also, in these cells, it was shown that the total secretion amounts of IgM and IgG increased compared to vectors having only the BTK promoter or vectors having the UCOE element and the BTK promoter (Figure 37).

[0184] T cell-dependent immune responses Furthermore, each transfected cell was administered to mice to test the T cell-dependent immune response. As lentiviral vectors, WT Mock, DKO, DKO Mock, BTKp, UCOE.BTKp, UCOE.BTKp.co (codon-optimized human BTK), Eμ.BTKp.co (codon-optimized human BTK), or Eμ.BTKp was used to transfect the cells. Subsequently, the immune response of T cells was evaluated. As shown in the figures, the expression levels of IgG and IgM increased in the cells transfected with the Eμ.BTKp lentiviral vector (Figs. 38 - 41).

[0185] Also, the amount of antibody was related to the expression of BTK and was also related to the survival rate of the mice. As shown in Fig. 42, the survival rate was improved in the mice administered with the cells transfected with the Eμ.BTKp lentiviral vector compared to the mice administered with DKO Mock cells.

[0186] Furthermore, the expression of BTK was also evaluated in neutrophils and secondary recipient mice. As shown in Fig. 43, when the cells transfected with the Eμ.BTKp lentiviral vector were administered to secondary recipient mice, the expression of BTK increased. In contrast, in the secondary recipient mice administered with the BTKp viral vector, the viral copy number increased (Fig. 44). When evaluating the lentiviral therapy for long-term survival, evidence was obtained that the survival rate of mice was extended by the UCOE.BTKp.co vector, UCOE.BTKp vector, and Eμ.BTKp vector.

[0187] When the BTK promoter was examined, it was demonstrated that overall, when the lentiviral vector contained the BTK promoter, BTK was significantly expressed in B cells and myeloid cells. UCOE.BTKpro and Eμ.BTKpro restored B cell development, the absolute number of B cells, B cell proliferation, and the immune response. Also, UCOE.BTKpro and Eμ.BTKpro restored myeloid cell development. Unexpectedly, vectors containing Eμ may not be safe for clinical use because they induce high titers of autoantibody production. The UCOE-Btkp-Btk vector restored cell function at far fewer viral copies than vectors without UCOE. Furthermore, the UCOE-Btkp-Btk vector sustained marker expression in mouse hematopoietic stem cells (HSCs) and human hematopoietic stem cells (HSCs). Therefore, the UCOE.BTKp-coBTK lentiviral vector is an improved unique clinical vector platform that can be further modified.

[0188] Another enhancer element Another enhancer element was used in the BTK promoter and its ability to improve BTK expression in cells was evaluated. The lentiviral constructs used are shown in Figure 46. As shown in the figure, when 1.5 kb of UCOE was used, an improvement was seen compared to the case of only the BTK promoter in B cells. However, due to the large size of the vector, further improvement was needed to reduce its size and improve the low viral titer (Figure 46).

[0189] The ends of the 1.5 kb UCOE were cut to make 0.7 kb UCOE, and a 0.7UCOE.BTKp lentiviral vector was prepared (Figure 2). As shown in Figure 2, a human BTK enhancer element that can function as an enhancer was further added to make 0.7UCOE.IE.BTKp. The intron region (IE) contained introns 4 and 5 derived from the human BTK locus associated with the human BTK proximal promoter.

[0190] Cells were transfected with 0.7UCOE.BTKp or 0.7UCOE.IE.BTKp, and the resulting cells were administered to mice using the method outlined in Figure 3. As shown in Figure 47, in cells transfected with 0.7UCOE.BTKp or 0.7UCOE.IE.BTKp, the expression of BTK and the number of splenic B cells are restored. Furthermore, these cells were shown to also restore the function of B cells (Figure 48).

[0191] Furthermore, the safety profile of cells transfected with 0.7UCOE.IE was shown to be improved compared to cells transfected with 0.7UCOE (see Figure 49). As shown in the figure, the titers of autoantibodies produced by 0.7UCOE and 0.7UCOE.IE are lower than those by the autoimmune control (and the previously reported Btk promoter - non - containing vector), and 0.7UCOE.IE exhibits equivalent efficacy despite having fewer viral integrations per cell.

[0192] Testing of BTK constructs containing DNase hypersensitive regions Lentiviral constructs for BTK expression were designed using DNase hypersensitive regions (DHS) (Figure 50). The resulting vectors were the 0.7UCOE.BTKp.coBTK vector (0.7UCOE enhancer, BTK promoter, and codon - optimized human BTK) and the 0.7UCOE.IE4,5,.BTKp.coBTK vector (0.7UCOE element, intron 4 and intron 5 of the human BTK locus associated with the human BTK proximal promoter, BTK promoter, and codon - optimized human BTK).

[0193] As shown in Figure 51, various DNase hypersensitive regions were identified.

[0194] Based on the identified introns and DNase hypersensitive regions, constructs containing intron candidates and DNase hypersensitive region candidates were constructed (Figure 52). The constructed constructs were 0.7UCOE.BTKp.coBTK, 0.7UCOE.IE.BTKp.coBTK, 0.7UCOE.DHS4.BTKp.coBTK, 0.7UCOE.DHS1,2.BTKp.coBTK, 0.7UCOE.DHS1,2,4.BTKp.coBTK, and 0.7UCOE.DHS1-5.BTKp.coBTK.

[0195] Constructs containing DNase hypersensitive regions were compared in vivo with the 0.7UCOE vector and the 0.7UCOE.IE vector. In the experimental setup, transduction was carried out overnight using 40 μl of virus per 1 × 10 6 cells (optimized so that the number of viruses (viral copy numbers) was the same for each). Next, 1 × 10 6 cells per condition were injected retroorbitally into TBKBP mice (irradiated with 900 rad of radiation before transplantation). As shown in the figure, cells transduced with 0.7UCOE.BTKp.coBTK had a higher viral copy number and a higher expression level of BTK (Figure 53).

[0196] Fifteen weeks after transplantation, B cell development was evaluated and the distribution of peripheral blood lymphocytes was examined. As shown in Figure 54, cells transduced with the constructed vectors had an increase in B cells compared to KO Mock cells, and in particular, an increase in B cells was shown with the 0.7UCOE lentiviral vector. However, in cells transduced with the lentiviral vector containing the 0.7UCOE element, the amount of reconstituted BTK in the lymphocyte subset was high.

[0197] Experiments were conducted to compare lentiviral constructs containing UCOE and intron elements with a new construct containing a DNase hypersensitive region. The viral fluid volume was adjusted using 40 μL of virus per million cells. As shown in Figure 55, in cells transduced with a lentiviral vector containing a 0.7 UCOE element, the copy number of the integrated virus was higher than that of the vector containing the DNase hypersensitive region. Also, in this experiment, no significant difference in BTK expression was observed between UCOE and the DNase hypersensitive region 4 (DHS4), but the ratio of BTK / VCN in the spleen when using DHS4 was significantly higher than that when using UCOE (Figure 56).

[0198] In another embodiment, the 0.7 UCOE.BTKp.coBTK vector, the 0.7 UCOE.DHS4.BTKp.coBTK vector, and the 0.7 UCOE.DHS1-5.BTKp.coBTK vector were used to examine BTK expression in vivo. To conduct this experiment, Lin− cells were collected from TBK donor mice. When performing transduction, the viral fluid volume was adjusted by using 10 μl of virus per million cells (goal: to adjust the copy number of the integrated virus to about 3 copies based on the prediction from in vitro tests), and transduction was performed at a density of 4×10 6 cells / ml in SCGM transduction medium (mSCF, mTPO) supplemented with polybrene over 16 hours. Next, 1.5×10 6Cells were transplanted by administering individual cells (recipient: TBK mice irradiated with 900 rad) (Figure 57). As shown in Figure 57, in cells transduced with the 0.6 UCOE construct, the viral copy number was high, but the expression level of BTK was comparable to that when a lentiviral construct containing the DHS4 element was introduced. Furthermore, when the peripheral blood lymphocyte distribution was analyzed 12 weeks later, B cells increased in cells transduced with the 0.7 UCOE lentiviral vector, 0.7 UCOE.DHS4 lentiviral vector, or 0.7 UCOE.DHS1-4 lentiviral vector. Thus, it was shown that mature B cells were generated in mice due to the induction of BTK expression by these lentiviral vectors (Figure 58). The distribution of peripheral blood lymphocytes 6 weeks later is shown in Figure 59. As shown in the figure, the production of B cells increased in cells expressing BTK from 0.7 UCOE, 0.7 UCOE.DHS4, or 0.7 UCOE.DHS1-4 (Figure 59). Furthermore, when cells transduced with the 0.7 UCOE lentiviral vector, 0.7 UCOE.DHS4 lentiviral vector, or 0.7 UCOE.DHS1-4 lentiviral vector were administered to mice and evaluated 6 and 12 weeks later, it was shown that BTK was expressed in B cells, monocytes, and neutrophils (Figure 60). In the blood sampling experiment 12 weeks later, it was shown that BTK was expressed in all subsets (Figure 61).

[0199] Testing of another human BTK construct with codon optimization Experiments were conducted to examine the effect of the codon-optimized human BTK construct on the cellular expression of BTK. The codon-optimized human BTK has been reported by Ng et al. (“Correction of B cell development in Btk-deficient mice using lentiviral vectors with codon-optimized human BTK.” Leukemia. 2010 Sep;24(9):1617-30; this reference is incorporated herein by reference in its entirety).

[0200] The following experiments aimed to compare the expression of BTK and BTK staining when using two codon-optimized human BTKs. The experimental setup included isolating Lin- cells from TBK mice; adding 5 μl, 10 μl, or 20 μl of virus to 1×10 6 cells (4×10 6 cells / ml) in complete SCGM transduction medium supplemented with mSCF, mTPO, and polybrene; culturing in vitro for 7 days; and analyzing BTK staining and viral copy number on day 7. The lentiviral constructs used were 0.7UCOE.BTKp.coBTK (titer: 1.17×10 9 ), 0.7UCOE.DHS4.BTKp.coBTK (titer: 1.09×10 9 ), 0.7UCOE.BTKp.newcoBTK (titer: 1.81×10 8 ), and 0.7UCOE.DHS4.BTKp.newcoBTK (titer: 1.13×10 8 ) (Figure 62).

[0201] As shown in Figure 63, BTK expression increased in cells transduced with 0.7UCOE.newcoBTK or DHS4.newcoBTK by adding 5 μL, 10 μL, or 20 μL of virus. Furthermore, the MFI increased in cells transduced with 0.7UCOE.newcoBTK or DHS4.newcoBTK by adding 5 μL, 10 μL, or 20 μL of virus (Figure 64). Optimal viral copy number per cell was shown in cells transduced by adding 10 μL of the 0.7UCOE.newcoBTK lentiviral vector or the DHS4.newcoBTK lentiviral vector (Figure 64).

[0202] Comparing the original codon-optimized human BTK and the newly codon-optimized human BTK in vivo was also considered. The experimental groups included 0.7UCOE.BTKp.coBTK (titer: 1.17×10 9)(5 mice), 0.7 UCOE.DHS4.BTKp.coBTK (titer: 1.09×10 9 )(5 mice), 0.7 UCOE.BTKp.newcoBTK (titer: 1.81×10 8 )(5 mice), 0.7 UCOE.DHS4.BTKp.newcoBTK (titer: 1.13×10 8 )(5 mice), KO Mock (3 mice), WT Mock (5 mice) and non-irradiated control (1 mouse) are included. The transduction setup includes adjusting the virus volume to 10 μl per 1 million cells (to ensure consistency in these in vivo tests) (Figure 71).

[0203] Testing regarding the selection of the directionality of the UCOE element in the lentiviral vector Experiments were conducted to examine the effect of the orientation of the UCOE element on the cellular expression of BTK (Figure 66). To evaluate whether the orientation of UCOE affects the expression of BTK, constructs shown in Figure 67 were prepared.

[0204] In this experiment, four lentiviral vectors of KO Mock, 0.7 UCOE.BTKp (7.52×10 7 ), 0.7 UCOEfwd.BTKp col4 (6.79×10 8 ), 0.7 UCOEfwd.BTKp col6 (1.79×10 9 ) and WT Mock were tested. As shown in Figure 68, the expression levels of BTK among the 0.7 UCOE.BTKp lentiviral vector (7.52×10 7 ), 0.7 UCOEfwd.BTKp col4 lentiviral vector (6.79×10 8 ) and 0.7 UCOEfwd.BTKp col6 lentiviral vector (1.79×10 9 ) were comparable, but increasing the virus volume increased the virus copy number.

[0205] As can be seen from the experiments, the BTK promoter is a strong promoter. Regarding the UCOE element, the 0.7 kb UCOE effectively prevents the silencing of BTK expression and increases the titer of the vector. Furthermore, when the UCOE is arranged in the forward direction, the titer significantly increases, but no change is observed in the expression level of BTK. This indicates that the reverse UCOE functions equivalently to the high-titer construct. Additionally, regarding the enhancer element, 0.7UCOE.IE.Btkp restores the BTK expression ability with fewer viral integrations than 0.7UCOE.Btkp, but it has been shown that adding a short enhancer element (DHS region) does not increase the titer compared to the longer IE construct.

[0206] Since the forward UCOE increases the titer of IE by more than 1 log, it has been shown that the forward UCOE increases the titer in all constructs.

[0207] For example, 0.7UCOE.DHS4.Btkp has been shown to increase BTK expression in B cells and myeloid cells more potently than 0.7UCOE.IE.Btkpro. From this, it has been shown that the 0.7UCOE.DHS4.Btkp vector is a particularly potent vector.

[0208] Regarding codon-optimized human BTK, the aforementioned new construct significantly increases BTK expression compared to the original co-Btk construct.

[0209] Testing of IgG, IgM, and NP-specific Ig / M in human hematopoietic stem cells (HSCs) - controls and XLA subjects Using a lentiviral vector, the recovery of B cell development in vivo and the recovery of the function of cells affected by XLA were investigated. Experiments were conducted to evaluate whether the B cell phenotype of XLA patients could be reproduced in NSG mice. Furthermore, in the aforementioned method, it was also examined whether B cell development could be restored in vivo by transducing stem cells affected by XLA using the aforementioned clinical lentiviral vector. A table showing the XLA patients selected for this treatment is shown in FIG. 71.

[0210] As the phenotype of peripheral B cells in XLA, the percentage of B cells is significantly low, the percentage of transitional B cells / immature B cells (CD38+CD24+CD10 high ) is high, and mature B cells (CD38-CD24-CD10 low ) are lacking.

[0211] Human chimeras in NSG mice are shown for XLA patients P2, P3, and P4 in FIG. 72. As shown in the figure, comparable numbers of hCD45 cells engrafted in the bone marrow, but the percentage of differentiated hCD45 cells (%) was significantly lower in the periphery.

[0212] Regarding human lymphocyte reconstitution, the percentage of B cells was comparable in the bone marrow for all of XLA patients P2, P3, and P4, but was significantly lower in the spleen, and myeloid cells and T cells were relatively increased (FIG. 73).

[0213] The phenotype of transplanted XLA-affected stem cells (in the spleen) is shown for XLA patients P2, P3, and P4 in FIG. 74. As shown in the figure, the percentage of mature B cells was low in each patient, but the percentage of immature B cells was comparable (FIG. 75).

[0214] The phenotypes of transplanted XLA-affected stem cells (in the spleen) are shown for XLA patients P2, P3, and P4 in FIG. 76. As shown in the figure, it was shown that the percentage (%) of pro-B cells in the patients was equal between the XLA group and the healthy group.

[0215] B cell development arrest was examined for all XLA patients. As shown in FIG. 77, BTK enables the differentiation of pro-B cells into mature B cells. Cells were analyzed for the expression of hCD19+, CD22+, and CD179a+. As shown in the figure, XLA patients had a significantly higher percentage (%) of pre-B cells than healthy controls. Thus, B cells affected by XLA are arrested in differentiation at the pre-B cell stage where they can migrate to the spleen (FIGS. 78 and 85).

[0216] In cells affected by XLA, the function of B cells due to the influx of Ca 2+ was examined (FIG. 80). As shown in the figure, in B cells affected by XLA, since IgM was expressed, Ca 2+ could not be made to flow in compared to the control.

[0217] When B cells affected by XLA were evaluated, it was shown that in cells affected by XLA, B cell development arrests at the pre-B cell stage (FIG. 81).

[0218] As shown in the figure, in XLA patients, the number and percentage (%) of B cells in the spleen are decreased. Furthermore, B cell development arrests at the pre-B cell stage in the bone marrow. As a next step, the B cell phenotype of XLA patients was reproduced in NSG mice to examine the effect of a lentiviral vector system expressing BTK.

[0219] Using the 0.7UCOE.BTKp.coBTK vector and the 0.7UCOE.DHS4.BTKp.coBTK vector, lentiviral transduction of human stem cells was performed according to the methods shown in FIGS. 83 and 90.

[0220] When human stem cells were transduced with a lentivirus, the survival rate of 0.7UCOEBTKp.BTK was 70% compared to the vector containing the fourth DNase hypersensitive region (Figure 85).

[0221] In addition, when cells derived from an XLA P2 patient were transduced with the 0.7UCOE.BTK.pBTK lentiviral vector, expression of BTK was observed. As shown in experiments under non-selective conditions, the expression of BTK was higher with 0.7UCOE.BTKpBK compared to the lentiviral vector containing the fourth DNase hypersensitive region (Figure 86).

[0222] As a result of the above experiments, it was concluded that stem cells affected by XLA could be transduced with 0.7UCOE.BTKp.BTK and 0.7UCOE. DHS4.BTKp.BTK was introduced at 1 - 2 copy numbers at MOI = 10, and this viral copy number is clinically significant. Therefore, it is considered that in vivo, transduction of stem cells affected by XLA with a lentivirus can restore B cell development.

[0223] Construction of a preclinical model of human hematopoietic stem cells (HSCs) A lentiviral vector expressing codon-optimized human BTK fused to GFP, which is self-cleavable with a T2A linker, was used to evaluate the construction of a preclinical model of human hematopoietic stem cells (HSC) (see Figure 88). As shown in the figure, the constructs tested contained a UCOE element, a BTK promoter, a codon-optimized human BTK gene, and a T2A-GFP marker protein. When CD34 + HSC were transduced with the lentiviral vector in vitro, GFP increased in the transduced cells (Figure 88). Then, as shown in Figure 90, these cells were administered to NSG recipient mice. In vivo analysis after 6 months showed an increase not only in B cells but also in myeloid cells (Figures 89 and 97).

[0224] Additional tests using the construct shown in Fig. 92 are also conceivable. A bioinformatics approach was taken using information on regulatory markers for specific cell lines available from the ENCODE genome-wide database. Regulatory markers were found in a process of identifying enhancer candidates using the conserved non-coding sequence information.

[0225] To improve tissue-specific BTK expression, conserved non-coding sequences were identified by comparing human and mouse non-coding sequences and identifying highly conserved regions. The conserved non-coding sequences were cloned immediately upstream of BTKp to confirm whether they could cooperate with the BTK promoter (BTKp) to improve expression. In the first reading, GFP reporter was used to track the expression. When the expression is improved, the signal of GFP, i.e., "MFI" increases. It was found that intron 4 and intron 5 increase MFI, and a contig containing intron 4, intron 5 and intron 13 also increases MFI. GFP was encoded by the sequence shown in SEQ ID NO: 8. The sequences shown in Set 1 of Fig. 92 are shown in SEQ ID NOs: 23 to 30. The test sequences encoding GFP are shown in SEQ ID NO: 31, SEQ ID NO: 32, and SEQ ID NOs: 36 to 40.

[0226] Next, using GFP, the contigs containing intron 4, intron 5 and intron 13 and the contigs containing only intron 4 and intron 5 were retested in vitro to make these comparisons. The contigs containing only intron 4 and intron 5 showed higher MFI.

[0227] Using a mouse gene therapy model, a contig containing only introns 4 and 5 was tested in vivo. The contig containing only introns 4 and 5 is referred to as intron enhancer 4,5 or IE4-5. In this study, an enhancer element / promoter element was used to promote the expression of the codon-optimized human BTK coding sequence. As a result of this study, it was shown that the introduction of IE4-5 improved the expression of BTK per viral copy number.

[0228] Polypeptides encoding sequences for expressing BTK are shown in SEQ ID NOs: 33-35 and SEQ ID NOs: 41-45.

[0229] Scrutiny of enhancer candidates using information from the ENCODE database In IE4-5, to more precisely define the DNA elements that exhibit enhancer activity, the ENCODE database was used to search for DNase hypersensitive regions contained in these introns. As a result, one DNase hypersensitive region was found in each intron. Although these DNase hypersensitive regions were found in B cells and myeloid cells, they did not always exist in non-related tissues. These DNase hypersensitive regions are referred to as DHS4 and DHS5, respectively. DHS4 and DHS5 were each 725 bp and 1077 bp shorter than the intron regions in which they were contained. In B cells and myeloid cells, DNase hypersensitive regions (DHS1, DHS2, and DHS3) were also identified within intron 1. Since there was evidence that intron 1 might increase MFI in vitro, these were also tested. As a result of the segmentation analysis using ENCODE, it was identified that DHS3 and DHS4 have characteristics as transcriptional enhancers in B cells. Also, DHS5 was identified as a CTCF binding site and an insulator candidate.

[0230] Various combinations of DHS regions 1-5 were also tested.

[0231] "1 kb" and "3 kb" shown in Fig. 92 are non-conserved sequences of intron 1 for adjusting the size of the enhancer.

[0232] By cleaving the ends of the 1.5 kb UCOE to 0.7 kb and identifying regions that can function as DNA enhancer elements, it may be possible to improve the titer of the lentiviral construct and the expression of BTK Figure 93A shows the result of cleaving the ends of the 1.5 kb ubiquitous chromatin opening element (UCOE) to 0.7 kb. The UCOE element is present in a large CpG-rich region spanning the promoter regions where the housekeeping gene CBX3 and the housekeeping gene HNRPA2B1 are transcribed outward from each other, and has been conventionally truncated to a region of 1.5 - 2.2 kb in length by various research groups for use in protein expression constructs. The 1.5 kb UCOE used in this experiment extends from exon 1 of CBX3 beyond the alternative exon 1 of CBX3. When this region is truncated at the ends to a size of 0.7 kb, the region downstream of the alternative exon 1 is removed. (Fig. 93B) Using the ENCODE database, DNase I hypersensitive regions (DHSs) were identified from the intron region of the BTK gene and visualized using the UCSC Genome Browser on Human Feb. 2009 (GRCh37 / hg19) Assembly. Five DHSs were identified and designated as DHS1, DHS2, DHS3, DHS4, and DHS5 in order (blue squares). By genome segmentation using ENCODE, a predicted enhancer element was identified around DHS4 (yellow square). Exons are shown as black squares. The sequence lengths are described below each DHS. These DHS sequences were variously combined and cloned into the 0.7UCOE.BTKp.coBTK construct and tested in vitro as follows (data not shown). Mouse Btk with lentivirus (LV) containing various expression cassettes shown below - / - Tec - / -It was transfected into bone marrow cells. Subsequently, the average fluorescence intensity of the expression of the transgene was compared by flow cytometry. (Fig. 93C) An in vitro transfection experiment into negative cells derived from the mouse (TBK) strain was carried out, and the expression levels of BTK by two kinds of codon-optimized BTKs were compared. As these two kinds of codon-optimized BTKs, coBTK (Figs. 1-2) and the codon-optimized BTK reported by Staal et al. (Leukemia 2010) (referred to as co2BTK in this specification) were used. The expression of BTK 7 days after transfection is shown in a representative flow cytometry plot. (Fig. 93D) Based on the results of the in vitro test of the DHS construct and the results of comparing coBTK and co2BTK, four constructs to be used in the in vivo test were identified. As shown in the figure, these constructs are lentiviral constructs having an RRL backbone, express any kind of codon-optimized human BTK (coBTK or co2BTK), contain a 0.7 kb ubiquitous chromatin opening element (0.7UCOE), and either DHS4 is added downstream or not added.

[0233] Figure 94 shows the results demonstrating the restoration of BTK expression in affected hematopoietic cell lineages and B cell development in mice treated with the 0.7UCOE vector-mediated gene therapy. At 19 - 23 weeks after transplantation, the percentage of BTK+ cells, the cell numbers of each reconstituted B cell subset, and the cell numbers of each myeloid cell subset were evaluated. (Figure 94A) Representative flow cytometry plots showing intracellular BTK staining in splenic B cells in endpoint analysis are presented. (Figures 94B - D) The percentage (%) of BTK+ cells in each lymphocyte subset in bone marrow (Figure 94B), spleen (Figure 94C), and peritoneal cavity (Figure 94D) obtained from the gene therapy-treated groups was measured by flow cytometry. Each cell subset was defined as neutrophils (CD11b+GR1+), monocytes (CD11b+), and B cells (B220+). (Figures 94E - F) The mean cell numbers of each B cell subset in bone marrow (Figure 94E), spleen (Figure 94F), and peritoneal cavity (Figure 94G) are shown as stacked bar graphs. Early B cell development (bone marrow), namely pro-B cells + pre-B cells (IgM-, IgD-), immature B cells (IgM+IgD-), and mature B cells (IgM+, IgD+) are shown. Late B cell development (spleen), namely transitional type 1 (T1) B cells (CD24hi, CD21-), transitional type 2 (T2) B cells (CD24hi, CD21int), marginal zone / marginal zone precursor (MZ / MZP) B cells (CD24hi, CD21hi), and follicular mature (FM) B cells (CD24int, CD21int) are shown. Intraperitoneal B cell subsets, namely B1 cells (IgM+CD43+) and B2 cells (CD43-) are shown. (Figure 94H) Restoration of BTK expression in each B cell subset measured by flow cytometry is shown. (Figure 94I) In each experiment, the MFI of BTK+ in the B cell development process normalized to WT Mock is shown. Data represent the mean ± SD of 4 independent experiments, with n = 13 (WT Mock), n = 13 (KO Mock), n = 11 (0.7UCOE.BTKp.co), n = 11 (0.7UCOE.BTKp.co2), n = 16 (0.7UCOE.DHS4.BTKp.co), n = 11 (0.7UCOE.DHS4.BTKp.co2), and n = 6 (0.7UCOE.DHS1 - 5.BTKp.co).P values were calculated by one-way ANOVA using the Sidak method (***P < 0.001; **P = 0.001 - 0.01; *P = 0.01 - 0.05).

[0234] Recovery of B cell function in vivo and in vitro is shown in Fig. 95. (Fig. 95A) Twelve weeks after transplantation, mice were immunized with NP-CGG plus alum. The NP-specific IgG concentration in the sera of immunized mice was measured by ELISA and shown as the relative amount to the IgG standard. Serum concentrations of high-affinity NP-specific IgG were measured before immunization (-) and 10 days after the primary immunization (1 0 ) and 1 month after the first immunization, mice were re-administered with NP-CGG in PBS, and sera were collected 10 days later (2 0)。(Figs. 95B - C) In endpoint analysis (21 - 23 weeks after transplantation), the total IgG concentration (Fig. 95B) and total IgM concentration (Fig. 95C) in the sera of mice treated with each vector were measured by ELISA. (Figs. 95D - F) In endpoint analysis, B cells were isolated from splenocytes by magnetic separation of CD43− cells, labeled with Cell Trace Violet, and stimulated with IgM, LPS, or medium control in vitro. (Fig. 95D) The percentage (%) of BTK+ B cells that underwent more than one cell division after 72 - hour incubation with anti - mouse IgM antibody, LPS, or medium alone is shown (analyzed by flow cytometry). (Fig. 95E) The mean fluorescence intensity (MFI) of BTK+ in cells after each cell division (D0 - D4), normalized to WT Mock, is shown. (Fig. 95F) A representative flow cytometry plot showing BTK staining plotted against dilution of the Cell Trace reagent in B cells 72 hours after stimulation with IgM, gated on live cells and B220+BTK+ cells. Data are shown as the mean ± SD of 4 independent experiments, with n = 13 (WT Mock), n = 13 (KO Mock), n = 11 (0.7UCOE.BTKp.co), n = 11 (0.7UCOE.BTKp.co2), n = 16 (0.7UCOE.DHS4.BTKp.co), n = 11 (0.7UCOE.DHS4.BTKp.co2), and n = 6 (0.7UCOE.DHS1 - 5.BTKp.co). P - values were calculated by one - way ANOVA using the Sidak method (***P < 0.001; **P = 0.001 - 0.01; *P = 0.01 - 0.05).

[0235] Considerations regarding the safety of the vectors are shown in Fig. 96. The anti-dsDNA IgG concentration (Fig. 96A) and anti-dsDNA IgG2c concentration (Fig. 96B) in the sera of mice treated with each vector were measured by ELISA and shown as the measured absorbance values (OD450). As positive controls, sera obtained from a known WAS chimeric mouse model with an autoimmune disease tendency and sera obtained from mice treated with Eμ.BTKp were used. (Fig. 96C) In the endpoint analysis, genomic DNA was isolated from total bone marrow cells and total spleen cells, and the number of virus integrations per cell (virus copy number) was quantified by qPCR. The data show the mean ± SD of four independent experiments, with n = 13 (WT Mock), n = 13 (KO Mock), n = 11 (0.7UCOE.BTKp.co), n = 11 (0.7UCOE.BTKp.co2), n = 16 (0.7UCOE.DHS4.BTKp.co), n = 11 (0.7UCOE.DHS4.BTKp.co2), and n = 6 (0.7UCOE.DHS1-5.BTKp.co). P values were calculated by one-way ANOVA using the Sidak method (***P < 0.001; **P = 0.001 - 0.01; *P = 0.01 - 0.05).

[0236] Construction of a preclinical model using a lentiviral (LV) vector in human hematopoietic stem cells (HSCs) obtained from XLA patients The following experiments were conducted with the aim of evaluating whether the generation of B cells from human hematopoietic stem cells (HSCs) affected by XLA could be restored when gene therapy vectors were transplanted into immunodeficient NSG mice. CD34 cells were obtained from XLA patient 3 (missense mutation) and healthy donor No. 15. The transduction protocol included pre-stimulating the cells for 48 hours in SCGM medium (TPO, FLT3, and SCF (each 100 ng / ml)) and then adding the lentivirus once. The lentivirus was used at an MOI = 5. The lentiviruses used were 0.7 UCOE.BTKp.BTK.co2 (titer: 7×10 8 ) and DHS4.co2 (titer: 1×10 9 ).

[0237] Experimental mice: 4 mice = healthy donor No. 15 (HD)

[0238] 3 mice = Mock-treated XLA P3 patients (XLAP3)

[0239] 5 mice = 0.7UCOE.BTKp.BTK.co2 (0.7UCOE)

[0240] 4 mice = 0.7UCOE.DHS4.BTKp.BTK.co2 (DHS4)

[0241] Analysis was performed 12 weeks after transplantation (Figure 97).

[0242] Figure 98 shows the results of transplanting human hematopoietic cells into the bone marrow with the same conditions among multiple treatment groups. Human stem cells derived from XLA patients who received gene therapy or human stem cells derived from XLA patients who did not receive gene therapy were transplanted into the bone marrow under the same conditions as human stem cells derived from healthy donors. Representative flow cytometry plots showing various markers of human immune cells, including human and mouse CD45 (hematopoietic cell marker), CD33 (myeloid cells), and CD19 (B cells), as well as CD4 and CD8 (T cells), are shown. After gating live total bone marrow cells with hCD45+ and mCD45− to obtain the human hematopoietic cell fraction, the CD33 marker and CD19 marker were analyzed in the cell population gated with hCD45+, and further, CD4 and CD8 were analyzed in the cell population gated with CD33−CD19−. (Figures 98B and 98C) show the percentage of human CD45 cells transplanted into the bone marrow (%) and the total number of hCD45 cells. n = 4 was set for each cohort (XLA3, XLA3 + 0.7UCOE.BTKp.BTKco2 lentivirus, XLA3 + 0.7UCOE.DHS4.BTKp.BTKco2 lentivirus, and healthy donor).

[0243] Figure 99 shows the results of treating HSCs from 3 XLA patients with gene therapy using 0.7UCOE.BTKp BTKco2 or 0.7UCOE.DHS4.BTKp.BTKco2 and administering these HSCs to mouse recipients. From these results, it can be seen that the number of human hematopoietic cells in the spleen is significantly increased. (Figure 99A) Representative flow cytometry plots showing various markers of human immune cells, including human and mouse CD45 (hematopoietic cell marker), CD33 (myeloid cells), and CD19 (B cells), as well as CD4 and CD8 (T cells). After gating hCD45+ and mCD45- to obtain the human hematopoietic cell fraction, the CD33 marker and CD19 marker were analyzed in the cell population gated with hCD45+, and further, CD4 and CD8 were analyzed in the cell population gated with CD33-CD19-. (Figures 99B and 99C) The percentage (%) and total number of hCD45+ splenocytes are shown. For each cohort, n = 4, and **P = 0.004 (one-way ANOVA). Figure 100 shows the results of transducing HSCs from XLA patients with lentivirus (using 0.7UCOE BTKp BTKco2 or DHS4 BTKpBTK.co2) and administering these HSCs to recipients. From these results, it can be seen that the proportion of splenic B cells (CD19+ cells) is increased compared to untreated cells from XLA patients. The flow cytometry results shown in Figure 2 are summarized by type of human immune cell. A - C: The percentage (%) of B cells (CD19+), myeloid cells (CD33+), and T cells (CD4+ or CD8+) in human CD45+ cells in the spleen are shown. D - F: The total number of B cells (CD19+), myeloid cells (CD33+), and T cells (CD4+ or CD8+) in human CD45+ cells in the spleen are shown. For each cohort, n = 4, and **P = 0.0044 (one-way ANOVA).

[0244] A representative flow cytometry plot examining each subset found in the B cell development process in the spleen is shown in Figure 101. A typical gating method for identifying each subset found in the human B cell development process in each gene therapy cohort is shown (on the right). The markers used in each panel are shown below (Hist = histogram). If pre-gating was performed, it is shown above each column. Human CD24 cells and hCD38 cells were gated from human CD19+ cells. Immature B cells (hCD24+hCD38+) are IgM+IgD-CD10high, and mature B cells (CD24lowCD38low) are IgM+IgD+CD10low.

[0245] Figure 102 shows the results of transducing HSCs from XLA patient 3 with lentivirus (using 0.7UCOE.BTKp.BTKco2 or 0.7UCOE.DHS4 BTKp.BTKco2) and transplanting these HSCs into recipients. As shown in the figure, in this recipient, the proportion of immature B cells (including CD19+CD24+CD38+ B cells and CD19+CD24+CD38+IgM+ cells) in the spleen was increased compared to the XLA control. A graph summarizing the flow cytometry results shown in Figure 4 by specific immature B cell subpopulations is shown. A: Shows the proportion (%) of immature B cells (CD24+CD38+) in the spleen. B: Shows the proportion (%) of IgM+ immature B cells. C - D: Shows the total number of immature B cells (CD24+CD38+) and the total number of CD24+hCD38+IgM+ cells in the spleen. E: Shows an overlay of histograms of CD10 and shows the change in the mean fluorescence intensity (MFI) of CD10 compared to healthy donors. For each cohort, n = 4, and ***P = 0.0004; **P = 0.0044; *P = 0.4 (one-way ANOVA).

[0246] When HSCs from XLA patients are transduced with lentivirus (0.7UCOE.BTKp.BTKco2 or 0.7UCOE.DHS4 BTKp.BTKco2) and transplanted into recipients, compared to the XLA control, mature B cells (CD19 + CD24 lowCD38 low IgM + IgD + ) The increase in the proportion is shown in Figure 103. (Figure 104A - C) Mature B cells (hCD24 in the spleen low hCD38 low ) The proportion (%) and IgM + Mature B cells and IgM + IgD + The proportion (%) of mature B cells is shown. (Figure 103D - F) Spleen mature B cells, IgM + Mature B cells and IgM + IgD + The total number of mature B cells is shown. (Figure 103G) It is an overlay of the histograms of CD10, indicating that the MFI of CD10 is similar to that of healthy donors. N = 4 for each cohort, ***P = 0.0004; **P = 0.0044; *P = 0.4 (one - way ANOVA).

[0247] Representative flow cytometry plots examining each subset seen in the B - cell development process in the bone marrow are shown in Figure 104. In each gene therapy cohort, the gating method for identifying each subset seen in the human B - cell development process in the bone marrow is shown (on the right). The markers used in each panel are shown below (Hist = histogram). If pre - gating was performed, it is shown above each column. Human CD24 cells and hCD38 cells were gated from human CD19 + cells. Immature B cells (hCD24 + hCD38 +) in the bone marrow are IgM + IgD - CD10high.

[0248] When HSCs from XLA patients are transduced with lentivirus (using 0.7UCOE BTKp BTKco2 or DHS4 BTKpBTK.co2) and transplanted into recipients, compared with XLA controls, CD19 + CD24 + CD38 + IgM +Figure 105 shows an increase in the proportion of immature B cells. A graph shows a summary of flow cytometry analysis based on the gating method shown in Figure 7. Each dot represents one mouse. (A - D) show the proportion (%) and number of immature B cells (CD24 + CD38 + ) and IgM + . (E) shows an overlay of histograms of CD10 and shows the change in MFI of CD10 compared to healthy donors. Blue represents individual mice treated with lentivirus containing 0.7.UCOE.BTKp.BTKco2, and orange represents individual mice treated with lentivirus containing 0.7UCOE.DHS4.UCOE.BTKp.BTKco2. n = 4 for each cohort. Statistical significance was calculated by one - way ANOVA, and ***P = 0.0004; **P = 0.0044; *P = 0.4

[0249] Figure 106 shows that when HSCs from XLA patients are transduced with lentivirus (using lentivirus containing 0.7UCOE BTKp BTKco2 or lentivirus containing 0.7UCOE.DHS4 BTKp.BTK.co2) and transplanted into recipients, the gene is integrated at a viral copy number (VCN) of 0.2 - 2 per cell in vivo. The virus integrated into the bone marrow (A) and spleen (B) and CD34 cells (C) before transplantation was measured by quantitative PCR, and the number of viral integrations per cell was calculated. There was no significant difference between 0.7UCOE.Co2.BTKp.BTK and DHS4.BTKp.BTKCo2. Each dot represents one mouse (A and B: N = 4, C: N = 1).

[0250] Treatment of HSCs derived from XLA patient 3 with a lentivirus containing 0.7UCOE.BTKp.BTKco2 or a lentivirus containing 0.7UCOE.DHS4.BTKp.BTKco2, and transplantation of these HSCs into recipients, result in the production of IgM-secreting B cells in vivo, as shown in Figure 107. The total IgM concentration in serum obtained 12 weeks after transplantation was quantified by ELISA. The IgM concentration (μg / mL) was determined using a human IgM standard. Each dot represents the result of one mouse, with N = 4 for each cohort.

[0251] Transduction of HSCs derived from XLA patient 3 with a lentivirus containing 0.7UCOE.BTKp.BTKco2 or a lentivirus containing 0.7UCOE.DHS4.BTKp.BTKco2, and transplantation of these HSCs into recipients, result in the recovery of calcium influx by B cells in response to B cell receptor (BCR) ligation, as shown in Figure 108. 5 × 10 6 spleen cells obtained from mice in each cohort were pooled and analyzed for calcium influx by splenocytes in response to B cell receptor (BCR) signaling. Calcium influx in response to B cell receptor (BCR) signaling is an important event downstream of BTK activation. Figure 108A is a representative flow cytometry plot showing the gating method for human CD19+ cells to evaluate calcium influx. Figure 108B shows the kinetic analysis of intracellular calcium concentration by flow cytometry after B cell receptor (BCR) ligation with a human IgM antibody.

[0252] A representative flow cytometry plot showing B cell class switch in vitro is shown in Figure 110. Spleen cells from recipient mice were cultured with a B cell differentiation induction protocol (previous slide) and stained with markers for the identification of plasma B cells. Also, the culture supernatant was collected and the human IgM concentration and human IgG concentration were measured by ELISA.

[0253] When HSCs derived from XLA patients are transduced with lentivirus (using 0.7 UCOE BTKp BTKco2 or DHS4 BTKpBTK.co2) and transplanted into recipients, Figure 111 shows that B cells capable of responding to cytokines and T cell-dependent signals are produced and antibodies are secreted. 0.5 × 10 6 Individual total spleen cells (pooled total spleen cells obtained from the mice of each cohort) were cultured in IMDM + 10% FBS + 2-mercaptoethanol medium. In Phase I, the cells were cultured for 7 days in the presence of MegaCD40L (100 ng / ml) + CpG ODN 2006 (1 μg / ml) + IL-2 (50 ng / ml) + IL-10 (50 ng / ml) + IL-15 (10 ng / ml). After the end of Phase I, the cells were washed twice with PBS and cultured for 3 days in Phase II medium (IMDM + 10% FBS + BME supplemented with IL-2 (50 ng / ml) + IL-6 (50 ng / ml) + IL-10 (50 ng / ml) + IL-15 (10 ng / ml)), and then the medium was changed to Phase III medium (IMDM + 10% FBS + BME supplemented with IL-6 (50 ng / ml) + IL-15 (10 ng / ml) + IFN-α2B (100 U / ml)) and cultured for 4 days. After the culture was completed, the culture supernatant was collected, and the human IgG concentration (A) and human IgM concentration (B) were measured by ELISA using human IgM and human IgG standards.

[0254] Further embodiments As described herein, provided is a polynucleotide for maintaining the expression of Bruton's tyrosine kinase (BTK). The polynucleotide may include a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the UCOE has a length (kb) within a range defined by 2 kb, 1.5 kb, 1 kb, 0.75 kb, 0.5 kb or 0.25 kb, or any two of these numerical values. In some embodiments, the first sequence includes the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the BTK promoter includes the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence includes the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the promoter is a B cell-specific promoter. In some embodiments, the B cell-specific promoter includes the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence includes the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the polypeptide further includes one or more enhancer elements. In some embodiments, the one or more enhancer elements include at least one DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region includes the sequence shown in SEQ ID NO: 3. In some embodiments, the one or more enhancer elements include at least one intron region.In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the at least one intron region is intron 4, intron 5, and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5), and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4, SEQ ID NO: 14, or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward orientation. In some embodiments, the UCOE is in the forward orientation. In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further comprises a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, the polypeptide comprises the sequence shown in SEQ ID NO: 33, 34, 35, 41, 42, 43, 44, or 45. In some embodiments, the 0.7 UCOE comprises the sequence shown in SEQ ID NO: 1. In some embodiments, the 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0255] Furthermore, provided is a vector for maintaining the expression of Bruton's tyrosine kinase (BTK) in cells. The vector may include a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the first sequence includes the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the promoter includes the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence includes the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the vector further includes a B cell-specific promoter. In some embodiments, the B cell-specific promoter includes the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence includes the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the vector further includes one or more enhancer elements. In some embodiments, the one or more enhancer elements include at least one intron region. In some embodiments, the one or more enhancer elements include a DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region includes the sequence shown in SEQ ID NO: 3. In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter.In some embodiments, the at least one intron region is intron 4, intron 5, and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5), and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4, SEQ ID NO: 14, or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward direction. In some embodiments, the UCOE is in the forward direction. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34. + A hematopoietic stem cell. In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further comprises a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, the polypeptide or vector comprises the sequence shown in SEQ ID NO: 33, 34, 35, 41, 42, 43, 44, or 45. In some embodiments, 0.7 UCOE comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0256] In some embodiments, there is provided a cell for BTK expression, comprising a polynucleotide comprising a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the polynucleotide is incorporated into a vector. The vector may comprise a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the vector further comprises a B cell-specific promoter. In some embodiments, the B cell-specific promoter comprises the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence comprises the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the vector further comprises one or more enhancer elements. In some embodiments, the one or more enhancer elements comprise at least one intron region. In some embodiments, the one or more enhancer elements comprise a DNase hypersensitive region (DHS). In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region comprises the sequence shown in SEQ ID NO: 3.In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the at least one intron region is intron 4, intron 5, and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5), and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4 (SEQ ID NO: 4: introns 4-5), the sequence shown in SEQ ID NO: 14, or the sequence shown in SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward orientation. In some embodiments, the UCOE is in the forward orientation. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34. + is a hematopoietic stem cell. In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further comprises a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or the sequence shown in SEQ ID NO: 22. In some embodiments, the vector is a lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34+ It is a hematopoietic stem cell. In some embodiments, 0.7UCOE contains the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer contains the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0257] In some embodiments, a method of promoting B cell survival, proliferation, and / or differentiation in a subject in need thereof, the method comprising administering to the subject a cell according to any one of the embodiments of the present invention, or a polynucleotide according to any one of the embodiments of the present invention or a cell comprising a vector according to any one of the embodiments of the present invention; optionally, prior to administering the cell, identifying the subject as a subject who may benefit from a therapeutic method that can promote B cell survival, proliferation, and / or differentiation; and / or optionally, measuring B cell survival, proliferation, and / or differentiation in the subject or a biological sample obtained from the subject. The vector may comprise a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the vector further comprises a B cell-specific promoter. In some embodiments, the B cell-specific promoter comprises the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence comprises the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the vector further comprises one or more enhancer elements. In some embodiments, the one or more enhancer elements comprise at least one intron region. In some embodiments, the one or more enhancer elements comprise a DNase hypersensitive region (DHS).In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region comprises the sequence shown in SEQ ID NO: 3. In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the at least one intron region is intron 4, intron 5 and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5) and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4 (SEQ ID NO: 4: introns 4-5), SEQ ID NO: 14 or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward orientation. In some embodiments, the UCOE is in the forward orientation. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34. +It is a hematopoietic stem cell. In some embodiments, the one or more enhancer elements include the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further includes a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer includes the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, the cell is obtained from the subject, and the cell is genetically recombined by introducing the polynucleotide or vector according to any one of the embodiments of the present invention. In some embodiments, the administration is performed by adoptive cell transfer. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 + It is a hematopoietic stem cell. In some embodiments, the subject is male. In some embodiments, the subject suffers from X-linked agammaglobulinemia (XLA). In some embodiments, the subject is selected as a subject to receive immunoglobulin replacement therapy. In some embodiments, the subject is selected as a subject to receive a targeted antimicrobial agent. In some embodiments, the polypeptide or vector includes the sequence shown in SEQ ID NO: 33, 34, 35, 41, 42, 43, 44 or 45. In some embodiments, the polypeptide or vector includes the sequence shown in SEQ ID NO: 33, 34, 35, 41, 42, 43, 44 or 45. In some embodiments, 0.7 UCOE includes the sequence shown in SEQ ID NO: 2. In some embodiments, the enhancer includes the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0258] In some embodiments, a method of treating, suppressing or alleviating X-linked agammaglobulinemia (XLA) or symptoms associated with XLA in a subject in need thereof, the method comprising administering to the subject a cell according to any one of the embodiments of the present invention, or a polynucleotide according to any one of the embodiments of the present invention or a cell comprising a vector according to any one of the embodiments of the present invention; optionally, identifying the subject as a subject who may benefit from a treatment method for XLA or symptoms associated with XLA; and / or optionally, measuring an improvement in the progression of XLA or an improvement in symptoms associated with XLA in the subject. The vector may comprise a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. In some embodiments, the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the promoter is a BTK promoter. In some embodiments, the promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the third sequence is codon-optimized for expression in humans. In some embodiments, the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the vector further comprises a B cell-specific promoter. In some embodiments, the B cell-specific promoter comprises the B cell-specific promoter B29. In some embodiments, the B29 promoter sequence comprises the sequence shown in SEQ ID NO: 46. In some embodiments, the B cell-specific promoter is an endogenous promoter. In some embodiments, the vector further comprises one or more enhancer elements. In some embodiments, the one or more enhancer elements comprise at least one intron region. In some embodiments, the one or more enhancer elements comprise a DNase hypersensitive region (DHS).In some embodiments, the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5). In some embodiments, the DNase hypersensitive region comprises the sequence shown in SEQ ID NO: 3. In some embodiments, the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the at least one intron region is intron 4, intron 5 and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter. In some embodiments, the intron region comprises the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5) and / or the sequence shown in SEQ ID NO: 11 (intron 13). In some embodiments, the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 4 (SEQ ID NO: 4: introns 4-5), SEQ ID NO: 14 or SEQ ID NO: 15. In some embodiments, the UCOE is in the reverse or forward direction. In some embodiments, the UCOE is in the forward direction. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34. +It is a hematopoietic stem cell. In some embodiments, the one or more enhancer elements include the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20. In some embodiments, the polynucleotide further includes a gene upstream of the BTK promoter. In some embodiments, the gene upstream of the BTK promoter is a BTK enhancer. In some embodiments, the BTK enhancer includes the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22. In some embodiments, the vector is a vector using a B cell lineage-specific lentiviral vector. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 + It is a hematopoietic stem cell. In some embodiments, the cell is obtained from the subject, and the cell is genetically modified by introducing the polynucleotide according to any one of the embodiments of the present invention or the vector according to any one of the embodiments of the present invention. In some embodiments, the administration is performed by adoptive cell transfer. In some embodiments, the cell is a B cell. In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is CD34 +It is a hematopoietic stem cell. In some embodiments, the subject is male. In some embodiments, the subject is a subject selected as a subject to receive immunoglobulin replacement therapy. In some embodiments, the subject is a subject selected as a subject to which a targeted antimicrobial agent is to be administered. In some embodiments, the polypeptide or vector comprises the sequence set forth in SEQ ID NO: 33, 34, 35, 41, 42, 43, 44 or 45. In some embodiments, 0.7 UCOE comprises the sequence set forth in SEQ ID NO: 2. In some embodiments, the enhancer comprises the sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

[0259] Sequence The sequences used in the embodiments of the present invention are shown below.

Table 2

[0260] >0.7 UCOE (SEQ ID NO: 1) (SEQ ID NO:1)Cgcgtgtggcatctgaagcaccaccagcgagcgagagctagagagaaggaaagccaccgacttcaccgcctccgagctgctccgggtcgcgggtctgcagcgtctccggccctccgcgcctacagctcaagccacatccgaagggggagggagccgggagctgcgcgcggggccgctggggggaggggtggcaccgcccacgccgggcggccacgaagggcggggcagcgggcgcgcgcccggcggggggaggggccgcgcgccgcgcccgctgggaattggggccctagggggagggcggaggcgccgacgaccgcggcacttaccgttcgcggcgtggcgcccggtggtccccaaggggagggaagggggaggcggggcgaggacagtgaccggagtctcctcagcggtggcttttctgcttggcagcctcagcggctggcgccaaaaccggactccgcccacttcctcgcccctgcggtgcgagggtgtggaatcctccagacgctgggggagggggagttgggagcttaaaaactagtacccctttgggaccactttcagcagcgaactctcctgtacaccaggggtcagttccacagacgcgggccaggggtgggtcattgcggcgtgaacaataatttgactagaagttgattcgggtgttt

[0261] >0.7UCOEfwd(SEQ ID NO:2) (SEQ ID NO: 2)Cgcaaacacccgaatcaacttctagtcaaattattgttcacgccgcaatgacccacccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtggtcccaaaggggtactagtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcgaggaagtgggcggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcactgtcctcgccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacggtaagtgccgcggtcgtcggcgcctccgccctccccctagggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgctgccccgcccttcgtggccgcccggcgtgggcggtgccacccctccccccagcggccccgcgcgcagctcccggctccctcccccttcggatgtggcttgagctgtaggcgcggagggccggagacgctgcagacccgcgacccggagcagctcggaggcggtgaagtcggtggctttccttctctctagctctcgctcgctggtggtgcttcagatgccacac

[0262] >DHS4 (SEQ ID NO: 3) aattctatcatagtgtgtcttgtctatgataactgcattgagaaagatgctctgcttgttgagtgagcatttcacttccttctggttctgactatctgtctaatagtggtcatgtgggttgaaaagatagaaaaggggagtagtattaggaagttcagtatgaggaagacttattagacttatgcataaacctaaattctgttgtaatctggaagagctgaagtgccacatatgcatctgtttaggagagcaagaactacaaatttggtcttcagtttggcttgcttacatcctgagaactctgtaggccacatgtcgtgaatatagcagcctctgcaacagtgaaagccagaaaaggaagtggaaagtctcaggggagggggctttctgtcatggatttatgagcacagcaagactaacaagcaaaaagaaaaatgtaaaaggatcttgttcgt

[0263] >IE4-5

[0264] >BTKp (SEQ ID NO: 5) Tgcatttcctaggagaatccctgggggaatcattgcagttggagcataatgtagggggcccctgagaaaacctccaggcttcaagtgacatacctagtctgctttaccggtttacaggactcaagagaaaggtggacattgagagttaatccctgaggccaaatcttaaatggagaaagtcaacatccacagaaaatggggaagggcacaagtatttctgtgggcttatattccgacatttttatctgtaggggaaaaatgctttcttagaaaatgactcagcacggggaagtcttgtctctacctctgtcttgttttgtcctttggggtcccttcactatcaagttcaactgtgtgtccctgagactcctctgccccggaggacaggagactcgaaaaacgctcttcctggccagtctctttgctctgtgtctgccagcccccagcatctctcctctttcctgtaagcccctctccctgtgctgactgtcttcatagtactttaggtatgttgtccctttacctctgggaggatagcttgatgacctgtctgctcaggccagccccatctagagtctcagtggccccagtcatgttgagaaaggttctttcaaagatagactcaagatagtagtgtcagaggtcccaagcaaatgaagggcggggacagttgagggggtggaatagggacggcagcagggaaccagatagcatgctgctgagaagaaaaaaagacattggtttaggtcaggaagcaaaaaaagggaactgagtggctgtgaaagggtggggtttgctcagactgtccttcctctctggactgtaagaattagtctc

[0265] >coBTK

[0266] >co2BTK

[0267] Array related to FIG. 92 (not previously described) - The following constructs were tested as top candidates for clinical gene therapy vectors in part of the process of identifying the aforementioned array.

[0268] >GFP (SEQ ID NO: 8) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0269] >Intron 4

[0270] >Intron 5

[0271] >Intron 13 (SEQ ID NO: 11) ggtagggtggactggccagttgcaaaaactacctttgctggccttgccttagggagtgtccttgaggtacactgttctgcagcagctgcctcaaggacgctcaagacagatccaagcaaaagttattcactgattttcttcctctagtggctacgactgggactgcaaaaacatagattcataaagggctttgtcgttgtcttgggtctttttgtcttttatttttaattgtgggaaaattttcagtactatccctgagttcattaactaccatcactaacataatcataaagggatttggggaggttgcttagtctatcttcttgccttatggccaccttgaacctaaaattcccagattcctctaaccaatgaatcccgtttctgagattgacttaagcaaagacagattagtacttctaaaaatttcccttttactagttttcctatttctaccccagtagggatttttgtctattgtaagaattatacattcatgaccccaaagaatcacaccaagacttta

[0272] >1 kb

[0273] >CONTIG

[0274] >revCONTIG

[0275] >ABCD

[0276]

[0277] >DCBA

[0278] >AB

[0279] >A (SEQ ID NO: 19) ctggggtatggcaggggctgggcagcagcagcaatgtaccttgcttgggacccctaaaaaccagagagacagcatggctggtgccatttatcagctagtggaggaggctgacggagggtgggagtgtcatcagcacaaggccctggcagtcccttctggtgattagagaggccgaaagggtcctttccgacaagggctgagggtgggcggaacaggaagagaaaaatgtgacatgaggtgaccatccgaacaggtagcaaatgttagaaaggggtacctctggcaaacttagtggaaaagtaatattgcagggagcagtcagataaaaacaagcccttctgtcaaatagtgcttgaagactcaatagggatacatgggtcaatgaagcctttagaaaaagaaatactaagaggcagattctctgagaacatggtaaaagctcacgctccacgttatgaagttgacctttgtgagctagggaaaggcctggctaggccagggtgtaggctacctgccttgagctgtaccaggccaaatgtcgccagggtcagagctggcttattaaaggactgtgtggaagctgtgccaacctcgtggtaacaatgggtaaaagactgggccaggagaaagcagcctctgcctcagcccagacagtgcggccaacccttgaggttgtggcaaaggtttctcctcttaccattgccctccatgtgcatggcttgcttttctcttgtcttcattatttctcctttcctttcctc

[0280] >B (SEQ ID NO: 20) gaattctttgtaaactccttatggtgcgaactaatgtaactttccatccagttatgggggattggtgcaattttaaattatcactatgatttgctatttccatttgagcaaatttcctatagagtttcctttcagtggactagacccatatcaggaagtgacttaggtataaagggaagatacagctttcgaaaaccaaagtttgggcgttctccaaagagttatcagatacccccttctacacccacaatgatctgattgctgagatctgattgctaactactgaaaataaggaagaactagaattttcagtgacacagtgctcagcaagaagctagaaaagaggccttgacatatttgactccaaagctacttggttatgcatgaagccatctggggaggggaaggaggagggagaactcctctgaggaccctgaaacaattgggccacgtgtgactttcagtttctatggagattcatgtgcagtggctgagggcaatctgagagcattggaaacccagaagctttaa

[0281] >BTKe

[0282] >BTKeΔMyc (SEQ ID NO: 22) tgttactcggcccccaccagcaagtcctaccatgcttgcgtgagcgctatcggcgcggaaagaaagaaaccgcgaggcaaacggaagtatataggaggttcccgatcgcacttcctcatgggagtcggtaggagcaatcatagagtgtaaggctcagcgcagcgccctcgggcggctgagaggactcagttcggagccgcgggcgggagcttaaggaaggactccgcctaaagggtggtccactcaccccgacttcctcccgccccgcagctttcaacgtttcgtcactttatctcttttggtggactctgctacgtagtggcgttcagtgaagggagcagtgtttttcccagatcctctggcctccccgtccccgagggaagccaggactagggtcgaatgaaggggtcctccacctccacgttccattcctgttccacctcaaggtcactgggaacacctttcgcagcaaactgctaattcaatgaagacctggagggagccaattgttccagttcatctatcacatggccagttggtccattcaacaaatggttattggatgcccattatgtggcaggcactgttccgggggagaggtacagtaatctaataggcttataaatgtgcaattatgaactaagtactttgaagaaaaggaacaatgattggcattaaagcagcacccttctgttgagggagtaagtcagcagctctaggttctgaaaagtgacaatgaaattgtttggctcctgt

[0283] The sequences of the following gene expression cassettes are cloned into the pRRL backbone of pRRLSIN.cppt.PGK-GFP.WPRE [with PGK-GFP removed] (Addgene #12252).

[0284] A nucleic acid containing a promoter having a GFP sequence is shown below (BTKp.GFP).

[0285] (SEQ ID NO: 23) INT4.BTKp.GFP (SEQ ID NO: 24) INT5.BTKp.GFP (SEQ ID NO: 25) INT13.BTKp.GFP (SEQ ID NO: 26) 1kb.BTKp.GFP (SEQ ID NO: 27) CONTIG.BTKp.GFP (SEQ ID NO: 28) 3 kb. BTKp. GFP (SEQ ID NO: 29) revCONTIG.BTKp.GFP (SEQ ID NO: 30) IE.BTKp.GFP (SEQ ID NO: 31) 0.7 UCOE.IE.BTKp.GFP (SEQ ID NO: 32) 0.7UCOE.BTKp.coBTK (SEQ ID NO: 33) IE.BTKp.coBTK (SEQ ID NO: 34) 0.7UCOE.IE.BTKp.coBTK (SEQ ID NO: 35) ABCD.BTKp.GFP (SEQ ID NO: 36) DBCA.BTKp.GFP (SEQ ID NO: 37) AB.BTKp.GFP (SEQ ID NO: 38) A.BTKp.GFP (SEQ ID NO: 39) B.BTKp.GFP (SEQ ID NO: 40) 0.7UCOE.AB.BTKp.coBTK (SEQ ID NO: 41) AB.BTKp.coBTK (Accession No. 42) BTKe.AB.BTKp.coBTK (Accession No. 43) BTKe.BTKp.coBTK (SEQ ID NO: 44)

[0286] BTKeΔMyc.BTKp.coBTK (SEQ ID NO: 45)

[0287] Accession number 46: B29 promoter sequence:

[0288] AGGAGGGCCATCATGGCCAAGTTGACCAGTGCTGTCCCAGTGCTCACAGCCAGGGATGTGGCTGGAGCTGTTGAGTTCTGGACTGACAGGTTGGGGTTCTCCAGAGATTTTGTGGAGGATGACTTTGCAGGTGTGGTCAGAGATGATGTCACCCTGTTCATCTCAGCAGTCCAGGACCAGGTGGTGCCTGACAACACCCTGGCTTGGGTGTGGGTGAGAGGACTGGATGAGCTGTATGCTGAGTGGAGTGAGGTGGTCTCCACCAACTTCAGGGATGCCAGTGGCCCTGCCATGACAGAGATTGGAGAGCAGCCCTGGGGGAGAGAGTTTGCCCTGAGAGACCCAGCAGGCAACTGTGTGCACTTTGTGGCAGAGGAGCAGGACTGA

[0289] One of ordinary skill in the art will understand that the terms described in this specification, particularly the terms described in the appended claims (e.g., the main body of the appended claims), are generally "open-ended" terms (e.g., the term "including" should be interpreted as "including, but not limited to", the term "having" should be interpreted as "having at least", and the term "include" should be interpreted as "including, but not limited to"). Further, one of ordinary skill in the art will understand that if a specific number is recited in a claim, such an intention is also clearly recited in the claim, and if no specific number is recited, such an intention does not exist. Specifically, for example, in the claims described below, there may be a preamble such as "at least one" or "one or more" to define the claim. However, just because such a preamble is recited, a claim that recites an element using the indefinite article "a" or "an" should not be limited to an embodiment that includes only one element. Even if the same claim includes both a preamble such as "one or more" or "at least one" and the indefinite article such as "a" or "an", it should not be limited to an embodiment that includes only one element (e.g., "a" and / or "an" should be interpreted as meaning "at least one" or "one or more"). This is the same for claims recited using the definite article. Also, even if a specific number is clearly recited in a claim, one of ordinary skill in the art will understand that it means that number "at least" (e.g., the recitation of "two" without a modifier means "at least two" or "two or more").Furthermore, when conventional terminology such as "at least one of A, B, and C" is used, usually, such terminology is described in the meaning that a person skilled in the art would normally understand it (for example, "a system having at least one of A, B, and C" includes, but is not limited to, a system having only A, a system having only B, a system having only C, a system having A and B, a system having A and C, a system having B and C, and / or a system having A, B, and C, etc.). Also, when conventional terminology such as "at least one of A, B, or C" is used, usually, such terminology is described in the meaning that a person skilled in the art would normally understand it (for example, "a system having at least one of A, B, or C" includes, but is not limited to, a system having only A, a system having only B, a system having only C, a system having A and B, a system having A and C, a system having B and C, and / or a system having A, B, and C, etc.). Furthermore, a person skilled in the art would understand that disjunctive terms and / or disjunctive statements for representing two or more alternatives may include one of the terms described, any of the terms described, or both of the terms described in any of the specification, claims, or drawings. For example, the expression "A or B" may include "A or B" or "A and B".

[0290] Furthermore, when a feature or aspect of the present disclosure is described in Markush form, a person skilled in the art would understand that each member or a subgroup consisting of them described in Markush form is also described.

[0291] The present invention includes the following inventions. [1] A polynucleotide for maintaining the expression of Bruton's tyrosine kinase (BTK), comprising a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK. [2] The polynucleotide according to [1], wherein the UCOE has a length (kb) within a range defined by 2 kb, 1.5 kb, 1 kb, 0.75 kb, 0.5 kb or 0.25 kb, or any two of these numerical values. [3] The polynucleotide according to [1] or [2], wherein the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. [4] The polynucleotide according to any one of [1] to [4], wherein the promoter is a BTK promoter. [5] The polynucleotide according to [4], wherein the BTK promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5. [6] The polynucleotide according to any one of [1] to [5], wherein the third sequence is codon-optimized for expression in humans. [7] The polynucleotide according to [6], wherein the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. [8] The polynucleotide according to any one of [1] to [7], wherein the promoter is a B cell-specific promoter. [9] The polynucleotide according to [8], wherein the B cell-specific promoter comprises the B cell-specific promoter B29.

[10] The polynucleotide according to [8] or [9], wherein the B cell-specific promoter is an endogenous promoter.

[11] The polynucleotide according to any one of [1] to

[10] , further comprising one or more enhancer elements.

[12] The polynucleotide according to

[11] , wherein the one or more enhancer elements comprise at least one DNase hypersensitive region (DHS).

[13] The polynucleotide according to

[12] , wherein the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5).

[14] The polynucleotide according to

[12] or

[13] , wherein the DNase hypersensitive region contains the sequence shown in SEQ ID NO: 3.

[15] The polynucleotide according to any one of

[11] to

[14] , wherein the one or more enhancer elements contain at least one intron region.

[16] The polynucleotide according to

[15] , wherein the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter.

[17] The polynucleotide according to

[15] or

[16] , wherein the at least one intron region is intron 4, intron 5, and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter.

[18] The polynucleotide according to

[17] , wherein the intron region contains the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5), and / or the sequence shown in SEQ ID NO: 11 (intron 13).

[19] The polypeptide according to

[15] or

[16] , wherein the one or more enhancer elements contain the sequence shown in SEQ ID NO: 4 (SEQ ID NO: 4: introns 4-5).

[20] The polypeptide according to

[15] or

[16] , wherein the one or more enhancer elements contain the sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15.

[21] The polynucleotide according to any one of [1] to

[20] , wherein the UCOE is in the reverse or forward direction.

[22] The polynucleotide according to

[21] , wherein the UCOE is in the forward direction.

[23] The polynucleotide according to any one of

[11] to

[22] , wherein the one or more enhancer elements contain the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20.

[24] The polynucleotide according to any one of [1] to

[23] , further comprising a gene upstream of the BTK promoter.

[25] The polynucleotide according to

[24] , wherein the gene upstream of the BTK promoter is a BTK enhancer.

[26] The polynucleotide according to

[25] , wherein the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22.

[27] A vector for maintaining the expression of Bruton's tyrosine kinase (BTK) in cells, comprising: a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK.

[28] The vector according to

[27] , wherein the first sequence comprises the nucleic acid sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[29] The vector according to

[27] or

[28] , wherein the promoter is a BTK promoter.

[30] The vector according to any one of

[27] to

[29] , wherein the promoter comprises the nucleic acid sequence shown in SEQ ID NO: 5.

[31] The vector according to any one of

[27] to

[30] , wherein the third sequence is codon-optimized for expression in humans.

[32] The vector according to

[31] , wherein the third sequence comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[33] The vector according to any one of

[27] to

[32] , further comprising a B cell-specific promoter.

[34] The vector according to

[33] , wherein the B cell-specific promoter comprises the B cell-specific promoter B29.

[35] The vector according to

[33] or

[34] , wherein the B cell-specific promoter is an endogenous promoter.

[36] The vector according to any one of

[27] to

[35] , further comprising one or more enhancer elements.

[37] The vector according to

[36] , wherein the one or more enhancer elements comprise at least one intron region.

[38] The vector according to

[36] , wherein the one or more enhancer elements include a DNase hypersensitive region (DHS).

[39] The vector according to

[38] , wherein the DNase hypersensitive region is DNase hypersensitive region 1 (DHS1), DNase hypersensitive region 2 (DHS2), DNase hypersensitive region 3 (DHS3), DNase hypersensitive region 4 (DHS4) and / or DNase hypersensitive region 5 (DHS5).

[40] The vector according to

[38] or

[39] , wherein the DNase hypersensitive region includes the sequence shown in SEQ ID NO: 3.

[41] The vector according to

[37] , wherein the at least one intron region is derived from the human BTK locus associated with the human BTK proximal promoter.

[42] The vector according to

[41] , wherein the at least one intron region is intron 4, intron 5 and / or intron 13 of the human BTK locus associated with the human BTK proximal promoter.

[43] The vector according to

[42] , wherein the intron region includes the sequence shown in SEQ ID NO: 9 (intron 4), the sequence shown in SEQ ID NO: 10 (intron 5) and / or the sequence shown in SEQ ID NO: 11 (intron 13).

[44] The vector according to

[36] , wherein the one or more enhancer elements include the sequence shown in SEQ ID NO: 4.

[45] The vector according to

[36] , wherein the one or more enhancer elements include the sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15.

[46] The vector according to any one of

[27] to

[45] , wherein the UCOE is in the reverse or forward direction.

[47] The vector according to

[46] , wherein the UCOE is in the forward direction.

[48] The vector according to any one of

[27] to

[47] , which is a vector using a B cell lineage-specific lentiviral vector.

[49] The vector according to any one of

[27] to

[48] , wherein the cell is a B cell.

[50] The vector according to any one of

[27] to

[48] , wherein the cell is a myeloid cell.

[51] The vector according to any one of

[27] to

[48] , wherein the cell is a hematopoietic stem cell.

[52] The cell is CD34 + The vector according to

[51] , wherein the cell is a hematopoietic stem cell.

[53] The vector according to any one of

[36] to

[52] , wherein the one or more enhancer elements comprise the sequence shown in SEQ ID NO: 16, the sequence shown in SEQ ID NO: 17, the sequence shown in SEQ ID NO: 18, the sequence shown in SEQ ID NO: 19, and / or the sequence shown in SEQ ID NO: 20.

[54] The vector according to any one of

[27] to

[53] , further comprising a gene upstream of the BTK promoter.

[55] The polynucleotide according to

[54] , wherein the gene upstream of the BTK promoter is a BTK enhancer.

[56] The polynucleotide according to

[55] , wherein the BTK enhancer comprises the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22.

[57] A cell for expressing Bruton's tyrosine kinase (BTK), comprising a polynucleotide comprising a first sequence encoding a ubiquitous chromatin opening element (UCOE); a second sequence encoding a promoter; and a third sequence encoding BTK.

[58] The cell according to

[57] , wherein the polynucleotide is incorporated into a vector.

[59] The cell according to

[57] or

[58] , wherein the vector is a lentiviral vector.

[60] The cell according to any one of

[57] to

[59] , which is a B cell.

[61] The cell according to any one of

[57] to

[59] , which is a myeloid cell.

[62] The cell according to any one of

[57] to

[59] , which is a hematopoietic stem cell.

[63] CD34 + The cell according to any one of

[57] to

[59] , wherein the cell is a hematopoietic stem cell.

[64] A method for promoting the survival, proliferation and / or differentiation of B cells in a subject in need thereof, the method comprising administering to the subject a cell as described in any of

[57] to

[63] , or a cell comprising a polynucleotide as described in any of [1] to

[26] or a vector as described in any of

[27] to

[56] ; optionally, prior to administering the cell, identifying the subject as a subject who may benefit from a treatment that can promote the survival, proliferation and / or differentiation of B cells; and / or optionally, measuring the survival, proliferation and / or differentiation of B cells in the subject or a biological sample obtained from the subject.

[65] The method according to

[64] , wherein the cell is obtained from the subject and is genetically modified by introducing a polynucleotide as described in any of [1] to

[26] or a vector as described in any of

[27] to

[56] .

[66] The method according to

[64] or

[65] , wherein the administration is by adoptive cell transfer.

[67] The method according to any of

[64] to

[66] , wherein the cell is a B cell.

[68] The method according to any of

[64] to

[66] , wherein the cell is a myeloid cell.

[69] The method according to any of

[64] to

[66] , wherein the cell is a hematopoietic stem cell.

[70] The method according to any of

[64] to

[66] , wherein the cell is a CD34 + hematopoietic stem cell.

[71] The method according to any of

[64] to

[70] , wherein the subject is male.

[72] The method according to any of

[64] to

[71] , wherein the subject suffers from X-linked agammaglobulinemia (XLA).

[73] The method according to any of

[64] to

[72] , wherein the subject is selected as a subject who should receive immunoglobulin replacement therapy.

[74] The method according to any one of

[64] to

[73] , wherein the subject is a subject selected as a subject to which a targeted antimicrobial agent is to be administered.

[75] A method for treating, suppressing or alleviating X-linked agammaglobulinemia (XLA) or symptoms associated with XLA in a subject in need thereof, the method comprising administering to the subject the cells according to any one of

[57] to

[63] , or cells comprising the polynucleotide according to any one of [1] to

[26] or the vector according to any one of

[27] to

[56] ; optionally, identifying the subject as a subject who may benefit from a treatment method for XLA or symptoms associated with XLA; and / or optionally, measuring improvement in the progression of XLA or improvement in symptoms associated with XLA in the subject.

[76] The method according to

[75] , wherein the cells are obtained from the subject and the cells are genetically modified by introducing the polynucleotide according to any one of [1] to

[26] or the vector according to any one of

[27] to

[56] .

[77] The method according to

[75] or

[76] , wherein the administration is by adoptive cell transfer.

[78] The method according to any one of

[75] to

[77] , wherein the cells are B cells.

[79] The method according to any one of

[75] to

[77] , wherein the cells are myeloid cells.

[80] The method according to any one of

[75] to

[77] , wherein the cells are hematopoietic stem cells.

[81] The method according to any one of

[75] to

[77] , wherein the cells are CD34 + hematopoietic stem cells.

[82] The method according to any one of

[75] to

[81] , wherein the subject is male.

[83] The method according to any one of

[75] to

[82] , wherein the subject is a subject selected as a subject to receive immunoglobulin replacement therapy.

[84] The method according to any one of

[75] to

[83] , wherein the subject is a subject selected as a subject to which a targeted antimicrobial agent is to be administered.

Claims

1. 1. A method for modifying cells in vitro or ex vivo, comprising: (i) a first nucleic acid encoding a ubiquitous chromatin opening element (UCOE) having a length in the range of 0.5 kb to 1 kb, the first nucleic acid comprising exon 1 of the CBX3 gene and an alternative exon 1 of the CBX3 gene; (ii) a second nucleic acid encoding a BTK promoter; and (iii) a third nucleic acid encoding BTK. A method comprising the step of introducing into a cell a polynucleotide comprising the formula:

2. The method of claim 1, wherein the UCOE has a length of 0.7 kb or less.

3. The method of claim 1 or 2, wherein the UCOE lacks a potential splice acceptor site located between exon 1 and alternative exon 1 in the wild-type CBX3 gene.

4. The method according to any one of claims 1 to 3, wherein the UCOE lacks a splice acceptor site located at the 3' end of exon 1 in the wild-type CBX3 gene.

5. The method of any one of claims 1 to 4, wherein the first nucleic acid comprises the nucleotide sequence shown in SEQ ID NO:

1.

6. The method of any one of claims 1 to 4, wherein the first nucleic acid comprises the nucleotide sequence shown in SEQ ID NO:

2.

7. The method of any one of claims 1 to 6, wherein the BTK promoter comprises the nucleotide sequence shown in SEQ ID NO:

5.

8. The method of any one of claims 1 to 7, wherein the third nucleic acid is codon-optimized for expression in humans.

9. The method of any one of claims 1 to 8, wherein the third nucleic acid comprises the nucleotide sequence shown in SEQ ID NO:

6.

10. The method of any one of claims 1 to 8, wherein the third nucleic acid comprises the nucleotide sequence shown in SEQ ID NO:

7.

11. The method of any one of claims 1 to 10, wherein the UCOE is in reverse orientation.

12. The method of any one of claims 1 to 10, wherein the UCOE is in forward orientation.

13. The method of any one of claims 1 to 12, wherein the polynucleotide is contained in a vector.

14. The method of claim 13 , wherein the vector is a viral vector.

15. The method of claim 13 or 14, wherein the vector is a lentiviral vector.

16. The method of any one of claims 1 to 15, wherein the cell is a B cell.

17. The method of any one of claims 1 to 15, wherein the cells are myeloid cells.

18. The method of any one of claims 1 to 15, wherein the cells are hematopoietic stem cells.

19. The cells are CD34 ＋ The method according to any one of claims 1 to 15, wherein the cell is a cell.

20. 20. The method of any one of claims 1 to 19, wherein the cells are autologous cells of a subject with X-linked agammaglobulinemia (XLA).

Images