Method for producing non-human mammals or their progeny and use thereof
By genetically modifying non-human mammals to knock out or inaccurately express specific domains of the IgM and IgG heavy chain constant regions, the method facilitates the production of heavy-chain antibodies with enhanced diversity and specificity, addressing the limitations of existing production methods.
Patent Information
- Application Number
- JP2023515139
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-04
- Filing Date
- 2021-09-02
- Publication Date
- 2025-06-23
- Estimated Expiration
- 2041-09-02
AI Technical Summary
Current methods for producing non-human mammals or their offspring for heavy-chain antibody production face challenges in accurately expressing or preventing the expression of specific domains of the IgM and IgG heavy chain constant regions.
A method involving genetic modification to knock out or inaccurately express the CH1 domain of the IgM heavy chain constant region and specific genes encoding the IgG heavy chain constant region in non-human mammals, allowing for the production of heavy-chain antibodies without the CH1 domain.
This approach enables the generation of non-human mammals that can produce heavy-chain antibodies with improved diversity and specificity, suitable for targeting hidden epitopes and difficult antigen binding sites.
Smart Images

Figure 0007696582000024 
Figure 0007696582000025 
Figure 0007696582000026
Abstract
Description
Cross - reference to related applications
[0001] This application claims the priority of a Chinese patent application with the application number 202010924095.1 and the invention title "Method for Producing Non - Human Mammals or Their Offspring and Use Thereof", which was filed on September 4, 2020, and all of its contents are incorporated into the present invention by reference.
Technical Field
[0002] This application relates to the field of biotechnology, specifically to a method for producing non - human mammals or their offspring that can be used for the production of heavy - chain antibodies and their use.
Background Art
[0003] An antibody is a four - peptide - chain structure in which two identical heavy chains (H chains) and two identical light chains (L chains) are linked by non - covalent bonds or disulfide bonds between the chains. The heavy - chain constant region (C H ) and the heavy - chain variable region (V H ) are included in the heavy - chain of the antibody. Here, the heavy - chain constant regions of IgD, IgG, and IgA include four domains: CH1, hinge region Hinge, CH2, and CH3, and the heavy - chain constant regions of IgM and IgE include four domains: CH1, CH2, CH3, and CH4 (Janeway’s Immunobiology, 9 th Edition). The CH1 domain of the heavy - chain constant region is linked to the light - chain constant domain by a disulfide bond. The heavy - chain variable region includes regions called hypervariable regions of complementarity - determining regions (CDRs) and relatively conserved framework regions (FRs). The heavy - chain variable region includes three CDRs and four FRs arranged in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 from the amino - terminal to the carboxyl - terminal.
[0004] Depending on the differences in antigen specificity of the heavy-chain constant regions of antibodies, there are five classes of antibodies: IgM, IgD, IgG, IgE, and IgA. Antibodies of the same class can still be classified into several subclasses due to slight differences in the antigen specificity of their heavy-chain constant regions. For example, human IgG includes IgG1, IgG2, IgG3, IgG4, etc., and human IgA includes IgA1, IgA2, etc. The types of antibody subclasses may vary between different mammals (e.g., humans, alpacas, and mice) and between different strains of mice (e.g., C57BL / 6 mice and BALB / c mice).
[0005] Genes related to the antibody heavy chain contain five gene segments: L, V, D, J, and C. Here, the heavy-chain variable region is encoded by three gene segments: V, D, and J, and the heavy-chain constant region is encoded by the C gene segment. The human antibody heavy-chain gene contains approximately 40 functional V genes, 23 D genes, 6 J genes, and 9 C genes (source: Janeway’s Immunobiology, 9 thIt includes (Edition, Page 177). The gene encoding the IgM heavy chain constant region is the Ighm gene (Immunoglobulin heavy constant mu), the gene encoding the IgD heavy chain constant region is the Ighd gene (Immunoglobulin heavy constant delta), the gene encoding the IgG heavy chain constant region is Ighg (Immunoglobulin heavy constant gamma), the gene encoding the IgA heavy chain constant region is Igha (Immunoglobulin heavy constant alpha), etc. Correspondingly, the gene encoding the IgG1 heavy chain constant region is Ighg1 (Immunoglobulin heavy constant gamma 1), the gene encoding the IgG3 heavy chain constant region is Ighg3 (Immunoglobulin heavy constant gamma 3), and the gene encoding the IgG2b heavy chain constant region is Ighg2b (Immunoglobulin heavy constant gamma 2b). Through the rearrangement of the heavy chain variable region, antibodies with diversity are generated. Mature B cells produce the secreted antibody IgM after being stimulated by an antigen. After being stimulated by the antigen again, the second rearrangement occurs, and the types of immunoglobulins expressed and secreted on the membrane switch from the low-affinity IgM to other classes or subclasses of immunoglobulins with high affinity, such as IgG, IgA, IgE, etc. Such a phenomenon is called class switch or isotype switch.
[0006] Heavy chain antibodies, also known as heavy chain only antibodies, refer to immunoglobulin antibodies consisting of only two heavy chains. Naturally occurring heavy chain antibodies exist in the bodies of camels and sharks in nature. The heavy chain locus in the germline of camels contains gene fragments encoding heavy chain constant regions. During the maturation period, the rearranged VDJ joining region is spliced to the 5' end of the gene fragment encoding the IgG hinge region, resulting in the absence of the CH1 region that mediates binding to the light chain. As a result, it cannot bind to the light chain, and IgG2 and IgG3 heavy chain antibodies are produced. Methods of modifying animals using genes can also generate heavy chain antibodies, and the classification method of the generated heavy chain antibodies is also based on the differences in antigen specificity in the heavy chain constant region of the antibodies.
[0007] Compared with the molecular weight of conventional antibodies (150 - 160 kDa), heavy chain antibodies are much smaller. One heavy chain of the IgG2c heavy chain antibody is approximately 40 kDa, and it is thereby determined that the heavy chain variable region with antigen recognition specificity is only approximately 15 kDa. The characteristics of heavy chain antibodies are that they have a small molecular weight, can bind to some hidden epitopes, and are particularly suitable for target points where it is difficult to obtain antibodies.
[0008] The information disclosed in this background art section is only intended to enhance the overall understanding of the present application and should not be considered as constituting prior art known to those skilled in the art or as implicitly suggesting such information in any form.
Summary of the Invention
Problems to be Solved by the Invention
[0009] The present application aims to provide a method for producing non-human mammals or their offspring and their use.
Means for Solving the Problems
[0010] To achieve the object of the present application, the present application provides the following technical solutions.
[0011] In a first aspect of the present application, a method for producing a non-human mammal or its offspring is provided, and the method includes: a step of preventing or inaccurately expressing the CH1 domain of the IgM heavy chain constant region in the body of a non-human mammal; and a step of preventing or inaccurately expressing the CH1 domain when one, two, three, four or more genes encoding the IgG heavy chain constant region are expressed in the body of a non-human mammal.
[0012] In a possible implementation form of the above production method, the step of preventing or inaccurately expressing the CH1 domain of the IgM heavy chain constant region in the body of a non-human mammal is: a step of preventing or inaccurately expressing only the CH1 domain of the IgM heavy chain constant region in the body of a non-human mammal, or a step of preventing or inaccurately expressing the IgM heavy chain constant region and the IgD heavy chain constant region in the body of a non-human mammal.
[0013] In a possible implementation form of the above production method, the step of preventing or inaccurately expressing the CH1 domain when one, two, three, four or more genes encoding the IgG heavy chain constant region are expressed in the body of a non-human mammal is: a step of preventing or inaccurately expressing the CH1 domain when the first gene encoding the IgG heavy chain constant region is expressed in the body of a non-human mammal, or When the first gene encoding the IgG heavy chain constant region in a non-human mammal is expressed, it is made not to express or not to accurately express the IgG heavy chain constant region encoded thereby, and when one, two or three of the second, third or fourth genes encoding the IgG heavy chain constant region in the non-human mammal are expressed, the CH1 domain is made not to express or not to accurately express, or, When the first and second genes encoding the IgG heavy chain constant region in a non-human mammal are expressed, it is made not to express or not to accurately express the IgG heavy chain constant region encoded thereby, and when one or two of the third or fourth genes encoding the IgG heavy chain constant region in the non-human mammal are expressed, the CH1 domain is made not to express or not to accurately express, or, When the first, second and third genes encoding the IgG heavy chain constant region in a non-human mammal are expressed, it is made not to express or not to accurately express the IgG heavy chain constant region encoded thereby, and when the fourth gene encoding the IgG heavy chain constant region in the non-human mammal is expressed, the CH1 domain is made not to express or not to accurately express, or, When the first gene encoding the IgG heavy chain constant region in a non-human mammal is expressed, it is made to accurately express the IgG heavy chain constant region encoded thereby, and when one, two or three of the second, third or fourth genes encoding the IgG heavy chain constant region in the non-human mammal are expressed, the CH1 domain is made not to express or not to accurately express, or, When the first and second genes encoding the IgG heavy chain constant region in a non-human mammal are expressed, it is made to accurately express the IgG heavy chain constant region encoded thereby, and when one or two of the third or fourth genes encoding the IgG heavy chain constant region in the non-human mammal are expressed, the CH1 domain is made not to express or not to accurately express, or, When the first, second, and third genes encoding the IgG heavy chain constant region are expressed in a non-human mammalian body, the IgG heavy chain constant region encoded thereby is accurately expressed, and when the fourth gene encoding the IgG heavy chain constant region is expressed in a non-human mammalian body, the step is to not express or not accurately express the CH1 domain.
[0014] The present application further provides a non-human mammal in which the CH1 domain of the IgM heavy chain constant region is not expressed or not accurately expressed in its body, and one, two, three, four or more genes encoding the IgG heavy chain constant region in its body do not express or do not accurately express the CH1 domain.
[0015] In a possible implementation form of the above non-human mammal, the step in which the CH1 domain of the IgM heavy chain constant region is not expressed or not accurately expressed in its body is The step in which only the CH1 domain of the IgM heavy chain constant region is not expressed or not accurately expressed, or The step in which the IgM heavy chain constant region and the IgD heavy chain constant region are not expressed or not accurately expressed.
[0016] In a possible implementation form of the above non-human mammal, the step in which one, two, three, four or more genes encoding the IgG heavy chain constant region in its body do not express or do not accurately express the CH1 domain is The step in which the first gene encoding the IgG heavy chain constant region does not express or does not accurately express the CH1 domain, or The first gene encoding the IgG heavy chain constant region does not express or does not accurately express the IgG heavy chain constant region encoded thereby, and one, two or three of the second, third or fourth genes encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain, or The step that the first and second genes encoding the IgG heavy chain constant region do not express or do not accurately express the IgG heavy chain constant region encoded thereby, and one or two of the third or fourth genes encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain, or, The step that the first, second, and third genes encoding the IgG heavy chain constant region do not express or do not accurately express the IgG heavy chain constant region encoded thereby, and the fourth gene encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain, or, The step that the first gene encoding the IgG heavy chain constant region accurately expresses the IgG heavy chain constant region encoded thereby, and one, two, or three of the second, third, or fourth genes encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain, or, The step that the first and second genes encoding the IgG heavy chain constant region accurately express the IgG heavy chain constant region encoded thereby, and one or two of the third or fourth genes encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain, or, The step that the first, second, and third genes encoding the IgG heavy chain constant region accurately express the IgG heavy chain constant region encoded thereby, and the fourth gene encoding the IgG heavy chain constant region do not express or do not accurately express the CH1 domain.
[0017] In the second aspect of the present application, a method for producing a non-human mammal or its offspring is provided, and the method includes The step of knocking out a nucleotide sequence containing a nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome of a non-human mammal, and The step of knocking out a target gene containing a nucleotide sequence encoding the CH1 domain on one, two, three, four, or more than four genes encoding the IgG heavy chain constant region.
[0018] The present application further provides a non-human mammal, in which the nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on its genome and the target gene are knocked out, and the target gene is comprises the nucleotide sequence encoding the CH1 domain on one, two, three, four or more genes encoding the IgG heavy chain constant region.
[0019] In a possible implementation form, for the above manufacturing method or non-human mammal, the step of knocking out the nucleotide sequence containing the nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome of the non-human mammal is the step of knocking out only the nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome of the non-human mammal, or the step of knocking out the nucleotide sequences encoding the IgM heavy chain constant region and the IgD heavy chain constant region on the genome of the non-human mammal.
[0020] In a possible implementation form, for the above manufacturing method or non-human mammal, the target gene is the nucleotide sequence encoding the CH1 domain on the first gene encoding the IgG heavy chain constant region, or all the nucleotide sequences of the nucleotide sequences encoding the CH1 domain on the genes from the first gene encoding the IgG heavy chain constant region to the second gene encoding the IgG heavy chain constant region, or all the nucleotide sequences of the nucleotide sequences encoding the CH1 domain on the genes from the first gene encoding the IgG heavy chain constant region to the third gene encoding the IgG heavy chain constant region, or all the nucleotide sequences of the nucleotide sequences encoding the CH1 domain on the genes from the first gene encoding the IgG heavy chain constant region to the fourth gene encoding the IgG heavy chain constant region, or All nucleotide sequences of the nucleotide sequence encoding the CH1 domain on the gene from the first gene encoding the IgG heavy chain constant region to the last gene encoding the IgG heavy chain constant region, or, The nucleotide sequence encoding the CH1 domain on the second gene encoding the IgG heavy chain constant region, or, All nucleotide sequences of the nucleotide sequence encoding the CH1 domain on the gene from the second gene encoding the IgG heavy chain constant region to the third gene encoding the IgG heavy chain constant region, or, All nucleotide sequences of the nucleotide sequence encoding the CH1 domain on the gene from the second gene encoding the IgG heavy chain constant region to the fourth gene encoding the IgG heavy chain constant region, or, The nucleotide sequence encoding the CH1 domain on the third gene encoding the IgG heavy chain constant region, or, All nucleotide sequences of the nucleotide sequence encoding the CH1 domain on the gene from the third gene encoding the IgG heavy chain constant region to the fourth gene encoding the IgG heavy chain constant region, or, The nucleotide sequence encoding the CH1 domain on the fourth gene encoding the IgG heavy chain constant region.
[0021] In a possible implementation form, the above manufacturing method A step of knocking out a nucleotide sequence containing a nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome of a non-human mammal, and A step of knocking out a target gene are completed in the same operation step or in different operation steps.
[0022] In a possible implementation form, the above manufacturing method or non-human mammal, the non-human mammal is a rodent, optionally, the rodent is a rat or a mouse, and further optionally, the rodent is a mouse, and furthermore, the mouse is a C57BL / 6 mouse or a BALB / c mouse.
[0023] In a possible embodiment, in the above manufacturing method or non-human mammal, the first gene encoding the IgG heavy chain constant region is Ighg3.
[0024] In a possible embodiment, in the above manufacturing method or non-human mammal, when the non-human mammal is a C57BL / 6 mouse, the first gene encoding the IgG heavy chain constant region is Ighg3, the second gene encoding the IgG heavy chain constant region is Ighg1, the third gene encoding the IgG heavy chain constant region is Ighg2b, and the fourth gene encoding the IgG heavy chain constant region is Ighg2c. When the non-human mammal is a BALB / c mouse, the first gene encoding the IgG heavy chain constant region is Ighg3, the second gene encoding the IgG heavy chain constant region is Ighg1, the third gene encoding the IgG heavy chain constant region is Ighg2b, and the fourth gene encoding the IgG heavy chain constant region is Ighg2a.
[0025] In a possible embodiment, in the above manufacturing method or non-human mammal, the genome of the non-human mammal contains a complete gene encoding a κ light chain and / or a λ light chain, and optionally, the non-human mammal can normally express the κ light chain and / or the λ light chain.
[0026] In a possible embodiment, in the above manufacturing method or non-human mammal, the method of knocking out a gene includes one or more of gene targeting technology, CRISPR / Cas9 method, zinc finger nuclease method, and transcription activator-like effector nuclease method.
[0027] In a possible embodiment, in the above manufacturing method or non-human mammal, the non-human mammal or its offspring is used for the production of heavy chain antibodies.
[0028] In the third aspect of the present application, a method for producing a C57BL / 6 mouse or its offspring is provided, and the method includes In the genome of C57BL / 6 mice, knocking out the genes encoding the constant regions of antibody IgM heavy chain and IgD heavy chain, and in the genome of C57BL / 6 mice, knocking out the nucleotide sequence encoding the CH1 domain on the gene from the gene encoding the constant region of IgG3 heavy chain to the gene encoding the constant region of IgG2c heavy chain.
[0029] The present application further provides C57BL / 6 mice in which the nucleotide sequences encoding the constant regions of antibody IgM, IgD, IgG1, IgG2b, IgG3 heavy chains in their genomes and the nucleotide sequences encoding the CH1 domain on the gene encoding the constant region of antibody IgG2c heavy chain in their genomes are knocked out.
[0030] In a possible implementation form, in the above manufacturing method or C57BL / 6 mice, the genome of the C57BL / 6 mice contains complete genes encoding κ light chain and / or λ light chain, and optionally, the C57BL / 6 mice can normally express κ light chain and / or λ light chain.
[0031] In a possible implementation form, in the above manufacturing method or C57BL / 6 mice, the methods for knocking out genes include one or more of gene targeting technology, CRISPR / Cas9 method, zinc finger nuclease method, and transcription activator-like effector nuclease method.
[0032] In a possible implementation form, in the above manufacturing method or C57BL / 6 mice, all nucleotide sequences from the first exon of the gene encoding the constant region of mouse IgM heavy chain to the first exon of the gene encoding the constant region of IgG2c heavy chain are knocked out.
[0033] In a possible implementation, the above manufacturing method or C57BL / 6 mouse uses an sgRNA targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse and an sgRNA targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse in the step of knocking out the gene.
[0034] In a possible implementation, the above manufacturing method or C57BL / 6 mouse has a target sequence upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse targeted by the sgRNA including SEQ ID NO: 1 and SEQ ID NO: 2, and / or a target sequence downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse targeted by the sgRNA including SEQ ID NO: 3 and SEQ ID NO: 4.
[0035] In a possible implementation, the sgRNA targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse is SEQ ID NO: 9 and SEQ ID NO: 10, and / or the sgRNA targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse is SEQ ID NO: 11 and SEQ ID NO: 12.
[0036] In a possible implementation, the above manufacturing method or C57BL / 6 mouse, the C57BL / 6 mouse or its offspring is used for the production of the heavy chain IgG2c antibody.
[0037] In the fourth aspect of the present application, a method for manufacturing a C57BL / 6 mouse or its offspring is provided, and the method includes: a step of knocking out the nucleotide sequence encoding the CH1 domain on the gene encoding the IgM heavy chain constant region in the genome of the C57BL / 6 mouse; a step of knocking out the nucleotide sequence encoding the CH1 domain on the gene from the gene encoding the IgG3 heavy chain constant region to the gene encoding the IgG2c heavy chain constant region in the genome of the C57BL / 6 mouse.
[0038] The present application further provides a C57BL / 6 mouse in which the nucleotide sequence encoding the CH1 domain on the gene encoding the IgM heavy chain constant region and the nucleotide sequence encoding the CH1 domain on the gene from the gene encoding the IgG3 heavy chain constant region to the gene encoding the IgG2c heavy chain constant region in its genome are knocked out.
[0039] In a possible implementation form, in the above production method or C57BL / 6 mouse, the genome of the C57BL / 6 mouse contains a complete gene encoding a κ light chain and / or a λ light chain, and optionally, the C57BL / 6 mouse can normally express the κ light chain and / or the λ light chain.
[0040] In a possible implementation form, in the above production method or C57BL / 6 mouse, the method for knocking out a gene includes one or more of gene targeting technology, CRISPR / Cas9 method, zinc finger nuclease method, and transcription activator-like effector nuclease method.
[0041] In a possible implementation form, in the above production method or C57BL / 6 mouse, in the step of knocking out a gene, the first exon of the gene encoding the IgM heavy chain constant region of the mouse is knocked out, and further, all nucleotide sequences from the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse to the first exon of the gene encoding the IgG2c heavy chain constant region are knocked out.
[0042] In a possible implementation form, in the above production method or C57BL / 6 mouse, in the step of knocking out a gene, an sgRNA targeting upstream and downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse is used, and further, an sgRNA targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse and an sgRNA targeting downstream of the first exon encoding the mouse IgG2c are used.
[0043] In a possible implementation form, the above manufacturing method or C57BL / 6 mice, the target sequences upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse targeted by the sgRNA include SEQ ID NO: 1 and SEQ ID NO: 2, and / or, In a possible implementation form, the target sequences downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse targeted by the sgRNA include SEQ ID NO: 5 and SEQ ID NO: 6, and / or, In a possible implementation form, the target sequences upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse targeted by the sgRNA include SEQ ID NO: 7 and SEQ ID NO: 8, and / or, In a possible implementation form, the target sequences downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse targeted by the sgRNA include SEQ ID NO: 3 and SEQ ID NO: 4.
[0044] In a possible implementation form, the above manufacturing method or C57BL / 6 mice, the sgRNAs targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse are SEQ ID NO: 9 and SEQ ID NO: 10, and / or, In a possible implementation form, the sgRNAs targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse are SEQ ID NO: 13 and SEQ ID NO: 14, and / or, In a possible implementation form, the sgRNAs targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse are SEQ ID NO: 15 and SEQ ID NO: 16, and / or, In a possible implementation form, the sgRNAs targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse are SEQ ID NO: 11 and SEQ ID NO: 12.
[0045] In a possible implementation form, the above manufacturing method or C57BL / 6 mice, the C57BL / 6 mice or their offspring are used for the production of heavy chain IgG2c antibodies.
[0046] In a fifth aspect of the present application, there is provided a method for producing a non-human mammal or its offspring, the method including the step of knocking out a nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome of the non-human mammal.
[0047] The present application further provides a non-human mammal in which the nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region on the genome has been knocked out.
[0048] In a possible embodiment, the above production method or non-human mammal is such that the non-human mammal is a rodent, optionally, the rodent is a rat or a mouse, and further optionally, the rodent is a mouse, and furthermore, the mouse is a C57BL / 6 mouse or a BALB / c mouse.
[0049] In a possible embodiment, the above production method or non-human mammal is such that the non-human mammal or its offspring is used for the construction of the above non-human mammal or its offspring.
[0050] In a sixth aspect of the present application, there is provided the use of the non-human mammal or its offspring constructed by the above production method, the C57BL / 6 mouse or its offspring constructed by the above production method, and the above non-human mammal and the above C57BL / 6 mouse in the screening of target heavy chain antibodies.
[0051] In a possible embodiment, the above use employs the phage display method when screening for target heavy chain antibodies.
[0052] In a possible embodiment, the above use is such that the screening of the target heavy chain antibody is to screen for a C-reactive protein, coronavirus S protein or coronavirus N protein antigen-specific IgG2c heavy chain antibody.
[0053] In the seventh aspect of the present application, a method for screening a target heavy-chain antibody is provided. The method includes using a non-human mammal or its offspring constructed by the production method described in the first aspect above, a non-human mammal or its offspring constructed by the production method described in the second aspect above, a C57BL / 6 mouse or its offspring constructed by the production method described in the third aspect above, or a C57BL / 6 mouse or its offspring constructed by the production method described in the fourth aspect above as an immunized animal for screening.
[0054] In a possible implementation form of the above method, when screening the target heavy-chain antibody, the phage display method is adopted.
[0055] In a possible implementation form of the above method, the screening of the target heavy-chain antibody is to screen a C-reactive protein, coronavirus S protein or coronavirus N protein antigen-specific IgG2c heavy-chain antibody.
[0056] In the eighth aspect of the present application, a non-human mammalian cell or cell line or primary cell culture is provided. The non-human mammalian cell or cell line or primary cell culture is derived from a non-human mammal or its offspring constructed by the above production method, or from a C57BL / 6 mouse or its offspring constructed by the above production method.
[0057] In the ninth aspect of the present application, an excised tissue or organ or its culture derived from a non-human mammal or its offspring constructed by the above production method, or from a C57BL / 6 mouse or its offspring constructed by the above production method is provided.
[0058] In the tenth aspect of the present application, an sgRNA composition is provided. The sgRNA composition includes an sgRNA targeting upstream of the first exon of the gene encoding the mouse IgM heavy-chain constant region, and an sgRNA targeting downstream of the first exon of the gene encoding the mouse IgG2c heavy-chain constant region, or an sgRNA targeting upstream and downstream of the first exon of the gene encoding the mouse IgM heavy-chain constant region, or It includes an sgRNA targeting the upstream of the first exon of the gene encoding the mouse IgG3 heavy chain constant region and an sgRNA targeting the downstream of the first exon encoding mouse IgG2c.
[0059] In a possible implementation form of the above sgRNA composition, the target sequences upstream of the first exon of the gene encoding the mouse IgM heavy chain constant region targeted by the sgRNA include SEQ ID NO: 1 and SEQ ID NO: 2, and / or, the target sequences downstream of the first exon of the gene encoding the mouse IgG2c heavy chain constant region targeted by the sgRNA include SEQ ID NO: 3 and SEQ ID NO: 4, and / or, the target sequences downstream of the first exon of the gene encoding the mouse IgM heavy chain constant region targeted by the sgRNA include SEQ ID NO: 5 and SEQ ID NO: 6, and / or, the target sequences upstream of the first exon of the gene encoding the mouse IgG3 heavy chain constant region targeted by the sgRNA include SEQ ID NO: 7 and SEQ ID NO: 8.
[0060] In a possible implementation form of the above sgRNA composition, the sgRNA targeting the upstream of the first exon of the gene encoding the mouse IgM heavy chain constant region is SEQ ID NO: 9 and SEQ ID NO: 10, and / or, the sgRNA targeting the downstream of the first exon of the gene encoding the mouse IgM heavy chain constant region is SEQ ID NO: 13 and SEQ ID NO: 14, and / or, the sgRNA targeting the upstream of the first exon of the gene encoding the mouse IgG3 heavy chain constant region is SEQ ID NO: 15 and SEQ ID NO: 16, and / or, the sgRNA targeting the downstream of the first exon of the gene encoding the mouse IgG2c heavy chain constant region is SEQ ID NO: 11 and SEQ ID NO: 12.
[0061] In the 11th aspect of the present application, a knockout vector containing one or more DNA sequences encoding the sgRNA is provided, and the target sequence of the sgRNA is Those targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse, or Those targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of a mouse, or Or those targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse, or Or it is one selected from those targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of a mouse.
[0062] In a possible implementation form, for the above knockout vector, the backbone of the knockout vector is a sgRNA expression vector.
[0063] In the 12th aspect of the present application, cells containing the above knockout vector are provided.
[0064] Regarding the failure to express accurately, in contrast to the failure to express accurately is the accurate expression. In the present application, the accurate expression and the failure to express accurately actually both have meanings generally understood in this field. For example, the failure to accurately express the CH1 domain means that due to genomic-level mutations or deletions, the CH1 domain of the heavy chain constant region is not accurately expressed, thereby causing the CH1 domain to lose its binding ability to the light chain. For example, mutations or deletions within 10 nucleotides upstream and downstream of the exon encoding the CH1 domain of the heavy chain constant region cause the CH1 domain to lose its binding ability to the light chain. Also, for example, when the gene encoding the IgG heavy chain constant region is expressed and thereby fails to accurately express the encoded IgG heavy chain constant region, it means that the immunoglobulin antibody obtained by the expression of the gene does not have antibody effects. In contrast, when the gene encoding the IgG heavy chain constant region is expressed and thereby accurately expresses the encoded IgG heavy chain constant region, it means that the immunoglobulin antibody obtained by the expression of the gene has antibody effects.
[0065] The first gene encoding the IgG heavy chain constant region, the second gene encoding the IgG heavy chain constant region, the third gene encoding the IgG heavy chain constant region, and the fourth gene encoding the IgG heavy chain constant region mean the order in which each gene encoding the IgG heavy chain constant region is arranged in the order from upstream to downstream on the locus encoding the IgG heavy chain constant region.
Advantages of the Invention
[0066] This application produces a non-human mammal or its progeny by steps of making the CH1 domain of the IgM heavy chain constant region not expressed or not accurately expressed in a non-human mammal, and making one or more genes encoding the IgG heavy chain constant region not express the CH1 domain or not accurately express it when expressed. The obtained non-human mammal or its progeny can be used for the production of heavy chain antibodies. The non-human mammal obtained by using the production method of this application can directly utilize all VDJ genes encoding the antibody heavy chain variable region in its own genome without introducing foreign genes encoding any antibody heavy chain variable region and constant region, and can generate heavy chain antibodies with better diversity by rearrangement of the heavy chain variable region.
[0067] In immunology, generally, IgM is extremely important for the development of B cells, and the development of B cells is considered extremely important for antibody production. This application shows by experiments that even if the gene encoding the CH1 domain of the IgM heavy chain constant region is not expressed, and further, even if the genes encoding the IgM heavy chain constant region and the IgD heavy chain constant region are deleted, it has no significant impact on the immune maturation of non-human mammals, all mice survive normally, and can still generate a highly potent immune response. Moreover, the inventor obtained heavy chain antibodies with strong specificity and high affinity through screening.
[0068] By selecting the gene encoding the IgG heavy chain constant region for gene modification, a specific subclass of heavy chain IgG antibodies can be obtained.
Brief Description of the Drawings
[0069] One or more embodiments are illustratively described by photographs in the corresponding drawings, and these illustrative descriptions do not limit the embodiments. The word "illustrative" used herein means "used as an example, embodiment or for explanation". Any embodiment described as "illustrative" herein should not necessarily be construed as being more preferred or superior to other embodiments.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5A
Figure 5B
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16A
Figure 16B
Figure 17
Figure 18A
Figure 18B
Figure 19
Figure 20A
Figure 20B
Figure 21
Figure 22A
Figure 22B
Figure 23
Figure 24
Figure 25
Figure 26
Figure 27
Figure 28
Figure 29
Figure 30
Figure 31
Figure 32
Figure 33
Figure 34
Modes for Carrying Out the Invention
[0070] To make the objectives, technical solutions, and advantages of the present application clearer, the technical solutions of the embodiments of the present application will be clearly and fully described below. It is obvious that the described embodiments are only some of the embodiments of the present application, not all of them. All other embodiments obtained by those skilled in the art without creative labor based on the embodiments of the present application shall fall within the protection scope of the present application.
[0071] In addition, for a better explanation of the present application, many specific details are provided in the following specific embodiments. Those skilled in the art should understand that the present application can be implemented similarly even without some of the specific details. In some embodiments, in order to highlight the gist of the present application, details about raw materials, elements, methods, means, etc. well-known to those skilled in the art are not described in detail.
[0072] Unless otherwise specified, throughout this specification and the claims, words such as "comprising", "containing", or "including" and their variants are to be understood as including the recited element or component without excluding other elements or components.
[0073] The experimental materials used in the following examples and their sources are px330 plasmid vector, purchased from Addgene, plasmid number #58778, pEASY-T5 Zero Cloning vector, purchased from TransGen Biotech Co., Ltd., product number: CT501-01, TOP10 competent cells, purchased from Tiangen Biochemical Technology Co., Ltd., product number: CB104, PET28 vector, purchased from Wuhan Biaoling Biotechnology Co., Ltd., product number: P31003, HiPure Total RNA Plusmini Kit, purchased from Magen, product number R4121, HiPure Gel Pure Micro Kit, purchased from Magen, product number D2110, HiPure Tissue DNAmini Kit, purchased from Magen, product number D3121, 2×M5 Hiper plus Taq HiFi PCR mix, purchased from Jumei, product number MF002-plus, Reverse transcription reagent 5X All-In-One RT MasterMix, purchased from abmgood, product number 490, DNA marker, purchased from Dongsheng, product number M1061 / M1062), Protein marker, purchased from Thermo, product number 26617, Hieff qPCR SYBR Green Master Mix, purchased from Yeasen, product number 11201ES08, APC / Cy7 anti-mouse CD38 Antibody, purchased from Biolegend, product number 102727, APC / Cy7 anti-mouse IgM Antibody, purchased from Biolegend, product number 406515, CD45R (B220) Monoclonal Antibody (RA3-6B2), APC, purchased from eBioscience, product number 85-17-0452-82 anti-CD23 antibody(Allophycocyanin), purchased from Abcam, product number ab25457, CD45R (B220) Monoclonal Antibody (RA3-6B2), eFluor 450, purchased from eBioscience, product number 85-48-0452-82, BV421 Rat Anti-Mouse CD138, purchased from BD Horizon, product number 562610, CD19 Monoclonal Antibody (eBio1D3 (1D3)), eFluor 506, purchased from eBioscience, product number 85-69-0193-80, CD43 Monoclonal Antibody (eBioR2 / 60), PE, purchased from eBioscience, product number 85-12-0431-81, CD23 Monoclonal Antibody (B3B4), PE, purchased from eBioscience, product number 85-12-0232-82, Anti-CD5 antibody [53-7.3] (Phycoerythrin), purchased from Abcam, product number ab114078, CD21 / CD35 Monoclonal Antibody (eBio8D9 (8D9)), PE-Cyanine7, purchased from eBioscience, product number 85-25-0211-80, PE-Cy TM 7 Hamster Anti-Mouse CD95, purchased from BD Pharmingen, product number 553653, CD19 Monoclonal Antibody PE-Cyanine7, purchased from eBioscience, product number 25-0193-82, IgM Monoclonal Antibody (eB121-15F9), PE-Cyanine7, purchased from eBioscience, product number 85-25-5890-82, CD43 Monoclonal Antibody (eBioR2 / 60), FITC, purchased from eBioscience, product number 85-11-0431-85, Mouse IgG2c Antibody - FITC Conjugated, purchased from Aviva system biology, product number OASA06628, 7-AAD Viability Staining Solution, purchased from eBioscience, product number 85-00-6993-50, Goat Anti-Mouse IgG2c heavy chain (HRP), purchased from Abcam, product number ab97255, ECL Prime Western Blot Dtection reagent, purchased from GE, product number RPN2236, Mouse IgM ELISA Quantitation Set, purchased from bethyl, product number E90-101, Mouse IgG2c ELISA Quantitation Set, purchased from bethyl, product number E90-136, Mouse IgG ELISA Quantitation Set, purchased from bethyl, product number E90-131, Mouse IgA ELISA Quantitation Set, purchased from bethyl, product number E90-103, Mouse IgE ELISA Quantitation Set, purchased from bethyl, product number E90-115, TMB Substrate Set, purchased from Biolegend, product number 421101, Freund’s Adjuvant complete, purchased from sigma, product number F5881, Freund’s Adjuvant incomplete, purchased from sigma, product number F5506.
[0074] Part 1, Ighm-d-g homozygous mice and their immunization results Example 1, Production of Ighm-d-g homozygous mice (also referred to as MDG1 mice in this specification) Ighm-d-g mice refer to C57BL / 6 mice in which the first exon located on the Ighm gene, Ighd gene, Ighg3 gene, Ighg1 gene, Ighg2b gene and Ighg2c gene has been knocked out, and this exon is responsible for encoding the CH1 domain of the IgG2c heavy chain. The following steps are used to produce Ighm-d-g homozygous mice.
[0075] (1) Acquisition of nucleic acid molecules The schematic diagram of the gene sites of the variable and constant regions of the antibody heavy chain of C57BL / 6 mice is as shown in Figure 1. A targeting strategy as shown in Figure 2 is designed to knock out the nucleotide sequences encoding the CH1 domain in the mouse Ighm, Ighd, Ighg3, Ighg1, Ighg2b genes and Ighg2c. The inventor selects the target sequences (SEQ ID NO: 1, SEQ ID NO: 2) of sgRNA from the upstream of the first exon of the mouse Ighm gene, and selects the sgRNA target sequences (SEQ ID NO: 3, SEQ ID NO: 4) from the downstream of the first exon of the mouse Ighg2c, and designs the sgRNA sequences according to the target sequences. Specifically, it is as shown in Table 1.
[0076]
Table 1
[0077] (2) Construct the nucleic acid molecules into a backbone plasmid to obtain sgRNA by in vitro transcription. The synthesized forward and reverse DNA oligos encoding the sgRNA sequence were annealed to form complementary double strands, ligated into the sgRNA expression vector (px330) using T4 ligase, and after ligation, verified by sequencing by a specialized sequencing company. The results showed that the plasmid of interest was obtained. Furthermore, sgRNA was obtained by in vitro transcription.
[0078] (3) The above sgRNA and Cas9 protein are introduced into the fertilized eggs of the host animal. Mouse ovulation was induced, in vitro fertilization was performed, and the fertilized eggs were incubated. Then, sgRNA and Cas9 protein were mixed, and Cas9 protein (or Cas9 mRNA, commercially available) was injected into the mouse fertilized eggs together with sgRNA by means of electrotransfection or microinjection of the mouse fertilized eggs.
[0079] (4) The cells containing the above sgRNA and Cas9 protein were implanted into the body of the host animal. The above fertilized egg cells were implanted into the body of a surrogate mother mouse to produce F0 generation chimeric mice. By extracting genomic DNA from the tails of the mice and performing PCR detection, knockout individuals among the F0 generation mice were detected. Sequencing was performed on the gene knockout mice to confirm that the target sequence was deleted. F0 generation chimeric mice with accurate gene knockout were selected for subsequent breeding and identification.
[0080] With the PCR primers Ighm-d-g-1F and Ighm-d-g-1R, the knockout gene (as shown by the arrow in Figure 2) can be detected. With the primers Ighd-2F and Ighd-2R, the wild-type gene (as shown by the arrow in Figure 2) can be detected. The sequences of each primer are as shown in Table 2. A schematic diagram of the PCR results when detecting individuals that have undergone knockout among Ighm-d-g mice is as shown in Figure 3. By amplifying the Ighm-d-g homozygous knockout gene using the primers Ighm-d-g-1F and Ighm-d-g-1R, a target band of approximately 700 bp can be obtained (as shown in the left figure). By amplifying with the primers Ighd-2F and Ighd-2R, no band can be obtained (as shown in the right figure). By amplifying the Ighm-d-g wild-type gene using the primers Ighm-d-g-1F and Ighm-d-g-1R, no band can be obtained (as shown in the left figure). By amplifying with the primers Ighd-2F and Ighd-2R, a target band of approximately 600 bp was obtained (as shown in the right figure).
[0081]
Table 2
[0082] (5) Breeding of heterozygous and homozygous gene knockout mice F0 generation mice with the target gene knocked out were mated with wild-type mice to obtain F1 generation mice. By extracting the genome from the tails of the mice and performing PCR detection, gene knockout positive F1 generation heterozygous mice that can be stably inherited were selected. Subsequently, when F1 generation heterozygous mice were mated with each other, gene knockout positive F2 generation homozygous mice, that is, Ighm-d-g homozygous mice, could be obtained. The method for genotyping the obtained F1 generation heterozygous or F2 generation homozygous mice is the same as in step (4).
[0083] Example 2, Antigen Immune Reaction and Titer Detection Ighm-d-g homozygous mice were immunized with human C-reactive protein (CRP).
[0084] The immunization method is as follows. Male mice aged 6 - 8 weeks were selected. Equal amounts of complete Freund's adjuvant (F5881, Sigma) were added to the antigen human C-reactive protein (CRP, A-5172, Baiqiao Ruijing), and water was dropped to emulsify it in a non-melting state. It was used for subcutaneous multiple-point injection for the first immunization of mice. The first immunization injection dose was 100 μg / mouse. After the first immunization, subsequent subcutaneous immunizations were performed every two weeks. After adding equal amounts of Freund's incomplete adjuvant (F5506, Sigma) to the CRP antigen and emulsifying it, it was subcutaneously injected into mice at multiple points, and the injection dose each time was 100 μg / mouse.
[0085] The method for detecting serum titer is as follows. The CRP antigen was diluted to 2 μg / mL, 100 μl was taken and placed in a polystyrene enzyme-linked detection plate, and then the plate was coated. Specific IgG2c heavy-chain antibodies that specifically bind to the CRP antigen in the serum were detected using HRP-goat anti-mouse IgG-Fc (Jackson 115-035-071).
[0086] As shown in Figure 4, blood was collected respectively before immunization, 1 week after the first immunization, 1 week after the second immunization, and 1 week after the third immunization. The serum was diluted with PBS, starting from a dilution of 1:500 and performing serial dilutions. The serum titers detected by ELISA showed that specific antibodies that bind to the antigen CRP did not appear in the non-immunized and first-immunized mice. After the second immunization, specific IgG2c antibodies that bind to the antigen appeared in the mice. After the third immunization, the titer did not further improve, and the serum titer was about 1:8000, which can be used for the experiment of retrieving antibody genes in the next step.
[0087] Example 3. Examination of the spleen, thymus, lymph nodes, and organs of non-immunized Ighm-d-g homozygous mice and Ighm-d-g homozygous mice after immunization with CRP antigen Following the above Example 2, mice were euthanized by carbon dioxide asphyxiation. After dissection, the sizes and morphologies of multiple organs such as the thymus, spleen, mesenteric lymph nodes, submandibular lymph nodes, and heart, liver, lungs, kidneys, etc. were observed, and anatomically, it was shown that there were no obvious abnormalities in the thymus, mesenteric lymph nodes, submandibular lymph nodes, and major organs of non-immunized Ighm-d-g homozygous mice and Ighm-d-g homozygous mice after antigen immunization.
[0088] Example 4, generating specific IgG2c heavy chain antibodies by antigen immunization Following the above Example 2, serum protein blotting of CRP antigen-immunized mice was performed. 2 μL of the post-immunization mouse serum was taken, 100 μL of PBS was added, and it was reacted with 10 μL of CRP antigen-Sepharose filler at room temperature for 60 minutes. Then, it was centrifuged at 6000 rpm for 30 seconds, and the supernatant was discarded. The filler was washed 3 times with PBS, resuspended in 10 μL of PBS, boiled, passed through 12% SDS-PAGE electrophoresis, transferred to a PVDF membrane, and then reacted with HRP-goat anti-mouse IgG-Fc (Jackson, 115-035-071, used for detection of heavy chains) antibody and HRP-goat anti-mouse Ig light chain (Jackson, 115-035-174) antibody, and further developed.
[0089] Due to the design of the present application, the genes of mouse IgM, IgD, IgG1, IgG2b, and IgG3 were knocked out. Therefore, when Ighm-d-g homozygous mice are immunized with an antigen protein, only IgG2c subclass antibodies are produced. Moreover, since the CH1 gene of the IgG2c heavy chain was knocked out, when Ighm-d-g homozygous mice are immunized with an antigen protein, IgG2c heavy chain antibodies (without the CH1 domain) can be produced. The molecular weight of a single IgG2c heavy chain is about 40 KD. After immunizing Ighm-d-g homozygous mice with an antigen protein, the antibodies produced in the mice, after undergoing steps such as separation, electrophoresis, and color development, a band that specifically binds to the antigen CRP appears on the left and right of a band with a size of 80 KD. This is consistent with the theoretical dimer molecular weight of the IgG2c heavy chain and contains a dimer that did not bind to the HRP-goat anti-mouse Ig light chain (Jackson, 115-035-174) antibody.
[0090] Example 5, Preparation of IgG2c Heavy Chain Antibody Gene Following the above Example 2, Ighm-d-g homozygous mice were immunized with CRP antigen, and after detecting the serum titer, the mice were euthanized, spleen cells were collected, and after Trizol lysis, total RNA was extracted and reverse transcribed to obtain cDNA. Using the following IgG2c subtype antibody-specific primers, the heavy chain variable region and the heavy chain constant region linked thereto were amplified by PCR. MHV1: ATGAAATGCAGCTGGGGCATSTTCTTC (SEQ ID NO: 21), MHV2: ATGGGATGGAGCTRTATCATSYTCTT (SEQ ID NO: 22), MHV3: ATGAAGWTGTGGTTAAACTGGGTTTTT (SEQ ID NO: 23), MHV4: ATGRACTTTGGGYTCAGCTTGRTTT (SEQ ID NO: 24), MHV5: ATGGGACTCCAGGCTTCAATTTAGTTTTCCTT (SEQ ID NO: 25), MHV6: ATGGCTTGTCYTTRGSGCTRCTCTTCTGC (SEQ ID NO: 26), MHV7: ATGGRATGGAGCKGGRGTCTTTMTCTT (SEQ ID NO: 27), MHV8: ATGAGAGTGCTGATTCTTTTGTG (SEQ ID NO: 28), MHV9: ATGGMTTGGGTGTGGAMCTTGCTTATTCCTG (SEQ ID NO: 29), MHV10: ATGGGCAGACTTACCATTCTCATTCCTG (SEQ ID NO: 30), MHV11: ATGGATTTTGGGCTGATTTTTTTTATTG (SEQ ID NO: 31), MHV12: ATGATGGTGTTAAGTCCTTCTGTACC (SEQ ID NO: 32), Combination B6_IgG2c_CH2 R1: 5’- TGGTCCACCCAAGAGGTCTG-3’ (SEQ ID NO: 33).
[0091] The PCR reaction system is as shown in Table 3.
[0092]
Table 3
[0093] PCR reaction process: At 98°C for 2 min - 30 cycles (each cycle is at 98°C for 10 s - at 50°C for 20 s - at 72°C for 40 s) - at 72°C for 5 min - 16°C.
[0094] The obtained PCR amplification product was ligated into the pEASY-T5 Zero Cloning vector, transformed into TOP10 competent cells, spread on LB plates, 11 clones were randomly selected, and sequencing was performed on the clones identified as positive by colony PCR (as shown in Figure 5A, the band with a size of 650 bp is the positive band).
[0095] According to the sequencing results of the positive clones (as shown in Figure 5B), in the FR4 region which is the variable region of the IgG2c heavy chain generated in Ighm-d-g homozygous mice, it is directly linked to the IgG2c Hinge region (antibody hinge region). Since the structure of the antibody heavy chain is VH-CH1-Hinge-CH2-CH3, it is shown that the VH region can also be divided into FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 in detail. As can be seen from Figure 5B, the FR4 region which is the variable region of the IgG2c heavy chain generated in Ighm-d-g homozygous mice is directly linked to the Hinge region (antibody hinge region), explaining the successful knockout of the IgG2c CH1 exon.
[0096] Example 6, Construction and Panning of a Phage Display Library of CRP Antigen-Specific IgG2c Heavy Chain Antibody Variable Regions I. Construction of the Phage Display Library Following the above Example 2, total RNA was extracted from the spleen of Ighm-d-g homozygous mice immunized with CRP, and cDNA (TAKAR 6110A cDNA synthesis kit) was prepared using oligo(Dt). The heavy chain antibody gene was obtained by performing PCR amplification twice using nested PCR.
[0097] The first PCR process is exactly the same as the PCR process mentioned in Example 5.
[0098] The primers, reaction system, and reaction process used for the second PCR are as follows. MHVF1-SfiI: ATGCCATGACTGTggcccaggcggcc GAG GTG AAG CTT CTC GAG TCT GG (SEQ ID NO: 34), MHVF2-SfiI: CATGCCATGACTGTggcccaggcggcc SAG GTS CAG CTG MAG GAG TCWGG (SEQ ID NO: 35), MHVF3-SfiI: CATGCCATGACTGTggcccaggcggcc GCC GAG GTC CAG CTG CAA CAA TCT GG (SEQ ID NO: 36), MHVF4-SfiI: CATGCCATGACTGTggcccaggcggcc SAG GTY CAR CTK CAG CAG YCT GG (SEQ ID NO: 37), MHVF5-SfiI: CATGCCATGACTGT ggcccaggcggcc GAR GTG AAG CTT GWG GAG TCT GG (SEQ ID NO: 38), B6-IgG2c-Hin-Sfi1: ACTCGCGGCCGGCCTGGCCTGTTATGGGCACTCTGGG (SEQ ID NO: 39), The reaction system is as shown in Table 4.
[0099]
Table 4
[0100] PCR reaction process: 98°C for 2 min - 30 cycles (each cycle: 98°C for 10 s - 65°C for 20 s - 72°C for 40 s) - 72°C for 5 min - 16°C.
[0101] The PCR amplification product was digested with SfiI (FD1824, Thermo), electrophoresed on an agarose gel, and the target product gel was recovered. Then, the target fragment from which the gel was recovered was cloned onto the pComb3XSS vector digested with SfiI. R2738 electrocompetent cells were electrotransformed to produce an IgG2c heavy chain antibody library, and panning was performed multiple times. Multiple positive clones were selected and sent for sequencing and identification, and the results are as shown in Figure 6.
[0102] II. Panning 1. Panning 1) Coating: Dilute the CRP antigen to 100 μg / mL with the coating solution, place it in two wells of an enzyme-labeled plate (100 μL / well), and coat it at 4°C overnight. 2) Sealing: Aspirate the coating solution, wash the plate three times with PBS, seal it with 300 μL of 4% skim milk (the second, third, fourth, and fifth sealing solutions are 4% BSA), and incubate it at 37°C for 2 h. 3) Binding: Aspirate the sealing solution, wash the plate three times with PBS, add 100 μL of the phage display library, and incubate it at 37°C for 1 h. 4) Washing: Aspirate the unbound phages and wash them with PBST (in this application, panning was performed 5 times in total. For the first and second times, wash 3 times with PBST each, and for the third, fourth, and fifth times, wash 10 times with PBST each). 5) Elution: Add 100 μL of Gly-HCl (pH 3.0), and gently pipette several times for 5 min at 37°C using a pipettor. 6) Neutralization: Aspirate the liquid in the well into a centrifuge tube, add 15 μL of neutralization buffer (1 M Tirs-Hcl, pH = 8.8) in advance and mix evenly. 7) Take 10 μL of the eluate after neutralization to measure the titer, amplify and culture the remaining eluate, and use it for the next round of panning.
[0103] 2. Amplification and purification of phages 1) Add the eluate after neutralization to 5 mL of ER2738 bacterial solution (the strain is purchased on the market, and the OD 600 is about 0.5 - 0.7), and mix evenly. 2) Let it stand in a constant temperature bath at 37°C for 30 min, and then culture it at 37°C and 180 rpm for 1 h. 3) Transfer the culture into 20 mL of LB medium, and culture it at 37°C and 180 rpm for 2 h. 4) Add 20 μL of helper phage M13KO7 (2×10 9 cfu) (purchased from NEB, product number is N03158), and mix evenly. 5) It was left standing in a 37°C constant temperature bath for 30 min, and then, after culturing at 37°C and 180 rpm for 1 h, an ampicillin antibiotic was added. 6) After culturing at 37°C and 180 rpm for 1 h, it was centrifuged at 8000 rpm for 5 min. 7) It was resuspended using 25 mL of LB medium / Amp / kan, precipitated, and cultured overnight (about 14 h) at 30°C and 180 rpm. 8) It was centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was collected. 9) 1 / 5 volume of PEG-NaCl solution was added, and it was left standing at 4°C for about 4 - 6 h. 10) It was centrifuged at 12000 rpm for 20 min at 4°C, and the supernatant was discarded. 11) The precipitate was resuspended with 1 mL, and 10 μL was taken to measure the titer.
[0104] 3. Measurement of titer 1) The phage to be tested was diluted with PBS (10 μL of phage was put into 990 μL of PBS to make 10 -2 ), and 10 μL of the diluted phage was taken and put into 200 μL of ER2738 bacterial solution and mixed uniformly. 2) The infected culture was left standing and cultured at 37°C for 30 min. 3) LB + Amp + It was spread on a resistant plate. 4) It was cultured overnight in an inverted position at 37°C. 5) The colonies were counted and the titer was calculated.
[0105] III. The results after manufacturing the IgG2c heavy chain antibody variable region library and performing panning 5 times are as shown in Table 5.
[0106]
Table 5
[0107] Panning was performed a total of 5 times. As can be seen from the above table, there was significant enrichment in the output phage. Positive clones were selected by PHAGE-ELISA experiment and sent for sequencing and identification.
[0108] Example 7, Identification of Prokaryotic Expression and Biological Activity of CRP Antigen-Specific IgG2c Heavy Chain Antibody Variable Region Following the above Example 6, the sequencing sequences were analyzed, and D4-12 (nucleotide sequence and amino acid sequence as shown in Table 6) that repeatedly appeared in the previous 5 panning was selected and transfected into BL21 Escherichia coli. At 16°C, IPTG at different concentrations was added to induce prokaryotic expression. After sonication, the supernatant was collected and purified by nickel affinity column.
[0109] Specific antigen CRP and irrelevant protein OVA (2 μg / mL) were coated, and the purified D4-12 was used for serial dilution and detected by ELISA. The results showed that the purified D4-12 heavy chain antibody variable region could specifically recognize and bind to antigen CRP, showing good concentration dependence, as shown in Figure 7.
[0110] [Table 6]
[0111] Example 8, Identification of Eukaryotic Expression and Biological Activity of CRP Antigen-Specific IgG2c Heavy Chain Antibody Variable Region Following the above Example 6, the sequencing sequences were further analyzed, and the most frequently repeated sequence D5S-12 (nucleotide sequence and amino acid sequence as shown in Table 7) was selected for identification of eukaryotic expression and biological activity. It was transfected into KOP293 cells (Zhuhai Carey), and the supernatant of the cultured cells was collected on the sixth day, and nickel affinity column purification of the target protein was performed.
[0112] [Table 7]
[0113] 1. Coated with specific antigen CRP and irrelevant proteins OVA or BSA (2 μg / mL), the purified D5S-12 antibody was serially diluted and detected by ELISA. The results showed that the purified D5S-12 heavy-chain antibody could specifically recognize and bind to the antigen CRP, showing good concentration dependence. The results are as shown in Figure 8.
[0114] 2. Measurement of the affinity of the D5S-12 heavy-chain antibody: Using FORTEBIO - OCTET, the affinity of the purified D5S-12 heavy-chain antibody for the antigen CRP was measured. The antibody was diluted to 10 μg / mL, and the antigen CRP was diluted to 200, 100, 50, 25, 12.5, 6.25, 3.13 nM. By measurement, its affinity constant was K D (M)=9.87E - 10, K on (1 / Ms)=8.55E + 04, K off (1 / s)=8.44E - 05. The heavy-chain antibody D5S-12 has a high affinity for the antigen CRP. The results are as shown in Figure 9.
[0115] The second part, production of IghM-3G3 homozygous mice and their immune results IghM-3G3 mice refer to C57BL / 6 mice in which the first exon on the Ighm gene, the Ighg3 gene, the Ighg1 gene, the Ighg2b gene, and the first exon on the Ighg2c gene have been knocked out. First, IghM homozygous mice (i.e., C57BL / 6 mice in which the first exon on the Ighm gene has been knocked out) were produced, and then based on the IghM homozygous mice, IghM-3G3 homozygous mice were produced.
[0116] Example 9. Production of IghM homozygous mice The production of IghM homozygous mice includes the following steps. (1) Obtaining nucleic acid molecules The schematic diagram of the gene sites of the antibody heavy chain variable region and constant region of C57BL / 6 mice is as shown in Figure 1. A target determination strategy as shown in Figure 10 was designed, and the nucleotide sequence encoding the CH1 domain in the mouse Ighm gene was knocked out.
[0117] To knock out the nucleotide sequence encoding the CH1 domain in the mouse Ighm gene, target points were selected from upstream and downstream of the first exon of the mouse Ighm gene. The inventor selected the target sequences (SEQ ID NO: 1, SEQ ID NO: 2) of sgRNA from upstream of the first exon on the mouse Ighm gene, and selected the sgRNA target sequences (SEQ ID NO: 5, SEQ ID NO: 6) from downstream of the first exon in the mouse Ighm gene, designed the sgRNA sequence based on the target sequences, specifically, as shown in Table 8.
[0118]
Table 8
[0119] (2) The nucleic acid molecule was constructed into a backbone plasmid to obtain RNA by in vitro transcription. The synthesized forward and reverse DNA oligos of the sgRNA sequence were formed into complementary double strands by annealing, ligated to the sgRNA expression vector (px330) with T4 ligase. After ligation, it was sequenced and verified by a sequencing company. The result showed that the target plasmid was obtained, and further sgRNA was obtained by in vitro transcription.
[0120] (3) The above sgRNA and Cas9 protein were introduced into the fertilized eggs of the host animal. Mouse ovulation was induced, in vitro fertilization was performed, and the fertilized eggs were incubated. Then, sgRNA and Cas9 protein were mixed, and Cas9 protein (or Cas9 mRNA, available on the market) was injected into the mouse fertilized eggs together with sgRNA by the method of electrotransfection or microinjection of the mouse fertilized eggs.
[0121] (4) The cells containing the above-mentioned sgRNA and Cas9 protein were implanted into the body of a surrogate animal. The above-mentioned fertilized egg cells were incorporated into the body of a surrogate mouse to produce F0 generation chimeric mice. By extracting genomic DNA from the tails of the mice and performing PCR detection, knockout individuals among the F0 generation mice were detected. Sequencing was performed on the gene knockout mice to confirm that the target sequence had been deleted. F0 generation chimeric mice with accurate gene knockout were selected and used for subsequent breeding and identification.
[0122] The knockout gene can be detected using PCR primers Ighm-F and Ighm-R (as shown by the arrows in Figure 10), and the primer sequences can be referred to in Table 9.
[0123]
Table 9
[0124] The detection results are shown in Figure 11. When performing PCR detection using the above primers, a band of approximately 600 bp can be obtained by amplifying the Ighm wild-type gene, and a band of approximately 300 bp can be obtained by amplifying the Ighm CH1 knockout gene. As can be seen from Figure 11, clones #1, #2, #3, and #6 contain the Ighm CH1 knockout gene. Sequencing was performed on the gene knockout mice to confirm that the first exon of the Ighm gene in the knockout mice had been deleted.
[0125] (5) Breeding heterozygous and homozygous gene knockout mice The F0 generation mice with the target gene knocked out were mated with wild-type mice to obtain F1 generation mice. By extracting the genome from the tails of the mice and performing PCR detection, gene knockout positive F1 generation heterozygous mice that can stably inherit were selected. Subsequently, when the F1 generation heterozygous mice were mated with each other, gene knockout positive F2 generation homozygous mice, that is, IghM homozygous mice, could be obtained. The method for genotyping the obtained F1 generation heterozygous or F2 generation homozygous mice is the same as in step 4.
[0126] Example 10, Recruitment of IgM heavy chain antibody gene After performing CRP antigen immunization according to Example 2 above, the IghM homozygous mice were euthanized to collect spleen cells, lysed with Trizol, total RNA was extracted, and cDNA was obtained by reverse transcription. The heavy chain variable region and the heavy chain constant region linked thereto were amplified by PCR using IgM subtype antibody-specific primers. The primers used and their sequences are MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12 (all can refer to Example 5), Combination B6 IghM CH2 R4: GTTCATCTCTGCGACAGC (SEQ ID NO: 46).
[0127] The PCR reaction system is as shown in Table 10.
[0128]
Table 10
[0129] PCR reaction process: At 98°C for 2 min - 30 cycles (each cycle is at 98°C for 10 s - 50°C for 20 s - 72°C for 40 s) - at 72°C for 5 min - 16°C.
[0130] The PCR amplification products were ligated into the pEASY-T5 Zero Cloning vector, transformed into TOP10 competent cells, plated on LB plates (ampicillin resistant), and clones were selected for colony PCR. The positive clones were sent for sequencing. As can be seen from the sequencing results, the FR4 of the IgM heavy chain variable region expressed in IghM homozygous mice was directly linked to CH2 (starting amino acid sequence AVAEMN), and the results were as shown in Figure 12, indicating successful knockout of the exon of genomic IgM CH1.
[0131] Example 11, Production of IghM-3G3 Homozygous Mice A method for producing IghM-3G3 mouse homozygotes, the method comprising the following steps. (1) Acquisition of nucleic acid molecules The schematic diagram of the gene sites of the antibody heavy chain variable region and constant region of C57BL / 6 mice is as shown in Figure 1. Based on the IghM homozygous mice obtained in Example 9, a target determination strategy as shown in Figure 13 was designed, and the first exons located on the Ighg3 gene, Ighg1 gene, Ighg2b gene, and Ighg2c gene were further knocked out.
[0132] To knockout the first exon encoding the CH1 domain on mouse Ighm, and the first exons encoding the CH1 domain on Ighg3, Ighg1, Ighg2b genes, and Ighg2c, the inventors selected the target sequences (SEQ ID NO: 7, SEQ ID NO: 8) of sgRNA from the upstream of the first exon of the mouse Ighg3 gene and the target sequences (SEQ ID NO: 3, SEQ ID NO: 4) of sgRNA from the downstream of the first exon of the mouse Ighg2c gene based on the IghM homozygous mice, and designed the sgRNA sequences according to the target sequences, specifically as shown in Table 11.
[0133]
Table 11
[0134] (2) The nucleic acid molecule was constructed into the backbone plasmid to obtain RNA by in vitro transcription. The forward and reverse DNA oligos of the synthesized sgRNA sequence were formed into complementary double strands by annealing, ligated to the sgRNA expression vector (px330) with T4 ligase. After ligation, it was sequenced and verified by a sequencing company. The results showed that the target plasmid was obtained, and further sgRNA was obtained by in vitro transcription.
[0135] (3) The above sgRNA and Cas9 protein were introduced into the fertilized eggs of the host animal. Mouse ovulation was induced, in vitro fertilization was performed, and the fertilized eggs were incubated. Then, sgRNA and Cas9 protein were mixed, and Cas9 protein (or Cas9 mRNA, available on the market) was injected into the mouse fertilized eggs together with sgRNA by means of electrotransfection or microinjection of the mouse fertilized eggs.
[0136] (4) The cells containing the above sgRNA and Cas9 protein were implanted into the host animal body. The above fertilized egg cells were incorporated into the body of the surrogate mother mouse to produce F0 generation chimeric mice. By extracting genomic DNA from the mouse tail and performing PCR detection, the knockout individuals among the F0 generation mice were detected. Sequencing was performed on the gene knockout mice to confirm that the target sequence was deleted. The F0 generation chimeric mice with the gene accurately knocked out were selected for subsequent breeding and identification.
[0137] The knockout gene can be detected with PCR primers Ighg-1F and Ighg-1R, and the wild-type gene (arrow in Figure 13) can be detected with primers Ighg-2R and Ighg-1F. The sequences of the primers are as shown in Table 12.
[0138]
Table 12
[0139] By PCR, genotype identification was performed on IghM-3G3 mice (Figure 14). Identification using primers Ighm-F and Ighm-R for the Ighm genotype: When amplifying the Ighm wild-type gene, a target product of approximately 600 bp can be obtained. Therefore, when amplifying the knockout gene, a target product of approximately 300 bp can be obtained. Identification using primers Ighg-1F, Ighg-1R, and Ighg-2R for the Ighg genotype: The Ighg knockout gene can be amplified using primers Ighg-1F and Ighg-2R to obtain a target product of approximately 500 bp. Bands cannot be obtained by amplifying with primers Ighg-1F and Ighg-1R. Bands cannot be obtained by amplifying the Ighg wild-type gene with primers Ighg-1F and Ighg-2R, and a target product of approximately 460 bp can be obtained by amplifying with primers Ighg-1F and Ighg-1R. + / −: Heterozygote, wt: Wild type, − / −: Knockout homozygote.
[0140] (5) Breeding of heterozygous and homozygous gene knockout mice F0 generation mice with the target gene knocked out were mated with wild-type mice to obtain F1 generation mice. By extracting the genome from the tails of the mice and performing PCR detection, genetically knockout positive F1 generation heterozygous mice that can be stably inherited were selected. Subsequently, when F1 generation heterozygous mice were mated with each other, genetically knockout positive F2 generation homozygous mice, that is, IghM-3G3 homozygous mice, could be obtained. The method for genotype identification of the obtained F1 generation heterozygous or F2 generation homozygous mice is the same as in step 4.
[0141] Example 12, Antigen Immune Response and Titer Detection of IghM-3G3 Homozygous Mice IghM-3G3 homozygous mice were immunized with human C-reactive protein (CRP).
[0142] The immunization method is as follows. Male mice at 6 - 8 weeks old are selected. Equal amounts of complete Freund's adjuvant (F5881, Sigma) are added to the antigen human C-reactive protein (CRP, A-5172, Baiqiao Ruijing), and water is dropped to emulsify it without melting, which can be used for the first subcutaneous multi-point injection for immunization of mice. The first immunization injection dose is 100 μg / mouse. After the first immunization, subsequent subcutaneous immunizations are carried out every 2 weeks. After adding equal amounts of Freund's incomplete adjuvant (F5506, Sigma) to the CRP antigen and emulsifying it, subcutaneous multi-point injection is performed on the mice, and the injection dose each time is 100 μg / mouse.
[0143] Detection of serum titer The method for detecting serum titer is as follows. The CRP antigen is diluted to 2 μg / mL, 100 μl is taken and put into a polystyrene enzyme-linked detection plate, and then the plate is coated. Specific IgG antibodies that specifically bind to the CRP antigen in the serum are detected using HRP-goat anti-mouse IgG-Fc (Jackson, 115-035-071).
[0144] As shown in Figure 15, blood is collected respectively before immunization, 1 week after the first immunization, and 1 week after the third immunization. The serum is diluted with PBS, starting from a dilution factor of 1:500 and performing serial dilutions, and the serum titer detected by ELISA shows that specific antibodies binding to the antigen CRP did not occur in the unimmunized and first-immunized mice, and the serum titer after the third immunization was about 1:32000.
[0145] Example 13, Acquisition of IgG2c heavy chain antibody gene IghM-3G3 homozygous mice are immunized with the CRP antigen, and after detecting the serum titer, the mice are euthanized to collect spleen cells, which are lysed with Trizol, total RNA is extracted, and cDNA is obtained by reverse transcription. The heavy chain variable region and the heavy chain constant region linked to it are amplified by PCR using the following IgG2c subtype antibody-specific primers. Any of MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12, and combination B6_I IgG2c_CH2 R1 refers to Example 5 and The PCR reaction system and PCR reaction process are as shown in Example 5.
[0146] The obtained PCR amplification product was ligated into the pEASY-T5 Zero Cloning vector, transformed into TOP10 competent cells, spread on an LB plate, and 7 clones were randomly selected. Those identified as positive by colony PCR were sent for sequencing (as shown in Figure 16A, the band with a size of 650 bp is the positive band).
[0147] The sequencing results of the positive clones show that the FR4 region, which is the variable region of the IgG2c heavy chain antibody generated in IghM-3G3 homozygous mice, is directly linked to the IgG2c Hinge region (antibody hinge region), and the structure of the antibody heavy chain is VH-CH1-Hinge-CH2-CH3. Here, the VH region can also be further divided into FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 in detail (as shown in Figure 16B), indicating that the FR4 region, which is the variable region of the IgG2c heavy chain antibody generated in IghM-3G3 homozygous mice, is directly linked to the Hinge region (antibody hinge region), explaining the successful knockout of the CH1 exon of IgG2c.
[0148] Example 14. Construction and panning of a phage display library of CRP antigen-specific IgG2c heavy chain antibody variable regions Following the above Example 13, the steps for constructing the phage display library and antibody panning are exactly the same as in Example 6, only adjusting the parameters in Table 13. The results after 5 rounds of panning are as shown in Table 13.
[0149]
Table 13
[0150] Panning was performed a total of 5 times. As can be seen from Table 13, there was significant enrichment in the output phages. Positive clones were selected by PHAGE-ELISA experiment and sent for sequencing and identification, as shown in Table 14.
[0151]
Table 14
[0152] Example 15, Antigen Immune Response and Titer Detection of IghM-3G3 Homozygous Mice In this example, IghM-3G3 homozygous mice were immunized with the coronavirus S protein antigen.
[0153] The immunization method is as follows. Male mice aged 6 - 8 weeks were selected. Equal amounts of complete Freund's adjuvant (F5881, Sigma) were added to the antigen coronavirus S protein (SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein, 40591-V08H, Sino Biological), and water was added dropwise to emulsify it in a non-melting state. This can be used for the first subcutaneous multi-point immunization of mice. The first immunization injection dose is 100 μg / mouse. After the first immunization, subsequent subcutaneous immunizations were performed every 2 weeks, and the injection dose each time was 100 μg / mouse.
[0154] Detection of Serum Titer The method for detecting serum titer is as follows. The coronavirus S protein antigen was diluted to 2 μg / mL, 100 μL was taken and placed in a polystyrene enzyme-linked detection plate, and then the plate was coated. HRP-goat anti-mouse IgG-Fc (Jackson 115-035-071) was used to detect the specific IgG antibody that specifically binds to the CRP antigen in the serum.
[0155] Blood samples were collected at the times of non-immunization, 1 week after the second immunization, 1 week after the third immunization, and 1 week after the fourth immunization, respectively. The serum was diluted with PBS, serially diluted starting from a dilution of 1:500, and the serum titer was detected by ELISA. The results are as shown in Fig. 17. Fig. 17 shows that in non-immunized mice, specific antibodies binding to the antigen coronavirus S protein did not appear, and the serum titer after the second immunization was about 1:64000.
[0156] Example 16, Acquisition of IgG2c heavy chain antibody gene According to the above Example 15, IghM-3G3 homozygous mice were immunized with the coronavirus S protein antigen. After detecting the serum titer, the mice were euthanized, and their spleen cells were collected. The spleen cells were lysed with Trizol, total RNA was extracted, and reverse transcription was performed to obtain cDNA. Using the following IgG2c subtype antibody-specific primers, the heavy chain variable region and the heavy chain constant region linked thereto were amplified by PCR. Any of MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12, and combination B6_IgG2c_CH2 R1 refers to Example 5. The PCR reaction system and the PCR reaction process are as shown in Example 5.
[0157] The obtained PCR amplification product was ligated to the pEASY-T5 Zero Cloning vector, transformed into TOP10 competent cells, and plated on LB plates. 23 clones were randomly selected, and the clones identified as positive by colony PCR were sent for sequencing (the PCR results are as shown in Fig. 18A, where the band with a size of 650 bp is the positive band).
[0158] Example 17, Construction and panning of a phage display library of the variable region of the coronavirus S protein antigen-specific IgG2c heavy chain antibody Following the above Example 16, the steps of constructing the phage display library and antibody panning are exactly the same as in Example 6. Panning was performed a total of 5 times, and there was significant enrichment in the phage output each time. Positive clones were selected by PHAGE-ELISA experiments and sent for sequencing and identification, as shown in Table 15. The similarities and differences in the CDR regions of these sequences were analyzed, and the results are as shown in Figure 18B.
[0159]
Table 15
[0160] The sequencing sequences were analyzed, and S-9, S-19, S-27, and S-47 (amino acid sequences as shown in Table 15) that appeared in the previous 5 panning were selected and transfected into BL21 Escherichia coli. At 30 °C, IPTG at different concentrations was added to induce prokaryotic expression. The supernatant was collected by ultrasonic disruption and purified by nickel affinity column.
[0161] Specific antigen coronavirus S protein and irrelevant protein OVA (2 μg / mL) were coated. After purification, the S-9, S-19, S-27, and S-47 antibodies were serially diluted and detected by ELISA method. The results show that the heavy chain antibody variable regions recruited this time can specifically recognize and bind to the antigen coronavirus S protein, showing good concentration dependence, as shown in Figure 19.
[0162] Example 18, Antigen Immune Response and Titer Detection of IghM-DG1 Homozygous Mice In this example, IghM-DG1 homozygous mice were immunized with the coronavirus S protein antigen.
[0163] The steps of antigen immunization of mice and detection of serum titer are exactly the same as those in Example 15, and the detection results of the serum titer are as shown in Figure 20A. The steps of constructing the phage display library and antibody panning are exactly the same as those in Example 6. Panning was performed a total of 5 times, and there was significant enrichment in the phage output each time. Positive clones were selected by PHAGE-ELISA experiment and sent for sequencing and identification, as shown in Table 16. Then, the similarities and differences in the CDR regions of these sequences were analyzed, and the results are as shown in Figure 20B.
[0164]
Table 16
[0165] The sequencing sequences were analyzed, and the DNA sequences of the S-1, S-2, S-7, S-12, S-17, S19, and S-65 antibodies (amino acid sequences as shown in Table 16) that appeared in the previous 5 panning were selected, cloned into the PET28 vector, transfected into BL21 Escherichia coli, induced for prokaryotic expression by adding different concentrations of IPTG at 16°C, the supernatant was collected after ultrasonic disruption, and nickel affinity column purification was performed.
[0166] Specific antigen coronavirus S protein and irrelevant protein OVA (2 μg / mL) were coated, and the purified S-1, S-7, S-12, S-17, S19, S-25, S-51, and S-65 antibodies were serially diluted and detected by ELISA method. The results showed that the heavy chain antibody variable regions recruited this time could specifically recognize and bind to the antigen coronavirus S protein, showing good concentration dependence, as shown in Figure 21.
[0167] Example 19, Recruitment of IgG2c heavy chain antibody gene In this example, MDG1 homozygous mice were immunized with coronavirus N protein antigen.
[0168] The immunization method and the method for detecting serum titer are exactly the same as those in Example 15, and the detection results of the serum titer after immunization are as shown in Fig. 22A. The antigen used in this example is the coronavirus N protein (SARS-CoV-2 (2019-nCoV) Nucleocapsid-His recombinant Protein, 40588-V08B-B, Sino Biological).
[0169] The steps for constructing the phage display library and antibody panning are exactly the same as those in Example 6. Panning was performed a total of 5 times, and there was significant enrichment in the phages output each time. Positive clones were selected by PHAGE-ELISA experiments and sent for sequencing and identification, as shown in Table 17. Then, the similarities and differences in the CDR regions of these sequences were analyzed, as shown in Fig. 22B.
[0170]
Table 17
[0171] The DNA sequence of the positive clone was cloned into the PET28 vector, transformed into BL21 bacteria to induce expression, and then the target protein was purified by nickel column. The specificity and binding ability of the antibody were detected by ELISA method, and the results are as shown in Fig. 23. The results in Fig. 23 show that the heavy chain antibody variable region recruited this time can specifically recognize and bind to the antigen coronavirus S protein, showing good concentration dependence.
[0172] Example 20: Detect the difference in the transcriptional level of each immunoglobulin gene in two genotypes of mice by fluorescence quantitative PCR RNA was extracted from the spleens of MDG1 mice and wild-type mice, reverse-transcribed into cDNA, and after 5-fold dilution of the cDNA, 5 μL was taken for fluorescence quantitative PCR experiments. Four individuals were selected from each genotype, and two techniques were repeated for each gene of each individual. The primers and the lengths of the amplified fragments used in the experiment are as shown in Table 18, and the fluorescence quantitative PCR amplification system is as shown in Table 19.
[0173]
Table 18
[0174]
Table 19
[0175] Amplification process: TIFF0007696582000021.tif41170 melting curve 65°C: 1 min Continuously increase the temperature to 95°C at a rate of 0.11°C / s
[0176] After the process is completed, judge the reliability of the numerical values according to the melting curve, and then calculate the relative expression levels of the transcription products of each immunoglobulin gene using 2 -ΔΔCt methods, and perform statistical analysis using a two-tailed T-test. The statistical results are as shown in Figures 24, 25, and 26. As can be seen from these results, compared with wild-type mice, MDG1 mice have lower expression levels of the transcription products of the μ gene in the bone marrow, spleen, and small intestine, higher expression levels of the transcription products of the γ2c gene, and the expression levels of the transcription products of the γ2c gene in the three immune tissues of MDG1 mice are all higher than the expression levels of the transcription products of the μ gene in wild-type mice. No statistical difference in the expression levels of the transcription products of the α gene was observed between the two genotypes of mice.
[0177] Example 21. Detect the expression pattern of IgG2c in the serum of MDG1 mice by Western Blot Under the same genetic background, sera from 8-week-old wild-type mice and MDG1 mice were collected for Western Blot detection. The sera of wild-type mice were diluted 20-fold with PBS, and the sera of MDG1 mice were diluted 100-fold with PBS. The intramolecular disulfide bonds were opened using 1 mM DTT under reducing conditions, and the Goat Anti-Mouse IgG2c heavy chain (HRP) antibody was diluted 10,000-fold. The detection results of Western Blot are as shown in Figure 27. As can be seen from Figure 27, the molecular weight of IgG2c in the sera of MDG1 mice under reducing conditions was approximately 45 kDa, and the molecular weight under non-reducing conditions was approximately 95 kDa, which was consistent with the molecular weights of the CH1 domain and light chain deletion.
[0178] Example 22. Detect the expression level of IgG2c in the sera of MDG1 mice by ELISA Under the same genetic background, sera from 8-week-old wild-type mice and MDG1 mice were collected and detected using the double antibody sandwich ELISA method. The IgM of wild-type mice was diluted 2,000-fold, IgG2c was diluted 4,000-fold, IgG was diluted 10,000-fold, IgA was diluted 5,000-fold, and IgE was diluted 20-fold. The IgM of MDG1 mice was diluted 2,000-fold, IgG2c was diluted 8,000-fold, IgG was diluted 10,000-fold, IgA was diluted 5,000-fold, and IgE was diluted 20-fold. The absorbance value at 450 nm of each sample well was read using a microplate reader, and a calibration curve was obtained according to the fitting of four parameters using ELISA Calc. The content of immunoglobulin in each well was calculated, and statistical analysis was performed using a two-tailed T test.
[0179] The results are as shown in Fig. 28. As can be seen from Fig. 28, IgM was indeed not expressed in the serum of MDG1 mice, and the expression level of its IgG2c was significantly higher than that of wild-type mice, corresponding to the expression level of IgM in wild-type mice. Since other IgG subtypes exist in wild-type mice, the expression level of total IgG in their serum was significantly higher than that of MDG1 mice. The expression level of IgE in the serum of MDG1 mice was significantly lower than that of wild-type mice. No statistical difference in the expression level of IgA was observed compared with wild-type mice.
[0180] Example 23. Detect the development of bone marrow, spleen and peritoneal cavity B cells of MDG1 mice by flow cytometry Bone marrow B cells: Under the same genetic background, six 8-week-old wild-type mice and six MDG1 mice were prepared. The two femurs and tibias of their lower limbs were taken, and bone marrow cells were put into centrifuge tubes using FACS. After short-term centrifugation, they were resuspended using ACK, and the cell suspension was filtered through a 70-μm filter mesh. After centrifugation, the supernatant was discarded. 1 mL of FACS was added to resuspend the cells. Then 50 μL of the cells were taken for staining, and 10 μL of the cells were taken and diluted 40-fold for counting. The staining protocol for bone marrow B cells is as shown in Table 20.
[0181] Spleen B cells: Under the same genetic background, four 8-week-old wild-type mice and four MDG1 mice were prepared. A 70-μm filter mesh was placed in a 60-mm dish, 1 mL of ACK was added, and their spleens were placed on the filter mesh and gently ground. The cell suspension after grinding was collected, and after short-term centrifugation, the supernatant was discarded. 1 mL of FACS was added to resuspend the cells. Then 50 μL of the cells were taken for staining, and 10 μL of the cells were taken and diluted 40-fold for counting. The staining protocol for spleen B cells is as shown in Table 20.
[0182] Peritoneal cavity B cells: Under the same genetic background, seven 8-week-old wild-type mice and seven MDG1 mice were prepared. They were fixed on a foam board with their abdomens facing up, the abdominal epidermis was incised to expose the peritoneal part, 5 mL of FACS was aspirated with a syringe and injected into the peritoneal cavity. After pipetting and aspirating 2-3 times using a pipette, the cell suspension was collected in a centrifuge tube, centrifuged briefly, resuspended using ACK, filtered through a 70-μm filter mesh, the supernatant was discarded after centrifugation, 200 μL of FACS was added to resuspend the cells, then 100 μL of the cells was taken for staining. The staining protocol for peritoneal B cells is as shown in Table 20.
[0183]
Table 20
[0184] The flow cytometry results of B cells in the bone marrow are as shown in Figure 29. The results in Figure 29 show the following. That is, compared with wild-type mice, there were no statistically significant differences in the ratio and number of B cells in the bone marrow of MDG1 mice, and there were no statistically significant differences in the ratio of pro-B cells and pre-B cells, but the number was significantly decreased. IgM is highly expressed in mature B cells and lowly expressed in immature B cells. Since the μ gene expressing IgM is deleted in MDG1 mice, the development status of immature B cells and mature B cells in their bodies cannot be confirmed. However, since there are a large number of IgG2c+ B cells in MDG1 mice, the ratio of this B cell population in wild-type mice is extremely low.
[0185] The flow cytometry results of B cells in the spleen are as shown in Figure 30, and the results in Figure 30 show the following. That is, compared with wild-type mice, the ratio of B cells in the spleen of MDG1 mice is significantly lower, but no statistical difference in numbers is observed. The ratio and number of IgG2c+B cells in the spleen of MDG1 mice are significantly higher than the ratio and number of IgM+B cells in wild-type mice, which may be due to the class switch and recombination of IgM in wild-type mice to other immunoglobulin subtypes. Since the mice selected for this flow cytometry experiment are in an unstimulated state, the ratio and number of plasma cells in the spleens of both wild-type mice and MDG1 mice are low, and no statistical difference is observed. The ratio and number of follicular B cells, transitional B cells, and marginal B cells in the spleen of MDG1 mice show no statistical difference compared with wild-type mice.
[0186] The flow cytometry results of B cells in the peritoneal cavity are as shown in Figure 31, and the results in Figure 31 show the following. That is, compared with wild-type mice, the ratio of B cells in the peritoneal cavity of MDG1 mice is significantly higher. Among MDG1 mice, the ratio of IgM+B1a cells is significantly decreased, and the ratios of B1b and B2 cells are significantly increased.
[0187] Example 24: Wild-type mice and MDG1 mice were immunostimulated using a specific antigen Under the same genetic background, 6 to 7 six-week-old wild-type mice and MDG1 mice were prepared, and an immunization experiment was carried out using chloramphenicol conjugated with BSA and atrazine. Each mouse was immunized at 100 μg / 100 μL each time. For the first immunization, complete Freund's adjuvant was used, and 50 μL was subcutaneously injected into the back and 50 μL was injected into the abdominal cavity. For the booster immunizations, incomplete Freund's adjuvant was used, and 100 μL was injected into the abdominal cavity. A total of 4 booster immunizations were carried out. Blood was collected from the inner canthus 3 days before the first immunization and 3 days after each booster immunization.
[0188] Example 25: Detect the changing trend of the relative expression level of antigen-specific antibodies in the sera of immunostimulated mice by ELISA Following the above Example 24, in order to avoid the interference of the BSA-specific antibody abundantly present in the serum after immune stimulation with the detection results, in this ELISA experiment, chloramphenicol and atrazine conjugated with OVA were used as coating antigens, the antigen coating amount was 200 ng / 100 μL / well, during the detection of antigen-specific IgM, IgG2c, IgG and IgA, the dilution factor of the serum was 4000-fold, and during the detection of IgE, the dilution factor of the serum was 100-fold. In order to ensure the consistency of each sample well, after adding the TMB chromogenic solution, the reaction time was strictly controlled to 20 min, and then the absorbance value at 450 nm was read using a microplate reader. Except for the individuals in whom no immune reaction occurred, a change trend diagram of the relative expression level of the antigen-specific antibody was plotted.
[0189] The changes in the relative expression levels of chloramphenicol- and atrazine-specific antibodies are as shown in FIGS. 32 and 33 respectively, and the results indicate the following. That is, from the overall situation of the immune response, chloramphenicol has a better immune effect than atrazine. The change trend of antigen-specific IgG2c in MDG1 mice is similar to the change trend of IgG2c in wild-type mice. Different from IgM, which is continuously expressed at a low level in wild-type mice, since there are other IgG subtypes in wild-type mice, the content of antigen-specific total IgG in wild-type mice is higher than that in MDG1 mice. Also, the relative expression levels of antigen-specific IgA and IgE in MDG1 mice are slightly higher than those in wild-type mice.
[0190] Example 26, Detection of the Development of Germinal Center B Cells and Plasma Cells in the Spleen after Antigen Immunization Six wild-type mice and six MDG1 mice after antigen immunization were taken, a 70-μm filter mesh was placed in a 60-mm dish, 1 mL of ACK was added, their spleens were removed and placed on the filter mesh and gently ground, the cell suspension after grinding was collected, and after short-term centrifugation, the supernatant was discarded, 1 mL of FACS was added to resuspend the cells, then 20 μL of the cells were taken for staining, and 10 μL of the cells were taken and diluted 80-fold for counting. The staining protocol for splenic B cells after immunization is as shown in Table 21.
[0191]
Table 21
[0192] The development status of spleen B cells, germinal center B cells and plasma cells in mice after antigen immunization is as shown in Fig. 34, and the results in Fig. 34 show the following. That is, compared with wild-type mice, the ratio of spleen B cells in MDG1 mice after immunization was significantly lower, but no statistical difference in number was observed. Compared with wild-type mice, both the ratio and number of germinal center B cells in MDG1 mice were significantly lower, and the ratio of IgG2c+GC B was significantly higher, but no statistical difference in number was observed. In MDG1 mice and wild-type mice after antigen immunization, no statistical differences were observed in the ratio and number of plasma cells and IgG2c+ plasma cells.
[0193] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application and do not limit them. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can modify the technical solutions described in each of the foregoing embodiments or perform equivalent substitutions on some of their technical features. It should be understood that these modifications and substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Industrial Applicability
[0194] The non-human mammals or their offspring obtained by using the method for producing non-human mammals or their offspring of the present application can directly utilize all VDJ genes encoding the variable region of the antibody heavy chain in their own genomes without introducing foreign genes encoding any antibody heavy chain variable region and constant region, and can generate heavy chain antibodies with better diversity through rearrangement of the variable region of the heavy chain.
Claims
A method for producing C57BL / 6 mice or their progeny, comprising the following modification to C57BL / 6 mice: Knocking out the nucleotide sequences encoding the CH1 domains on the genes encoding the IgM heavy chain constant region, the IgD heavy chain constant region, the IgG3 heavy chain constant region, the IgG1 heavy chain constant region, the IgG2b heavy chain constant region, and the IgG2c heavy chain constant region in the genome of C57BL / 6 mice, which is the only modification carried out, is characterized by the manufacturing method.
2. The manufacturing method according to claim 1, wherein the C57BL / 6 mice can normally express κ light chain and / or λ light chain.
3. The gene knockout is carried out by the following: Upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse, the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 are selected as the target sequences of sgRNA, and downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse, the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 are selected as the target sequences of sgRNA, and by designing sgRNA according to the target sequences respectively, gene knockout is carried out. The manufacturing method according to claim 1 or 2.
4. The sequence of the sgRNA targeting the sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 9, the sequence of the sgRNA targeting the sequence shown in SEQ ID NO: 2 is shown in SEQ ID NO: 10, the sequence of the sgRNA targeting the sequence shown in SEQ ID NO: 3 is shown in SEQ ID NO: 11, and the sequence of the sgRNA targeting the sequence shown in SEQ ID NO: 4 is shown in SEQ ID NO:
12. The manufacturing method according to claim 3.
5. A method for producing C57BL / 6 mice or their progeny, comprising the following modification to C57BL / 6 mice: Knocking out the nucleotide sequence encoding the CH1 domain on the gene encoding the IgM heavy chain constant region in the genome of C57BL / 6 mice, and Knocking out the nucleotide sequence encoding the CH1 domain on the genes encoding the IgG3 heavy chain constant region, the IgG1 heavy chain constant region, the IgG2b heavy chain constant region, and the IgG2c heavy chain constant region in the genome of C57BL / 6 mice, wherein only the above is performed, a method for producing C57BL / 6 mice or their offspring.
6. The production method according to claim 5, wherein the genome of the C57BL / 6 mouse contains a complete gene encoding a κ light chain and / or a λ light chain.
7. The production method according to claim 6, wherein the C57BL / 6 mouse can normally express a κ light chain and / or a λ light chain.
8. In knocking out the gene, sgRNAs targeting upstream and downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse are used, and further, an sgRNA targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse, and an sgRNA targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse are used. The production method according to claim 5. **Claim 9**: There are two sgRNAs targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse, with their respective sequences shown in SEQ ID NO: 9 and SEQ ID NO:
10. There are two sgRNAs targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse, with their respective sequences shown in SEQ ID NO: 13 and SEQ ID NO:
14. There are two sgRNAs targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of a mouse, with their respective sequences shown in SEQ ID NO: 15 and SEQ ID NO:
16. There are two sgRNAs targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of a mouse, with their respective sequences shown in SEQ ID NO: 11 and SEQ ID NO:
12. The production method according to claim 8. **Claim 10** The target sequences upstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse that the sgRNA targets include the sequence shown in SEQ ID NO: 1 and the sequence shown in SEQ ID NO:
2. The target sequences downstream of the first exon of the gene encoding the IgM heavy chain constant region of a mouse that the sgRNA targets include the sequence shown in SEQ ID NO: 5 and the sequence shown in SEQ ID NO:
6. The target sequences upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of a mouse that the sgRNA targets include the sequence shown in SEQ ID NO: 7 and the sequence shown in SEQ ID NO:
8. The target sequences downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of a mouse that the sgRNA targets include the sequence shown in SEQ ID NO: 3 and the sequence shown in SEQ ID NO:
4. The production method according to claim 8 or 9. **Claim 11** Use in screening for a target heavy chain antibody of a C57BL / 6 mouse or its offspring constructed by the production method according to any one of claims 1 to 10. **Claim 12** The use according to claim 11, wherein the phage display method is employed during screening for the target heavy chain antibody. **Claim 13** The screening of the target heavy-chain antibody is to screen for an IgG2c heavy-chain antibody specific for C-reactive protein, coronavirus S protein or coronavirus N protein antigen, the use according to claim 11 or 12.
14. A method for screening a target heavy-chain antibody, comprising using a C57BL / 6 mouse constructed by the production method according to any one of claims 1 to 10 or its offspring as an immunized animal for screening.
15. The method according to claim 14, wherein the phage display method is adopted during the screening of the target heavy-chain antibody.
16. The screening of the target heavy-chain antibody is to screen for an IgG2c heavy-chain antibody specific for C-reactive protein, coronavirus S protein or coronavirus N protein antigen. The method according to claim 14 or 15.
17. Derived from a C57BL / 6 mouse constructed by the production method according to any one of claims 1 to 10 or its offspring. Cells or cell lines or primary cells or excised tissues or excised organs of non-human mammals.
Citation Information
Patent Citations
Nucleic acid molecule and application to preparing human derived single domain antibody
CN108486125A
Combined molecules
JP2010503659A
Mice that produce heavy chain antibodies
JP2013513388A
Transgenic mouse
JP2017537653A