Kit for collecting a body fluid sample
The use of a body fluid sample collection article with an enclosed target substance carrier in a liquid-permeable sheet addresses the challenges of laborious collection and contamination in newborn screening, ensuring efficient and accurate detection of target substances.
Patent Information
- Application Number
- JP2021561525
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-28
- Filing Date
- 2020-11-27
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2040-11-27
AI Technical Summary
Existing methods for collecting body fluid samples, particularly from newborns, are laborious, time-consuming, and prone to contamination, especially in large-scale screening tests, which can lead to false positives due to carry-over contamination from positive to negative samples.
An article for collecting body fluid samples where a target substance-adhering carrier is enclosed in a liquid-permeable sheet, preventing contamination and scattering by enclosing the carrier before contact with the specimen, and using a device with an outer package to minimize direct handling and reduce contamination risks.
Facilitates easy collection of body fluid samples while preventing contamination and scattering, ensuring accurate detection of target substances without the need for frequent washing of equipment, thereby improving the reliability of screening tests.
Smart Images

Figure 0007697678000006 
Figure 0007697678000007 
Figure 0007697678000008
Abstract
Description
Technical Field
[0001] The present invention relates to articles for collecting body fluid samples, kits containing the same, and methods for detecting target substances in body fluids.
Background Art
[0002] As a method for examining the health condition and medical condition of a subject, a method of examining a body fluid sample such as urine or blood is known. For example, as a method for evaluating the renal function of a subject, a method of measuring creatinine, urea nitrogen, and total protein in urine is known. As a method for examining the possibility of diabetes, hyperthyroidism, and renal glycosuria in a subject, a method of measuring the sugar concentration in urine is known. In recent years, there has been a demand for a method for simply and quickly examining whether a patient is infected with a pathogenic microorganism. For example, in newborns, the presence or absence of inborn errors of metabolism is widely examined by newborn screening, and the presence or absence of hearing impairment is widely examined by newborn hearing screening for early detection of congenital diseases. In addition to these, there is also a growing voice calling for the implementation of a newborn screening test for congenital cytomegalovirus (CMV) infection. CMV can cause fetal infection and may leave sequelae such as hearing loss, mental and motor developmental disorders. Currently, it is said that there are about 3,000 children with congenital CMV infection in Japan every year. In addition, it has been reported that for symptomatic children with congenital CMV infection, early administration of antiviral drugs can reduce hearing loss and mental development delay. Therefore, it is desired to detect children with congenital CMV infection at an early stage. In addition, since it becomes difficult to distinguish between congenital and acquired CMV infections after 3 weeks of age, when congenital infection is suspected, it is required to collect urine within 3 weeks after birth and perform an examination. As detection methods, there are virus culture identification methods and nucleic acid amplification detection tests, but nucleic acid amplification detection tests are frequently used in terms of speed, simplicity, accuracy, etc. As such a nucleic acid amplification detection test, a method has been proposed in which a cut is made in the surface sheet on the side that contacts the skin of a disposable diaper, a filter paper is attached between the surface sheet and the absorber, and urine is collected by using it for infants, and the DNA in the urine collected on the filter paper is quantified (Patent Document 1: Japanese Patent Application Laid-Open No. 2008-99622).
Prior Art Documents
Patent Documents
[0003]
Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0004] In screening tests, especially large-scale screening tests, a large number of specimens are handled, so it is required to simply collect body fluid samples from individual subjects. On the other hand, since the large number of specimens include positive samples and negative samples for the detection target (target substance), it is required to simply prevent contamination from positive samples to negative samples. In particular, in qualitative tests using highly sensitive methods such as the PCR method, even a slight contamination can change the determination result, so it is strongly required to prevent it. In particular, directly collecting urine from newborns is a difficult and very time-consuming task, which is one of the reasons why the neonatal screening test for congenital CMV infection has not been widely implemented. Therefore, articles and methods for simplifying the task of collecting urine from newborns are required. In this regard, the method described in Patent Document 1 involves making a cut in the surface sheet on the side that contacts the skin of the diaper and attaching filter paper between the surface sheet and the absorber (paragraph
[0033] ). However, it is difficult and extremely time-consuming to actually perform such an operation on the diapers of a large number of subjects. Further, in the method described in Patent Document 1, in order to put the filter paper coated with the specimen into a PCR tube, it is necessary to punch out a disk with a diameter of 3 mm from the filter paper (paragraph
[0037] ). However, contamination from a positive sample to a negative sample, so-called carry-over, may occur through the punching device (puncher). In this case, the negative sample will be a false positive. In order to prevent this contamination, it is necessary to wash the puncher every time the filter paper is punched out, but it is not practical to perform this operation every time a large number of test samples are inspected. On the other hand, the inventor devised a method to prevent contamination through the puncher by punching out the filter paper with a puncher before bringing the filter paper into contact with the specimen and attaching the punched-out filter paper to the diaper. However, it was found that a new problem occurred in that the filter paper scattered in the diaper in such a case. In such a situation, there is a need for an article for collecting a body fluid sample that can (i) easily collect a body fluid sample from a subject, (ii) easily prevent contamination from a positive sample to a negative sample among a plurality of samples, and / or (iii) prevent the carrier for detecting a target substance in the body fluid sample from scattering in a sanitary product such as a diaper.
Means for Solving the Problems
[0005] As a result of intensive research to solve the above problems, the present inventors found that at least one of the above problems (i) to (iii) can be solved by using an article in which a carrier for detecting a target substance in a body fluid sample is enclosed in a liquid-permeable sheet, and thus completed the present invention. That is, the present invention is as follows.
[0006] [1] An article for collecting a body fluid sample, in which a target substance - adhering carrier for detecting a target substance in the body fluid sample is encapsulated in a liquid - permeable sheet. [2] The article according to [1] above, wherein the target substance - adhering carrier is a paper carrier, a cloth carrier or polymer beads. [3] The article according to [1] or [2] above, wherein the body fluid sample is a sample containing a body fluid selected from the group consisting of urine, saliva, blood, amniotic fluid, breast milk and exudate. [4] A device for collecting a body fluid sample, including the article according to any one of [1] to [3] above and an outer package. [5] A kit for collecting a body fluid sample, including the article according to any one of [1] to [3] above and an outer package. [6] The kit for collecting a body fluid sample according to [5] above, further including a drying case. [7] An absorbent hygiene product provided with the article according to any one of [1] to [3] above or the collecting device according to [4] above. [8] A method for detecting a target substance in a body fluid, including the following steps. (a) A step of preparing a target substance - adhering carrier. (b) A step of processing a liquid - permeable sheet to encapsulate the carrier in the liquid - permeable sheet. (c) A step of bringing the article obtained in step (b), in which the target substance - adhering carrier is encapsulated in the liquid - permeable sheet, into contact with a body fluid sample. (d) A step of detecting the target substance adhered to the carrier. [9] An article for collecting a body fluid sample, in which a nucleic acid - adhering carrier for detecting a target nucleic acid in the body fluid sample is encapsulated in a liquid - permeable sheet.
[10] The article according to [9] above, wherein the nucleic acid - adhering carrier is a paper carrier, a cloth carrier or polymer beads.
[11] The article according to [9] or
[10] above, wherein the target nucleic acid is derived from a microorganism.
[12] The article according to
[11] above, wherein the microorganism is a virus, a bacterium or a protozoan.
[13] The article according to
[12] above, wherein the virus is a herpes virus.
[14] The article according to any one of [9] to
[13] above, wherein the body fluid sample is a sample containing a body fluid selected from the group consisting of urine, saliva, blood, amniotic fluid, breast milk, and exudate.
[15] A device for collecting a body fluid sample, comprising the article according to any one of [9] to
[14] above and an outer package.
[16] A kit for collecting a body fluid sample, comprising the article according to any one of [9] to
[14] above and an outer package.
[17] The kit for collecting a body fluid sample according to
[16] above, further comprising a drying case.
[18] An absorbent hygiene product comprising the article according to any one of [9] to
[14] above or the collecting device according to
[15] above.
[19] A method for detecting a target nucleic acid in a body fluid, comprising the following steps. (a) A step of preparing a nucleic acid-attaching carrier. (b) A step of processing a liquid-permeable sheet to enclose the carrier in the liquid-permeable sheet. (c) A step of bringing the article obtained in step (b), in which the nucleic acid-attaching carrier is enclosed in the liquid-permeable sheet, into contact with a body fluid sample. (d) A step of taking out the nucleic acid-attaching carrier from the article that has been in contact with the body fluid sample, and (e) A step of putting the nucleic acid-attaching carrier taken out in step (d) into a container for nucleic acid amplification and detecting the target nucleic acid by a nucleic acid amplification reaction.
[20] The method according to
[19] above, wherein step (a) further comprises a step of processing the nucleic acid-attaching carrier into a form that can be stored in a container for nucleic acid amplification.
[21] The method according to
[19] or
[20] above, wherein step (c) further comprises a step of disposing the article on an absorbent hygiene product.
Advantages of the Invention
[0007] According to the present invention, compared with the prior art, a body fluid sample can be easily collected from a subject, contamination from a positive sample to a negative sample can be easily prevented, and / or scattering of a carrier for detecting a target substance in a body fluid sample in absorbent hygiene products such as diapers can be prevented.
Brief Description of the Drawings
[0008]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Embodiments for Carrying Out the Invention
[0009] Hereinafter, the present invention will be described in detail. The following embodiments are examples for explaining the present invention, and the present invention is not intended to be limited only to these embodiments. The present invention can be implemented in various forms without departing from its gist. In addition, this specification includes the contents described in the specification and drawings of the Japanese patent application (Japanese Patent Application No. 2019-215227) filed on November 28, 2019, which is the basis for claiming the priority of the present application.
[0010] 1. Summary In screening tests, particularly large-scale screening tests, since a large number of specimens need to be tested quickly, it is required to simply collect body fluid samples from individual subjects. On the other hand, since the large number of specimens include positive samples and negative samples for the detection target (target substance), it is required to simply prevent contamination from positive samples to negative samples. In particular, in qualitative tests using highly sensitive methods such as the PCR method, even a slight contamination can change the judgment result, so it is strongly required to prevent it. In particular, since directly collecting urine from a newborn is a very laborious task, articles and methods for simplifying the task of collecting urine from a newborn are required. In this regard, the method described in Patent Document 1 (Japanese Patent Application Laid-Open No. 2008-99622) involves making a cut in the surface sheet on the side that contacts the skin of the disposable diaper and attaching filter paper between the surface sheet and the absorber (paragraph
[0033] ). However, it is not easy to actually perform such an operation on the diapers of a large number of subjects, and it is also very time-consuming. Further, in the method described in Patent Document 1, it is necessary to punch out a 3-mm diameter disk from the filter paper on which the specimen is applied in order to put the filter paper into a PCR tube (paragraph
[0037] ). However, contamination from positive samples to negative samples can occur through the punching device (puncher). In this case, the negative sample will be a false positive. To prevent this contamination, it is necessary to wash the puncher every time the filter paper is punched, but it is not practical to perform this operation on a large number of test samples. In contrast, the inventor has devised a method to prevent contamination through the puncher by punching out the filter paper with a puncher before bringing the filter paper into contact with the specimen and attaching the punched filter paper to the diaper. However, in this case, it has been found that the filter paper scatters in the diaper, and as a result, the filter paper may enter the subject's body or move to a location other than the appropriate position for collecting the sample, etc., and there is a possibility that the body fluid sample cannot be collected well. These problems are new problems found by the inventors. As a result of intensive research to solve the above problems, the present inventors have found that by using an article in which a carrier for detecting a target substance in a body fluid sample is enclosed in a liquid-permeable sheet, (i) a body fluid sample can be easily collected from a subject, (ii) contamination from a positive sample to a negative sample can be easily prevented among a plurality of samples, and / or (iii) it is possible to prevent the carrier for detecting a target substance in a body fluid sample from being scattered in sanitary products such as diapers. The present invention has been invented based on such findings.
[0011] 2. Target substance In the present invention, the "target substance" means a substance to be detected or quantified among the substances contained in the body fluid. In the present invention, a substance that can adhere to the target substance-attaching carrier of the present invention can be a detection target and thus can be a target substance. That is, in the present invention, the target substance is not limited as long as it is a substance that can adhere to the target substance-attaching carrier of the present invention, and examples thereof include nucleic acids, proteins, organic compounds, saccharides, inorganic compounds, cell components, etc., and preferably nucleic acids, proteins, organic compounds, saccharides, and inorganic compounds.
[0012] In the present invention, the "target nucleic acid" refers to a nucleic acid to be amplified, detected, or quantified. The target nucleic acid can be appropriately selected according to the purpose of detection or quantification, but is preferably DNA or RNA derived from a microorganism. DNA includes total DNA, cDNA, genomic DNA, and synthetic DNA. RNA includes mRNA, rRNA, genomic RNA, and synthetic RNA (the microorganism from which the target nucleic acid is derived will be described later in "(2) Nucleic acid-attaching carrier" of "3."). In the present invention, the target nucleic acid can be detected or quantified using a known nucleic acid amplification method such as the PCR method.
[0013] In the present invention, the "target protein" refers to a protein to be detected or quantified. In the present invention, the target protein is not limited as long as it can adhere to the target substance - adherent carrier of the present invention. For example, total protein (TP), albumin, hemoglobin, etc. in a body fluid sample can be mentioned. In the present invention, the target protein can be detected or quantified using known reaction reagents, test strips, measuring instruments, etc.
[0014] In the present invention, the "target organic compound" refers to an organic compound other than the target nucleic acid and the target saccharide, and is an organic compound to be detected or quantified. The target organic compound includes metabolites of proteins. In the present invention, the target organic compound is not limited as long as it can adhere to the target substance - adherent carrier of the present invention. For example, creatinine (Cr), urea (urea nitrogen (UN)), uric acid (UA), bilirubin, ketone bodies, urobilinogen, amino acids, acylcarnitine, etc. can be mentioned.
[0015] In the present invention, the "target saccharide" refers to a saccharide to be detected or quantified. In the present invention, the target saccharide is not limited as long as it can adhere to the target substance - adherent carrier of the present invention. For example, sugar (glucose (Glu)) etc. can be mentioned.
[0016] In the present invention, the "target inorganic compound" refers to an inorganic compound to be detected or quantified. The target inorganic compound (including ions) is not limited as long as it can adhere to the target substance - adherent carrier of the present invention. For example, hydrogen ion (pH), nitrite, ammonia, sodium, potassium, chlorine, calcium, inorganic phosphorus, iron, magnesium, etc. can be mentioned.
[0017] In the present invention, the target organic compound, the target saccharide, and the target inorganic compound can be detected or quantified using known reaction reagents, test strips, measuring instruments, etc.
[0018] In the present invention, the "target cell component" refers to a cell or its component that is the subject of detection or quantification. In the present invention, the target cell component is not limited as long as it can adhere to the target substance-attached carrier of the present invention, and examples thereof include red blood cells and white blood cells. In the present invention, the target cell component can be detected or quantified using a known test strip, measuring instrument, or the like.
[0019] In the present invention, when the body fluid sample is a urine sample, the target substances include, but are not limited to, for example, nucleic acid, total protein (TP), albumin, creatinine (Cr), urea (urea nitrogen (UN)), uric acid (UA), bilirubin, ketone bodies, urobilinogen, sugar, hydrogen ion (pH), nitrite, hemoglobin, red blood cells, white blood cells, and the like.
[0020] In the present invention, when the body fluid sample is a blood sample, the target substances include, but are not limited to, for example, nucleic acid, amino acid, acylcarnitine, and the like.
[0021] In the present invention, when the body fluid sample is saliva, amniotic fluid, exudate, and other body fluid samples, the target substances include, for example, nucleic acid. In the present invention, when the body fluid sample is a breast milk sample, the target substances include, for example, nucleic acid and the like. Specific examples of the "nucleic acid" exemplified as the target substance above will be described later in "(2) Nucleic acid-attached carrier" in "3".
[0022] 3. Target substance - adhering carrier (1) Target substance - adhering carrier In the present invention, the "target substance - adherent carrier" (hereinafter also referred to as "carrier") means a carrier having the property that a target substance can adhere thereto. In the present invention, the target substance - adherent carrier is not limited as long as a target substance can adhere thereto, and examples of such carriers include paper carriers, cloth carriers, polymer beads, and the like. Examples of paper carriers include filter paper, various test papers, etc., and an example of a cloth carrier is filter cloth, but it is not limited thereto. In the present invention, the "test paper" refers to paper whose color changes when the test paper comes into contact with a target substance, as compared with the test paper before contact with the target substance or the test paper not in contact with the target substance. Commercially available test papers can be used, and those skilled in the art can appropriately select according to the type of target substance. For example, when the target substance is sugar in urine, a urine sugar test paper can be selected; when the target substance is protein in urine, a urine protein test paper can be selected. Further, as the target substance - adherent carrier, for example, a test paper capable of detecting various target substances such as sugar, protein, albumin, creatinine (Cr), hydrogen ion (pH), hemoglobin, red blood cells, ketone bodies, bilirubin, urobilinogen, nitrite, white blood cells, etc. at once can be used. Furthermore, a test paper portion for various target substances can be cut out from such a test paper, and the cut - out test paper can be used as the target substance - adherent carrier. In the present invention, examples of the test paper include, but are not limited to, test papers for sugar detection, test papers for protein detection, test papers for albumin detection, test papers for creatinine detection, pH test papers, test papers for occult blood detection, test papers for ketone body detection, test papers for bilirubin detection, test papers for urobilinogen detection, test papers for nitrite detection, test papers for white blood cell detection, and the like.
[0023] In the present invention, the target substance - adherent carrier is used for detecting a target substance in a body fluid sample. In the present invention, the "body fluid sample" refers to a sample containing a body fluid derived from a living body. The "body fluid" includes, for example, urine, saliva, amniotic fluid, breast milk, blood (whole blood, serum, plasma), exudate, cerebrospinal fluid, synovial fluid, ascites, pleural effusion, otorrhea, nasal discharge, pus, bile, sputum, sweat, and other crushed fluids of cells or tissues. As the body fluid, those selected from the group consisting of urine, saliva, amniotic fluid, breast milk, whole blood, and exudate are preferable, and those selected from the group consisting of urine, saliva, amniotic fluid, breast milk, and exudate are more preferable. Here, the exudate refers to a body fluid oozing from a wound or a lesion site (for example, a syphilis lesion site). The body fluid sample may contain cells. In the present invention, the living body includes an animal individual, animal tissue, animal cells (including cultured cells), etc. Examples of the animal include human, mouse, rat, horse, dog, sheep, rabbit, cow, pig, rhesus monkey, common marmoset, chicken, etc., preferably human, mouse, rat, and more preferably human.
[0024] In addition, in the case of a human-derived body fluid sample, the age (including months and days) of the subject human is not limited and can be appropriately selected within the range from the fetal period to 120 years old according to the purpose of detection. For example, when diagnosing or detecting congenital cytomegalovirus infection, it is selected within the range from the fetal period to within 21 days after birth. In the case of acquired cytomegalovirus infection, it is required to detect the virus in children in whom congenital cytomegalovirus infection has been excluded, about 1 month or more after birth. When detecting or diagnosing cytomegalovirus infection in an immunocompromised human, the age is not limited.
[0025] In the present invention, the form of the target substance-attaching carrier can be arbitrarily selected according to the method for detecting the target substance. For example, in the method for detecting sugar in urine, when using a urine sugar test strip as the target substance-attaching carrier, the form of the target substance-attaching carrier is not limited as long as it can be enclosed in the liquid-permeable sheet of the present invention (shape, size). Further, in the method for detecting an organic compound in urine using a reaction reagent, when using filter paper as the target substance-attaching carrier, the form of the target substance-attaching carrier is not limited as long as it can be used for the reaction of the target substance with the reagent. Such forms include, for example, a form (e.g., shape, size) that can be stored in a reaction vessel. In the present invention, the "reaction vessel" means a normal vessel used for the reaction between the target substance and the reagent, and examples thereof include tubes, vials, plates, etc., which are usually used in experiments. Since the pore diameter of these reaction vessels is usually 20 mm or less, as a form that can be stored in the reaction vessel, a form with the longest side or diameter of about 20.0 mm or less is preferable. Further, from the viewpoint of operability, as a form that can be stored in the reaction vessel, a form with the longest side or diameter of about 0.1 mm or more is preferable. That is, in the present invention, as a form that can be stored in the reaction vessel, the longest side or diameter is, for example, about 0.1 to 20.0 mm, about 0.1 to 15.0 mm, about 0.1 to 10.0 mm, about 0.1 to 8.0 mm, about 0.1 to 7.0 mm, about 0.1 to 6.0 mm, about 0.1 to 5.0 mm, about 0.5 to 20.0 mm, about 0.5 to 15.0 mm, about 0.5 to 10.0 mm, about 0.5 to 8.0 mm, about 0.5 to 7.0 mm, about 0.5 to 6.0 mm, about 0.5 to 5.0 mm, about 1.0 to 20.0 mm, about 1.0 to 15.0 mm, about 1.0 to 10.0 mm, about 1.0 to 8.0 mm, about 1.0 to 7.0 mm, about 1.0 to 6.0 mm, about 1.0 to 5.0 mm, about 1.0 to 4.0 mm, about 2.0 to 10.0 mm, about 2.0 to 8.0 mm, about 2.0 to 7.0 mm, about 2.0 to 6.0 mm, about 2.0 to 5.0 mm, about 2.0 to 4.0 mm, or about 3.0 to 4.0 mm. In the present invention, the "form" that can be stored in the reaction vessel is not limited as long as it can be put into the reaction vessel and the lid of the vessel can be closed. For example, a disk-shaped, plate-shaped, spherical, cubic, or rectangular parallelepiped-shaped object can be mentioned. In the present invention, the reaction vessel includes a nucleic acid amplification vessel.
[0026] In the present invention, as long as the target substance-attaching carrier can be used in the detection test of the target substance, it is not necessary to process its material (such as paper, cloth, etc.). On the other hand, if necessary, the material of the target substance-attaching carrier can be processed into a form that can be used in the detection test of the target substance. In the present invention, "processing" means to perform operations on the material to make it into a desired form. In the target substance-attaching carrier of the present invention, the processing is not limited. For example, cutting, dyeing, cutting, punching (for example), pulverizing, drying, adhering, welding, decorating, etc. can be mentioned. When the target substance-attaching carrier of the present invention is a test paper, the test paper can be cut into a form that can be enclosed in the liquid-permeable sheet of the present invention. Also, when the test paper can detect various target substances (test items) such as sugar, protein, albumin, creatinine (Cr), hydrogen ion (pH), hemoglobin, red blood cells, ketone bodies, bilirubin, urobilinogen, nitrite, white blood cells, etc. at one time, a test paper portion for each target substance can be cut from this test paper, and the cut test paper can be used as the target substance-attaching carrier. Here, a plurality of cut test papers can be used for each target substance. Also, when the target substance-attaching carrier of the present invention is a filter paper, for example, the filter paper can be dyed with an arbitrary dye.
[0027] As described above, since the target substances of the present invention include, for example, nucleic acids, proteins, organic compounds, saccharides, inorganic compounds, cell components, etc., examples of the target substance-attaching carrier of the present invention include a nucleic acid-attaching carrier, a protein-attaching carrier, an organic compound-attaching carrier, a saccharide-attaching carrier, an inorganic compound-attaching carrier, a cell component-attaching carrier, etc.
[0028] (2) Nucleic acid - adhering carrier In the present invention, when the target substance is a nucleic acid, a nucleic acid-attaching carrier can be used as the target substance-attaching carrier. In the present invention, the "nucleic acid-attaching carrier" means a carrier having the property of being able to attach a nucleic acid. In the present invention, the nucleic acid-attaching carrier is not limited as long as a nucleic acid can attach thereto, and examples of such carriers include paper carriers, cloth carriers, polymer beads, and the like. Examples of the paper carrier include filter paper, and examples of the cloth carrier include filter cloth, but are not limited thereto.
[0029] In the present invention, the form of the nucleic acid-attaching carrier is not limited as long as it can be subjected to a nucleic acid amplification reaction, and examples of such forms include a form (e.g., shape, size) that can be stored in a container for nucleic acid amplification. In the present invention, the "container for nucleic acid amplification" means an ordinary container used for nucleic acid amplification reactions, and examples thereof include tubes, vials, plates, etc. that are used for nucleic acid amplification reactions. Since the pore diameter of these containers for nucleic acid amplification is usually 20 mm or less, as a form that can be stored in the container for nucleic acid amplification, a form in which the longest side or diameter is about 20.0 mm or less is preferable. Further, from the viewpoint of operability, as a form that can be stored in the container for nucleic acid amplification, a form in which the longest side or diameter is about 0.1 mm or more is preferable. That is, in the present invention, as a form that can be stored in the container for nucleic acid amplification, the longest side or diameter is, for example, about 0.1 to 20.0 mm, about 0.1 to 15.0 mm, about 0.1 to 10.0 mm, about 0.1 to 8.0 mm, about 0.1 to 7.0 mm, about 0.1 to 6.0 mm, about 0.1 to 5.0 mm, about 0.5 to 20.0 mm, about 0.5 to 15.0 mm, about 0.5 to 10.0 mm, about 0.5 to 8.0 mm, about 0.5 to 7.0 mm, about 0.5 to 6.0 mm, about 0.5 to 5.0 mm, about 1.0 to 20.0 mm, about 1.0 to 15.0 mm, about 1.0 to 10.0 mm, about 1.0 to 8.0 mm, about 1.0 to 7.0 mm, about 1.0 to 6.0 mm, about 1.0 to 5.0 mm, about 1.0 to 4.0 mm, about 2.0 to 10.0 mm, about 2.0 to 8.0 mm, about 2.0 to 7.0 mm, about 2.0 to 6.0 mm, about 2.0 to 5.0 mm, about 2.0 to 4.0 mm or about 3.0 to 4.0 mm. In the present invention, the "form" that can be stored in the container for nucleic acid amplification is not limited as long as it can be put into the container for nucleic acid amplification and the lid of the container can be closed, and examples thereof include disk-shaped, plate-shaped, spherical, cubic, and rectangular parallelepiped shapes.
[0030] In the present invention, as long as the nucleic acid-attaching carrier can be subjected to a nucleic acid amplification reaction, it is not necessary to process the material (such as paper or cloth) of the nucleic acid-attaching carrier. On the other hand, if necessary, the material of the nucleic acid-attaching carrier can be processed into a form that can be subjected to a nucleic acid amplification reaction. In the present invention, "processing" means to perform operations on a material to give it a desired form. In the nucleic acid - adhering carrier of the present invention, the processing is not limited and includes, for example, cutting, dyeing, punching (e.g., using a punch), pulverizing, drying, adhering, welding, decorating, etc. When the nucleic acid - adhering carrier of the present invention is filter paper, for example, the filter paper can be dyed with any dye.
[0031] In the present invention, when the target substance is nucleic acid, examples of the target nucleic acid include nucleic acids derived from microorganisms (microbial nucleic acids). The microorganism from which the target nucleic acid is derived is not limited as long as it has a nucleic acid genome, and pathogenic microorganisms are preferred. In the present invention, examples of microorganisms include viruses, bacteria, protozoa, fungi, yeasts, slime molds, etc., and viruses, bacteria or protozoa are preferred. In the present invention, viruses include DNA viruses having DNA as a genome and RNA viruses having RNA as a genome, and DNA viruses are preferred. DNA viruses include double - stranded DNA viruses and single - stranded DNA viruses, and preferably double - stranded DNA viruses. Examples of double - stranded DNA viruses include herpesviruses, adenoviruses, poxviruses, etc., and herpesviruses are preferred.
[0032] Herpesviruses are viruses that have animals as hosts and have been found in large numbers in mammals, birds, amphibians, reptiles, fish, etc. As the herpesvirus from which the target nucleic acid of the present invention is derived, a herpesvirus that has humans as hosts (human herpesvirus) is preferred. Examples of human herpesviruses include, but are not limited to, human cytomegalovirus (HCMV), herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VSV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7), Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8), among which human cytomegalovirus (HCMV), herpes simplex virus type 1 (HSV-1), and herpes simplex virus type 2 (HSV-2) are preferred.
[0033] Human herpesviruses are each factors of various diseases. HCMV is involved in HCMV infections (e.g., congenital CMV infection), interstitial pneumonia, CMV retinitis, CMV mononucleosis, congenital cytomegalic inclusion disease, and HSV-1 is involved in oral herpes, genital herpes, Kaposi varicelliform eruption, herpes encephalitis, herpes keratitis, Bell's palsy, etc. Also, HSV-2 is involved in genital herpes, neonatal herpes, myelitis, aseptic meningitis, acute retinal necrosis, and VSV is involved in chickenpox, herpes zoster, Ramsay Hunt syndrome. Also, EBV is involved in infectious mononucleosis, chronic active EBV infection, nasopharyngeal carcinoma, Burkitt lymphoma, EBV-related gastric cancer, and HHV-6 is involved in exanthema subitum, encephalitis / encephalopathy. Furthermore, HHV-7 is involved in exanthema subitum, and HHV-8 is involved in Kaposi's sarcoma (AIDS-related type, classical type, African type), Castleman disease, malignant B lymphoma.
[0034] Examples of single-stranded DNA viruses include parvoviruses (such as adeno-associated viruses). RNA viruses include double-stranded RNA viruses and single-stranded RNA viruses. Examples of single-stranded RNA viruses include Rubella virus, Zika virus, retroviruses (such as RNA tumor viruses, human immunodeficiency virus, human T-cell leukemia virus, etc.), rhabdoviruses (such as rabies virus, vesicular stomatitis virus, etc.), paramyxoviruses (such as Sendai virus, mumps virus, measles virus, etc.), orthomyxoviruses (such as influenza virus, etc.), arenaviruses (such as lymphocytic choriomeningitis virus, Lassa virus, etc.), coronaviruses (such as SARS (Severe Acute Respiratory Syndrome) virus (SARS-CoV, SARS-CoV-2), MARS (Middle East Respiratory Syndrome) virus (MARS-CoV), etc.), noroviruses, and the like.
[0035] As the virus-derived target nucleic acid, any region of virus-derived DNA or RNA can be selected. For example, DNA or RNA in a conserved region with few gene mutations can be selected as the target nucleic acid. In human cytomegalovirus, for example, DNA containing the nucleotide sequences of the glycoprotein B gene (SEQ ID NO: 1), glycoprotein H gene (SEQ ID NO: 2), matrix phosphoprotein pp65 gene (SEQ ID NO: 3), etc. can be selected as the target nucleic acid. This gene information can be obtained from known gene information databases (such as ENA of the European Bioinformatics Institute (EBI), etc.).
[0036] In the present invention, bacteria include both Gram-positive bacteria and Gram-negative bacteria. Examples of Gram-positive bacteria include Staphylococcus bacteria such as Staphylococcus aureus, Streptococcus bacteria, Listeria bacteria such as Listeria monocytogenes, Bacillus bacteria such as Bacillus cereus, Mycobacterium bacteria such as Mycobacterium tuberculosis, Mycoplasma bacteria, Clostridium bacteria such as Clostridium botulinum (botulinum toxin) and Clostridium perfringens (welchii). Examples of Gram-negative bacteria include Escherichia bacteria such as Escherichia coli, Treponema pallidum, Citrobacter bacteria such as Citrobacter koseri, Chlamydia bacteria such as Chlamydia trachomatis and Chlamydia pneumoniae, Enterobacteriaceae represented by Klebsiella bacteria such as Klebsiella oxytoca, Vibrio bacteria such as Vibrio cholerae, Haemophilus bacteria such as Haemophilus influenzae, Salmonella bacteria, Proteus bacteria, Pseudomonas bacteria, and Neisseria gonorrhoeae.
[0037] In the present invention, examples of protozoa include, but are not limited to, Toxoplasma. Toxoplasma is a protozoan that causes congenital toxoplasmosis.
[0038] In the present invention, the microorganisms from which the target nucleic acid is derived include pathogenic microorganisms of congenital infectious diseases. Examples of such microorganisms include, but are not limited to, viruses such as herpes virus, rubella virus, and Zika virus, bacteria such as Treponema pallidum, and protozoa such as Toxoplasma.
[0039] In the present invention, any region in DNA derived from bacteria can be selected as a target nucleic acid. For example, DNA in a region containing a gene that causes a disease (pathogenic gene) can be selected as the target nucleic acid. Examples of such pathogenic genes include, but are not limited to, the listeriolysin O (hlyA) gene of Listeria bacteria, the enterotoxin gene and invasion (invA) gene of Salmonella bacteria, the verotoxin gene of pathogenic Escherichia coli O-157, the enterotoxin gene of Staphylococcus aureus, the cereulide (vomiting toxin) gene and enterotoxin gene of Bacillus cereus, various toxin genes of Clostridium botulinum, etc.
[0040] A person skilled in the art can select any region of DNA or RNA derived from a microorganism as a target nucleic acid based on known gene information and gene databases (such as GenBank of NCBI, etc.), and amplify the target nucleic acid by a nucleic acid amplification reaction using primers capable of amplifying the region. The nucleic acid sequence to be amplified may be either the full length or a part of the target nucleic acid sequence. For example, in the case of human cytomegalovirus, DNA containing the nucleotide sequence of the glycoprotein H gene of human cytomegalovirus is selected as the target nucleic acid, and the target nucleic acid is amplified by a nucleic acid amplification reaction using oligonucleotide primers capable of amplifying all or part of the target nucleic acid, and can be detected or quantified (Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60). A person skilled in the art can also detect or quantify other target nucleic acids derived from microorganisms using a similar method.
[0041] The base sequence of the target nucleic acid to be detected or quantified may be, for example, the base sequence on the sense strand or the base sequence on the antisense strand if it is a double-stranded nucleic acid. For example, by detecting or quantifying the nucleic acid sequence on the antisense strand, the complementary nucleic acid sequence on the sense strand can be detected or quantified.
[0042] (3) Protein - adhering carrier, organic compound - adhering carrier, saccharide - adhering carrier, inorganic compound - adhering carrier, cell component - adhering carrier A protein-attaching carrier, an organic compound-attaching carrier, a saccharide-attaching carrier, an inorganic compound-attaching carrier, and a cell component-attaching carrier can be prepared and used by those skilled in the art based on the description of the above “(1) target substance-attaching carrier”.
[0043] 4. Articles for collecting body fluid samples The article for collecting a body fluid sample of the present invention is one in which a target substance-attaching carrier for detecting a target substance in the body fluid sample is enclosed in a liquid-permeable sheet. Further, the article for collecting a body fluid sample of the present invention is an article used for collecting a body fluid sample derived from a subject. Here, as described above, the target substance-attaching carrier includes a nucleic acid-attaching carrier, a protein-attaching carrier, an organic compound-attaching carrier, a saccharide-attaching carrier, an inorganic compound-attaching carrier, a cell component-attaching carrier, and the like. The sampling article of the present invention can easily collect a body fluid sample from a subject by being disposed near a site where body fluid is discharged to the outside of the body (for example, excreted, secreted). A person skilled in the art can appropriately select the position where the sampling article of the present invention is disposed. The sampling article of the present invention may be used by being disposed on an absorbent hygiene product or clothing (such as underwear) described later, or may be used without being disposed on an absorbent hygiene product or clothing. When the sampling article of the present invention is disposed on an absorbent hygiene product and the body fluid is urine, the body fluid sample can be easily collected from the subject by disposing (fixing if necessary) the sampling article of the present invention at an appropriate position on the absorbent hygiene product (for example, a diaper). The "appropriate position" can be appropriately selected by a person skilled in the art based on known information. When the subject is a male newborn, examples of the appropriate position where the sampling article is disposed include, but are not limited to, a portion slightly forward from the center of the surface sheet (the sheet in contact with the skin) of the diaper.
[0044] In the sampling article for a body fluid sample of the present invention, since the target substance - adhering carrier is enclosed in a liquid - permeable sheet, the carrier can be prevented from scattering whether the article is used as it is or used after being disposed on an absorbent hygiene product. In the present invention, the "liquid - permeable sheet" refers to a sheet - like material having the property of permeating liquid. In the present invention, the liquid - permeable sheet is not limited as long as it has the property of permeating liquid (for example, body fluid permeability, water permeability, etc.). Examples include non - woven fabric, a net - like sheet material formed by plain - weaving yarns (such as yarns of nylon, polyethylene terephthalate, etc.), a film sheet material having a large number of through - holes, a woven fabric having liquid - permeability, paper (such as tissue paper), and the like. The "body fluid" in the present invention is as described in the above "3. Target substance - adhering carrier". In the present invention, the "nonwoven fabric" refers to a sheet formed by joining fibers without weaving. In the present invention, the nonwoven fabric is not limited as long as it has the property of permeating liquid, and the material of the nonwoven fabric is not limited either. Examples of such materials include, but are not limited to, cotton, hemp, wool, rayon, acetate, nylon, polyester, etc. In the present invention, "enclosed" means a state in which the target substance - adherent carrier is closed by a liquid - permeable sheet. Here, the "closed state" means a state in which the liquid - permeable sheet is processed (for example, folded, welded, etc.) so that the target substance - adherent carrier does not spread out from the inside (between the sheets) of the overlapping liquid - permeable sheets to the outside of the liquid - permeable sheet. In the present invention, the "closed state" does not necessarily mean a hermetically sealed state. The mode of enclosure in the present invention is not limited as long as the target substance - adherent carrier exists inside the overlapping liquid - permeable sheets (between the overlapping liquid - permeable sheets) and does not spread out to the outside of the overlapping liquid - permeable sheets. The mode of closing the target substance - adherent carrier with a liquid - permeable sheet is not limited, and examples include a mode of closing by folding the liquid - permeable sheet, a mode of closing by welding with a heat sealer, and a mode of closing by a combination thereof. The mode of enclosure is not limited, and for example, in the case of a rectangular liquid - permeable sheet, by folding a part of a single liquid - permeable sheet, welding a part of two liquid - permeable sheets with a heat sealer, etc., a overlap of the liquid - permeable sheets is formed, and a mode of putting the target substance - adherent carrier inside the overlapping liquid - permeable sheets can be mentioned (in the present invention, the welded part is called a "welded part"). In this mode, further, the non - closed part of the liquid - permeable sheet can be closed, but it is not necessarily required to close all the non - closed parts as long as the target substance - adherent carrier does not spread out to the outside of the liquid - permeable sheet. In another mode, as a mode of enclosure, for example, a mode of putting the target substance - adherent carrier into a liquid - permeable sheet processed into a bag shape and closing the non - closed part can be mentioned. The mode of enclosure of the present invention also includes a mode in which the target substance - adherent carrier is confined by a liquid - permeable sheet. Here, the "confined state" means a state in which the target substance - adherent carrier exists inside the overlapping liquid - permeable sheets and there is no non - closed part around the target substance - adherent carrier.
[0045] The number of the target substance - adhering carriers to be encapsulated can be appropriately selected by those skilled in the art according to the shape and size of the carrier and the permeable sheet, the type of the target substance, and the purpose of the test, and thus is not limited. As one aspect of the present invention, for example, when the longest side or diameter of the target substance - adhering carrier is plate - shaped or disc - shaped and is about 3 to 10 mm, the number of the target substance - adhering carriers to be encapsulated is, for example, 3 to 50.
[0046] As one aspect of the present invention, examples of the target substance - adhering carrier include those that are in a state of not being in contact (non - contact) with the body fluid sample before being encapsulated in the permeable sheet.
[0047] In one aspect of the present invention, the article for collecting a body fluid sample may have a handle portion for the test performer to hold the article (FIGS. 2 and 5). In the present invention, the handle portion is made so that the target substance - adhering carrier does not enter the handle portion. For example, in the present invention, the handle portion can be made by welding with a heat sealer at an arbitrary position (for example, a position about 5 to 30 mm) from the edge of the overlapped permeable sheet. (In the present invention, the welded portion is referred to as the welded part). The position and range of the handle portion are not limited, and those skilled in the art can appropriately adjust the position and range according to the necessity of the handle portion and the size of the article, etc. In the present invention, the number of the handle portions is not limited, and for example, it is 0 to 4.
[0048] In one aspect of the article for collecting a body fluid sample of the present invention, the permeable sheet for encapsulating the target substance - adhering carrier may be overlapped in multiple layers (for example, 2 to 4 layers) to increase the thickness of the permeable sheet layer. That is, as one aspect of the article for collecting a body fluid sample of the present invention, there is an article for collecting a body fluid sample in which the permeable sheets are overlapped in 2 to 4 layers, but the number of overlaps and the thickness of the permeable sheet are not limited.
[0049] 5. Devices for collecting body fluid samples The device for collecting a body fluid sample of the present invention includes the article for collecting a body fluid sample of the present invention and an outer package. The outer package used in the present invention is a part for covering the article for collection. The mode of covering the article for collection of the present invention with the outer package is not limited, and examples of the mode of covering the article for collection of the present invention with the outer package include putting (for example, inserting), wrapping, sandwiching, overlapping, installing, etc. In the present invention, by using the outer package, when the device for collecting a body fluid sample is arranged on the absorbent sanitary product, for example, the burden on the skin of the subject can be further reduced, the contamination of the article for collection by feces can be further reduced, and the displacement when arranged on an absorbent sanitary product such as a diaper can be further reduced. The outer package is not limited, and examples thereof include an outer package formed of a liquid-permeable sheet (for example, a non-woven fabric), a cotton puff, gauze, etc. As one aspect of the device for collection of the present invention, there is provided a device for collection in which the article for collecting a body fluid sample of the present invention is covered with an outer package. An example of the device for collection in which the article for collecting a body fluid sample of the present invention is covered with an outer package is shown in FIG. 6 (particularly FIG. 6b).
[0050] 6. Kits for collecting body fluid samples The kit for collecting a body fluid sample of the present invention includes the article for collecting a body fluid sample of the present invention and an outer package. Further, the kit for collecting a body fluid sample of the present invention may further include a case (drying case) for drying the article for collection after contact with the body fluid sample (hereinafter, also referred to as "the article for collection in contact with the body fluid sample") in addition to the article for collecting a body fluid sample of the present invention and the outer package.
[0051] The kit for collecting a body fluid sample of the present invention, in addition to the article for collecting a body fluid sample, an outer package and a drying case of the present invention, may appropriately include additional liquid-permeable sheets, absorbent sanitary products, adhesive seals, cutters, tweezers, individual identification tags (for example, seals, sheets, etc.), delivery materials, instruction manuals, etc., things necessary for collecting a body fluid sample, things necessary for taking out a target substance adherent carrier from the article for collection in contact with the body fluid sample, things necessary for detecting and measuring the target substance, etc.
[0052] In the present invention, the drying case is a case that can be used when drying sampling articles that have come into contact with a body fluid sample. By storing the sampling articles that have come into contact with the body fluid sample in the drying case, it is possible to reduce contamination caused by human hands touching the sampling articles during operations such as drying, delivery, opening, and detection testing. Also, it is possible to deliver the sampling articles that have come into contact with the body fluid sample while they are stored in the drying case. In the present invention, the drying case includes an opening lid and a main body, the lid and the main body are provided with a plurality of ventilation holes, and it is provided with a volume part for receiving sampling articles that have come into contact with a body fluid sample. In one aspect of the present invention, at least one of the lid and the main body may be provided with an opening hole so that when the sampling articles that have come into contact with the body fluid sample are stored in the drying case, the stored sampling articles can be opened from the outside of the drying case. In one aspect of the present invention, the drying case may have an area for attaching an individual identification tag. The individual identification tag may be an individual identification seal or sheet. The mode of individual identification is not limited, and for example, any mode such as a barcode, numbers, characters other than numbers, etc. can be appropriately selected. In one aspect of the present invention, the drying case may be provided with a window portion that is used to adhere the sampling article and the drying case from the outside of the drying case when the sampling article that has come into contact with the body fluid sample is stored in the drying case. For adhesion, any means can be used, such as fastening with a seal or tape. The window portion can be provided on at least one of the lid and the main body of the drying case. Due to the drying case of the present invention having the above structure, the test performer can open the sampling articles that have come into contact with the body fluid sample without touching them with their hands, and further take out the target substance - adhering carrier from the articles. The mode of opening will be described in "10. Method for Detecting Target Substances in Body Fluids" described later.
[0053] In the kit of the present invention, the additional liquid-permeable sheet can be used, for example, by overlaying it on the article for collecting a body fluid sample of the present invention, or can be used as an exterior packaging. In the present invention, the "absorbent hygiene product" means a hygiene product containing an absorbent material. Examples of such hygiene products include, but are not limited to, diapers, masks, and other absorbent pads (such as urine pads, breast milk pads, etc.). The articles of the present invention can be placed (fixed if necessary) in these absorbent hygiene products for use. The collection kit of the present invention may include multiple types of absorbent hygiene products. That is, the collection kit of the present invention can include at least one absorbent hygiene product selected from the group consisting of diapers, masks, and absorbent pads.
[0054] 7. Absorbent sanitary articles equipped with articles or devices for collecting body fluid samples The article or device for collecting a body fluid sample of the present invention can be used by being placed in an absorbent hygiene product. That is, the present invention provides an absorbent hygiene product provided with an article for collecting a body fluid sample. In the present invention, "provided with an article or device for collecting a body fluid sample" means a state in which the article or device for collecting a body fluid sample is placed at an appropriate position in the absorbent hygiene product for collecting the body fluid sample. Also, if necessary, the article or device for collection of the present invention may not only be placed at an appropriate position in the absorbent hygiene product, but may also be fixed, attached, packaged, embedded, inserted, etc. by any known method. Furthermore, the "absorbent hygiene product provided with an article or device for collecting a body fluid sample" of the present invention includes those in which the article or device for collecting a body fluid sample and the absorbent hygiene product are manufactured as an integral unit. In this case, it is possible to collect a body fluid sample simply by having the subject wear the absorbent hygiene product without the need to place the article or device for collecting a body fluid sample in the absorbent hygiene product. The "absorbent hygiene product" in the present invention is as described in the above "6. Collection Kit for Body Fluid Sample".
[0055] 8. Method for manufacturing an article in which a target substance - adhering carrier is enclosed in a liquid - permeable sheet The present invention provides a method for manufacturing an article in which a target substance - adherent carrier is enclosed in a liquid - permeable sheet, including the following steps. (a) A step of preparing a target substance - adherent carrier, and (b) A step of processing the liquid - permeable sheet to enclose the carrier in the liquid - permeable sheet
[0056] Step (a) is a step of preparing a target substance - adherent carrier. In the present invention, "preparing" means preparing the material of the target substance - adherent carrier (such as filter paper, test paper, filter cloth, etc.), and if necessary, processing the material into a form in which it can be subjected to the reaction of the target substance with the test paper or reagent. As one aspect of the mode of "processing into a form in which it can be subjected to the reaction of the target substance with the test paper or reagent", for example, step (a) may include a step of processing the target substance - adherent carrier into a form that can be enclosed in a liquid - permeable sheet or a form that can be stored in a reaction container. However, in the present invention, as long as the target substance - adherent carrier is in a form that can be subjected to the detection test of the target substance, it is not necessary to process its material.
[0057] Step (b) is a step of processing the liquid - permeable sheet so that the target substance - adherent carrier can be put into it, and enclosing the target substance - adherent carrier in the processed liquid - permeable sheet. In this step, the processing of the liquid - permeable sheet is not limited as long as it is processing that allows the target substance - adherent carrier to be put into it. For example, folding, cutting, folding, stacking, welding, processing into a bag shape, etc. of the liquid - permeable sheet can be mentioned. Also, when a processed liquid - permeable sheet is available, it can be used as it is without further processing for enclosing the target substance - adherent carrier. For example, a commercially available liquid - permeable sheet processed in a tea - bag shape can be obtained.
[0058] In the present invention, terms such as "target substance - adherent carrier", "form capable of being stored in a reaction vessel", and "processing" are as described in "3. (1) Target substance - adherent carrier", and terms such as "permeable sheet" and "enclosure" are as described in "4. Articles for collecting body fluid samples".
[0059] 9. Method for manufacturing an article in which a nucleic acid - adhering carrier is enclosed in a liquid - permeable sheet The present invention provides a method for manufacturing an article in which a nucleic acid - adherent carrier is enclosed in a permeable sheet, which includes the following steps. (a) A step of preparing a nucleic acid - adherent carrier, and (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet
[0060] Step (a) is a step of preparing a nucleic acid - adherent carrier. In the present invention, "preparing" (preparing) means preparing a material for the nucleic acid - adherent carrier (such as filter paper, filter cloth, etc.), and, if necessary, processing the material into a form that can be used in a nucleic acid amplification reaction. As one aspect of "processing the material of the nucleic acid - adherent carrier into a form that can be used in a nucleic acid amplification reaction", for example, step (a) may include a step of processing the nucleic acid - adherent carrier into a form that can be stored in a nucleic acid amplification container. However, in the present invention, as long as the nucleic acid - adherent carrier is in a form that can be used in a nucleic acid amplification reaction, it is not necessary to process the material of the nucleic acid - adherent carrier.
[0061] Step (b) is a step of processing a permeable sheet so that a nucleic acid - adherent carrier can be put into it, and enclosing the nucleic acid - adherent carrier in the processed permeable sheet. In this step, the processing of the permeable sheet is not limited as long as it is processing that allows a nucleic acid - adherent carrier to be put into it. For example, folding, cutting, folding, stacking, welding, processing into a bag shape, etc. of the permeable sheet can be mentioned. Also, when a processed permeable sheet is available, it can also be used as it is without further processing for enclosing the nucleic acid - adherent carrier. For example, a permeable sheet processed into a tea - bag shape can be obtained commercially.
[0062] In the present invention, terms such as "nucleic acid - adhering carrier", "form storable in a container for nucleic acid amplification", and "processing" are as described in "3. (2) Nucleic acid - adhering carrier", and terms such as "permeable sheet" and "enclosure" are as described in "4. Articles for collecting body fluid samples".
[0063] 10. Method for detecting a target substance in body fluid The present invention provides a method for detecting a target substance in a body fluid, which includes the following steps. (a) A step of preparing a target - substance - adhering carrier; (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet; (c) A step of bringing into contact an article obtained in step (b) in which the target - substance - adhering carrier is enclosed in the permeable sheet with a body fluid sample; (d) A step of detecting the target substance adhered to the carrier.
[0064] Steps (a) and (b) are as described in the above "8. Method for manufacturing an article in which a target - substance - adhering carrier is enclosed in a permeable sheet".
[0065] Step (c) is a step of bringing into contact an article obtained in step (b) in which the target - substance - adhering carrier is enclosed in the permeable sheet with a body fluid sample. In the present invention, "bringing into contact" means bringing at least a part of the target - substance - adhering carrier enclosed in the permeable sheet into contact with the body fluid sample, and does not necessarily mean bringing all of the enclosed target - substance - adhering carriers into contact with the body fluid sample. Further, this step may further include, if necessary, a step of placing an article in which the target - substance - adhering carrier is enclosed in the permeable sheet or a device for collecting a body fluid sample of the present invention on an absorbent hygiene product. Also, if necessary, not only placing the article or device on the absorbent hygiene product, but also fixing, wearing, inserting, etc. by any known method may be performed. Regarding the position for placement or fixation, etc., it is as described in the above "4. Articles for collecting body fluid samples".
[0066] In the method of the present invention, when a sampling device is used, after step (c), the outer packaging may be removed from the sampling article that has come into contact with the body fluid sample.
[0067] In the present invention, after step (c), the sampling article that has come into contact with the body fluid sample obtained in step (c) can be dried. The sampling article that has come into contact with the body fluid sample may be stored in a drying case and dried. In the present invention, as an opening mode of the sampling article that has come into contact with the body fluid sample and is stored in the drying case, for example, (1) taking out the sampling article from the drying case and opening the taken-out article with scissors or a cutter, etc.; (2) (i) opening the stored sampling article from the outside of the drying case with a cutter or the like through an opening hole provided in the drying case; (ii) adhering the sampling article that has come into contact with the body fluid sample and the drying case with tape or the like through a window portion provided in the drying case; (iii) opening the case to open the sampling article adhered thereto without touching it by hand. These are examples, but not limited thereto.
[0068] Step (d) is a step of detecting the target substance attached to the target substance-attaching carrier. The mode of this step can be appropriately selected according to the type of the target substance to be targeted. The mode of this step is not limited, and for example, (1) A mode including a step of using various test papers as the target substance-attaching carrier and detecting the target substance using the change in the color of the carrier as an index; (2) A mode including a step of taking out the target substance-attaching carrier from the article that has come into contact with the body fluid sample, putting the taken-out target substance-attaching carrier into a reaction container, and detecting the target substance using the change in the color of the reagent or the carrier caused by the reaction between the target substance and the detection reagent as an index; (3) A mode including a step of taking out the target substance-attaching carrier from the article that has come into contact with the body fluid sample, preparing an extract from the taken-out target substance-attaching carrier, and detecting the target substance by the reaction between the target substance in the extract and the detection reagent. A mode including a step of taking out a nucleic acid - adhering carrier from an article contacted with a body fluid sample, putting the taken - out nucleic acid - adhering carrier into a reaction vessel, and detecting a target nucleic acid by a nucleic acid amplification reaction. Examples include. Hereinafter, the above - mentioned modes (1) to (4) will be described.
[0069] (1) Aspects of using various test papers as target substance - adhering carriers In this mode, the target - substance - adhering carrier in the above step (a) (the step of preparing the target - substance - adhering carrier) may be various test papers or processed products thereof. The explanations of "test paper" and "processing" are as described in the above "3. (1) Target - substance - adhering carrier".
[0070] In step (a), when the target - substance - adhering carrier is various test papers or processed products thereof, the above step (d) includes a step of detecting the target substance using the change in the color of the carrier as an index. The change in color in this step means that when the carrier comes into contact with the target substance, the color of the carrier changes compared to the color of the carrier before contact with the target substance or the carrier not in contact with the target substance. For example, if the color of the carrier before contact with the target substance or the carrier not in contact with the target substance (referred to as the "original color") is an arbitrary color, such as yellow, and the carrier in contact with the target substance has a color different from the original color, such as blue, it can be said that there has been a change in color. "Using the change in color as an index" means using the change in color to indicate the presence or concentration level of the target substance in the sample.
[0071] In the present invention, when the color of the carrier changes, the change in color indicates the presence or concentration level of the target substance. On the other hand, in the present invention, when the color of the carrier does not change, this indicates that there is no target substance in the sample or the concentration of the target substance in the sample is at a level that cannot be detected. That is, since the change in the color of the carrier is associated with the presence or concentration level of the target substance, the target substance can be detected using the change in color as an index. The change in color can be confirmed visually or using known analytical instruments. In step (d), if the color change of the carrier can be visually confirmed outside the article, it is not always necessary to take out the carrier from the article.
[0072] (2) Aspects of detecting a target substance using a detection reagent In this aspect, the above step (d) is, for example, (i) a step of taking out the target substance - adherent carrier from the article that has been in contact with the body fluid sample, and (ii) a step of putting the taken - out target substance - adherent carrier into a reaction vessel and detecting the target substance by the reaction of the target substance with a detection reagent and includes.
[0073] The above step (i) is a step of taking out the target substance - adherent carrier from the article that has been in contact with the body fluid sample obtained in step (c). The method of taking out the target substance - adherent carrier is not limited. For example, the article that has been in contact with the body fluid sample in step (c) is opened, and a method of taking out the target substance - adherent carrier encapsulated in the article using an instrument that has undergone target substance removal treatment or an unused instrument (such as tweezers) can be mentioned.
[0074] The above step (ii) is a step of putting the target substance - adherent carrier taken out in step (i) into a reaction vessel and detecting the target substance by the reaction of the target substance with a detection reagent. In the present invention, before putting the target substance - adherent carrier taken out in step (i) into the reaction vessel, the carrier may be washed, dried, etc.
[0075] In the present invention, the "reaction vessel" is as described in the above "3. (1) Target substance - adherent carrier". The above step (ii) includes a step of putting a reagent that reacts with the target substance into the reaction vessel. The reagent can be put in before or after putting the target substance - adherent carrier into the reaction vessel. The reagent is not limited as long as it is a reagent that reacts with the target substance. A person skilled in the art can select and obtain a commercially available reagent that reacts with the target substance to be targeted according to the type of the target substance. Multiple types of reagents can be used.
[0076] In the above step (ii), as an aspect of "detecting the target substance by the reaction between the target substance and the detection reagent", for example, an aspect of detecting the target substance by using the color change of the reagent due to the reaction between the target substance and the detection reagent as an index is included.
[0077] The color change in this step means that when the reagent comes into contact with the target substance, the color of the reagent or the carrier changes as compared with the color of the reagent or the carrier before contact with the target substance or the reagent or the carrier not in contact with the target substance. For example, if the color of the reagent or the carrier before contact with the target substance or the reagent or the carrier not in contact with the target substance ("original color") is an arbitrary color, for example, transparent or white, and the reagent or the carrier in contact with the target substance is a color different from the original color, for example, purple, it can be said that there is a color change. "Using the color change as an index" means using the color change to indicate the presence or the level of concentration of the target substance in the sample.
[0078] In the present invention, when the color of the reagent or the carrier changes, the color change indicates the presence or the level of concentration of the target substance. On the other hand, in the present invention, when the color of the reagent or the carrier does not change, this indicates that there is no target substance in the sample or the concentration of the target substance in the sample is at a level that cannot be detected. That is, since the color change of the reagent or the carrier is associated with the presence or the level of concentration of the target substance, the target substance can be detected using the color change as an index. The color change can be confirmed visually or by a method such as measuring the absorbance using a known analytical instrument.
[0079] As an aspect of this step, for example, it includes a step of putting the target substance-attached carrier taken out in step (i) and the detection reagent into a reaction container (for example, a tube), heating it, and examining the presence or absence of a color change. This step further includes other steps necessary for detection (for example, a stirring step, a centrifugation step, etc.). In this step, a plurality of types of reagents may be used. The reaction conditions between the target substance and the reagent (e.g., reaction temperature, reaction time, amount of reagent, etc.), as well as the types and conditions of other necessary steps, can be appropriately set by those skilled in the art based on the instructions of the reagent.
[0080] (3) Aspects of detecting a target substance using an extract prepared from a target substance - adhering carrier In this embodiment, step (d) includes (i) a step of taking out the target substance-attached carrier from the article that has contacted the body fluid sample, and (ii) a step of preparing an extract from the taken-out target substance-attached carrier and detecting the target substance by the reaction between the target substance in the extract and the detection reagent. It includes. The above step (i) is as described in the above "Mode of Detecting the Target Substance Using the Detection Reagent". The above step (ii) includes a step of preparing an extract from the target substance-attached carrier taken out from the article. As one aspect of this step, for example, the target substance-attached carrier and a liquid solvent (e.g., water) can be placed in a reaction vessel (e.g., a tube), and the extract can be prepared by stirring with a mixer for the reaction vessel or the like. In addition, the above step (ii) further includes a step of placing the extract in a reaction vessel and detecting the target substance by the reaction between the target substance and the detection reagent. As one aspect of this step, for example, the extract prepared above is placed in another container, the detection reagent is added thereto, and the target substance is detected by analyzing the solution generated by the reaction between the target substance in the extract and the detection reagent (e.g., measuring the absorbance of the solution, etc.). In this step, when the detection is performed using an automatic analyzer, the detection reagent may be automatically added by the device. The reaction conditions between the target substance and the reagent (e.g., reaction temperature, reaction time, amount of reagent, etc.), as well as the types and conditions of other necessary steps, can be appropriately set by those skilled in the art based on the instructions of the reagent or the analyzer.
[0081] The aspect of the above (4) will be described in the following "11. Method for Detecting Target Nucleic Acid in Body Fluid".
[0082] 11. Method for detecting a target nucleic acid in body fluid The present invention provides a method for detecting a target nucleic acid in a body fluid, which includes the following steps. (a) A step of preparing a nucleic acid-attaching carrier; (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet; (c) A step of bringing an article obtained in step (b) in which the nucleic acid-attaching carrier is enclosed in the permeable sheet into contact with a body fluid sample; (d) A step of taking out the nucleic acid-attaching carrier from the article that has been in contact with the body fluid sample; and (e) A step of putting the nucleic acid-attaching carrier taken out in step (d) into a container for nucleic acid amplification and detecting the target nucleic acid by a nucleic acid amplification reaction
[0083] Steps (a) and (b) are as described in the above "9. Method for manufacturing an article in which a nucleic acid-attaching carrier is enclosed in a permeable sheet".
[0084] Step (c) is a step of bringing an article obtained in step (b) in which the nucleic acid-attaching carrier is enclosed in the permeable sheet into contact with a body fluid sample. In the present invention, "bringing into contact" means bringing at least a part of the nucleic acid-attaching carrier enclosed in the permeable sheet into contact with the body fluid sample, and does not necessarily mean bringing all of the enclosed nucleic acid-attaching carriers into contact with the body fluid sample. Also, this step may further include a step of disposing an article in which the nucleic acid-attaching carrier is enclosed in the permeable sheet or a device for collecting a body fluid sample of the present invention on an absorbent hygiene product, if necessary. Further, if necessary, not only disposing the article or device on the absorbent hygiene product, but also fixing, wearing, inserting, etc. by any known method may be performed. Regarding the position of disposal or fixation, etc., it is as described in the above "4. Articles for collecting body fluid samples".
[0085] In the method of the present invention, when a collection device is used, after step (c), the outer packaging may be removed from the collection article that has been in contact with the body fluid sample.
[0086] In the present invention, after step (c), the sampling article that has contacted the body fluid sample obtained in step (c) can be dried. The sampling article that has contacted the body fluid sample may be stored in a drying case and dried. In the present invention, the mode of opening the sampling article that has contacted the body fluid sample and is stored in the drying case is as described in the above "10. Method for Detecting a Target Substance in Body Fluid".
[0087] Step (d) is a step of taking out the nucleic acid-attaching carrier from the article that has been contacted with the body fluid sample obtained in step (c). The method of taking out the nucleic acid-attaching carrier is not limited. For example, the article that has been contacted with the body fluid sample in step (c) is opened, and a method of taking out the nucleic acid-attaching carrier enclosed in the article using an instrument that has undergone nucleic acid removal treatment or an unused instrument (for example, tweezers) can be mentioned.
[0088] Step (e) is a step of putting the nucleic acid-attaching carrier taken out in step (d) into a nucleic acid amplification container and detecting the target nucleic acid by nucleic acid amplification reaction. In the present invention, before putting the nucleic acid-attaching carrier taken out in step (d) into the nucleic acid amplification container, the carrier may be washed, dried, etc. However, in the present invention, after contacting an article in which the nucleic acid-attaching carrier is enclosed in a liquid-permeable sheet with a body fluid sample, before putting the nucleic acid-attaching carrier taken out from the article into a nucleic acid amplification container, the operation of cutting out (for example, punching) the carrier is not included. Thereby, contamination (for example, carry-over) from a positive sample to a negative sample among a plurality of samples can be easily prevented.
[0089] In the present invention, the "nucleic acid amplification container" is as described in the above "3. (2) Nucleic Acid-Attaching Carrier". In the present invention, the detection of the target nucleic acid can be performed by a method (nucleic acid amplification method) using an arbitrary nucleic acid amplification reaction. Nucleic acid amplification reactions are well-known, and examples include reactions involving temperature changes (temperature cycles) and isothermal nucleic acid amplification reactions that do not involve temperature changes. Examples of methods that utilize reactions accompanied by temperature changes include the PCR method (White, T.J. et al., Trends Genet., 5, 185 (1989)), the RT-PCR method, the LCR method (Ligase Chain Reaction: Barany, F., Proc. Natl. Acad. Sci. USA, Vol. 88, p. 189-193, 1991), and the like. Examples of methods that utilize isothermal nucleic acid amplification reactions include the SmartAmp (Smart Amplification Process) method (Japanese Patent No. 3897805), the LAMP (Loop-Mediated Isothermal Amplification) method (Japanese Patent No. 3313358), the SDA method (Strand Displacement Amplification: Edward L. Chan et al, Arch. Pathol. Lab. Med., 124:1649-1652, 2000), the ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids) method, the TMA (Transcription Mediated Amplification) method, the NASBA (Nucleic Acid Sequence-Based Amplification) method, the RCA (rolling circle amplification) method, the TRC (Transcription Reverse Transcription Concerted Reaction) method, the HDA (Helicase-dependent isothermal DNA amplification) method, but are not limited thereto. In the present invention, it is preferable that the amplification of the target nucleic acid is by a method selected from the group consisting of the PCR method, the RT-PCR method, the LCR method, the SmartAmp method, the LAMP method, the RT-LAMP method, the SDA method, the ICAN method, the TMA method, the NASBA method, the RCA method, the TRC method, and the HDA method. In the present invention, the "SmartAmp method" also includes the SmartAmp2 (Smart Amplification Process 2) method.
[0090] The PCR method, RT-PCR method, LCR method, SmartAmp method, LAMP method, SDA method, ICAN method, TMA method, NASBA method, RCA method, TRC method, and HDA method are techniques well-known to those skilled in the art, and those skilled in the art can easily implement them based on known information. Also, those skilled in the art can appropriately select primers and other reagents used in these nucleic acid amplification methods.
[0091] Hereinafter, the present invention will be described in detail by way of examples, but the present invention is not limited to these examples.
Examples
[0092] [Example 1] Production of an article in which a target substance - adhering carrier is enclosed in a liquid - permeable sheet In this example, an article in which a target substance-attaching carrier was enclosed in a liquid-permeable sheet was produced through the following steps. (1) Step of preparing a target substance - adhering carrier Filter paper (qualitative filter paper No. 2 or No. 131, manufactured by Toyo Roshi Kaisha, Ltd.) or urine test paper (Class II general-purpose test series, multi-item test paper kit, Uropaper III 'Eiken', Eiken Chemical Co., Ltd.) was used as the material for the target substance-attaching carrier. The filter paper was punched into a circular shape with a diameter of about 3 mm using a hand punch (1 / 8-inch standard, manufactured by Fiskars) to obtain a disc-shaped target substance-attaching carrier. In one example, filter paper dyed with a dye was also used as the material for the target substance-attaching carrier. The urine test paper had the test paper portion (about 5 mm in length × about 4 mm in width) removed for each test item (glucose, protein), and a plurality of plate-shaped target substance-attaching carriers were obtained for each test item.
[0093] (2) Step of processing a liquid - permeable sheet to enclose the carrier in the liquid - permeable sheet The disk-shaped target substance-attaching carrier obtained in the above (1) was placed in a non-woven fabric processed into a bag shape [tea pack M (manufactured by Tokiwa Kogyo Co., Ltd.) (approx. 95 mm × approx. 70 mm) or Heatron GSP-S (manufactured by Sankei Special Paper Co., Ltd.) (approx. 55 mm × approx. 75 mm)], with around 10 pieces in each. Also, the plate-shaped target substance-attaching carriers obtained in the above (1) were placed in a non-woven fabric processed into a bag shape, several pieces for each inspection item. Next, one open side of the bag-shaped non-woven fabric was welded with a heat sealer (P-200, manufactured by Fuji Impulse Co., Ltd.) (the welded part is referred to as the "welded part"), and the target substance-attaching carrier was sealed in the non-woven fabric. Through the above steps, an article (an article for collecting a body fluid sample) in which the target substance-attaching carrier was sealed in a liquid-permeable sheet was successfully produced (Figure 1).
[0094] As another example, about 10 mm from the upper end and / or lower end of the article in which the target substance-attaching carrier obtained in the above (2) was sealed in a non-woven fabric was welded with a heat sealer (the welded part is referred to as the "welded part") to produce a handle part. At this time, the enclosed target substance-attaching carrier was prevented from entering the handle part. One having a handle part (Figure 2) and two having handle parts (Figure 5) were produced.
[0095] As another example, the target substance-attaching carrier was placed in a non-woven fabric that was doubled, tripled, or quadrupled of the "non-woven fabric processed into a bag shape" used in the above (2), and an article for collecting a body fluid sample in which the liquid-permeable sheet was doubled, tripled, or quadrupled was produced.
[0096] [Example 2] Production of an article in which a nucleic acid - adhering carrier is enclosed in a liquid - permeable sheet In this example, an article in which the nucleic acid-attaching carrier was sealed in a liquid-permeable sheet was produced through the following steps. (1) Filter paper (qualitative filter paper No. 2, manufactured by Toyo Roshi Kaisha, Ltd.) was used as the material of the nucleic acid-attaching carrier. The filter paper was punched into a circular shape with a diameter of about 3 mm using a hand punch (1 / 8-inch standard, manufactured by Fiskars Co., Ltd.) to obtain a disk-shaped nucleic acid-attaching carrier [step of preparing the nucleic acid-attaching carrier]. In one example, filter paper dyed with a dye was also used as the material of the nucleic acid-attaching carrier. (2) A non-woven fabric processed into a bag shape (tea pack M (manufactured by Tokiwa Kogyo Co., Ltd.)) (vertically about 95 mm × horizontally about 70 mm) was filled with about 10 nucleic acid-attaching carriers obtained in the above (1), and one open side of the bag-shaped non-woven fabric was welded with a heat sealer (P-200, Fuji Impulse Co., Ltd.) (the welded part is referred to as the "welded part"), and a [step of processing a liquid-permeable sheet to enclose the carrier in the liquid-permeable sheet] in which the nucleic acid-attaching carrier was enclosed in the non-woven fabric was performed. Through the above steps, an article (article for collecting a body fluid sample) in which the nucleic acid-attaching carrier was enclosed in the liquid-permeable sheet was successfully produced (Figure 1).
[0097] As another example, a part about 10 mm from the upper end or the lower end of the article in which the nucleic acid-attaching carrier obtained in the above (2) was enclosed in the non-woven fabric was welded with a heat sealer (the welded part is referred to as the "welded part"), and a handle part was produced. At this time, the enclosed nucleic acid-attaching carrier was prevented from entering the handle part. An article having one handle part (Figure 2) and an article having two handle parts (Figure 5) were produced.
[0098] As another example, the nucleic acid-attaching carrier was put into a non-woven fabric that was double, triple, or quadruple the "bag-shaped non-woven fabric" used in the above (2), and an article for collecting a body fluid sample in which the liquid-permeable sheet was double, triple, or quadruple was produced.
[0099] [Example 3] Manufacture of a device for collecting body fluid samples In this example, a device for collecting a body fluid sample including the article for collecting a body fluid sample and an exterior produced in Example 1 or 2 was manufactured. Specifically, a non-woven fabric or gauze was processed into a bag shape to produce an exterior, and the article for collecting a body fluid sample was put into this to produce a collecting device. As another example, a non-woven fabric or gauze was used as the exterior, and the article for collecting a body fluid sample was wrapped with the non-woven fabric or gauze to produce a collecting device (Figure 6). As another example, a cotton puff provided with a pocket was used as the exterior, and the article for collecting a body fluid sample was inserted into the pocket to produce a collecting device.
[0100] [Example 4] Manufacture of a kit for collecting body fluid samples In this example, a kit for collecting a body fluid sample was manufactured, which included the article for collecting a body fluid sample prepared in Example 1 or 2 and the exterior prepared in Example 3. Further, in addition to the article for collection and the exterior, a kit for collecting a body fluid sample including a drying case was manufactured. In this example, a drying case with a barcode seal attached was prepared. In addition to the above, the kit prepared in this example may also include absorbent sanitary products, instruction manuals, and instruments and materials necessary for operations related to the collection and testing of body fluid samples.
[0101] [Example 5] Manufacture of an absorbent sanitary article equipped with an article or device for collecting body fluid samples In this example, an article for collecting a body fluid sample prepared in Example 1 or 2 or a collection device prepared in Example 3 was placed on the surface sheet (the part in contact with the subject's skin) of a commercially available diaper, thereby manufacturing a diaper equipped with the article for collecting a body fluid sample or the collection device.
[0102] [Example 6] Detection of target substances 1. Detection of target nucleic acids In this example, as a positive sample of a body fluid sample containing a target nucleic acid, a sample containing CMV (Towne strain) at 1x10 8 cp / ml in a buffer solution (Tris-EDTA buffer solution, 93283-100ML, Merck & Co., Inc.) (CMV-containing sample) was used. Also, the buffer solution (blank solution) was used as a negative sample. In addition, in this example, real-time PCR was used as the gene amplification and detection method. The composition of the reaction solution used in PCR is as follows. The primer concentration and probe concentration at the final reaction were 500 nM and 250 nM, respectively. Brilliant III Ultra-Fast QPCR Master Mix was purchased from Agilent Technologies. [Table 1] F-Primer: CGAATACCTCAGCGACCTGTACA (SEQ ID NO: 4) R-Primer: CGTTCGAGCGAGTGATCG (SEQ ID NO: 5) Probe: CCTGTTCCAGTAGCGGGCGACG (SEQ ID NO: 6) (Fluorescence: FAM / TAMRA)
[0103] First, 200 μL of the above CMV-containing sample or blank solution was dropped onto the article for collecting body fluid samples prepared in Example 2, thereby bringing the article for collection into contact with the CMV-containing sample or blank solution. Then, the article was dried. Next, the bag-shaped liquid-permeable sheet (specifically, non-woven fabric) related to the article was opened, and the nucleic acid-attaching carrier was taken out from the article. The nucleic acid-attaching carrier taken out from the article was put into 30 μL of the above reaction solution dispensed into each well of the measurement plate, and PCR was performed. PCR was carried out under the conditions of [60 seconds at 95°C] × 1 cycle, then [20 seconds at 95°C, 20 seconds at 60°C] × 50 cycles, and then [60 seconds at 37°C] × 1 cycle. The PCR apparatus used was Cobas z480 (Roche Diagnostics). As a result, in the sample containing the nucleic acid-attaching carrier taken out from the article for collection that had been brought into contact with the CMV-containing sample, the target nucleic acid of CMV could be detected (Figure 3). This Example demonstrated that the target nucleic acid in body fluid can be detected.
[0104] 2. Detection of target saccharides, target inorganic compounds As the specimen, a 1000 mg / dL glucose aqueous solution (prepared by dissolving glucose (Nisshin Medicalose Co., Ltd.) in pure water) was used. Also, pure water was used as a negative control. As the target substance-attaching carrier, only the glucose test paper part was cut out from a urine test strip containing a plurality of test items. 1 mL of the above specimen or negative control was dropped onto the sampling device prepared in Example 3, which contained several glucose test strips, thereby bringing the sampling article into contact with the specimen or negative control. After the contact, the change in the color of the test strip before and after dropping the specimen was confirmed. The results are shown in Table 2 below. In the table, "○" indicates that the color of the test strip, which is the carrier, has changed, and "×" indicates that the color of the test strip has not changed. [Table 2] As shown in the above table, for the sampling device onto which an aqueous glucose solution as the specimen was dropped, the color of the test strip, which is the target substance - adhering carrier, changed, while for the sampling device onto which the negative control was dropped, the color of the test strip did not change. This test showed that the target saccharide in body fluid can be detected using the article of the present invention. Also, from these results, it was shown that by using test strips for detecting inorganic compounds (including ions) such as nitrate test strips, calcium test strips, chlorine test strips, and pH test strips as the material of the target substance - adhering carrier instead of glucose test strips, the target inorganic compounds in body fluid can be detected.
[0105] 3. Detection of target proteins (1) Detection using test paper A protein standard solution (FUJIFILM Wako Pure Chemical Corporation) was used as the specimen. Also, pure water was used as the negative control. As the target substance - adhering carrier, only the protein test strip part was cut out from a urine test strip containing multiple test items. 1 mL of the above specimen or negative control was dropped onto the sampling device prepared in Example 3, which contained several protein test strips, thereby bringing the sampling article into contact with the specimen or negative control. After the contact, the change in the color of the test strip before and after dropping the specimen was confirmed. The results are shown in Table 3 below. In the table, "○" indicates that the color of the test strip, which is the carrier, has changed, and "×" indicates that the color of the test strip has not changed. [Table 3] As shown in the above table, in the sampling device to which the protein standard solution as the sample was dropped, the color of the test strip, which is the target substance - adhering carrier, changed, while in the sampling device to which the negative control was dropped, the color of the test strip did not change. This test showed that by using a protein test strip as the material of the target substance - adhering carrier, the target protein (total protein) in body fluid can be detected.
[0106] (2) Detection using a detection reagent In this test, the target protein - adhering carrier that had contacted the sample was immersed in the detection reagent, and by visually confirming the color change of the carrier or the reagent after a certain period of time, the target protein in the sample was detected. Specifically, it is as follows.
[0107] As samples, (i) a protein standard solution (FUJIFILM Wako Pure Chemical Corporation), (ii) a solution obtained by diluting TP / ALB standard serum (Sinotest Co., Ltd.) 7 - fold with pure water (hereinafter referred to as "TP / ALB standard serum dilution"), (iii) a sample obtained by adding TP / ALB standard serum (Sinotest Co., Ltd.) to adult pooled urine (hereinafter referred to as "TP / ALB standard serum - added urine") at about 70 mg / dL, and (iv) TP / ALB standard serum - added urine at about 700 mg / dL were used. Also, pure water was used as the negative control for samples (i) and (ii), and adult pooled urine was used as the negative control for samples (iii) and (iv). As the detection reagent, Micro TP - AR(2 / PM - R1) (FUJIFILM Wako Pure Chemical Corporation) was used. As the target substance - adhering carrier, the disk - shaped target substance - adhering carrier prepared in Example 1 was used.
[0108] First, 500 μL of the above - mentioned sample or negative control was dropped onto the article for collecting body fluid samples prepared in Example 1, thereby bringing the article for collection into contact with the sample or negative control. Then, the article was dried. Next, the bag-shaped liquid-permeable sheet (specifically, non-woven fabric) related to the article was opened, and the carrier was taken out from the article. The carrier was placed in each tube of an 8-well PCR tube (Watson Co., Ltd.), 60 μL of the detection reagent was added thereto, and it was heated at 37°C for 10 minutes using a heat block (Mini Block Bath MyBL-10) (AS ONE). The color of the reagent at the time of adding the detection reagent was compared with the color of the reagent after heating. The results are shown in Table 4 below. In the table, "○" indicates that the color of the target substance-attached carrier or the reagent has changed, and "×" indicates that the color of the carrier or the reagent has not changed.
Table 4
[0109] 4. Detection of target organic compounds (1) Detection using a detection reagent In this test, the target organic compound-attached carrier contacted with the specimen was immersed in the detection reagent, and the change in the color of the reagent after a certain period of time was visually confirmed to detect the target organic compound (biochemical substance) in the specimen. Specifically, it is as follows.
[0110] As specimens, (i) creatinine (hereinafter referred to as "CRE") (Nacalai Tesque Inc.) dissolved in pure water to form a 100 mg / dL aqueous solution, (ii) the specimen (i) diluted 10-fold with pure water to form a 10 mg / dL aqueous solution, and (iii) two adult pooled urine samples with different bases ("adult pooled urine A" and "adult pooled urine B") were used. Also, pure water was used as a negative control. As the detection reagent, Signas Auto CRE (Sinotest Co., Ltd.) was used. As the target substance-attached carrier, the disk-shaped target substance-attached carrier prepared in Example 1 was used.
[0111] First, 500 μL of the above specimen or negative control was dropped onto the article for collecting body fluid samples prepared in Example 1, thereby bringing the collecting article into contact with the specimen or negative control. Then, the article was dried. Next, the bag-shaped liquid-permeable sheet (specifically, non-woven fabric) related to the article was opened, and the carrier was taken out from the article. The carrier was placed in each tube of an 8-well PCR tube (Watson Co., Ltd.), 45 μL of R1, which is the detection reagent, was added thereto, and it was heated at 37 °C for 5 minutes in a heat block (Mini Block Bath MyBL-10) (AS ONE). Then, 15 μL of R2, which is the detection reagent, was added, stirred with a vortex mixer, spun down, and then heated at 37 °C for 5 minutes in a heat block. The color of the reagent at the time when R2, which is the detection reagent, was added was compared with the color of the reagent after heating. The results are shown in Table 5 below. In the table, "○" indicates that the color of the reagent changed, and "×" indicates that the color of the reagent did not change.
Table 5
[0112] (2) Detection using an analyzer In this test, an extract of the target organic compound was prepared from the target organic compound - adhering carrier that had contacted the specimen, and the target organic compound contained in the extract was detected using an automated biochemical analyzer. (2 - 1) Detection of creatinine The specimen, negative control, detection reagent, and target substance - adhering carrier used in this test were the same as those in (1) above.
[0113] First, the specimen or negative control was dropped onto the article for collecting the body fluid sample prepared in Example 1, thereby bringing the collecting article into contact with the specimen or negative control. Then, the article was dried. Next, the bag - shaped liquid - permeable sheet (specifically, non - woven fabric) related to the article was opened, and the carrier was taken out from the article. The carrier was placed in a 1.5 mL tube, 200 μL of pure water was added, and it was stirred with a vortex mixer for 30 seconds to prepare an extract. Then, the extract was measured using an automated biochemical analyzer (Hitachi 7180 type) equipped with a detection reagent. The analysis parameters used were those specified by the manufacturer. As a result, the extracts prepared from the carriers taken out from the collecting articles that had contacted the 100 mg / dL CRE aqueous solution (specimen (i)), 10 mg / dL CRE aqueous solution (specimen (ii)), and adult pooled urine A and B (specimen (iii)) showed significantly higher values for the CRE content compared to the negative control (Figure 7). This result indicates that the presence of CRE in the specimen could be detected. Therefore, this test demonstrated that the target organic compound (biochemical substance) in body fluid can be detected using the article of the present invention.
[0114] (2 - 2) Detection of urea nitrogen As specimens, (i) a UN (urea nitrogen) standard solution (Shinotest Corporation) and (ii) two adult pooled urine samples with different bases (“adult pooled urine A” and “adult pooled urine B”) were used. Also, pure water was used as a negative control. As a detection reagent, Signus Auto UN (Shinotest Corporation) was used. As the target substance-attached carrier, the disk-shaped target substance-attached carrier prepared in Example 1 was used.
[0115] First, 500 μL of the above specimen or negative control was dropped onto the article for collecting a body fluid sample prepared in Example 1, thereby bringing the article into contact with the specimen or negative control. Then, the article was dried. Next, the bag-shaped liquid-permeable sheet (specifically, a non-woven fabric) related to the article was opened, and the carrier was taken out from the article. The carrier was put into a 1.5 mL tube, 200 μL of pure water was added, and it was stirred with a vortex mixer for 30 seconds to prepare an extract. Then, the extract was measured with a biochemical automatic analyzer (Hitachi 7180 type) equipped with a detection reagent. The analysis parameters were those specified by the manufacturer. As a result, the extracts prepared from the carriers taken out from the articles in contact with the UN standard solution (specimen (i)), adult pooled urine A and B (specimen (ii)) showed significantly higher values for the UN content compared to the negative control (Figure 8). This result indicates that the presence of UN in the specimen could be detected. Therefore, this test showed that the target organic compound (biochemical substance) in the body fluid can be detected using the article of the present invention.
[0116] [Comparative Example 1] Contamination (carry - over) via a puncher Different from the present invention, in a method of processing the filter paper with a puncher after bringing the filter paper into contact with the sample, whether contamination from a positive sample to a negative sample occurs through the puncher was tested by the following procedure. (1) The filter paper before being processed with the puncher was brought into contact with the CMV-containing sample used in “1. Detection of target nucleic acid” of Example 6 and dried. Also, the filter paper before being processed with the puncher was brought into contact with the blank solution and dried. (2) Next, the filter paper that had been brought into contact with the CMV-containing sample was punched out (punched) using a puncher. (3) The filter paper that had been brought into contact with the blank solution was punched out using the puncher used in (2) above without washing the puncher. (4) The operation in (3) above, that is, the operation of punching out the filter paper that had been brought into contact with the blank solution using an unwashed puncher, was continuously performed a total of 5 times. (5) For the disk-shaped filter paper pieces obtained by punching out with a puncher, PCR was performed in the same manner as in "1. Detection of target nucleic acid" in Example 6.
[0117] As a result, it was found that when punching out the filter paper that had been brought into contact with the CMV-containing sample in (2) above and then punching out the filter paper that had been brought into contact with the blank solution using an unwashed puncher, false positives continued even after punching out a total of 5 times (Figure 4). In Figure 4, "after CMV-containing sample" refers to a sample containing filter paper pieces obtained by punching the filter paper that had been brought into contact with the blank solution using the puncher that had punched the filter paper that had been brought into contact with the CMV-containing sample. The sample of "after CMV-containing sample" in Figure 4 was obtained by punching the filter paper that had been brought into contact with the blank solution. However, because the puncher that had punched the filter paper that had been brought into contact with the CMV-containing sample was used, it is understood that the filter paper that had been brought into contact with the blank solution was contaminated by the nucleic acid derived from CMV adhering to the puncher. From the above results, it was shown that in the prior art, contamination from a positive sample to a negative sample can occur through equipment for processing filter paper or the like, and as a result, false positives may occur.
Industrial Applicability
[0118] The article for collecting a body fluid sample of the present invention is useful for collecting a body fluid sample from a subject.
Explanation of Signs
[0119] 1 Permeable sheet 2 Target substance-attaching carrier 3 Handle part 4 Welding part 5 Welding part Articles for collecting body fluid samples 7 Exterior packaging 8 Device for collecting body fluid samples
Sequence Listing Free-Text
[0120] SEQ ID NOs: 4 to 6: Synthetic DNA
Claims
Article for collecting urine, comprising a plurality of nucleic acid - adhering carriers and overlapping permeable sheets, wherein the plurality of carriers are present between the overlapping permeable sheets, the carrier has the longest side or diameter equal to or less than the pore diameter of the container for nucleic acid amplification, the pore diameter is 20.0 mm, and the longest side or diameter is 0.5 - 20.0 mm.
2. The article for collecting urine according to claim 1, wherein the carrier is a paper carrier, a cloth carrier or polymer beads. Article for collecting urine, comprising a plurality of nucleic acid - adhering carriers and overlapping permeable sheets, wherein the plurality of carriers are present between the overlapping permeable sheets, the carrier has the longest side or diameter equal to or less than the pore diameter of the container for nucleic acid amplification, and the pore diameter is 20.0 mm.
4. A urine collection device, comprising the article for collecting urine according to any one of claims 1 - 3 and an outer package.
5. A urine collection kit, comprising the article for collecting urine according to any one of claims 1 - 3 and an outer package.
6. The urine collection kit according to claim 5, further comprising a drying case.
7. An absorbent hygiene product, comprising the article for collecting urine according to any one of claims 1 - 3 or the urine collection device according to claim 4.
8. A method for detecting nucleic acid in urine, comprising the following steps: (a) A step of preparing a plurality of nucleic acid - adhering carriers, wherein the carrier is processed so as to have the longest side or diameter equal to or less than the pore diameter of the container for nucleic acid amplification, the pore diameter is 20.0 mm, and the longest side or diameter is 0.5 - 20.0 mm; (b) A step of processing the permeable sheet so that the plurality of nucleic acid - adhering carriers are present between the overlapping permeable sheets; (c) A step of bringing the article obtained in step (b), in which the plurality of nucleic acid - adhering carriers are present between the overlapping permeable sheets, into contact with urine; (d) A step of detecting the nucleic acid attached to the carrier.
9. The following steps: (a) A step of preparing a plurality of nucleic acid - adhering carriers, wherein the carrier is processed so as to have the longest side or diameter equal to or less than the pore diameter of the container for nucleic acid amplification, and the pore diameter is 20.0 mm; (b) A step of processing the permeable sheet so that the plurality of nucleic acid - adhering carriers are present between the overlapping permeable sheets; (c) A step of bringing an article in which the plurality of carriers having nucleic acid adhesiveness obtained in step (b) are present between overlapping liquid-permeable sheets into contact with urine, and (d) A step of detecting the nucleic acid attached to the carrier A method for detecting nucleic acid in urine, comprising:
Citation Information
Patent Citations
Testing-tool sample transfer means
JP1993099807A
Dermal patch lacking separate absorbent material
JP1999506624A
Menstrual discharge or vaginal secretion collecting instrument, kit and method
JP2002372527A
Biological sample collection device and collection method
JP2002527726A
Method for amplifying genes in body fluid
JP2008099622A