Flow cell

Abstract

An example of a flow cell includes a base support and a multilayer stack positioned on the base support. The multilayer stack includes a resin layer positioned on the base support and a hydrophobic layer positioned on the resin layer. A recess is defined in the multilayer stack using the hydrophobic material and a portion of the resin.

Description

Technical Field

[0001] (Cross - Reference to Related Applications) This application claims the benefit of U.S. Provisional Patent Application No. 62 / 951,780, filed on December 20, 2019, the content of which is incorporated herein by reference in its entirety.

[0002] (Reference to Sequence Listing) The sequence listing submitted herewith via EFS - Web is incorporated herein by reference in its entirety. The file name is ILI188BPCT_IP - 1910 - PCT_Sequence_Listing_ST25.txt, the file size is 526 bytes, and the file creation date is December 10, 2020.

Background Art

[0003] Some available platforms for nucleic acid sequencing utilize a synthetic sequencing approach. In this approach, a nascent strand is synthesized, and the addition of each monomer (e.g., nucleotide) to the growing strand is detected optically and / or electronically. Since the template strand instructs the synthesis of the nascent strand, the sequence of the template DNA can be inferred from the series of nucleotide monomers added to the growing strand during synthesis. In some examples, sequential paired - end sequencing can be used, where the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced. In other examples, simultaneous paired - end sequencing can be used, where the forward and reverse strands are sequenced simultaneously.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Summary of the Invention

Means for Solving the Problems

[0005] Some examples and aspects of the methods disclosed herein generate flow cells for sequential paired-end reads. Other examples and aspects of the methods disclosed herein generate flow cells for simultaneous paired-end reads. The methods provide simplified patterning techniques for generating various flow cell surfaces.

[0006] A first aspect disclosed herein is a flow cell that includes a base support, a multilayer stack, and a recess, where the multilayer stack is positioned on the base support and includes a resin layer positioned on the base support and a hydrophobic layer positioned on the resin layer, and the recess is defined in the multilayer stack using a hydrophobic material and a portion of the resin.

[0007] An example of the first aspect further includes a polymer hydrogel positioned in the recess. This example may further include a primer attached to the polymer hydrogel.

[0008] In an example of the first aspect, a first region of the recess includes a first polymer hydrogel and a first primer set attached to the first polymer hydrogel, a second region of the recess includes a second polymer hydrogel and a second primer set attached to the second polymer hydrogel, and the first primer set is different from the second primer set.

[0009] It should be understood that any features of the first aspect disclosed herein can be combined together in any desirable manner and / or configuration to achieve the advantages described in this disclosure, for example, including recesses surrounded by hydrophobic regions.

[0010] A second aspect disclosed herein is a method comprising defining a recess in a multilayer stack including a hydrophobic layer on a resin layer, and applying a functionalized layer to at least one region of the recess, wherein defining the recess is by: i) etching using the depth of the hydrophobic layer, or ii) imprinting and etching the hydrophobic layer using the depth of the hydrophobic layer, or iii) imprinting using the depth of the hydrophobic layer and a portion of the depth of the resin layer.

[0011] In one example of the second aspect, defining the recess involves ii) imprinting and etching the hydrophobic layer using the depth of the hydrophobic layer, and imprinting and etching the hydrophobic layer involves imprinting using a portion of the depth of the hydrophobic layer and etching the remaining portion of the depth of the hydrophobic layer, whereby the resin layer acts as an etch stop, and etching the remaining portion.

[0012] In one example of the second aspect, defining the recess involves i) etching using the depth of the hydrophobic layer, and prior to etching using the depth of the hydrophobic layer, the method further involves applying a lift-off resist and an additional resin layer on the hydrophobic layer, imprinting the additional resin layer to form a recessed region therein, and extending the recessed region to the surface of the hydrophobic layer by selectively etching portions of the additional resin layer and the lift-off resist, whereby other portions of the additional resin layer and the lift-off resist adjacent to the recessed region remain intact. In this example, after the functionalized layer is applied, the method may further include lifting off the other portions of the lift-off resist.

[0013] In certain examples of the second aspect, prior to applying the functionalized layer, the method comprises applying a sacrificial layer over a first portion of the recess, whereby a second portion of the recess is exposed, and further comprising applying the sacrificial layer over which the functionalized layer is applied over the sacrificial layer and the second portion of the recess. Following applying the functionalized layer, the method further comprises removing the sacrificial layer to expose the first portion of the recess, and applying a second functionalized layer over the first portion of the recess.

[0014] It should be understood that any features of the second aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, to achieve the advantages described in the present disclosure, including simplified methods for patterning various flow cell surfaces.

[0015] A third aspect disclosed herein is a method comprising applying a sacrificial layer over a first portion of a recess defined in a substrate, whereby a second portion of the recess remains exposed; applying a first functionalized layer over the sacrificial layer and the second portion of the recess; removing the sacrificial layer and the first functionalized layer applied thereon, thereby exposing the first portion of the recess; applying a second functionalized layer over the second portion of the recess; and attaching respective primer sets to the first functionalized layer and the second functionalized layer.

[0016] In certain examples of the third aspect, the substrate comprises a resin layer on a base support; the recess is defined using a portion of the resin layer.

[0017] In certain examples of the third aspect, prior to applying the sacrificial layer over the first portion, the method further comprises forming the recess in the resin layer using nanoimprint lithography.

[0018] In an example of the third aspect, before applying the sacrificial layer onto the first portion, the method further includes forming a recess in the resin layer, and the forming includes applying a photoresist to the resin layer, developing the photoresist to define a recess pattern where the soluble photoresist is removed and a gap pattern where the insoluble photoresist remains on the resin layer, etching the resin layer with the recess pattern, and removing the insoluble photoresist.

[0019] It should be understood that any features of the third aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, to achieve the advantages described in the present disclosure including a simplified method for patterning various flow cell surfaces.

[0020] A fourth aspect disclosed herein is to imprint a resin layer to form a concave region including a deep portion and a shallow portion defined by a step portion, wherein the resin layer is positioned on a multilayer stack including at least two layers having different etching rates positioned on a base support, the forming, selectively etching the resin layer and the at least two layers to form a recess adjacent to the deep portion, applying a first functionalized layer to the recess, selectively etching the resin layer, the at least two layers, or a combination thereof to expose a region under the step portion, and applying a second functionalized layer to the exposed region.

[0021] In an example of the fourth aspect, at least two layers include a sacrificial layer positioned on an additional resin layer. In this example, selectively etching to form a recess involves etching a first portion of the resin layer beneath the deep portion, etching a portion of the sacrificial layer beneath the deep portion, thereby exposing a portion of the additional resin layer, i) etching a second portion of the resin layer to expose another portion of the sacrificial layer, and ii) etching the exposed portion of the additional resin layer. In this example, selectively etching to expose the region beneath the step portion involves etching a second portion of the sacrificial layer to expose a second portion of the additional resin layer. In this example, the second functionalized layer is applied to the second portion of the additional resin layer, and the method further includes etching the remaining portion of the sacrificial layer.

[0022] In an example of the fourth aspect, at least two layers include a poly(methyl methacrylate) lift-off layer positioned on a sacrificial layer. In this example, selectively etching to form a recess involves etching a first portion of the resin layer beneath the deep portion, etching a portion of the poly(methyl methacrylate) lift-off layer beneath the deep portion, etching a portion of the sacrificial layer beneath the deep portion, thereby forming a recess in the sacrificial layer. In this example, the region beneath the step portion is a portion of the base support, and selectively etching to expose the region beneath the step portion involves etching the step portion of the resin layer, etching a second portion of the poly(methyl methacrylate) lift-off layer beneath the step portion, and etching a second portion of the sacrificial layer beneath the step portion. In this example, the second functionalized layer is applied to a portion of the base support, and the method further includes lift-off of the remaining portion of the poly(methyl methacrylate) lift-off layer and etching of the remaining portion of the sacrificial layer.

[0023] In one example of the fourth aspect, at least two layers include a poly(methyl methacrylate) lift-off layer positioned on a sacrificial layer positioned on an additional resin layer. In this example, selectively etching to form a recess involves etching a first portion of the resin layer beneath the deep portion, etching a portion of the poly(methyl methacrylate) lift-off layer beneath the deep portion, etching a portion of the sacrificial layer beneath the deep portion, thereby forming a recess in the sacrificial layer. In this example, before etching a portion of the sacrificial layer beneath the deep portion, the method further includes etching the resin layer to remove the step portion and exposing a second portion of the poly(methyl methacrylate) lift-off layer. In this example, the region beneath the step portion is a portion of the additional resin layer, and selectively etching to expose the region beneath the step portion involves etching a second portion of the poly(methyl methacrylate) lift-off layer and etching a second portion of the sacrificial layer beneath the second portion of the poly(methyl methacrylate) lift-off layer. In this example, the second functionalized layer is applied to a portion of the additional resin layer, and the method further includes lift-off of the remaining portion of the poly(methyl methacrylate) lift-off layer and etching of the remaining portion of the sacrificial layer.

[0024] It should be understood that any features of the fourth aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect and / or the fourth aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, to achieve the advantages described in this disclosure including a simplified method for patterning various flow cell surfaces.

[0025] A fifth aspect disclosed herein involves applying a first functionalized layer onto a substrate that includes a concave region having a deep portion and a shallow portion defined by a step portion, patterning the first functionalized layer, thereby forming a first functionalized region covered by a photoresist in the deep portion adjacent to the step portion, and applying a second functionalized layer onto the substrate and the photoresist.

[0026] An example of the fifth aspect further includes dry etching the substrate to remove the step portion and form a recess adjacent to the first functionalized region. In some of these examples, after the second functionalized layer is applied, the method further includes lift-off of the photoresist and the second functionalized layer thereon, and removing a portion of the second functionalized layer, thereby forming a second functionalized region adjacent to the first functionalized region. In some of these examples, patterning the first functionalized layer involves applying a photoresist onto the first functionalized layer and dry etching the photoresist and the first functionalized layer until the step portion is exposed. In this example, the dry etching of the substrate or the photoresist involves reactive ion etching.

[0027] As described above, certain examples of the fifth aspect further include dry etching the substrate to remove the step portion and form a recess adjacent to the first functionalized region. In some of these examples, the substrate is a multilayer stack including a resin layer on a base support, and before applying the first functionalized layer, the method further includes imprinting the resin layer to form a concave region and selectively etching the resin layer to expose the base support at a deep portion, and the dry etching of the substrate involves dry etching the resin layer, and the base support functions as an etching step during the dry etching. In some of these examples, after the second functionalized layer is applied, the method further includes lifting off the photoresist and the second functionalized layer thereon, removing a portion of the second functionalized layer, thereby forming a second functionalized region adjacent to the first functionalized region. In some of these examples, patterning the first functionalized layer involves applying a photoresist on the first functionalized layer and dry etching the photoresist and the first functionalized layer until the step portion is exposed.

[0028] It should be understood that any features of the fifth aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect and / or the fourth aspect and / or the fifth aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, to achieve the advantages described in the present disclosure including a simplified method for patterning various flow cell surfaces.

[0029] The sixth aspect disclosed in this specification is to imprint an additional resin layer to form a concave region therein, wherein the additional resin layer is positioned on a poly(methyl methacrylate) lift-off layer positioned on the first resin layer, forming the concave region, and by etching a first portion of the additional resin layer and a first portion of the poly(methyl methacrylate) lift-off layer, exposing a portion of the first resin layer below the concave region, and i) etching the additional resin layer to expose a second portion of the poly(methyl methacrylate) lift-off layer, ii) etching the exposed portion of the first resin layer to form a recess in the first resin layer, applying a functionalized layer on the recess and the second portion of the poly(methyl methacrylate) lift-off layer, and removing the second portion of the poly(methyl methacrylate) lift-off layer and the functionalized layer thereon.

[0030] It should be understood that any features of the sixth aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect and / or the fourth aspect and / or the fifth aspect and / or the sixth aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, to achieve the advantages described in this disclosure including a simplified method for patterning various flow cell surfaces.

[0031] The seventh aspect disclosed in this specification is to imprint a resin layer to form a convex region, wherein the resin layer is positioned on a multilayer stack including a lift-off resist on a functionalized layer on a substrate, forming, selectively etching portions of the resin layer, the lift-off resist, and the functionalized layer to expose a portion of the substrate, whereby other portions of the lift-off resist and the functionalized layer adjacent to the convex region remain intact, exposing, and lift-off other portions of the lift-off resist.

[0032] In an example of the seventh aspect, the substrate includes a base support and an additional resin layer on the base support.

[0033] It should be understood that any features of the seventh aspect may be combined together in any desirable manner. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect and / or the fourth aspect and / or the fifth aspect and / or the sixth aspect and / or the seventh aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, it should be understood that the advantages described in this disclosure including a simplified method for patterning various flow cell surfaces can be achieved.

[0034] The eighth aspect disclosed herein is to imprint a resin to form a convex region, wherein the resin is positioned on a multilayer stack including a sacrificial layer on a substrate, forming, selectively etching a portion of the resin and the sacrificial layer around the convex region to expose a portion of the substrate, patterning a photoresist to cover the exposed portion of the substrate, exposing a second portion of the substrate under the sacrificial layer, applying a functionalized layer on the exposed second portion of the substrate, and lifting off the photoresist.

[0035] In an example of the eighth aspect, the substrate includes an additional resin layer on a base support. In this example, selectively etching further involves selectively etching using a portion of the depth of the additional resin layer to form protrusions in the additional resin layer having the shape of the convex region. In this example, selectively etching exposes the surface of the additional resin layer.

[0036] It should be understood that any features of the eighth aspect may be combined together in any desirable way. Further, any combination of features of the first aspect and / or the second aspect and / or the third aspect and / or the fourth aspect and / or the fifth aspect and / or the sixth aspect and / or the seventh aspect and / or the eighth aspect may be used together, and / or in combination with any of the examples disclosed herein, for example, it should be understood that the advantages described in the present disclosure can be achieved, including a simplified method for patterning various flow cell surfaces.

[0037] The features of the examples of the present disclosure will become apparent by referring to the following detailed description and the drawings. In the drawings, like reference numerals correspond to components that are similar but not necessarily identical. For the sake of brevity, reference numerals or features having the aforementioned functions may or may not be described in connection with the other drawings in which they appear.

Brief Description of the Drawings

[0038]

Figure 1A

Figure 1B

Figure 1C

Figure 2

Figure 3A

Figure 3B

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 5A

Figure 5B

Figure 5C

Figure 5D

Figure 5E

Figure 6A

Figure 6B

Figure 6C

Figure 7A

Figure 7B

Figure 7C

Figure 7D

Figure 7E

Figure 7F

Figure 7G

Figure 7H

Figure 7I

Figure 7J

Figure 7K

Figure 7L

Figure 7M

Figure 7N

Figure 8A

Figure 8B

Figure 8C

Figure 8D

Figure 9A

Figure 9B

Figure 9C

Figure 9D

Figure 9E

Figure 9F

Figure 10

Figure 11

Figure 12A

Figure 12B

Figure 12C

Figure 12D

Figure 12E

Figure 12F

Figure 12G

Figure 12H

Figure 13A

Figure 13B

Figure 13C

Figure 13D

Figure 13E

Figure 13F

Figure 13G

Figure 13H

Figure 14A

Figure 14B

Figure 14C

Figure 14D

Figure 14E

Figure 14F

Figure 14G

Figure 14H

Figure 14I

Figure 14J

Figure 15A

Figure 15B

Figure 15C

Figure 15D

Figure 15E

Figure 15F

Figure 15G

Figure 15H

Figure 15I

Figure 15J

Figure 15K

Figure 16A

Figure 16B

Figure 16C

Figure 16D

Figure 16E

Figure 16F

Figure 16G

Figure 16H

Figure 16I

Figure 17A

Figure 17B

DETAILED DESCRIPTION OF THE INVENTION

[0039] The examples of flow cells disclosed herein can be used for nucleic acid sequencing.

[0040] Some of the flow cells include different primer sets attached to different regions of the flow cell substrate. In these examples, the primer sets can be controlled such that the cleavage (linearization) chemistries are orthogonal in different regions. Orthogonal cleavage chemistries can be achieved by the same cleavage sites attached to different primers within different sets, or by different cleavage sites attached to different primers within different sets. Thereby, forward strand clusters can be generated in one region of the substrate, and reverse strand clusters can be generated in another region of the substrate. In one example, the regions are directly adjacent to each other. In another example, any space between the regions is small enough that clustering can span the two regions. In some of the flow cell configurations disclosed herein, the forward and reverse strands are spatially separated, which separates the fluorescence signals from both leads while enabling simultaneous basecalling for each read. Thus, some examples of the flow cells disclosed herein enable obtaining simultaneous paired-end reads. Some exemplary methods for generating these flow cells are described.

[0041] Others of the flow cells include the same primer set attached to different regions of the flow cell substrate. In these examples, the primer set includes two different primers for each region. This provides at least the advantages of: i) forward strand clusters that are generated, sequenced, and removed in each region of the substrate; and ii) reverse strand clusters that are generated, sequenced, and removed in each region of the substrate. Thus, other examples of the flow cells disclosed herein enable obtaining sequential paired-end reads. Some exemplary methods for generating these flow cells are described.

[0042] Definitions

[0043] The terms used in this specification should be understood to have their ordinary meanings in the relevant technical fields, unless otherwise specified. Some of the terms used in this specification and their meanings are described below.

[0044] The singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0045] The terms "comprising", "including", "containing", and various forms of these terms are synonymous with each other and are meant to be equally broad.

[0046] To describe the flow cell and / or various components of the flow cell, terms such as "top", "bottom", "lower", "upper", "on", etc. are used in this specification. It should be understood that these terms indicating directions do not mean to indicate a specific orientation, but rather are used to specify the relative orientation between components. The use of the terms indicating directions should not be construed as limiting the examples disclosed in this specification to any specific orientation.

[0047] Terms such as "first", "second", etc. also do not mean to indicate a specific orientation or order, but rather are used to distinguish one component from another.

[0048] The ranges provided herein are to be understood to include the recited range and any value or sub-range within the recited range as if such values or sub-ranges were expressly recited. For example, a range of from about 400 nm to about 1 μm (1000 nm) is to be interpreted to include not only the expressly recited limits of from about 400 nm to about 1 μm, but also individual values such as about 708 nm, about 945.5 mm, etc., and sub-ranges such as from about 425 nm to about 825 mm, from about 550 nm to about 940 nm, etc. Further, when “about” and / or “substantially” are utilized to describe a value, they are meant to encompass minor variations (up to ±10%) from the recited value.

[0049] An “acrylamide monomer” is a monomer having the structure

Chem.

Chem.

Chem.

[0050] An aldehyde, as used herein, is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) having a hydrogen, and a carbon atom bonded to an R group such as an alkyl or other side chain. The general structure of an aldehyde is

Chem.

[0051] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). An alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, and the like. By way of example, the notation "C1-4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0052] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain that contains one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0053] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain that contains one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0054] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent carbon atoms) that contains only carbon in the ring skeleton. When aryl is a ring system, all rings within the system are aromatic. An aryl group can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0055] The "amino" functional group refers to the -NR a R b group, wherein R a and R b are each, as defined herein, hydrogen (e.g.,

Chemical formula

[0056] As used herein, the term "attached" refers to a state in which two things are joined, fastened, adhered, connected, or coupled to each other, either directly or indirectly. For example, a nucleic acid can be attached to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of a pair of electrons between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electrons, and examples thereof include hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0057] The "azide" or "azido" functional group refers to -N3.

[0058] As used herein, the "bonding region" refers to a region of a substrate that is bonded to another material, which can be, by way of example, a spacer layer, a lid, another substrate, etc., or a combination thereof (e.g., a spacer layer and a lid, or a spacer layer and another substrate). The bond formed in the bonding region can be a chemical bond or a mechanical bond (e.g., using fasteners, etc.) as described above.

[0059] As used herein, "carbocycle" means a non-aromatic cyclic ring or ring system that contains only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged, or spiro-connected manner. The carbocycle can have any degree of saturation, provided that at least one ring within the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. The carbocycle group can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.

[0060] As used herein, the terms "carboxylic acid" or "carboxyl" as used herein refer to -COOH.

[0061] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the remainder of the molecule through two attachment points.

[0062] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, and none of the rings within the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one heteroatom in the ring skeleton and having at least one double bond, and none of the rings within the ring system are aromatic.

[0063] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, and none of the rings within the ring system are aromatic. One example is cyclooctyne. Another example is bicyclononyne. Also, as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one triple bond and having at least one heteroatom in the ring skeleton, and none of the rings within the ring system are aromatic.

[0064] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automatic and which, in some cases, results in the modification of surface properties. Generally, deposition can be carried out using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0065] As used herein, the term "recess" refers to a distinct recessed feature in a substrate having an opening in the surface that is at least partially surrounded by an interstitial region(s) of the substrate. The recess can take on any of a variety of shapes at the opening of the surface, such as, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices), etc. The cross-section of the recess taken perpendicular to the surface can be a curved shape, square, polygonal, hyperbolic, conical, angled, etc. By way of example, the recess can be a well or two interconnected wells. The recess can also have a more complex structure, such as ridges, stepped features, and the like.

[0066] As used with reference to a set of items, the term "each" is intended to identify individual items within the set, but does not necessarily refer to all items within the set. Exceptions can occur where the explicit disclosure or context clearly indicates otherwise.

[0067] As used herein, the term "epoxy" (also referred to as glycidyl or oxirane group)

Chemical formula

[0068] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can occur, an inlet for delivering reagent(s) to the flow channel, and an outlet for removing reagent(s) from the flow channel. In some examples, the flow cell corresponds to the detection of a reaction occurring within the flow cell. For example, the flow cell may include one or more transparent surfaces that enable optical detection, such as an array, optically labeled molecules, and the like.

[0069] As used herein, "flow channel" can be a region defined between two joined components that can selectively receive a liquid sample. In some examples, the flow channel may be defined between a resin and a lid of a patterned substrate, and thus may be in fluid communication with one or more recesses defined within the patterned resin. In other examples, the flow channel can be defined between two substrates, each of which has sequencing chemistry thereon.

[0070] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms, i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur in the ring backbone. When heteroaryl is a ring system, all rings within the system are aromatic. A heteroaryl group can have 5 to 18 ring members.

[0071] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged, or spiro-connected manner. Heterocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In a ring system, the heteroatom(s) can be present in either a non-aromatic ring or an aromatic ring. A heterocyclic group can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone including carbon atoms and heteroatoms). In some examples, the heteroatom(s) is O, N, or S.

[0072] The term "hydrazine" or "hydrazinyl", as used herein, refers to the -NHNH2 group.

[0073] As used herein, the term "hydrazone" or "hydrazonyl" as used herein [Chemical formula] refers to a group, in which R a and R b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle as defined herein.

[0074] As used herein, "hydroxy" or "hydroxyl" refers to the -OH group.

[0075] As used herein, the term "gap region" refers to the region of a substrate, patterned resin, or other support that separates recesses or protrusions. For example, the gap region can separate one recess of an array from another recess of the array. Two recesses or protrusions separated from each other may be distinct, i.e., they may lack physical contact with each other. In many instances, the gap region is continuous, although the recesses or protrusions are distinct, such as in the case of a plurality of recesses defined on a surface where the rest is continuous. In other instances, the gap region and the features are distinct, such as in the case of a plurality of recesses in the shape of grooves separated by their respective gap regions. The separation provided by the gap region can be partial or complete. The gap region may have a surface material different from that of the surface material of the recess or protrusion. For example, the recess may have a polymer and a first primer set therein, and the gap region may have a polymer and a second primer set thereon. For another example, the recesses of an array may have beads therein, while the gap region does not have beads thereon.

[0076] As used herein, "negative photoresist" refers to a photosensitive material in which the portions exposed to light of a particular wavelength(s) become insoluble in the developer. In these examples, the insoluble negative photoresist has a solubility of less than 5% in the developer. In a negative photoresist, light exposure changes the chemical structure such that the exposed portions of the material have lower solubility (than the unexposed portions) in the developer. The insoluble negative photoresist is not soluble in the developer, but can have a solubility of at least 95% in a remover different from the developer. The remover can be, for example, a solvent or solvent mixture used in a lift-off process.

[0077] In contrast to the insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light has a solubility of at least 95% in the developer. In some examples, the portion of the negative photoresist that is not exposed to light has a solubility of at least 98%, for example, 99%, 99.5%, 100% in the developer.

[0078] "Nitrile oxide", as used herein, means "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxide include from aldoxime by treatment with chloramide-T, or by the action of a base on imidoyl chloride [RC(Cl)=NOH], or in situ generation from the reaction between hydroxylamine and aldehyde.

[0079] "Nitrone", as used herein,

Chemical formula

[0080] As used herein, "nucleotide" contains a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. A nucleotide is a monomeric unit of a nucleic acid sequence. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group present at the 2'-position of ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) may be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to N-1 of pyrimidine or N-9 of purine. A nucleic acid analog can have a change in either the phosphate backbone, the sugar, or the nucleobase. Examples of nucleic acid analogs include universal bases or phosphate-sugar backbone analogs such as, for example, peptide nucleic acid (PNA).

[0081] In some examples, the term "over" can mean that one component or material is positioned directly over another component or material. When one is directly over the other, the two are in contact with each other. In FIG. 1A, the resin layer 18 is applied over the base substrate 22, and as a result, is directly present on and in contact with the base substrate 22.

[0082] In other examples, the term "over" can mean that one component or material is positioned indirectly over another component or material. Indirectly means that a gap or additional component or material can be positioned between the two components or materials. In FIG. 1A, the hydrophobic layer 16 is positioned over the base substrate 22, and as a result, the two are in indirect contact. More specifically, since the resin layer 18 is positioned between the two components 16 and 22, the hydrophobic layer 16 is indirectly over the base substrate 22.

[0083] "Patterned resin" refers to any polymer that may have recesses and / or protrusions defined therein. Specific examples of resins and techniques for patterning resins are further described below.

[0084] As used herein, "positive photoresist" refers to a photosensitive material in which the portions exposed to light of a particular wavelength(s) become soluble in a developer. In these examples, any portion of the positive photoresist exposed to light has a solubility of at least 95% in the developer. In some examples, the portion of the positive photoresist exposed to light has a solubility of at least 98%, such as 99%, 99.5%, 100% in the developer. In a positive photoresist, light exposure changes the chemical structure such that the exposed portions of the material are more soluble (than the unexposed portions) in the developer.

[0085] In contrast to the soluble positive photoresist, any portion of the positive photoresist not exposed to light is insoluble (less than 5% solubility) in the developer. The insoluble positive photoresist is not soluble in the developer, but may have a solubility of at least 95% in a remover different from the developer. In some examples, the insoluble positive photoresist has a solubility of at least 98%, such as 99%, 99.5%, 100% in the remover. The remover can be a solvent or solvent mixture used in a lift-off process.

[0086] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA). Some primers referred to herein as amplification primers function as starting points for template amplification and cluster generation. Other primers referred to herein as sequencing primers function as starting points for DNA or RNA synthesis. The 5'-end of the primer may be modified to enable a coupling reaction with a functional group of the polymer. The length of the primer can be of any number of bases and can include various unnatural nucleotides. In one example, the sequencing primer is a short strand in the range of 10 to 60 bases, or 20 to 40 bases.

[0087] "Spacer layer", as used herein, refers to a material that binds two components together. In some examples, the spacer layer can be a radiation-absorbing material that aids in binding, or can be contacted with a radiation-absorbing material that aids in binding.

[0088] The term "substrate" refers to a structure onto which various components of a flow cell (e.g., polymers, primers, etc.) can be added. The substrate can be a wafer, panel, rectangular sheet, die, or any other suitable configuration. The substrate is generally rigid and hard and insoluble in aqueous liquids. The substrate may be inert to the chemical substances used to modify the recesses or the chemical substances present in the recesses. For example, the substrate may be inert to the chemical substances used to form polymers, such as for attaching primers, etc. The substrate may be a single-layer structure (e.g., a base support), or may be a multi-layer structure (e.g., including a base support and one or more layers on the base support). Examples of suitable substrates are further described below.

[0089] The "thiol" functional group refers to -SH.

[0090] As used herein, the terms "tetrazine" and "tetrazinyl" refer to 6-membered heteroaryl groups containing 4 nitrogen atoms. Tetrazine may optionally be substituted.

[0091] "Tetrazole", as used herein, refers to a 5-membered heterocyclic group containing 4 nitrogen atoms. Tetrazole may optionally be substituted.

[0092] The term "transparent", when referring to a base support or layer, refers to a material in the form of a substrate or layer that is transparent to, for example, a specific wavelength or wavelength range. For example, the material may be transparent to the wavelength(s) used to chemically alter a positive or negative photoresist. Transparency can be quantified using the transmittance, i.e., the ratio of the light energy transmitted through an object to the light energy incident on the object. The transmittance of a transparent base support or transparent layer depends on the thickness of the base support or layer and the wavelength of the light. In the examples disclosed herein, the transmittance of a transparent base support or transparent layer can range from 0.25 (25%) to 1 (100%). The material of the base support or layer can be a pure material, a material having some impurities, or a mixture of materials, as long as the resulting base support or layer allows the desired transmittance. Additionally, depending on the transmittance of the base support or layer, the exposure time of light and / or the output power of the light source can be increased or decreased to deliver a suitable dose of light energy through the transparent base support and / or layer to achieve the desired effect (e.g., producing a soluble or insoluble photoresist).

[0093] Methods and flow cells for sequential paired-end sequencing

[0094] One example of a flow cell for sequential paired-end sequencing generally includes a substrate, a functionalized layer on at least a portion of the substrate, and a primer set attached to the functionalized layer. The configuration of the various components of the flow cell can vary in part depending on the method used to produce the flow cell. Here, some exemplary methods will be described.

[0095] FIGS. 1A - 1C each show an example of a method for fabricating a flow cell 10A. This exemplary method includes defining a recess 12 in a multilayer stack 14 including a hydrophobic layer 16 on a resin layer 18 by imprinting and etching the hydrophobic layer 16, and applying a functionalized layer 20 to at least one region of the recess 12.

[0096] In the example shown in FIG. 1A, the multilayer stack 14 is positioned on a base support 22. Examples of suitable materials for the base support include epoxy siloxane, glass and modified or functionalized glass, plastics (acrylic, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® manufactured by Chemours), cyclic olefin / cycloolefin polymer (COP) (such as ZEONOR® manufactured by Zeon), polyimide, etc.), nylon, ceramic / ceramic oxide, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped P+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5), or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc. The base support 22 may also be a multilayer structure. Some examples of multilayer structures include glass or silicon having a coating layer of tantalum oxide or another ceramic oxide on its surface. Still other examples of multilayer structures may include a silicon-on-insulator (SOI) substrate.

[0097] In one example, the base support 22 can have a rectangular sheet or panel with a diameter in the range of about 2 mm to about 300 mm, or a maximum dimension of up to about 10 feet (about 3 meters). In one example, the base support 22 is a wafer having a diameter in the range of about 200 mm to about 300 mm. In another example, the substrate is a die having a width in the range of about 0.1 mm to about 10 mm. Although exemplary dimensions are provided, it should be understood that a base support 22 having any suitable dimensions can be used. For another example, a panel, which is a rectangular support having a larger surface area than a 300 mm round wafer, can be used.

[0098] The resin layer 18 is deposited on the base support 22 using any suitable deposition technique, including the examples disclosed herein, and can be cured using conditions suitable for the resin. Some examples of suitable resins are selected from the group consisting of polyhedral oligomeric silsesquioxane resin (POSS) - based resins, epoxy resins, poly (ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof. Although some examples are provided, it is contemplated that any resin that can be cured can be used.

[0099] As used herein, the term "polyhedral oligomeric silsesquioxane" (commercially available as POSS® from HybridPlastics) refers to a chemical composition that is a hybrid intermediate between silica (SiO2) and silicone (R2SiO) (e.g., RSiO 1.5 )). One example of a polyhedral oligomeric silsesquioxane can be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pages 776 - 778, which is incorporated by reference in its entirety. In one example, the composition has the chemical formula [RSiO 3 / 2 n ​It is an organosilicon compound having, wherein the R groups may be the same or different. Exemplary R groups of polyhedral oligomeric silsesquioxane include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin compositions disclosed herein may include one or more different cage or core structures as monomer units. The polyhedral structure is [Chemical formula] It can be a T8 structure such as [Chemical formula] It is represented by. This monomer unit typically has eight arms of functional groups R1 to R8.

[0100] The monomer unit is [Chemical formula] such as T 10 It can have a cage structure having ten silicon atoms and ten R groups called, or [Chemical formula] such as T 12 It can have a cage structure having twelve silicon atoms and twelve R groups called. Polyhedral oligomeric silsesquioxane-based materials can alternatively include T6, T 14 , or T 16 cage structures. The average cage content can be adjusted during synthesis and / or controlled by purification methods, and a wide distribution of monomer unit(s) cage sizes can be used in the examples disclosed herein.

[0101] In some of the examples disclosed herein, R1 to R8 or R 10 or R 12At least one of them contains epoxy. R1 to R8 or R 10 or R 12 may or may not be the same. In some examples, R1 to R8 or R 10 or R 12 at least one of them contains epoxy, and at least one of the other of R1 to R8 or R 10 or R 12 is a non-epoxy functional group. The non-epoxy functional group is a reactive group that reacts orthogonally to the epoxy group (i.e., reacts under conditions different from those of the epoxy group), that is, a reactive group that can function as a handle for coupling the resin to an amplification primer, a polymer, or a polymerizing agent, or (b) a group that adjusts the mechanical or functional properties of the resin, such as surface energy adjustment. In some examples, the non-epoxy functional group is selected from the group consisting of azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, amino, hydroxyl, alkynyl, ketone, aldehyde, ester group, alkyl, aryl, alkoxy, and haloalkyl.

[0102] Depending on the resin layer 18 used, the resin layer 18 can be activated using silanization or plasma ashing to generate surface groups, which can subsequently react with the functionalized layer 20 deposited thereon (see FIG. 1C).

[0103] Silylation can be achieved using any silane or silane derivative. The choice of silane or silane derivative may depend in part on the functionalized layer 20 being formed, as it may be desirable to form a covalent bond between the silane or silane derivative and the functionalized layer 20. Some exemplary silane derivatives include unsaturated portions of cycloalkenes such as norbornene, norbornene derivatives (e.g., (hetero)norbornene containing oxygen or nitrogen in place of one of the carbon atoms), trans-cyclooctene, trans-cyclooctene derivatives, trans-cyclopentene, trans-cycloheptene, trans-cyclononene, bicyclo[3.3.1]nona-1-ene, bicyclo[4.3.1]deca-1(9)-ene, bicyclo[4.2.1]nona-1(8)-ene, and bicyclo[4.2.1]nona-1-ene. Any of these cycloalkenes can be substituted with an R group such as, for example, hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heterocycloaliphatic, aralkyl, or (heterocycloaliphatic)alkyl. An example of a norbornene derivative is [(5-bicyclo[2.2.1]hepta-2-enyl)ethyl]trimethoxysilane. Other exemplary silane derivatives include unsaturated portions of cycloalkynes such as cyclooctyne, cyclooctyne derivatives, or bicyclononine (e.g., bicyclo[6.1.0]nona-4-yne or its derivatives, bicyclo[6.1.0]nona-2-yne, or bicyclo[6.1.0]nona-3-yne). These cycloalkynes can be substituted with any of the R groups described herein.

[0104] The method used to attach the silane or silane derivative can vary depending on the silane or silane derivative used. Examples of suitable silylation methods include vapor deposition (e.g., the YES method), spin coating, or other deposition methods.

[0105] In other examples, the resin layer 18 may be activated using plasma ashing rather than silanization. Plasma ashing may generate surface activating substance(s) (e.g., hydroxyl (C-OH or Si-OH) and / or carboxyl groups), which can subsequently adhere the deposited functionalized layer 20 to the resin layer 18 exposed in the recess 12. In these examples, the functionalized layer 20 is selected to react with the surface groups generated by plasma ashing.

[0106] The hydrophobic layer 16 may be deposited on the resin layer 18 using any suitable deposition technique including the examples disclosed herein.

[0107] Examples of the hydrophobic layer 16 may be selected from the group consisting of fluorinated polymers, perfluorinated polymers, silicon polymers, and mixtures thereof. By way of example, the hydrophobic layer 16 may be an amorphous fluoropolymer (commercial examples of which include those in the CYTOP® series manufactured by AGC Chemicals having one of the following end functional groups: A type: -COOH, M type: -CONH-Si(OR) n or S type: -CF3), polytetrafluoroethylene (commercial examples of which include TEFLON® manufactured by Chemours, parylene, fluorinated hydrocarbons, and fluoroacrylic copolymers (commercial examples of which include those as FLUOROPEL® manufactured by Cytonix).

[0108] The hydrophobic layer 16 is then imprinted (FIG. 1A) and etched (FIG. 1B) to form the recess 12. Thus, in this example, the recess 12 is defined in the hydrophobic layer 16. As shown in FIG. 1B, the bottom of the recess 12 is defined by the resin layer 18 and the wall of the recess 12 is defined by the hydrophobic layer 16. Although a single recess 12 is shown in FIGS. 1A-1C, several recesses 12 may be formed and it should be understood that each recess 12 is isolated from each other by the gap region 26 of the hydrophobic layer 16 (see FIG. 2B).

[0109] In this exemplary method, imprinting is performed using a portion of the depth of the hydrophobic layer 16; etching removes the remaining portion of the depth of the hydrophobic layer 16, and the resin layer 18 acts as an etch stop.

[0110] The hydrophobic layer 16 can be imprinted using nanoimprint lithography. A nanoimprint lithography mold or working stamp 24 (FIG. 1A) is pressed into the hydrophobic layer 16 while the hydrophobic layer 16 is soft, creating an imprint of the working stamp features in the hydrophobic layer 16. The hydrophobic layer 16 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation such as visible light or ultraviolet (UV) light if a radiation-curable hydrophobic material is used, or by exposure to heat if a thermosetting hydrophobic material is used. Curing can promote polymerization and / or crosslinking. As an example, curing can include multiple steps including soft bake (e.g., to remove solvent(s)) and hard bake. The soft bake can be performed at a lower temperature in the range of about 50° C. to about 150° C. The duration of the hard bake can be continued for about 5 seconds to about 10 minutes at a temperature in the range of about 100° C. to about 300° C. Examples of equipment that can be used for soft baking and / or hard baking include a hot plate, an oven, and the like.

[0111] After curing, the working stamp 24 is removed. This creates topographical features in the hydrophobic layer 16. In this exemplary method, since the working stamp 24 does not extend through the entire depth of the hydrophobic layer 16, partial recesses 12' are formed after the imprinting process. As shown in FIG. 1A, the hydrophobic layer portion 16' remains in the partial recesses 12'.

[0112] Next, the hydrophobic layer 16 can be etched to remove the remaining hydrophobic layer portion 16' from the partial recess 12'. Any exposed area of the hydrophobic layer 16 can be etched during this process, as indicated by the downward arrow in FIG. 1B. Thus, the region of the hydrophobic layer 16 that defines the gap region 26 can be etched in addition to the hydrophobic layer portion 16'. However, the hydrophobic layer 16 and the resin layer 18 have different etching rates, and thus, when the hydrophobic layer portion 16' is removed, the resin layer 18 acts as a stop for the etching of the partial recess 12'. Etching can be stopped when the resin layer 18 is exposed. This forms the recess 12. For this etching process, plasma etching with air or oxygen (O2) gas can be used. In another example, dry etching with oxygen (O2) gas can be used.

[0113] Although FIGS. 1A - 1C show the formation of a single recess 12, it should be understood that an array of recesses 12 may be formed, for example, along the lanes of the flow cell 10A. FIG. 2A illustrates, for example, a top view of the flow cell 10A, without including a lid or other substrate coupled thereto, and includes eight lanes 28. FIG. 2B illustrates a cross-sectional perspective view of an array of recesses 12 formed in one lane 28.

[0114] Many different layouts of the array of recesses 12 can be envisioned, including regular, repetitive, and irregular patterns. In one example, the recesses 12 are arranged in a hexagonal grid for dense packing and improved density. Other layouts can include, for example, a linear (rectangular) layout, a triangular layout, etc. In some examples, the layout or pattern can be an x - y configuration of recesses 12 forming rows and columns. In some other examples, the layout or pattern can be a repetitive arrangement of recesses 12 and / or gap regions 26. In yet other examples, the layout or pattern can be a random arrangement of recesses 12 and / or gap regions 26. The pattern can include spots, stripes, spirals, lines, triangles, rectangles, circles, arcs, checks, grid lines, diagonals, arrows, squares, and / or cross - hatching.

[0115] The layout or pattern of the recesses 12 can be characterized in terms of the density of the recesses 12 (the number of recesses 12) within a specified area. For example, the recesses 12 may be present at a density of about two million per 1 mm 2 or so. The density can be, for example, approximately 100 per 1 mm 2 or so, 1,000 per 1 mm 2 or so, 100,000 per 1 mm 2 or so, 1 million per 1 mm 2 or so, 2 million per 1 mm 2 or so, 5 million per 1 mm 2 or so, 10 million per 1 mm 2 or so, and can be adjusted to various densities including up to about 50 million per 1 mm 2 It should be further understood that the density of the recesses 12 in the hydrophobic layer 16 (or other layers described herein) may be between one of the lower values selected from the above ranges and one of the higher values. By way of example, a high-density array can be characterized as having recesses 12 spaced less than about 100 nm apart, a medium-density array can be characterized as having recesses 12 spaced from about 400 nm to about 1 μm apart, and a low-density array can be characterized as having recesses 12 spaced greater than about 1 μm apart. Although exemplary densities are provided, it should be understood that any suitable density can be used. The density of the recesses 12 can depend in part on the depth of the recesses 12. In some cases, it may be desirable for the spacing between the recesses 12 to be even greater than the examples listed herein.

[0116] The layout or pattern of the recesses 12 may further or alternatively be characterized in terms of an average pitch, or the distance between the centers of adjacent recesses 12 (center-to-center distance) or the distance between the left end of one recess 12 and the right end of the adjacent recess 12 (end-to-end distance). The pattern may be regular such that the coefficient of variation around the average pitch is small, or it may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, approximately about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm. The average pitch of a particular pattern of recesses 12 may be between one of the lower values selected from the above ranges and one of the higher values. In one example, the recesses 12 have a pitch (center-to-center distance) of about 1.5 μm. Although exemplary average pitch values are provided, it should be understood that other average pitch values may be used.

[0117] The size of each recess 12 can be characterized by its volume, opening area, depth, and / or diameter.

[0118] Each recess 12 can have any volume that can confine a fluid. The minimum or maximum volume can be selected, for example, to correspond to the throughput (e.g., multiplicity), resolution, labeled nucleotides, or reactivity of the analyte expected for use downstream of the flow cell 10A. For example, the volume can be at least about 1×10 -3 μm 3 , at least about 1×10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 or a volume greater than that. Alternatively or in addition, the volume can be up to about 1×10 4 μm 3 , up to about 1×10 3 μm 3 , up to about 100 μm 3 , up to about 10 μm3 , and can be a volume of at most about 1 μm 3 , at most about 0.1 μm 3 , or less.

[0119] The area occupied by the opening of each recess can be selected based on the same criteria as the above volume. For example, the area of the opening of each recess is at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 , or an area greater than that. Alternatively or in addition, the area can be at most about 1×10 3 μm 2 , at most about 100 μm 2 , at most about 10 μm 2 , at most about 1 μm 2 , at most about 0.1 μm 2 , at most about 1×10 -2 μm 2 , or less. The area occupied by the opening of each recess can be greater than, less than, or between the above values.

[0120] The depth of each recess 12 can be large enough to accommodate some of the functionalized layer 20. In one example, the depth can be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or greater. Alternatively or in addition, the depth can be at most about 1×10 3 μm, at most about 100 μm, at most about 10 μm, or less. In some examples, the depth is about 0.4 μm. The depth of each recess 12 can be greater than, less than, or between the values shown above.

[0121] In some cases, the diameter or length and width of each recess 12 can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or a length greater than that. Alternatively or in addition, the diameter or length and width can be at most about 1×10 3 μm, at most about 100 μm, at most about 10 μm, at most about 1 μm, at most about 0.5 μm, at most about 0.1 μm, or less than that (e.g., about 50 nm). In some examples, each of the diameter, or length and width, is about 0.4 μm. The diameter or length and width of each recess 12 can be greater than, less than, or between the values shown above.

[0122] Referring again to FIG. 1C, after the hydrophobic layer 16 is imprinted and etched to form the recess(es) 12, the functionalized layer 20 can be deposited.

[0123] The functionalized layer 20 can be any gel material that can swell when a liquid is absorbed and contract, for example, when the liquid is removed by drying. In one example, the gel material is a polymeric hydrogel. In one example, the polymeric hydrogel includes acrylamide copolymers, such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, PAZAM. PAZAM and some other forms of acrylamide copolymers have the following structure (I): [Chemical formula] (wherein, R A is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl; R C 、RD and R E is each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p each of - may be optionally substituted; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; m is an integer in the range of 1 to 100,000).

[0124] One of ordinary skill in the art will recognize that the arrangement of the "n" and "m" features repeated in Structure (I) is representative, and that the monomeric subunits can be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0125] The molecular weight of PAZAM and other forms of acrylamide copolymers can range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0126] In some examples, PAZAM and other forms of acrylamide copolymers are linear polymers. In some other examples, PAZAM and other forms of acrylamide copolymers are lightly cross-linked polymers.

[0127] In other examples, the first high molecular weight hydrogel may be a modification of Structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide

Chemical formula

Chemical formula

[0128] As another example of the polymer hydrogel, the repeating "n" features in structure (I) are structure (II): [Chemical formula] (where R 1 is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker containing 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and a linear chain having 10 optional substituents on the carbon and any nitrogen atoms in the chain, E is a linear chain containing 1 to 4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain, A is an N-substituted amide in which H or C1-C4 alkyl is bonded to N, and Z is a nitrogen-containing heterocycle) can be replaced with a monomer containing a heterocyclic azide group. Examples of Z include 5- to 10-carbon-containing ring members existing as a monocyclic structure or a condensed structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0129] As yet another example, the first polymer hydrogel has structures (III) and (IV), [Chemical formula] (wherein R 1a ), R 2a ), R 1b ), and R 2b are each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl, and R 3a and R 3b are each independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl, and L 1 and L 2 may each independently include a repeating unit of (optionally substituted alkylene linker or optionally substituted heteroalkylene linker).

[0130] It should be understood that other molecules may be used to form the functionalized layer 20 as long as other molecules are functionalized and oligonucleotide primers are grafted thereto. Other examples of suitable functionalized layers include colloidal structures such as agarose, or polymer mesh structures such as gelatin, or crosslinked polymer structures, for example, those having polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-decomposed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing a vinyl group, or from monomers that form [2+2] photocycloaddition reactants. Still other examples of suitable first polymer hydrogels include mixed copolymers of acrylamide and acrylate. In the examples disclosed herein, various polymer structures including acrylic monomers (e.g., acrylamide, acrylate, etc.) can be utilized, such as branched polymers including star polymers, star or star-shaped block polymers, dendrimers, etc. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) may be incorporated into the branches (arms) of the star polymer either randomly or in blocks.

[0131] The gel material of the functionalized layer 20 can be formed using any suitable copolymerization process. The functionalized layer 20 can also be deposited using any of the methods disclosed herein.

[0132] The attachment of the functionalized layer 20 to the activated (e.g., silanized or plasma ashed) surface of the resin layer 18 can be by covalent bond. The covalent bond serves to maintain the primer set 30 (FIG. 2B) within the recess 12 over the life of the formed flow cell 10A during various uses. In contrast, the functionalized layer 20 does not attach (e.g., covalently) to the hydrophobic layer 16. Rather, the hydrophobic nature of the hydrophobic layer 16 repels the gel material of the functionalized layer 20 and thus does not deposit or is loosely applied over the gap region 26. Due to the different interactions in the recess 12 and the gap region 26, the functionalized layer 20 remains within the recess 12 and can be easily removed from the gap region 26 (e.g., via sonication, washing, wiping, etc.).

[0133] In an exemplary flow cell 10A, the primer set 30 is grafted to the functionalized layer 20 in each of the recesses 12. This exemplary primer set 30 includes two different primers 32, 34. The primers 32, 34 are desirably immobilized to the functionalized layer 20. In some examples, the immobilization can be by a single-point covalent bond to the functionalized layer 20 at the 5' end of each of the respective primers 32, 34. Any suitable covalent bonding means known in the art can be used. In some examples, the immobilization can be by strong non-covalent bonds.

[0134] Examples of terminal primers that can be used include alkyne - terminal primers, tetrazine - terminal primers, azide - terminal primers, amino - terminal primers, epoxy or glycidyl - terminal primers, thiophosphate - terminal primers, thiol - terminal primers, aldehyde - terminal primers, hydrazine - terminal primers, phosphoramidite - terminal primers, triazolinedione - terminal primers, and biotin - terminal primers. In some specific examples, succinimidyl (NHS) ester - terminal primers can react with amines on the surface of the functionalized layer 20, aldehyde - terminal primers can react with hydrazines on the surface of the functionalized layer 20, or alkyne - terminal primers can react with azides on the surface of the functionalized layer 20, or azide - terminal primers can react with alkynes or DBCO (dibenzocyclooctyne) on the surface of the functionalized layer 20, or amino - terminal primers can react with activated carboxylate groups or NHS esters on the surface of the functionalized layer 20, or thiol - terminal primers can react with alkylating reactants (e.g., iodoacetamide or maleimide) on the surface of the functionalized layer 20, phosphoramidite - terminal primers can react with thioethers on the surface of the functionalized layer 20, or biotin - modified primers can react with streptavidin on the surface of the functionalized layer 20.

[0135] Each of primers 32, 34 has a universal sequence for the purpose of capture and / or amplification. Examples of primers 32, 34 include P5 and P7 primers, and these examples are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HISEQ (trademark), HISEQX (trademark), MISEQ (trademark), MISEQDX (trademark), MINISEQ (trademark), NEXTSEQ (trademark), NEXTSEQDX (trademark), NOVASEQ (trademark), ISEQ (trademark), GENOME ANALYZER (trademark) and other instrument platforms. In one example, the P5 and P7 primers include: P5: 5’→3’ AATGATACGGCGACCACCGA (SEQ ID NO: 1) P7: 5’→3’ CAAGCAGAAGACGGCATACGA (SEQ ID NO: 2)

[0136] For successive paired-end sequencing, each of these primers 32, 34 may also contain a cleavage site. The cleavage sites of primers 32, 34 may be different from each other so that the cleavage of primers 32, 34 does not occur simultaneously. Examples of suitable cleavage sites include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases). Enzymatically cleavable nucleobases may be susceptible to cleavage by reaction with glycosylase and endonuclease, or exonuclease. One specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted by the USER enzyme. In one example, the uracil base can be incorporated at the seventh position from the 3' end of the P5 primer (P5U) or the P7 primer (P7U). Other abasic sites can also be used. Examples of chemically cleavable nucleobases, modified nucleobases, or linkers include 8-oxoguanine, vicinal diol, disulfide, silane, azobenzene, photocleavable groups, allyl T (a thymine nucleotide analog having an allyl functional group), allyl ether, or azide-functionalized ether.

[0137] The primer set 30 may be pre-grafted to the gel material (of the functionalized layer 20) and thus may be present in the recess 12 when the functionalized layer 20 is applied.

[0138] In other examples, primers 32, 34 are not pregrafted to the functionalized layer 20. In these examples, primers 32, 34 can be grafted after the functionalized layer 20 is applied. The grafting can be achieved by flow-through deposition (e.g., using a temporarily attached lid), dunk coating, spray coating, puddle dispensing, or another suitable method of attaching primers 32, 34 to the functionalized layer 20. Each of these exemplary techniques can utilize a primer solution or mixture that can include primers 32, 34, water, buffer, and a catalyst. Regardless of the grafting method, primers 32, 34 attach to the reactive groups of the functionalized layer 20 and have no affinity for the hydrophobic layer 16.

[0139] Referring now to FIGS. 3A and 3B, another example of a method for fabricating the flow cell 10B is illustrated. This exemplary method includes defining a recess 12 in a multilayer stack 14 that includes a hydrophobic layer 16 on a resin layer 18 by using the depth (or thickness) of the hydrophobic layer 16 and a portion of the depth (or thickness) of the resin layer 18, and applying a functionalized layer 20 to at least one region of the recess 12.

[0140] In the example shown in FIG. 3A, the multilayer stack 14 is positioned on a base support 22. Any example of the base support 22, resin layer 18, and hydrophobic layer 16 described herein can be used in this example.

[0141] The resin layer 18 can be deposited on the base support 22 using any suitable deposition technique, including the examples disclosed herein. However, unlike the examples of FIGS. 1A - 1C, the resin layer 18 is not yet cured. Rather, the hydrophobic layer 16 is deposited on the resin layer 18 using any suitable deposition technique.

[0142] Next, as shown in FIG. 3A, the hydrophobic layer 16 and the resin layer 18 are imprinted to form the recess 12. In this exemplary method, the imprinting is performed using the entire depth (or thickness) of the hydrophobic layer 16 and a portion of the depth (or thickness) of the resin layer 18. As shown in FIG. 3A, the working stamp 24 is pressed into the hydrophobic layer 16 and the resin layer 18 while they are soft, creating an imprint of the working stamp features in the layers 16, 18. The imprinting displaces some of the hydrophobic material and the resin material, but the two materials do not mix. This ensures that the resin layer 18 is at the bottom surface of the recess 12.

[0143] Next, the hydrophobic and resin layers 16, 18 can be cured with the working stamp 24 in a predetermined position. The curing can be performed as described herein using conditions suitable for both the hydrophobic and resin layers 16, 18.

[0144] After curing, the working stamp 24 is removed. This creates topographic features in the hydrophobic and resin layers 16, 18. More specifically, in this example, the recess 12 is defined in a portion of the hydrophobic layer 16 and the resin layer 18. As shown in FIG. 3A, the bottom of the recess 12 is defined by the resin layer 18, and the walls of the recess 12 are defined by the hydrophobic layer 16 and the resin layer 18. Although a single recess 12 is shown in FIGS. 3A - 3C, it should be understood that several recesses 12 may be formed, and each recess 12 is isolated from each other by the gap region 26 of the hydrophobic layer 16 (similar to the example shown in FIG. 2B).

[0145] In this exemplary method, the exposed resin layer 18 can be activated using silanization or plasma ashing. It is desirable that the subsequently applied functionalized layer 20 adheres to the exposed resin layer 18 and does not adhere to the hydrophobic layer 16. Thus, any plasma ashing used in this exemplary method activates the exposed resin layer 18 but does not activate the hydrophobic layer 16.

[0146] Next, the functionalized layer 20 and the primer set 30 can be applied using any of the examples described herein.

[0147] Referring now to FIGS. 4A-4D, another example of a method for fabricating the flow cell 10C is illustrated. This exemplary method defines the recess 12 in the multilayer stack 14 including the additional resin layer 38 on the lift-off resist 36 on the hydrophobic layer 16 over the (first) resin layer 18 by imprinting using the depth (or thickness) of the hydrophobic layer 16, and applies the functionalized layer 20 to at least one region of the recess 12.

[0148] Any of the examples of the base support 22, the resin layer 18, and the hydrophobic layer 16 described herein can be used in the example shown in FIG. 4A.

[0149] In this example, the resin layer 18 can be deposited, cured, and activated (e.g., via silanization or plasma ashing) on the base support 22 as described herein. Next, the hydrophobic layer 16 can be deposited and cured on the resin layer 18.

[0150] Next, the lift-off resist 36 can be applied to the hydrophobic layer 16. Examples of suitable lift-off resists 36 include those commercially available from Kayaku Advanced Materials, Inc. (formerly MicroChem), which are based on a polymethylglutarimide platform. The lift-off resist 36 can be spin-on or otherwise deposited, cured, and subsequently removed at a desired time in the process (see FIG. 4D).

[0151] Next, the additional resin layer 38 can be applied to the lift-off resist 36. The additional resin layer 38 can be any of the examples described herein for the resin layer 18. The additional resin layer 38 can also be deposited using any suitable deposition technique.

[0152] Next, an additional resin layer 38 is imprinted to form a concave region 40 in the additional resin layer 38. As shown in FIG. 4A, the working stamp 24 is pressed into the additional resin layer 38 while the additional resin layer 38 is soft, creating an imprint of the working stamp features in the additional resin layer 38. The additional resin layer 38 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat as described herein.

[0153] After curing, the working stamp 24 is removed. This creates topographic features in the additional resin layer 38. In this exemplary method, since the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, a portion 38' of the additional resin layer 38 forms the bottom of the concave region 40.

[0154] The concave region 40 is then extended to the surface of the resin layer 18 by selectively etching a portion of the additional resin layer portion 38', a portion of the lift-off resist 36, and a portion of the hydrophobic layer 16. Each of these layers 38 and 36 is selected to have a different etching rate, and thus, when etching a layer directly applied thereon, one layer can act as an etch stop (e.g., the lift-off resist 36 acts as an etch stop when etching the additional resin layer 38). Layers 36 and 16 can have the same etching rate, which can be etched using the same technique. The underlying resin layer 18 can act as an etch stop for the technique used to etch layers 36 and 16.

[0155] For the additional resin layer 38, etching can be performed using anisotropic oxygen plasma or using 90% CF4 and 10% O2. Any exposed area of the additional resin layer 38 can be etched during this process, as indicated by the downward arrow in FIG. 4B. However, the lift-off resist 36 acts as a stop for the etching of the concave region 40 when the additional resin layer portion 38' is removed. This first etching process can be stopped when the lift-off resist 36 is exposed to the concave region 40.

[0156] For the portion of the lift-off resist 36 adjacent to the concave region 40, 100% O2 plasma etching can be used. Any area of the lift-off resist 36 exposed to the concave region can be etched during this process, as indicated by the downward arrow in FIG. 4B. This etching process also removes the portion of the hydrophobic layer 16 adjacent to the concave region 40. Alternatively, plasma etching with air or dry etching with oxygen (O2) gas can be used to remove the portion of the hydrophobic layer 16. Any area of the hydrophobic layer 16 exposed to the concave region can be etched during this process, as indicated by the downward arrow in the center of FIG. 4B. The resin layer 18 acts as a stop for the etching of the concave region 40 when the hydrophobic layer portion is removed.

[0157] As shown in FIG. 4B, the additional resin layer 38, the lift-off resist 36, and other portions of the hydrophobic layer 16 adjacent to the concave region 40 remain intact after various etching processes are performed.

[0158] Next, as shown in FIG. 4C, using any of the examples described herein, the functionalized layer 20 can be applied. In this example, the functionalized layer 20 is deposited on the resin layer 18 of the concave region 40 and on the remaining additional resin layer 38.

[0159] Next, lift-off of the remaining lift-off resin 36 can be performed. As shown in FIG. 4D, the lift-off process removes, for example, at least 99% of the additional resin layer 38 and the functionalized layer 20 overlapping on the remaining lift-off resin 36. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper. Next, the remaining hydrophobic layer 16 is exposed, and the recess 12 is formed. The functionalized layer 20 remains intact within the recess 12.

[0160] Although not shown in FIGS. 4A-4D, in this example, it should be understood that the primer set 30 (FIG. 2B) may be pre-grafted to the functionalized layer 20, or grafted after application of the functionalized layer (FIG. 4C), or grafted after lift-off and formation of the recess 12 (FIG. 4D). When applied after lift-off, the primers 32, 34 (FIG. 2B) of the primer set 30 have no affinity for the hydrophobic layer 16 and thus selectively graft to the functionalized layer 20 within the recess 12.

[0161] Although FIGS. 4A-4D show the formation of a single recess 12, it should be understood that an array of recesses 12 can be formed, for example, with each recess 12 isolated from each other by the gap region 26 of the hydrophobic layer 16 (similar to the example shown in FIG. 2B).

[0162] Referring now to FIGS. 5A-5E, another example of a method for fabricating the flow cell 10D is illustrated. This exemplary method utilizes a multilayer stack 14 on a base support 22, and the multilayer stack 14 includes a resin layer 18, a poly(methyl methacrylate) lift-off layer 42, and an additional resin layer 38.

[0163] Any example of the base support 22 and the resin layer 18 described herein can be used in the example shown in FIG. 5A.

[0164] In this example, the resin layer 18 can be deposited, cured, and activated (e.g., via silanization or plasma ashing) on the base support 22 as described herein.

[0165] Next, the poly(methyl methacrylate) lift-off layer 42 can be deposited on the resin layer 18 using any suitable technique and cured using heat. The poly(methyl methacrylate) lift-off layer 42 is a layer of poly(methyl methacrylate). Although this exemplary method is described with respect to the poly(methyl methacrylate) lift-off layer 42, it should be understood that this layer can be another type of lift-off resist. Any of the exemplary lift-off resists for layer 36 can be used in place of the poly(methyl methacrylate) lift-off layer 42.

[0166] Next, an additional resin layer 38 can be applied to the poly(methyl methacrylate) lift-off layer 42. The additional resin layer 38 can be any of the examples described herein for the resin layer 18. The additional resin layer 38 can also be deposited using any suitable deposition technique.

[0167] Next, the additional resin layer 38 is imprinted to form a concave region 40 in the additional resin layer 38. As shown in FIG. 5A, the working stamp 24 is pressed into the additional resin layer 38 while the additional resin layer 38 is soft, creating an imprint of the working stamp features in the additional resin layer 38. The additional resin layer 38 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat as described herein.

[0168] After curing, the working stamp 24 is removed. This creates a topographical feature in the additional resin layer 38. In this exemplary method, since the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, a portion 38' of the additional resin layer 38 forms the bottom of the concave region 40.

[0169] Next, the concave region 40 is extended to the surface of the resin layer 18 by selectively etching an additional resin layer portion 38' and a portion of the poly(methyl methacrylate) lift-off layer 42. Each of these layers 38 and 42 is selected to have a different etching rate, and thus, when etching the additional resin layer 38, the poly(methyl methacrylate) lift-off layer 42 acts as an etching stop.

[0170] For the additional resin layer 38, etching can be performed using anisotropic oxygen plasma. Any exposed region of the additional resin layer 38 can be etched during this process, as indicated by the downward arrow in FIG. 5B. As described above, the poly(methyl methacrylate) lift-off layer 42 acts as an etching stop for the concave region 40 when the additional resin layer portion 38' is removed. This first etching process can be stopped when the poly(methyl methacrylate) lift-off layer 42 is exposed to the concave region 40.

[0171] For the portion of the poly(methyl methacrylate) lift-off layer 42 adjacent to the concave region 40, reactive ion etching (e.g., O2 or O2 / CHF3) or CF4 / O2 plasma etching or 100% O2 plasma etching can be used. Any region of the poly(methyl methacrylate) lift-off layer 42 exposed to the concave region 40 can be etched during this process, as indicated by the downward arrow in FIG. 5B. The resin layer 18 acts as an etching stop for the concave region 40 when the poly(methyl methacrylate) lift-off layer 42 is removed.

[0172] As illustrated in FIG. 5B, the other portions of the additional resin layer 38 and the poly(methyl methacrylate) lift-off layer 42 adjacent to the concave region 40 remain intact after various etching processes are performed.

[0173] Next, this exemplary method involves simultaneously etching the additional resin layer 38 and the resin layer 18 exposed in the concave region 40. Thus, in this example, the additional resin layer 38 and the resin layer 18 can be of the same material or different materials having the same etching rate. As shown in FIG. 5C, the layers 38, 18 can be etched until the additional resin layer 38 is removed. The poly(methyl methacrylate) lift-off layer 42 functions as an etching stop for the etching process. As shown in FIG. 5C, a portion of the resin layer 18 is removed to form the recess 12 in the resin layer 18. The resin layers 38, 18 can be etched using anisotropic oxygen plasma or using 90% CF4 and 10% O2.

[0174] In an alternative method, the additional resin layer 38 and the resin layer 18 can have different etching rates. In this example, the additional resin layer 38 can be etched to expose the underlying poly(methyl methacrylate) lift-off layer 42, and then the resin layer 18 can be etched to form the recess 12.

[0175] Next, as shown in FIG. 5D, using any of the examples described herein, the functionalized layer 20 can be applied. In this example, the functionalized layer 20 is deposited on the resin layer 18 within the recess 12 and on the remaining poly(methyl methacrylate) lift-off layer 42.

[0176] Next, lift-off of the remaining poly(methyl methacrylate) lift-off layer 42 can be performed. As shown in FIG. 5E, the lift-off process removes at least 99% of the poly(methyl methacrylate) lift-off layer 42 and the functionalized layer 20 overlapping on the remaining poly(methyl methacrylate) lift-off layer 42. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper. Removal of the poly(methyl methacrylate) lift-off layer 42 exposes the gap region 26 of the resin layer 18. The functionalized layer 20 remains intact within the recess 12, in part because the functionalized layer is covalently bonded to the resin 18.

[0177] Although not shown in FIGS. 5A - 5E, in this example, the primer set 30 (FIG. 2B) may be pre-grafted to the functionalized layer 20, or may be grafted after application of the functionalized layer 20 (FIG. 5D), or may be grafted after lift-off (FIG. 5E). It should be understood that when applied after lift-off, the primers 32, 34 (FIG. 2B) of the primer set 30 do not have an affinity for the resin layer 18 and thus selectively graft to the functionalized layer 20 within the recess 12.

[0178] Although FIGS. 5A - 5E show the formation of a single recess 12, it should be understood that an array of recesses 12 can be formed, for example, with each recess 12 isolated from each other by the gap region 26 of the resin layer 18 (similar to the example shown in FIG. 2B).

[0179] Referring now to FIGS. 6A - 6C, another example of a method for fabricating the flow cell 10E is illustrated. This exemplary method utilizes a multilayer stack 14 on a base support 22, and the multilayer stack 14 includes an additional resin layer 38 positioned on a lift-off resist 36 positioned on a functionalized layer 20 positioned on a resin layer 18.

[0180] Any example of the base support 22 and resin layer 18 described herein can be used in the example shown in FIG. 6A.

[0181] In this example, the resin layer 18 can be deposited, cured, and activated (e.g., via silanization or plasma ashing) on the base support 22 as described herein.

[0182] Next, as shown in FIG. 6A, the functionalized layer 20 can be applied using any of the examples described herein. In this example, the functionalized layer 20 is deposited on and adheres to the resin layer 18.

[0183] Next, a lift-off resist 36 can be applied to the functionalized layer 20. Any of the lift-off resists disclosed herein may be used. The lift-off resist 36 can be, for example, spin-on and cured.

[0184] Next, an additional resin layer 38 can be applied to the lift-off resist 36. The additional resin layer 38 can be any of the examples described herein for the resin layer 18. The additional resin layer 38 can also be deposited using any suitable deposition technique.

[0185] As shown in FIG. 6A, next, the additional resin layer 38 is imprinted to form a convex region 44 in the additional resin layer 38. As shown in FIG. 6A, the working stamp 24 is pressed into the additional resin layer 38 while the additional resin layer 38 is soft, creating an imprint of the working stamp features in the additional resin layer 38. The additional resin layer 38 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat, as described herein.

[0186] After curing, the working stamp 24 is removed. This creates a topographical feature in the additional resin layer 38. In this exemplary method, since the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, a portion 38' of the additional resin layer 38 remains adjacent to the convex region 44.

[0187] Next, a sequential etching process is performed to expose a portion of the resin layer 18 underlying the portion 38' of the additional resin layer 38. The arrows in FIG. 6B generally indicate the regions that can be etched during these processes.

[0188] The first of the etching processes removes some of the portion 38’ of the convex region 44 and some of the additional resin layer 38 (e.g., the upper surface of the convex region 44). The underlying lift-off resist 36 acts as an etching stop (e.g., when the portion 38’ is removed) because its etching rate is different from that of the additional resin layer 38. The etching of the additional resin layer 38 may involve anisotropic oxygen plasma.

[0189] Next, the convex region 44 is extended onto the surface of the resin layer 18 by selectively etching the lift-off resist 36 and the functionalized layer 20. The selective etching process removes portions of the lift-off resist 36 and the functionalized layer 20 that are not under the convex region 44.

[0190] To remove portions of the lift-off resist 36 and the functionalized layer 20, 100% O2 plasma etching can be used. For example, any regions of the lift-off resist 36 and the functionalized layer 20 that are exposed adjacent to the convex region 44 can be etched during this process. In this example, the resin layer 18 acts as an etching stop for the lift-off resist etching process. As a result, a portion of the functionalized layer 20 remains intact under the convex region 44 (FIG. 6B).

[0191] Next, lift-off of the remaining lift-off resist 36 can be performed. As shown in FIG. 6C, the lift-off process removes, for example, at least 99% of the remaining lift-off resist 36 and the additional resin layer 38 that overlays the remaining lift-off resist 36. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper. Removal of the lift-off resist 36 exposes the gap region 26 of the resin layer 18. The functionalized layer 20 (which is under the convex region 44) remains intact on the surface of the resin layer 18.

[0192] This example of the flow cell 10E does not include the recess 12. Instead, the functionalized layer 20 forms patches or pads 46 that are isolated by the adjacent gap regions 26.

[0193] Although not shown in FIGS. 6A - 6C, in this example, the primer set 30 (FIG. 2B) may be pre-grafted to the functionalized layer 20, or grafted after the application of the functionalized layer 20 (e.g., before the application of the lift-off resist 36), or grafted after lift-off (FIG. 6C). It should be understood that when applied after lift-off, the primers 32, 34 of the primer set 30 (FIG. 2B) do not have an affinity for the resin layer 18 and thus selectively graft to the functionalized layer 20.

[0194] FIGS. 6A - 6C show the formation of a single functionalized layer 20, but it should be understood that an array of patches or pads 46 can be formed such that each patch or pad 46 is isolated from each other by the gap regions 26 of the resin layer 18.

[0195] Two other examples of methods for forming examples of the flow cells 10F (FIG. 7H) and 10G (FIG. 7N) are shown in FIGS. 7A - 7N. One exemplary method is shown in FIGS. 7A - 7H, and another exemplary method is shown in FIGS. 7A, 7B, and 7I - 7N. These exemplary methods utilize a multilayer stack 14 on the base support 22, and the multilayer stack 14 includes an additional resin layer 38 positioned on a sacrificial layer 48 positioned on the resin layer 18.

[0196] Any example of the base support 22 and the resin layer 18 described herein can be used in the example shown in FIG. 7A. In this example, the resin layer 18 can be deposited, cured, and activated (e.g., via silanization or plasma ashing) on the base support 22 as described herein.

[0197] Next, a sacrificial layer 48 can be applied. Examples of suitable materials for the sacrificial layer 48 include semimetals such as silicon, or metals such as aluminum, copper, titanium, gold, silver, etc., or negative or positive photoresists. In some examples, the semimetal or metal can be at least substantially pure (<99% pure). In other examples, molecules or compounds of the listed elements can be used to provide the desired etch stop or other functionality in a particular way. For example, any of the listed semimetal oxides (e.g., silicon dioxide) or metal oxides (e.g., aluminum oxide) can be used alone or in combination with the listed semimetals or metals. These materials can be deposited using any suitable technique disclosed herein.

[0198] Next, an additional resin layer 38 can be applied to the sacrificial layer 48. The additional resin layer 38 can be any of the examples described herein for the resin layer 18. The additional resin layer 38 can also be deposited using any suitable deposition technique.

[0199] As shown in FIG. 7A, next, the additional resin layer 38 is imprinted to form a convex region 44 in the additional resin layer 38. As shown in FIG. 7A, the working stamp 24 is pressed into the additional resin layer 38 while the additional resin layer 38 is soft, creating an imprint of the working stamp features in the additional resin layer 38. Next, the additional resin layer 38 can be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat as described herein.

[0200] After curing, the working stamp 24 is removed. This creates topographic features in the additional resin layer 38. In this exemplary method, since the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, a portion 38' of the additional resin layer 38 remains adjacent to the convex region 44.

[0201] Next, a sequential etching process is performed to expose the portion of the resin layer 18 that is beneath the portion 38' of the additional resin layer 38. The arrows in FIG. 7B generally indicate the areas that can be etched during these processes.

[0202] The first of the etching processes removes a portion 38' of the convex region 44 and some of the additional resin layer 38 (e.g., the upper surface of the convex region 44). The underlying sacrificial layer 48 acts as an etch stop (e.g., when the portion 38' is removed) because its etching rate is different from that of the additional resin layer 38. The etching of the additional resin layer 38 can involve anisotropic oxygen plasma.

[0203] Next, the convex region 44 is extended onto the surface of the resin layer 18 by selectively etching the exposed portion of the sacrificial layer 48. As an example, an aluminum sacrificial layer 48 can be removed under acidic or basic conditions, a copper sacrificial layer 48 can be removed using FeCl3, a photoresist sacrificial layer 48 can be removed using an organic solvent such as acetone or under basic (pH) conditions, and a silicon sacrificial layer 48 can be removed under basic (pH) conditions. In this example, the resin layer 18 acts as an etch stop for the sacrificial layer etching process.

[0204] An example of the method proceeds from FIG. 7B to FIG. 7C. This exemplary method involves simultaneously etching the additional resin layer 38 (of the convex region 44) and some of the exposed resin layer 18 (e.g., around the convex region 44). The arrows in FIG. 7C generally indicate the areas that can be etched during this process.

[0205] In some examples, the additional resin layer 38 and the resin layer 18 can be the same material or different materials having the same etching rate. The resin layers 38, 18 can be etched simultaneously using anisotropic oxygen plasma or using 90% CF4 and 10% O2. As shown in FIG. 7C, the layers 38, 18 can be etched until the additional resin layer 38 is removed. The sacrificial layer 48 functions as an etching stop for the etching process. This selective etching is performed using a portion of the depth (or thickness) of the resin layer 18 to form a protrusion 51 having the shape of the convex region 44. As a result of this etching process, the convex region 44 is extended into a portion of the resin layer 18, exposing another portion 18' of the resin layer 18.

[0206] In an alternative method, the additional resin layer 38 and the resin layer 18 can have different etching rates. In this example, the additional resin layer 38 can be etched to expose the underlying sacrificial layer 48, and then the resin layer 18 can be etched to extend the convex region 44 into a portion of the resin layer 18, thereby exposing another portion 18' of the resin layer 18.

[0207] Next, the photoresist 50 can be applied over the remaining portion of the sacrificial layer 48 and the exposed portion 18' of the resin layer 18. As shown in FIG. 7E, the photoresist 50 can be patterned such that the insoluble region 50' remains over the portion 18' of the resin layer 18. In one example, the photoresist 50 is a negative photoresist (the exposed regions are insoluble in the developer). An example of a suitable negative photoresist includes the NR (registered trademark) series of photoresists (available from Futurrex). Other suitable negative photoresists include the SU-8 series and the KMPR (registered trademark) series (both available from Kayaku Advanced Materials, Inc.), or the UVN (trademark) series (available from DuPont). When a negative photoresist is used, it is selectively exposed to light of a particular wavelength to form the insoluble region 50', and then exposed to a developing solution to remove the soluble portions. In this example, the light exposure can pass through the base support 22 (which is transparent to the light used) and the resin layer 18, and the sacrificial layer 48 blocks the light. In another example, the photoresist 50 is a positive photoresist (the exposed regions become soluble in the developer). Examples of suitable positive photoresists include the MICROPOSIT (registered trademark) S1800 series or the AZ (registered trademark) 1500 series, both of which are available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR (trademark)-220 (manufactured by DuPont). When a positive photoresist is used, it is selectively exposed to light of a particular wavelength to form soluble regions (e.g., having at least 95% solubility in the developer), and then exposed to a developing solution to remove the soluble portions.

[0208] In the example shown in FIG. 7F, the remaining portion of the sacrificial layer 48 can be etched away. The sacrificial layer 48 can be etched as described herein. The insoluble region(s) 50' of the photoresist 50 can have an etching rate different from that of the sacrificial layer 48, and thus can remain intact when the sacrificial layer 48 is etched away. Further, the resin layer 18 can have an etching rate different from that of the sacrificial layer 48, and thus the portion of the resin layer 18 underlying the sacrificial layer 48 can act as an etching stop for the sacrificial layer etching process. As shown in FIG. 7F, removal of the sacrificial layer 48 exposes a portion of the resin layer 18 that is part of the convex region 44.

[0209] Next, as shown in FIG. 7G, using any of the examples described herein, the functionalized layer 20 can be applied. In this example, the functionalized layer 20 is deposited on the resin layer 18 of the convex region 44 and on the insoluble portion 50' of the photoresist 50.

[0210] Next, lift-off of the insoluble portion 50' of the photoresist 50 can be performed. As shown in FIG. 7H, the lift-off process removes the functionalized layer 20 that overlays the insoluble portion 50'. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper.

[0211] In this flow cell 10F, the functionalized layer 20 remains intact on the convex portion 51 (e.g., the portion of the convex region 44 defined in the resin layer 18). In the array, it should be understood that each convex portion 51 is isolated from each other by the gap region 26. The gap region 26 is also defined in the resin layer 18 but has a height lower than that of the convex portion(s) 51.

[0212] Although not shown in FIGS. 7A - 7H, in this example, primer set 30 (FIG. 2B) may be pre - grafted onto functionalized layer 20, or may be grafted after application of the functionalized layer (FIG. 7G), or may be grafted after lift - off and formation of protrusions 51 (FIG. 7H). It should be understood that when applied after lift - off, primers 32, 34 of primer set 30 (FIG. 2B) do not have an affinity for gap region 26 and thus selectively graft onto functionalized layer 20 on protrusions 51.

[0213] Another example of the method proceeds from FIGS. 7B to 7I. In this exemplary method, photoresist 50 may be applied over the exposed portions of resin layer 18 and over convex regions 44. Photoresist 50 may be patterned such that insoluble regions 50' remain over the exposed portions of resin layer 18 and such that additional resin layer 38 of convex regions 44 is re - exposed. This is shown in FIG. 7J. When a negative photoresist is used in this example, light exposure can pass through base support 22 and resin layer 18, and sacrificial layer 48 blocks the light. Base support 22 and resin layer 18 are transparent to the wavelength of light used.

[0214] In the example shown in FIG. 7K, the remaining portions of additional resin layer 38 may be etched away. Additional resin layer 38 may be etched as described herein. Insoluble regions 50' (s) of photoresist 50 may have an etching rate different from that of additional resin layer 38 and thus may remain intact when additional resin layer 38 is etched away.

[0215] In the example shown in FIG. 7L, the remaining portion of the sacrificial layer 48 can be etched away. The sacrificial layer 48 can be etched as described herein. The insoluble region(s) 50' of the photoresist 50 can have an etching rate different from that of the sacrificial layer 48, and thus can remain intact when the sacrificial layer 48 is etched away. Further, the resin layer 18 can have an etching rate different from that of the sacrificial layer 48, and thus the portion of the resin layer 18 beneath the sacrificial layer 48 can act as an etching stop for the sacrificial layer etching process. As shown in FIG. 7L, removal of the sacrificial layer 48 exposes a portion of the resin layer 18 underlying the convex region 44.

[0216] Next, as shown in FIG. 7M, one of the examples described herein can be used to apply the functionalized layer 20. In this example, the functionalized layer 20 is deposited over the resin layer 18 that is not covered by the insoluble portion 50' of the photoresist 50.

[0217] Next, lift-off of the insoluble portion 50' of the photoresist 50 can be performed. As shown in FIG. 7N, the lift-off process removes the functionalized layer 20 that overlays the insoluble portion 50'. This lift-off process can be performed as described herein.

[0218] In this flow cell 10G, the functionalized layer 20 remains intact and forms patches or pads 46 isolated by the adjacent gap regions 26. In the array, it should be understood that each patch or pad 46 is isolated by the gap region 26 for each patch or pad 46.

[0219] Although not shown in FIGS. 7A, 7B, and 7I-7I, in this example, primer set 30 (FIG. 2B) may be pre-grafted onto functionalized layer 20, or may be grafted after application of the functionalized layer (FIG. 7M), or may be grafted after lift-off and formation of patches or pads 46 (FIG. 7N). It should be understood that when applied after lift-off, primers 32, 34 of primer set 30 (FIG. 2B) do not have an affinity for gap region 26 and thus selectively graft to functionalized layer 20 of patches or pads 46.

[0220] Method and flow cell for simultaneous paired-end sequencing

[0221] An example of a flow cell for simultaneous paired-end sequencing generally includes a substrate, two functionalized layers on at least a portion of the substrate, and different primer sets attached to the two functionalized layers.

[0222] In one example, the first primer set includes a non-cleavable first primer and a cleavable second primer; the second primer set includes a cleavable first primer and a non-cleavable second primer. FIGS. 8A-8D illustrate different configurations of primer sets 52A, 52A', 52B, 52B', 52C, 52C', and 52D, 52D' attached to functionalized layers 20A, 20B.

[0223] Each of the first primer sets 52A, 52B, 52C, and 52D includes a non-cleavable first primer 54 or 54' and a cleavable second primer 56 or 56'; each of the second primer sets 52A', 52B', 52C', and 52D' includes a cleavable first primer 58 or 58' and a non-cleavable second primer 60 or 60'.

[0224] The non-cleavable first primer 54 or 54' and the cleavable second primer 56 or 56' are, for example, an oligo pair in which the non-cleavable first primer 54 or 54' is a forward amplification primer and the cleavable second primer 56 or 56' is a reverse amplification primer, or the cleavable second primer 56 or 56' is a forward amplification primer and the non-cleavable first primer 54 or 54' is a reverse amplification primer. In each example of the first primer sets 52A, 52B, 52C, and 52D, the cleavable second primer 56 or 56' includes the cleavage site 62, while the non-cleavable first primer 54 or 54' does not include the cleavage site 62.

[0225] The cleavable first primer 58 or 58' and the non-cleavable second primer 60 or 60' are also, for example, an oligo pair in which the cleavable first primer 58 or 58' is a forward amplification primer and the non-cleavable second primer 60 or 60' is a reverse amplification primer, or the non-cleavable second primer 60 or 60' is a forward amplification primer and the cleavable first primer 58 or 58' is a reverse amplification primer. In each example of the second primer sets 52A', 52B', 52C', and 52D', the cleavable first primer 58 or 58' includes the cleavage site 62' or 64, while the non-cleavable second primer 60 or 60' does not include the cleavage site 62' or 64.

[0226] Except that the cleavable first primer 58 or 58' contains a cleavage site 62' or 64 incorporated into the nucleotide sequence or into a linker 66' attached to the nucleotide sequence, the non-cleavable first primer 54 or 54' of the first primer sets 52A, 52B, 52C, 52D and the cleavable first primer 58 or 58' of the second primer sets 52A', 52B', 52C' and 52D have the same nucleotide sequence (e.g., both are forward amplification primers). Similarly, except that the cleavable second primer 56 or 56' contains a cleavage site 62 incorporated into the nucleotide sequence or into a linker 66 attached to the nucleotide sequence, the cleavable second primer 56 or 56' of the first primer sets 52A, 52B, 52C, 52D and the non-cleavable second primer 60 or 60' of the second primer sets 52A', 52B', 52C' and 52D have the same nucleotide sequence (e.g., both are reverse amplification primers).

[0227] It should be understood that when the first primers 54 and 58 or 54' and 58' are forward amplification primers, the second primers 56 and 60, or 56' and 60' are reverse primers, and vice versa.

[0228] Examples of non-cleavable primers 54, 60 or 54', 60' include the P5 and P7 primers described herein. In some examples, the P5 and P7 primers do not contain cleavage sites 62, 62', 64, so the P5 and P7 primers are non-cleavable primers 54, 60 or 54', 60'. It should be understood that any suitable universal sequence can be used as the non-cleavable primers 54, 60 or 54', 60'.

[0229] Examples of cleavable primers 56, 58 or 56', 58' include those incorporated into the respective nucleic acid sequences (e.g., FIGS. 8A and 8C), or those incorporated into linkers 66', 66 that attach cleavable primers 56, 58 or 56', 58' to the respective functionalized layers 20A, 20B (FIGS. 8B and 8D), and P5 and P7 (or other universal sequences) primers having respective cleavage sites 62, 62', 64. Examples of suitable cleavage sites 62, 62', 64 include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases), as described herein.

[0230] Each primer set 52A and 52A', or 52B and 52B', or 52C and 52C', or 52D and 52D' is attached to the respective functionalized layers 20A, 20B on the substrate. In some examples, the functionalized layers 20A, 20B have the same surface chemistry, and one set of primers 54, 56 or 54', 56' on the functionalized layer 20A, and another set of primers 58, 60 or 58', 60' on the functionalized layer 20B can be grafted using any of the techniques described herein. In other examples, the functionalized layers 20A, 20B include different surface chemistries (e.g., functional groups) that can selectively react with the respective primers 54, 56, or 54', 56', or 58, 60, or 58', 60'. In these other examples, the functionalized layer 20A has a first functional group, and the functionalized layer 20B has a second functional group different from the first functional group.

[0231] As described above, FIGS. 8A - 8D illustrate different configurations of primer sets 52A, 52A', 52B, 52B', 52C, 52C', and 52D, 52D' attached to the functionalized layers 20A, 20B. More specifically, FIGS. 8A - 8D illustrate different configurations of primers 54, 56 or 54', 56', and 58, 60 or 58', 60' that can be used.

[0232] In the example shown in FIG. 8A, the primers 54, 56 and 58, 60 of primer sets 52A and 52A' are attached directly to the functionalized layers 20A, 20B, for example, without linkers 66, 66'. The functionalized layer 20A may have surface functional groups that can immobilize terminal groups at the 5'-ends of the primers 54, 56. Similarly, the functionalized layer 20B may have surface functional groups that can immobilize terminal groups at the 5'-ends of the primers 58, 60. In one example, the immobilization chemistry between the functionalized layer 20A and the primers 54, 56, and the immobilization chemistry between the functionalized layer 20B and the primers 58, 60 may be different, such that the primers 54, 56 or 58, 60 selectively attach to the desired layer 20A or 20B. In another example, the immobilization chemistry may be the same for the layers 20A or 20B and the respective primers 54, 56 or 58, 60, and patterning techniques can be used to graft one primer set 52A, 52A' at a time. In yet another example, the materials applied to form the functionalized layers 20A, 20B may have the respective primers 54, 56 or 58, 60 pre-grafted thereto, and thus the immobilization chemistry may be the same or different.

[0233] In this example, the immobilization can be by single-point covalent bonds to the respective functionalized layers 20A, 20B at the 5'-ends of the respective primers 54 and 56 or 58 and 60. Any suitable covalent bonding means known in the art can be used, examples of which are described herein for primers 32, 34.

[0234] Also, in the example shown in FIG. 8A, the cleavage sites 62, 62' of each of the cleavable primers 56, 58 are incorporated into the primer sequences. In this example, the same type of cleavage sites 62, 62' are used for the cleavable primers 56, 58 of each primer set 52A, 52A'. As an example, the cleavage sites 62, 62' are uracil bases, and the cleavable primers 56, 58 are P5U and P7U. In this example, the non-cleavable primer 54 of the oligo pair 54, 56 can be P7, and the non-cleavable primer 60 of the oligo pair 58, 60 can be P5. Thus, in this example, the first primer set 52A includes P7, P5U, and the second primer set 52A' includes P5, P7U. The primer sets 52A, 52A' have opposite linearization chemistries that enable the formation of the forward template strand on one of the functionalized layers 20A or 20B and the reverse strand on the other functionalized layer 20B or 20A after amplification, cluster generation, and linearization.

[0235] In the example shown in FIG. 8B, primers 54', 56', 58', and 60' of primer sets 52B and 52B' are attached to functionalized layers 20A and 20B, for example, via linkers 66 and 66'. The functionalized layer 20A may have surface functional groups capable of immobilizing the linker 66 at the 5'-ends of the primers 54' and 56'. Similarly, the functionalized layer 20B may have surface functional groups capable of immobilizing the linker 66' at the 5'-ends of the primers 58' and 60'. In one example, the immobilization chemistry of the functionalized layer 20A and the linker 66 and the immobilization chemistry of the region 16 and the linker 66' may be different, such that the primers 18', 20' or 19', 21' selectively graft to the desired functionalized layer 20A or 20B. In another example, the immobilization chemistry may be the same for the functionalized layers 20A and 20B and the linkers 66 and 66', and using any suitable technique disclosed herein, one primer set 52B, 52B' can be grafted at a time. In yet another example, the materials applied to form the functionalized layers 20A and 20B may have their respective primers 54', 56' and 58', 60' pre-grafted thereto, and thus the immobilization chemistry may be the same or different. Examples of suitable linkers 66 and 66' include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers having vicinal diols, peptide linkers, and the like. One example of a nucleic acid linker is a poly-T spacer, although other nucleotides can also be used. In one example, the spacer is a 6T - 10T spacer. The following are some examples of nucleotides containing non-nucleic acid linkers (where B is a nucleobase and "oligo" is a primer).

Chemical formula

[0236] In the example shown in FIG. 8B, primers 54′, 58′ have the same sequence (e.g., P5) and the same or different linkers 66, 66′. Primer 54′ is non-cleavable, while primer 58′ contains a cleavage site 62′ incorporated into linker 66′. Also, in this example, primers 56′, 60′ have the same sequence (e.g., P7) and the same or different linkers 66, 66′. Primer 60′ is non-cleavable, and primer 56′ contains a cleavage site 62 incorporated into linker 66. The same type of cleavage sites 62, 62′ are used for the respective linkers 66, 66′ of the cleavable primers 56′, 58′. As an example, the cleavage sites 62, 62′ can be uracil bases incorporated into the nucleic acid linkers 66, 66′. Primer sets 52B, 52B′ have opposite linearization chemistries that, after amplification, cluster generation, and linearization, enable the formation of the forward template strand on one of the functionalized layers 20A or 20B and the reverse strand on the other functionalized layer 20B or 20A.

[0237] The example shown in FIG. 8C is similar to the example shown in FIG. 8A, except that different types of cleavage sites 62, 64 are used for the cleavable primers 56, 58 of the respective primer sets 52C, 52C′. As an example, two different enzymatic cleavage sites may be used, two different chemical cleavage sites may be used, or one enzymatic cleavage site and one chemical cleavage site may be used. Examples of different cleavage sites 62, 64 that can be used for the respective cleavable primers 56, 58 include any combination of vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0238] The example shown in FIG. 8D is the same as the example shown in FIG. 8B, except that different types of cleavage sites 62, 64 are used for linkers 66, 66' attached to cleavable primers 56', 58' of respective primer sets 52D, 52D'. Examples of different cleavage sites 62, 64 that can be used in each of the linkers 66, 66' attached to cleavable primers 56', 58' include any combination of vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0239] In any of the examples shown in FIGS. 8A - 8D, the attachment of primers 54, 56 and 58, 60 or 54', 56' and 58', 60' to the functionalized layers 20A, 20B leaves the template - specific portions of the primers 54, 56 and 58, 60 or 54', 56' and 58', 60' free and anneals to its homologous template and 3'-hydroxyl group to allow free primer extension.

[0240] The functionalized layers 20A, 20B represent different regions of a substrate having different primer sets 52A, 52A' or 52B, 52B' or 52C, 52C' or 52D, 52D' attached thereto. The functionalized layers 20A, 20B can include materials having different functional groups. In some cases, the different functional groups are functional groups on the surface of the substrate or functional groups introduced onto the surface of the substrate, or can be functional groups of another component (e.g., polymer layer, beads, etc.) deposited on the substrate.

[0241] In some examples, the functionalized layers 20A, 20B are chemically the same, and using any of the techniques disclosed herein, the primers 54, 56 and 58, 60 or 54', 56' and 58', 60' of each set 52A and 52A', or 52B and 52B', or 52C and 52C', or 52D and 52D' can be sequentially attached to the functionalized layers 20A, 20B.

[0242] In yet another example, the materials applied to form the functionalized layers 20A, 20B may have respective primers 54, 56 or 58, 60 pre-grafted thereto, and thus, the immobilization chemistries may be the same or different.

[0243] The configuration of the various components of the flow cell can vary depending in part on the method used to generate the flow cell. Here, some exemplary methods will be described.

[0244] Examples of the methods shown in FIGS. 9A-9F may use a single-layer substrate 68 (without the base support 22), or a multilayer substrate including the base support 22 having a resin layer 18 thereon. In these figures, since the support 22 is not present when the single-layer substrate 68 is used, the base support 22 is shown imaginarily.

[0245] The recess 12 is defined in the single-layer substrate 68 or the resin layer 18. Although a single recess 12 is shown, it should be understood that the flow cell 10H (FIG. 9F) may include a plurality of recesses 12, similar to those shown in FIG. 2B.

[0246] The recess 12 can be formed in the single-layer substrate 68 using any suitable technique such as photolithography, nanoimprint lithography (NIL), stamping techniques, laser-assisted direct imprinting (LADI) embossing techniques, molding techniques, microetching techniques, etc. The technique used depends in part on the type of material used. For example, the recess 12 can be microetched into a glass single-layer substrate.

[0247] The recess 12 can be formed in the resin layer 18 of the multilayer substrate using any suitable technique such as nanoimprint lithography (NIL) or photolithography. The technique used will depend in part on the type of material used.

[0248] An example of forming the recess 12 in the resin layer 18 is illustrated in FIG. 10. In this example, the working stamp 24 is pressed into the resin layer 18 while the resin layer 18 is soft, creating an imprint of the working stamp feature in the resin layer 18. Next, the resin layer 18 can be cured with the working stamp 24 in a predetermined position. The curing can be achieved by exposure to actinic rays or heat as described herein. After curing, the working stamp 24 is removed. Thereby, the recess 12 is created in the resin layer 18.

[0249] Another example of forming the recess 12 in the resin layer 18 utilizes a photoresist 50. In this example, the photoresist 50 is applied onto the resin layer 18 and developed (by the light exposure and developing solution described herein), defining a recess pattern from which the (developer) soluble photoresist has been removed, and a gap pattern of (developer) insoluble photoresist regions 50' remaining on the resin layer 18. FIG. 11 illustrates the recess pattern 70 and the gap pattern 72. From the top view, the recess pattern 70 has the same shape as the final recesses 12 (plural possible), and the gap pattern 72 has the same shape as the gap regions 26 (plural possible).

[0250] Next, the resin layer 18 is etched with the recess pattern 70 (indicated by the arrow in FIG. 11). The insoluble photoresist regions 50' act as an etching mask. The resin layer 18 can be etched as described herein. As illustrated in FIG. 11, the etching can be performed such that a portion of the resin layer 18 remains at the bottom of the recess 12. Next, the insoluble photoresist regions 50' can be removed, for example, by a lift-off technique. Referring back to FIG. 9A, the removal of the insoluble photoresist regions 50' exposes the gap regions 26.

[0251] Depending on the single-layer substrate 68 or the resin layer 18 used, activation of the exposed surface using silanization or plasma ashing can be performed to generate surface groups that can react with the functionalized layers 20A, 20B subsequently deposited on the single-layer substrate 68 or the resin layer 18 (for example, see FIG. 9E).

[0252] With the recess 12 formed in the single-layer substrate 68 or the resin layer 18, this exemplary method is followed by the application of the sacrificial layer 48 onto a portion of the recess 12. This is illustrated in FIG. 9B. Any example of the sacrificial layer 48 disclosed herein may be used.

[0253] The applied sacrificial layer 48 defines a pattern for one of the functionalized layers 20B that is subsequently applied over the covered portion of the recess 12. Thus, the sacrificial layer 48 may be applied to cover a portion of the recess 12 including some of the sidewalls and some of the bottom, while another portion 74 of the recess 12 remains exposed. The sacrificial layer 48 may also be applied over the gap region(s) 26 adjacent to the coated sidewall(s). Coating the gap region 26 may be desirable to ensure that the uppermost portion of the sidewall of the recess is available for subsequent deposition of the functionalized layer 20B.

[0254] In some examples, the sacrificial layer 48 can be fabricated using a photolithography process combined with either a lift-off technique or an etching technique. In other examples, selective deposition techniques such as chemical vapor deposition (CVD) and its variations (e.g., low-pressure CVD or LPCVD), atomic layer deposition (ALD), and masking techniques can be used to deposit the sacrificial layer 48 in the desired regions. Alternatively, the sacrificial layer 48 can be applied over the single-layer substrate 68 or the resin layer 18 (including all of the recess 12) and then selectively removed from the portion 74 (e.g., via masking and etching) to define a pattern for one of the functionalized layers 20B.

[0255] As shown in FIG. 9C, the functionalized layer 20A can then be applied using any of the deposition techniques described herein. In this example, the functionalized layer 20A is deposited over the exposed surface of the single-layer substrate 68 or the resin layer 18 (including over the portion 74 of the recess 12) and over the sacrificial layer 48.

[0256] Next, the sacrificial layer 48 is removed to expose the portion 76 of the recess 12 that was covered by the sacrificial layer 48. This is shown in FIG. 9D. Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized layer 20A is covalently bonded to the single-layer substrate 68 or the resin layer 18 and thus is not removed from the single-layer substrate 68 or the resin layer 18 during sacrificial layer etching. However, the functionalized layer 20A on the sacrificial layer 48 is removed. The single-layer substrate 68 or the resin layer 18 can function as an etching stop for sacrificial layer etching, for example, when the single-layer substrate 68 or the resin layer 18 has an etching rate different from that of the sacrificial layer 48.

[0257] As shown in FIG. 9E, next, the functionalized layer 20B can be applied using any of the deposition techniques disclosed herein. In this example, the functionalized layer 20B is deposited on the exposed portion of the single-layer substrate 68 or the exposed portion of the resin layer 18 (including over the portion 76 of the recess 12). In this example, when the deposition of the functionalized layer 20B is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second functionalized layer 20B does not deposit on or adhere to the first functionalized layer 20A. Thus, the functionalized layer 20B does not contaminate the functionalized layer 20A.

[0258] In FIG. 9F, the functionalized layers 20A, 20B on the gap region 26 are removed. This removal involves polishing the functionalized layers 20A, 20B from the gap region 26 or another suitable technique that does not remove the functionalized layers 20A, 20B from the recess 12.

[0259] The polishing process can be performed using a chemical slurry (e.g., including an abrasive, buffer, chelating agent, surfactant, and / or dispersant) that can remove the functionalized layers 20A, 20B from the gap region 26 without adversely affecting the underlying substrate 68 or resin layer 18 in those regions 26. Alternatively, the polishing can be performed using a solution that does not contain abrasive particles.

[0260] The chemical slurry can be used in a chemical mechanical polishing system to polish the surface of the gap region 26. The polishing head(s) / pad(s) or other polishing tool(s) can polish the functionalized layers 20A, 20B that may be present on the gap region 26 while leaving the functionalized layers 20A, 20B in the recesses 12 (if any) at least substantially intact. As an example, the polishing head can be a Strasbaugh ViPRRII polishing head.

[0261] The cleaning and drying processes can be performed after polishing. The cleaning process can utilize a water bath and ultrasonic treatment. The water bath can be maintained at a relatively low temperature in the range of about 22°C to about 30°C. The drying process can involve spin drying or drying via another suitable technique.

[0262] In some examples, the primers 54, 56 or 54’, 56’ (not shown in FIGS. 9A - 9F) can be pre-grafted onto the functionalized layer 20A. Similarly, the primers 58, 60 or 58’, 60’ (not shown in FIGS. 9A - 9F) can be pre-grafted onto the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0263] In other examples, primers 54, 56 or 54', 56' are not pre-grafted to the functionalized layer 20A. In these examples, primers 54, 56 or 54', 56' can be grafted after the functionalized layer 20A is applied (e.g., FIG. 9C). In these examples, primers 58, 60 or 58', 60' can be pre-grafted to the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58', 60' may not be pre-grafted to the second functionalized layer 20B. Rather, primers 58, 60 or 58', 60' can be grafted after the second functionalized layer 20B is applied (e.g., FIG. 28E), provided that i) the functionalized layer 20B has different functional groups (from the functionalized layer 20A) for attaching to primers 58, 60 or 58', 60', or ii) any unreacted functional groups of the functionalized layer 20A are quenched using, for example, Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0264] If the grafting is carried out during the process, the grafting can be achieved using any suitable grafting technique such as those disclosed herein. In any of the grafting methods, primers 54, 56 or 54', 56' react with the reactive groups of the functionalized layer 20A, or primers 58, 60 or 58', 60' react with the reactive groups of the functionalized layer 20B and have no affinity for the single-layer substrate 68 or the resin layer 18.

[0265] Figures 9A - 9F show the formation of a single recess 12 having functionalized layers 20A, 20B therein, but it should be understood that an array of recesses 12 having functionalized layers 20A, 20B therein can be formed, for example, with each recess 12 being isolated from each other by the gap region 26 of the single-layer substrate 68 or the resin layer 18 (similar to the example shown in FIG. 2B).

[0266] The processes of the methods shown in FIGS. 9B - 9E may also be performed in conjunction with the exemplary methods shown in FIGS. 1A - 1C or FIGS. 3A and 3B to introduce two functionalized layers 20A and 20B into the recess 12 instead of one functionalized layer 20. For example, the process described with reference to FIGS. 9B - 9E may be performed after (and instead of) the process described with reference to FIG. 1B. In another example, the process described with reference to FIGS. 9B - 9E may be performed after (and instead of) the process described with reference to FIG. 3A. It should be understood that since the two functionalized layers 20A and 20B do not adhere to the hydrophobic layer 16 of FIGS. 1B and 3A, no polishing is performed.

[0267] FIGS. 12A - 12H, FIGS. 13A - 13H, and FIGS. 14A - 14J illustrate different examples of methods that result in different examples of flow cells 10I, 10J, 10K, each of which includes functionalized layers 20A and 20B. Each of these methods utilizes a different multilayer stack 14 on the base support 22.

[0268] Generally, each of these methods is to imprint the resin layer 18 or 38 to form a concave region 40 including a deep portion 78 and a shallow portion 80 defined by a step portion 82, wherein the resin layer 18 or 38 is positioned on a multilayer stack 14 including at least two layers (e.g., 42 and 48, or 48 and 38, or 42, 48, and 38) having different etching rates positioned on the base support 22, forming the concave region 40; selectively etching the resin layer 18 or 38 and the at least two layers to form a recess 12 adjacent to the deep portion 78; applying a first functionalized layer 20A to the recess 12; selectively etching the resin layer 18 or 38, the at least two layers, or a combination thereof to expose the region under the step portion 82; and applying a second functionalized layer 20B to the exposed region. Here, each method will be described with reference to its respective set of figures.

[0269] In FIGS. 12A - 12H, the multilayer stack 14 includes a sacrificial layer 48 on a base support 22, a poly(methyl methacrylate) lift-off layer 42 on the sacrificial layer 48, and a resin layer 18 on the poly(methyl methacrylate) lift-off layer 42.

[0270] The surface of the base substrate 22 below the sacrificial layer 48 can function like an ashed support, and thus additional activation may not be performed.

[0271] The sacrificial layer 48 can be applied to the base support 22 using any suitable technique disclosed herein. Examples of suitable materials for the sacrificial layer 48 include any of those described herein, such as silicon, aluminum, negative or positive photoresist, copper, etc.

[0272] Next, the poly(methyl methacrylate) lift-off layer 42 is deposited on the sacrificial layer 48 using any suitable technique and can be cured using heat.

[0273] Next, the resin layer 18 can be applied to the poly(methyl methacrylate) lift-off layer 42. The resin layer 18 can be any of the examples described herein and can be deposited using any suitable deposition technique.

[0274] Next, the resin layer 18 is imprinted to form the concave region 40, which in this example includes a deep portion 78 and a shallow portion 80 that is partially defined by a step portion 82 of the resin layer 18. As shown in FIG. 12A, the working stamp 24 is pressed into the resin layer 18 while it is soft, creating an imprint of the working stamp features in the resin layer 18. The resin layer 18 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat as described herein.

[0275] After hardening, the working stamp 24 is removed. This creates various topographical features in the resin layer 18. In this exemplary method, as shown in FIG. 12A, the working stamp 24 does not extend through the entire depth (or thickness) of the resin layer 18 at the deep portion 78, and thus, a portion 18'' of the resin layer 18 forms the bottom of the concave region 40 at the deep portion 78.

[0276] Next, the recess 12 (shown in FIG. 12C) is formed by etching a first portion 18'' of the resin layer 18 under the deep portion 78, etching a portion of the poly(methyl methacrylate) lift-off layer 42 under the deep portion 78, and etching a portion of the sacrificial layer 48 under the deep portion 78, thereby forming the recess 12 in the sacrificial layer 48.

[0277] Referring to FIG. 12B, the deep portion 78 of the concave region 40 is extended to the surface of the sacrificial layer 48 by selectively etching a portion of the resin layer portion 18'' and the poly(methyl methacrylate) lift-off layer 42 (under the resin layer portion 18''). Each of these layers 18 and 42 is selected to have a different etching rate, and thus, when etching the resin layer 18, the poly(methyl methacrylate) lift-off layer 42 acts as an etching stop.

[0278] For the resin layer 18, etching can be performed using anisotropic oxygen plasma. As indicated by the downward arrow in FIG. 12B, any exposed region of the resin layer 18 can be etched during this process. As described above, the poly(methyl methacrylate) lift-off layer 42 acts as a stop for the etching of the concave region 40 when the resin layer portion 18'' is removed. This first etching process can be stopped when the poly(methyl methacrylate) lift-off layer 42 is exposed to the deep portion 78 of the concave region 40, and thus the entire resin layer 18 is not etched away (as shown in FIG. 12B). Further, the depth (or thickness) of the step portion 82 can also be selected before imprinting such that the portion of the poly(methyl methacrylate) lift-off layer 42 below the step portion 82 is not exposed during this first etching process. Thus, the depth (or thickness) of the step portion 82 may be greater than the depth (or thickness) of the resin layer portion 18''.

[0279] For the portion of the poly(methyl methacrylate) lift-off layer 42 below the resin layer portion 18'', reactive ion etching (e.g., O2 or O2 / CHF3) or CF4 / O2 plasma etching or 100% O2 plasma etching can be used. Any region of the poly(methyl methacrylate) lift-off layer 42 exposed to the concave region 40 can be etched during this process. The sacrificial layer 48 acts as a stop for the etching of the deep portion 78 of the concave region 40 when the portion of the poly(methyl methacrylate) lift-off layer 42 is removed. As shown in FIG. 12B, after performing this etching process, any covered portion of the poly(methyl methacrylate) lift-off layer 42 remains intact.

[0280] Next, the deep portion 78 is further extended to the surface of the base support 22 to form a recess 12 in the sacrificial layer 48 adjacent to the deep portion 78. This can involve selectively etching the exposed portion of the sacrificial layer 48 (adjacent to the deep portion 78). In this example, the base support 22 acts as a stop for the etching of the sacrificial layer etching process.

[0281] Next, this exemplary method involves extending the shallow portion 80 of the recessed region 40 to the surface of the sacrificial layer 48 by selectively etching another portion of the step portion 82 and the poly(methyl methacrylate) lift-off layer 42 (beneath the step portion 82).

[0282] For the resin layer 18, etching can be performed again using anisotropic oxygen plasma. Any exposed region of the resin layer 18 can be etched during this process, as indicated by the downward arrow in FIG. 12D. The poly(methyl methacrylate) lift-off layer 42 also acts here as a stop for the etching of the recessed region 40 when the step portion 82 is removed. This etching process can be stopped when the poly(methyl methacrylate) lift-off layer 42 is exposed to the shallow portion 80 of the recessed region 40, and thus the entire resin layer 18 is not etched away (as shown in FIG. 12D).

[0283] For the portion of the poly(methyl methacrylate) lift-off layer 42 beneath the step portion 82, reactive ion etching (e.g., O2 or O2 / CHF3) or CF4 / O2 plasma etching or 100% O2 plasma etching can be used. Any region of the poly(methyl methacrylate) lift-off layer 42 exposed to the recessed region 40 can be etched during this process. The sacrificial layer 48 acts as a stop for the etching of the shallow portion 80 of the recessed region 40 when the portion of the poly(methyl methacrylate) lift-off layer 42 is removed. As shown in FIG. 12D, after performing this etching process, any covered portion of the poly(methyl methacrylate) lift-off layer 42 remains intact.

[0284] As shown in FIG. 12E, the functionalized layer 20A can then be applied using any suitable deposition technique. In this example, the functionalized layer 20A is deposited over the base support 22 within the recess 12, over any exposed portion of the sacrificial layer 48, and over any exposed portion of the resin layer 18.

[0285] Next, the sacrificial layer 48 adjacent to the shallow portion 80 is removed to expose another portion of the base support 22 adjacent to the functionalized layer 20A on the base support 22. This is illustrated in FIG. 12F. Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized layer 20A is covalently bonded to the base support 22 and thus is not removed during the sacrificial layer etching. Further, since the resin layer 18 is resistant to sacrificial layer etching, the functionalized layer 20A on the resin layer 18 is also not removed during the sacrificial layer etching. However, the functionalized layer 20A on the sacrificial layer 48 is removed. A single base support 22 can function as an etching stop for the sacrificial layer etching, for example, when the base support 22 has an etching rate different from that of the sacrificial layer 48.

[0286] As shown in FIG. 12G, the functionalized layer 20B can be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited on the exposed portion of the base substrate 12. In this example, when the deposition of the functionalized layer 20B is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second functionalized layer 20B does not deposit on or adhere to the first functionalized layer 20A. Thus, the functionalized layer 20B does not contaminate the functionalized layer 20A.

[0287] Next, lift-off of the remaining poly(methyl methacrylate) lift-off layer 42 can be performed. As shown in FIG. 12G, the lift-off process removes the poly(methyl methacrylate) lift-off layer 42, the resin layer 18, and the functionalized layer 20A that overlays the remaining poly(methyl methacrylate) lift-off layer 42. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper. Removal of the poly(methyl methacrylate) lift-off layer 42 exposes any remaining portions of the sacrificial layer 48.

[0288] As indicated by the downward arrow in FIG. 12H, the remaining portion of the sacrificial layer 48 is then removed using an etching process suitable for the particular sacrificial layer 48. The functionalized layers 20A, 20B remain intact on the base support 22, in part because the functionalized layers 20A, 20B are covalently bonded to the base support 22.

[0289] In some examples, primers 54, 56 or 54’, 56’ (not shown in FIGS. 12A - 12H) may be pre-grafted to the functionalized layer 20A. Similarly, primers 58, 60 or 58’, 60’ (not shown in FIGS. 12A - 12H) may be pre-grafted to the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0290] In other examples, primers 54, 56 or 54’, 56’ are not pre-grafted to the functionalized layer 20A. In these examples, primers 54, 56 or 54’, 56’ may be grafted after the functionalized layer 20A has been applied (e.g., FIG. 12E). In these examples, primers 58, 60 or 58’, 60’ may be pre-grafted to the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58’, 60’ may not be pre-grafted to the second functionalized layer 20B. Rather, primers 58, 60 or 58’, 60’ may be grafted after the second functionalized layer 20B has been applied (e.g., FIG. 12G), provided that i) the functionalized layer 20B has a different functional group (than the functionalized layer 20A) for attaching to the primers 58, 60 or 58’, 60’, or ii) any unreacted functional groups of the functionalized layer 20A have been quenched using, for example, Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0291] When the grafting is performed during the method, the grafting can be achieved using any suitable grafting technique such as those disclosed herein. In any of the grafting methods, primers 54, 56 or 54', 56' react with the reactive groups of the functionalized layer 20A, or primers 58, 60 or 58', 60' react with the reactive groups of the functionalized layer 20B and have no affinity for the base support 22.

[0292] In this example of the flow cell 10I, the functionalized layers 20A, 20B are not limited within the recess 12 (as in the flow cell 10H). Rather, the functionalized layers 20A, 20B form respective patches or pads 46A, 46B isolated by the adjacent gap regions 26 of the base support 22.

[0293] Figures 12A - 12H show the formation of a single set of functionalized layers 20A, 46A and 20B, 46B, but it should be understood that an array of patches or pads 46A, 46B can be formed such that each set of patches or pads 46A, 46B is isolated from each other set of patches or pads 46A, 46B by the gap regions 26 of the base support 22.

[0294] In Figures 13A - 13H, the multilayer stack 14 includes a resin layer 18 on a sacrificial layer 48 on top of an additional resin layer 38 on the base support 22.

[0295] Before forming the multilayer stack 14 on the base support 22, the base support 22 may be activated using silanization. The surface of the resin layer 38 under the sacrificial layer 48 functions like an ashed surface, and thus activation of this resin layer 38 is not performed.

[0296] The additional resin layer 38 can be deposited on the base support 22 using any suitable deposition technique including the examples disclosed herein and cured using conditions suitable for the resin.

[0297] The sacrificial layer 48 can be applied to the additional resin layer 38 using any suitable technique disclosed herein. Examples of suitable materials for the sacrificial layer 48 include silicon, aluminum, negative or positive photoresist, copper, and the like.

[0298] The resin layer 18 can be deposited on the sacrificial layer 48 using any suitable deposition technique including the examples disclosed herein. The resin layer 18 is then imprinted to form the concave region 40, which in this example includes a shallow portion 80 that is partially defined by the deep portion 78 and a step portion 82 of the resin layer 18. As shown in FIG. 13A, the working stamp 24 is pressed into the resin layer 18 while it is soft, creating an imprint of the working stamp features in the resin layer 18. The resin layer 18 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat as described herein.

[0299] After curing, the working stamp 24 is removed. This creates various topographical features in the resin layer 18. In this exemplary method, since the working stamp 24 does not extend through the entire depth (or thickness) of the resin layer 18 at the deep portion 78, a portion 18'' of the resin layer 18 forms the bottom of the concave region 40 at the deep portion 78.

[0300] Next, the recess 12 (shown in FIG. 13D) is formed, which is formed by etching a first portion 18'' of the resin layer 18 underlying the deep portion 78, etching a portion of the sacrificial layer 48 underlying the deep portion 78, thereby exposing a portion of the additional resin layer 38, and simultaneously etching a second portion (e.g., the step portion 82) of the resin layer 18 to expose another portion of the sacrificial layer 48, and ii) etching the exposed portion 38'' of the additional resin layer 38.

[0301] Referring to FIG. 13B, the deep portion 78 of the concave region 40 is extended to the surface of the sacrificial layer 48 by selectively etching the resin layer portion 18''. The etching can be performed using anisotropic oxygen plasma. Any exposed region of the resin layer 18 can be etched during this process, as indicated by the downward arrow in FIG. 13B. The sacrificial layer 48 acts as a stop for the etching of the concave region 40 when the resin layer portion 18'' is removed. This first etching process can be stopped when the sacrificial layer 48 is exposed in the deep portion 78 of the concave region 40, and thus the entire resin layer 18 is not etched away (as shown in FIG. 13B). Further, the depth (or thickness) of the step portion 82 can also be selected before imprinting such that the portion of the sacrificial layer 48 underlying the step portion 82 is not exposed during this first etching process. Thus, the depth (or thickness) of the step portion 82 may be greater than the depth (or thickness) of the resin layer portion 18''.

[0302] Next, as shown in FIG. 13C, the deep portion 78 is further extended to the surface of the additional resin layer 38. This may involve selectively etching the exposed portion of the sacrificial layer 48 (adjacent to the deep portion 78). In this example, the additional resin layer 38 acts as a stop for the etching of the sacrificial layer etching process.

[0303] Next, the method of this example involves simultaneously etching the resin layer 18 and the portion 38'' of the additional resin layer 38 exposed in the concave region 40. Thus, the portion 38'' of the additional resin layer 38 and the resin layer 18 can be of the same material or different materials having the same etching rate. As shown in FIG. 3D, the layers 18, 38 can be etched until the portion of the sacrificial layer 48 under the step portion 82 is exposed. The thickness of the step portion 82 remaining after the first etching process (FIG. 13B) is generally thinner than the thickness of the additional resin layer 38. Thus, the simultaneous etching process removes the step portion 82 to expose the sacrificial layer 48, but does not extend through the depth (or thickness) of the additional resin layer 38. As shown in FIG. 13D, a portion of the additional resin layer 38 is removed to form a recess 12 in the additional resin layer 38.

[0304] In an alternative method, the additional resin layer 38 and the resin layer 18 can have different etching rates. In one example, the step portion 82 of the resin layer 18 can be etched to expose the underlying sacrificial layer 48, and then the additional resin layer 38 (adjacent to the deep portion 78) can be removed to form the recess 12. In another example, the additional resin layer 38 (adjacent to the deep portion 78) can be removed to form the recess 12, and then the step portion 82 of the resin layer 18 can be etched to expose the underlying sacrificial layer 48.

[0305] As shown in FIG. 13E, the functionalized layer 20A can then be applied using any suitable deposition technique. In this example, the functionalized layer 20A is deposited over the additional resin layer 38 within the recess 12, over any exposed portion of the sacrificial layer 48, and over any exposed portion of the resin layer 18.

[0306] Next, the sacrificial layer 48 adjacent to the shallow portion 80 is removed to expose another portion 38''' of the additional resin layer 38 (see FIG. 13F). Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized layer 20A is covalently bonded to the additional resin layer 38 and thus is not removed during the sacrificial layer etching. Further, since the resin layer 18 is resistant to sacrificial layer etching, the functionalized layer 20A on the resin layer 18 is also not removed during the sacrificial layer etching. However, the functionalized layer 20A on the sacrificial layer 48 is removed. The additional resin layer 38 can function as an etching stop for the sacrificial layer etching, for example, when the additional resin layer 38 has an etching rate different from that of the sacrificial layer 48. The exposed portion 38''' of the additional resin layer 38 has not been etched as described with reference to FIG. 13D and is thus raised compared to the bottom of the recess 12. This is illustrated in FIG. 13F.

[0307] As shown in FIG. 13G, the functionalized layer 20B can be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited on the exposed portion 38''' of the additional resin layer 38. In this example, when the deposition of the functionalized layer 20B is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second functionalized layer 20B does not deposit on or adhere to the first functionalized layer 20A. Thus, the functionalized layer 20B does not contaminate the functionalized layer 20A.

[0308] Next, the remaining resin layer 18 and the sacrificial layer 48 may be etched once using an etchant suitable for the resin layer 18 and then etched for the sacrificial layer 48. The removal of the remaining resin layer 18 (and any functionalized layer 20A thereon) and the sacrificial layer 48 exposes the remaining portion of the additional resin layer 38, in this example the gap region 26. The functionalized layers 20A, 20B remain intact on the additional resin layer 38, in part because the functionalized layers 20A, 20B are covalently bonded to the additional resin layer 38.

[0309] In some examples, primers 54, 56 or 54', 56' (not shown in FIGS. 13A - 13H) can be pre - grafted onto the functionalized layer 20A. Similarly, primers 58, 60 or 58', 60' (not shown in FIGS. 13A - 13H) can be pre - grafted onto the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0310] In other examples, primers 54, 56 or 54', 56' are not pre - grafted onto the functionalized layer 20A. In these examples, primers 54, 56 or 54', 56' can be grafted after the functionalized layer 20A has been applied (e.g., FIG. 13E). In these examples, primers 58, 60 or 58', 60' can be pre - grafted onto the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58', 60' may not be pre - grafted onto the second functionalized layer 20B. Rather, primers 58, 60 or 58', 60' can be grafted after the second functionalized layer 20B has been applied (e.g., FIG. 13G), provided that i) the functionalized layer 20B has different functional groups (from the functionalized layer 20A) for attaching to primers 58, 60 or 58', 60', or ii) any unreacted functional groups of the functionalized layer 20A are quenched, for example, using Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0311] When grafting is performed during the process, the grafting can be achieved using any suitable grafting technique such as those disclosed herein. In either grafting method, primers 54, 56 or 54', 56' react with the reactive groups of the functionalized layer 20A, or primers 58, 60 or 58', 60' react with the reactive groups of the functionalized layer 20B and have no affinity for the base support 22.

[0312] In this example of the flow cell 10J, one of the functionalized layers 20A is confined within the recess 12, and the other functionalized layer 20B is defined over a portion of the gap region 26 adjacent to the recess 12.

[0313] Figures 13A - 13H show the formation of a single set of functionalized layers 20A and 20B, but it should be understood that an array of similar functionalized layers 20A and 20B can be formed, for example, with each set being isolated from the others by a gap region 26.

[0314] In Figures 14A - 14J, the multilayer stack 14 includes a resin layer 18 on a poly(methyl methacrylate) lift - off layer 42 on a sacrificial layer 48 on an additional resin layer 38 on a base support 22.

[0315] Before forming the multilayer stack 14 on the base support 22, the base support 22 may be activated using silanization. The surface of the resin layer 38 under the sacrificial layer 48 functions like an ashed surface, and thus activation of this resin layer 38 is not performed.

[0316] The additional resin layer 38 can be deposited on the base support 22 using any suitable deposition technique, including those disclosed herein, and cured using conditions suitable for the resin.

[0317] The sacrificial layer 48 can be applied to the additional resin layer 38 using any suitable technique, such as those disclosed herein. Examples of suitable materials for the sacrificial layer 48 include any of those described herein, such as silicon, aluminum, negative or positive photoresist, copper, etc.

[0318] Next, the poly(methyl methacrylate) lift - off layer 42 can be deposited on the sacrificial layer 48 using any suitable technique and cured using heat.

[0319] Next, the resin layer 18 can be applied to the poly(methyl methacrylate) lift - off layer 42. The resin layer 18 can be any of the examples described herein and can be deposited using any suitable deposition technique.

[0320] Next, the resin layer 18 is imprinted to form a concave region 40, which, in this example, includes a shallow portion 80 that is partially defined by a deep portion 78 and a step portion 82 of the resin layer 18. As shown in FIG. 14A, the working stamp 24 is pressed into the resin layer 18 while the resin layer 18 is soft, creating an imprint of the working stamp features in the resin layer 18. The resin layer 18 can then be cured with the working stamp 24 in a predetermined position. Curing can be achieved by exposure to actinic radiation or heat, as described herein.

[0321] After curing, the working stamp 24 is removed. This creates various topographical features in the resin layer 18. In this exemplary method, since the working stamp 24 does not extend through the entire depth of the resin layer 18 in the deep portion 78, a portion 18'' of the resin layer 18 forms the bottom of the concave region 40 in the deep portion 78.

[0322] Next, a recess 12 (shown in FIG. 14D) is formed, which is formed by etching a first portion 18'' of the resin layer 18 under the deep portion 78 (FIG. 14B), etching a portion of the poly(methyl methacrylate) lift-off layer 42 under the deep portion 78 (FIG. 14B), and etching a portion of the sacrificial layer 48 under the deep portion 78 (FIG. 14D).

[0323] Referring now to FIG. 14B, the deep portion 78 of the concave region 40 is extended to the surface of the sacrificial layer 48 by selectively etching a portion of the resin layer portion 18'' and a portion of the poly(methyl methacrylate) lift-off layer 42 (under the resin layer portion 18''). Each of these layers 18 and 42 is selected to have a different etching rate, and thus, when etching the resin layer 18, the poly(methyl methacrylate) lift-off layer 42 acts as an etching stop.

[0324] For the resin layer 18, etching can be performed using anisotropic oxygen plasma. Any exposed area of the resin layer 18 can be etched during this process, as indicated by the downward arrow in FIG. 14B. As described above, the poly(methyl methacrylate) lift-off layer 42 acts as a stop for the etching of the concave region 40 when the resin layer portion 18'' is removed. This first etching process can be stopped when the poly(methyl methacrylate) lift-off layer 42 is exposed to the deep portion 78 of the concave region 40, and thus the entire resin layer 18 is not etched away (as shown in FIG. 12B). Further, the depth of the step portion 82 can also be selected before imprinting so that the portion of the poly(methyl methacrylate) lift-off layer 42 below the step portion 82 is not exposed during this first etching process. Thus, the depth of the step portion 82 may be greater than the depth of the resin layer portion 18''.

[0325] For the portion of the poly(methyl methacrylate) lift-off layer 42 under the resin layer portion 18'', reactive ion etching (e.g., O2 or O2 / CHF3) or CF4 / O2 plasma etching or 100% O2 plasma etching can be used. Any area of the poly(methyl methacrylate) lift-off layer 42 exposed in the concave region 40 can be etched during this process. The sacrificial layer 48 acts as a stop for the etching of the deep portion 78 of the concave region 40 when the portion of the poly(methyl methacrylate) lift-off layer 42 is removed. As shown in FIG. 14B, after performing this etching process, any covered portion of the poly(methyl methacrylate) lift-off layer 42 remains intact.

[0326] Before etching the sacrificial layer 48 of the deep portion 78, this exemplary method may further include etching the resin layer 18 to remove the step portion 82 and exposing a second portion of the poly(methyl methacrylate) lift-off layer 42. This is illustrated in FIG. 14C. The etching of the resin layer 18 may be performed as described herein, and the poly(methyl methacrylate) lift-off layer 42 under the step portion 82 acts as an etching stop. The exposed sacrificial layer 48 is not etched during this process (as shown in FIG. 14C) because it has an etching rate different from that of the resin layer 18.

[0327] The deep portion 78 is then further extended onto the surface of the additional resin layer 38, and a recess 12 is formed in the additional resin layer 38 adjacent to the deep portion 78. This is shown in FIG. 14D. This process may involve selectively etching the exposed portion of the sacrificial layer 48 (adjacent to the deep portion 78). In this example, the additional resin layer 38 acts as an etching stop for the sacrificial layer etching process.

[0328] This exemplary method may further include etching the poly(methyl methacrylate) lift-off layer 42 of the shallow portion 80. This is illustrated in FIG. 14E. The etching of the exposed portion of the poly(methyl methacrylate) lift-off layer 42 (of the shallow portion 80) may be performed as described herein, and the underlying sacrificial layer 48 acts as an etching stop. The exposed portion 38'' of the additional resin layer 38 is not etched during this process (as shown in FIG. 14E) because it has an etching rate different from that of the poly(methyl methacrylate) lift-off layer 42.

[0329] As shown in FIG. 14F, the functionalized layer 20A may be applied using any suitable deposition technique. In this example, the functionalized layer 20A is deposited over the exposed portion 38'' of the additional resin layer 38 of the recess 12, over any exposed portion of the sacrificial layer 48, and over any exposed portion of the resin layer 18.

[0330] Next, the sacrificial layer 48 adjacent to the shallow portion 80 is removed to expose another portion of the additional resin layer 38 adjacent to the functionalized layer 20A on the additional resin layer 38. This is illustrated in FIG. 14G. Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized layer 20A is covalently bonded to the additional resin layer 38 and thus is not removed during the sacrificial layer etching. Further, since the resin layer 18 is resistant to sacrificial layer etching, the functionalized layer 20A on the resin layer 18 is also not removed during the sacrificial layer etching. However, the functionalized layer 20A on the sacrificial layer 48 is removed. The additional resin layer 38 can function as an etching stop for the sacrificial layer etching, for example, when the additional resin layer 38 has an etching rate different from that of the sacrificial layer 48.

[0331] As shown in FIG. 14H, the functionalized layer 20B can be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited on the exposed portion of the additional resin layer 38. In this example, when the deposition of the functionalized layer 20B is performed under high ionic strength (e.g., in the presence of 10×PBS, NaCl, KCl, etc.), the second functionalized layer 20B does not deposit on or adhere to the first functionalized layer 20A. Thus, the functionalized layer 20B does not contaminate the functionalized layer 20A.

[0332] Next, lift-off of the remaining poly(methyl methacrylate) lift-off layer 42 can be performed. As shown in FIG. 14I, the lift-off process removes the poly(methyl methacrylate) lift-off layer 42, the resin layer 18, and the functionalized layer 20A that overlaps the remaining poly(methyl methacrylate) lift-off layer 42. This lift-off process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper. Removal of the poly(methyl methacrylate) lift-off layer 42 exposes any remaining portions of the sacrificial layer 48.

[0333] Next, as indicated by the downward arrow in FIG. 14J, any remaining portions of the sacrificial layer 48 are removed using an etching process suitable for the particular sacrificial layer 48. The functionalized layers 20A, 20B remain intact on the additional resin layer 38, in part because the functionalized layers 20A, 20B are covalently bonded to the additional resin layer 38. ***

[0334] In some examples, primers 54, 56 or 54', 56' (not shown in FIGS. 14A - 14J) can be pre-grafted onto the functionalized layer 20A. Similarly, primers 58, 60 or 58', 60' (not shown in FIGS. 14A - 14J) can be pre-grafted onto the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0335] In other examples, primers 54, 56 or 54', 56' are not pre-grafted onto the functionalized layer 20A. In these examples, primers 54, 56 or 54', 56' can be grafted after the functionalized layer 20A has been applied (e.g., FIG. 14F). In these examples, primers 58, 60 or 58', 60' can be pre-grafted onto the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58', 60' may not be pre-grafted onto the second functionalized layer 20B. Rather, primers 58, 60 or 58', 60' can be grafted after the second functionalized layer 20B has been applied (e.g., FIG. 14H), provided that i) the functionalized layer 20B has a different functional group (than the functionalized layer 20A) for attachment to the primers 58, 60 or 58', 60', or ii) any unreacted functional groups of the functionalized layer 20A are quenched using, for example, Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0336] When the grafting is carried out during the process, the grafting can be achieved using any suitable grafting technique such as those disclosed herein. In any of the grafting methods, the primers 54, 56 or 54’, 56’ react with the reactive groups of the functionalized layer 20A, or the primers 58, 60 or 58’, 60’ react with the reactive groups of the functionalized layer 20B and have no affinity for the additional resin layer 38.

[0337] In this example of the flow cell 10K, the functionalized layers 20A, 20B are not limited within the recess 12 (as in the flow cell 10H). Rather, the functionalized layers 20A, 20B form respective patches or pads 46A, 46B isolated by the adjacent gap regions 26 of the additional resin layer 38.

[0338] Figures 14A - 14J show the formation of a single set of functionalized layers 20A, 46A and 20B, 46B, but it should be understood that an array of patches or pads 46A, 46B can be formed such that each set of patches or pads 46A, 46B is isolated by the gap region 26 of the additional resin layer 38 for each set of patches or pads 46A, 46B.

[0339] Further exemplary methods for fabricating other examples of the flow cells 10L, 10M are shown in Figures 15A - 15K. One method is shown in Figures 15A - 15H and another method is shown in Figures 15A - 15D and Figures 15I - 15K. These figures illustrate a recess 12A defined in a single - layer substrate 68. It should be understood that this method can be used, for example, with a multi - layer substrate including a base support 22 and a resin layer 18 thereon.

[0340] As shown in FIG. 15A, the recess 12A defined in the single-layer substrate 68 includes a deep portion 78 and a shallow portion 80 that is partially defined by a step portion 82. The recess 12A may be defined via imprinting, etching, etc., depending on the type of substrate 68 used. After forming the recess 12A, the single-layer substrate 68 may be activated using silanization or plasma ashing to generate surface groups, which can subsequently react with the functionalized layer 20A deposited thereon.

[0341] As shown in FIG. 15B, the first functionalized layer 20A is applied over the recess 12A. The first functionalized layer 20A can be any of the examples disclosed herein and can be deposited using any of the techniques described herein.

[0342] In FIGS. 15C-15E, the first functionalized layer 20A is then patterned to form a first functionalized region (region 84 shown in FIG. 15E) covered by a photoresist 50. Any photoresist can be used. In other examples, a lift-off resist is used instead of a photoresist.

[0343] As shown in FIG. 15C, the photoresist 50 is first applied to the first functionalized layer 20A. The entire photoresist 50 can be developed to form insoluble portions, as a result of which it can be exposed to an etching process.

[0344] Next, using a timed dry etching process, portions of the photoresist 50 and the functionalized layer 20A can be removed from the single-layer substrate 68, including from the surface, a shallow portion 80, and a portion of the deep portion 78. As shown in FIG. 15D, the timed dry etching is stopped such that the first functionalized layer 20A and the photoresist 50 remain in a portion of the deep portion 78 adjacent to the stepped portion 82. In one example, the timed dry etching can involve reactive ion etching (e.g., using CF4), and the photoresist 50 is etched at a rate of about 17 nm / min. In another example, the timed dry etching can involve 100% O2 plasma etching, and the photoresist 50 is etched at a rate of about 98 nm / min.

[0345] During the etching of the photoresist 50, the functionalized layer 20A can also be removed. A combustion reaction can be performed to convert the functionalized layer 20A to carbon dioxide and water and exhaust it from the etching chamber.

[0346] As indicated by the downward arrow in FIG. 15E, the single-layer substrate 68 is then etched to i) create a gap region 26 that is at least substantially coplanar with the surface of the first functionalized layer 20A, leaving a photoresist region 50 in the portion of the deep portion 78, and ii) create a second recess 12B adjacent to the first functionalized layer 20A and can also leave a photoresist region 50 in the portion of the deep portion 78. This is a dry etching process selected based on the material of the single-layer substrate 68. This etching process is also timed. In one example, this timed dry etching can involve or be related to 90% CF4 and 10% O2, and the single-layer substrate 68 is etched at a rate of about 42 nm / min. In another example, the timed dry etching can involve reactive ion etching (e.g., using O2), and the single-layer substrate 68 is etched at a rate of about 4 nm / min. This process can also remove the first functionalized layer 20A not covered by the photoresist 50.

[0347] As shown in FIG. 15F, the functionalized layer 20B can be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited over the gap region 26 and the photoresist 50. In this example, any suitable deposition technique can be used, in part because the first functionalized layer 20A is covered.

[0348] Next, removal of the photoresist 50 can be performed. As shown in FIG. 15G, this process removes the photoresist 50 and the functionalized layer 20B that overlays the remaining photoresist 50. This removal process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper, or another suitable remover for the particular photoresist. This exposes the functionalized layer 20A, and thus the functionalized region 84.

[0349] In FIG. 15H, the functionalized layer 20B over the gap region 26 is removed. This removal involves polishing the functionalized layer 20B from the gap region 26, as described herein. This leaves a functionalized region 86 adjacent to the functionalized region 84. FIG. 15H illustrates the flow cell 10L.

[0350] Referring again to FIG. 15D, the timed dry etching of the photoresist is stopped such that the first functionalized layer 20A and the photoresist 50 remain in the portion of the deep portion 78 adjacent the step portion 82. Unlike the example shown in FIG. 15E, this exemplary method does not include etching away the step portion 82.

[0351] Rather, this exemplary method then continues to FIG. 15I, where the functionalized layer 20B can then be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited over the gap region 26, the step portion 82, and the photoresist 50. In this example, any suitable deposition technique can be used, in part because the first functionalized layer 20A is covered.

[0352] Next, the removal of the photoresist 50 can be performed. As shown in FIG. 15J, this process removes the photoresist 50 and the functionalized layer 20B that overlays the remaining photoresist 50. This removal process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper, or any other suitable remover for the photoresist 50.

[0353] In FIG. 15K, the functionalized layer 20B on the gap region 26 is removed. This removal involves polishing the functionalized layer 20B from the gap region 26 as described herein. The polishing may or may not remove the functionalized layer 20B from the sidewalls of the recess 12A. This leaves the functionalized region 86 adjacent to the functionalized region 84. FIG. 15K illustrates the flow cell 10M.

[0354] In some examples, the primers 54, 56 or 54’, 56’ (not shown in FIGS. 15A - 15K) can be pre-grafted onto the functionalized layer 20A. Similarly, the primers 58, 60 or 58’, 60’ (not shown in FIGS. 15A - 15K) can be pre-grafted onto the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0355] In other examples, primers 54, 56 or 54', 56' are not pre-grafted onto the functionalized layer 20A. In these examples, primers 54, 56 or 54', 56' can be grafted after the functionalized layer 20A has been applied (e.g., FIG. 15B). In these examples, primers 58, 60 or 58', 60' can be pre-grafted onto the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58', 60' may not be pre-grafted onto the second functionalized layer 20B. Rather, primers 58, 60 or 58', 60' may be grafted after the second functionalized layer 20B has been applied (e.g., FIGS. 15F, 15G, or 15H, or FIGS. 15I, 15J or 15K), provided that i) the functionalized layer 20B has a different functional group (than the functionalized layer 20A) for attachment to primers 58, 60 or 58', 60', or ii) any unreacted functional groups of the functionalized layer 20A have been quenched, e.g., using Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0356] If the grafting is carried out during the process, the grafting can be achieved using any suitable grafting technique such as those disclosed herein. In any of the grafting methods, primers 54, 56 or 54', 56' react with the reactive groups of the functionalized layer 20A, or primers 58, 60 or 58', 60' react with the reactive groups of the functionalized layer 20B and have no affinity for the single-layer substrate 68.

[0357] In these examples of flow cells 10L, 10M, the functionalized regions 84, 86 are limited within the recesses. In FIG. 15H, the recess includes a portion of 12A and 12B (as in flow cell 10H). In FIG. 15K, the recess is recess 12A. In an array, each region 84, 86 within a recess can be isolated from each region 84, 86 within another recess by an adjacent gap region 26.

[0358] Another exemplary method for fabricating another example of the flow cell 10N is shown in FIGS. 16A-16I. These figures illustrate, for example, a recess 12A defined in the resin layer 18 of a multilayer substrate that includes a base support 22 and a resin layer 18 thereon.

[0359] First in the method shown in FIGS. 16A-16I, the base support 22 can be activated using silanization or plasma ashing to generate surface groups that can react with the functionalized layers 20A, 20B.

[0360] As shown in FIG. 16A, the recess 12A defined in the resin layer 18 includes a deep portion 78 and a shallow portion 80 that is partially defined by a step portion 82. The recess 12A may be defined via imprinting, etching, etc., depending on the type of resin layer 18 used.

[0361] Referring to FIG. 16B, the deep portion 78 of the recess 12A is extended to the surface of the base support 22 by selectively etching the resin layer 18 (e.g., the portion 18'' shown in FIG. 16A). Each of these layers 18 and 22 is selected to have a different etching rate, and thus, when etching the resin layer 18, the base support 22 acts as an etching stop.

[0362] Regarding the resin layer 18, etching can be performed using anisotropic oxygen plasma. Any exposed area of the resin layer 18 can be etched during this process, as indicated by the downward arrow in FIG. 16B. As described above, the base support 22 acts as a stop for the etching of the recess 12A when the resin layer portion 18'' is removed. This etching process can be stopped when the base support 22 is exposed to the deep portion 78 of the recess 12A, and thus the entire resin layer 18 is not etched away (as shown in FIG. 16B). Further, the depth (or thickness) of the step portion 82 can also be selected before imprinting such that the portion of the base support 22 underlying the step portion 82 is not exposed during this etching process. Thus, the depth (or thickness) of the step portion 82 may be greater than the depth (or thickness) of the resin layer portion 18'' (FIG. 16A).

[0363] As shown in FIG. 16C, the first functionalized layer 20A is applied over the recess 12A and thus over the exposed portion of the base support 22. The first functionalized layer 20A can be any of the examples disclosed herein and can be deposited using any of the techniques described herein.

[0364] The first functionalized layer 20A is then patterned to form a first functionalized region (region 84) covered by the photoresist 50. Any photoresist can be used. In other examples, a lift-off resist is used instead of a photoresist.

[0365] As shown in FIG. 16D, the photoresist 50 is first applied to the first functionalized layer 20A. The entire photoresist 50 can be developed to form insoluble portions, which can then be exposed to an etching process.

[0366] Next, using a timed dry etching process, portions of the photoresist 50 and the functionalized layer 20A can be removed from the resin layer 18, including from the shallow portion 80 and a portion of the deep portion 78. As shown in FIG. 16E, the timed dry etching stops such that the first functionalized layer 20A and the photoresist 50 remain in a portion of the deep portion 78 adjacent to the stepped portion 82. In one example, the timed dry etching can involve reactive ion etching (e.g., using CF4), and the photoresist 50 is etched at a rate of about 17 nm / min. In another example, the timed dry etching can involve 100% O2 plasma etching, and the photoresist 50 is etched at a rate of about 98 nm / min.

[0367] During etching of the photoresist 50, the functionalized layer 20A can also be removed. A combustion reaction can be performed to convert the functionalized layer 20A to carbon dioxide and water and exhaust it from the etching chamber.

[0368] As indicated by the downward arrow in FIG. 16F, the resin layer 18 is then etched again to i) create a gap region 26 that is at least substantially coplanar with the surface of the first functionalized layer 20A, leaving a photoresist region 50 in a portion of the deep portion 78, and ii) create a second recess 12B adjacent to the first functionalized layer 20A and also leaving a photoresist region 50 in a portion of the deep portion 78. This is a dry etching process selected based on the material of the resin layer 18. This etching process is also timed. In one example, this timed dry etching can involve or be related to 90% CF4 and 10% O2, and the resin layer 18 is etched at a rate of about 42 nm / min. In another example, the timed dry etching can involve reactive ion etching (e.g., using O2), and the resin layer 18 is etched at a rate of about 4 nm / min. This process can also remove the first functionalized layer 20A not covered by the photoresist 50.

[0369] As shown in FIG. 16G, the functionalized layer 20B can be applied using any suitable deposition technique. In this example, the functionalized layer 20B is deposited over the gap region 26 and the photoresist 50. In this example, any suitable deposition technique can be used, for one reason that the first functionalized layer 20A is covered.

[0370] Next, removal of the photoresist 50 can be performed. As shown in FIG. 16H, this process removes the photoresist 50 and the functionalized layer 20B that overlays the remaining photoresist 50. This removal process can be performed using sonication in dimethyl sulfoxide (DMSO), or in acetone, or using an NMP (N-methyl-2-pyrrolidone)-based stripper, or any other suitable remover of the photoresist 50. This process also exposes the functionalized layer 20A, and thus the functionalized region 84.

[0371] In FIG. 16I, the functionalized layer 20B over the gap region 26 is removed. This removal involves polishing the functionalized layer 20B from the gap region 26, as described herein. This leaves a functionalized region 86 adjacent to the functionalized region 84. FIG. 16I illustrates the flow cell 10N.

[0372] In some examples, primers 54, 56 or 54', 56' (not shown in FIGS. 16A-16I) can be pre-grafted to the functionalized layer 20A. Similarly, primers 58, 60 or 58', 60' (not shown in FIGS. 16A-16I) can be pre-grafted to the second functionalized layer 20B. In these examples, no additional primer grafting is performed.

[0373] In other examples, primers 54, 56 or 54', 56' are not pre-grafted to the functionalized layer 20A. In these examples, primers 54, 56 or 54', 56' can be grafted after the functionalized layer 20A has been applied (e.g., FIG. 16C). In these examples, primers 58, 60 or 58', 60' can be pre-grafted to the second functionalized layer 20B. Alternatively, in these examples, primers 58, 60 or 58', 60' may not be pre-grafted to the second functionalized layer 20B. Rather, primers 58, 60 or 58', 60' may be grafted after the second functionalized layer 20B has been applied (e.g., FIGS. 16G, 16H, or 16I), provided that i) the functionalized layer 20B has different functional groups (from the functionalized layer 20A) for attachment to primers 58, 60 or 58', 60', or ii) any unreacted functional groups of the functionalized layer 20A are quenched using, for example, Staudinger reduction to an amine or an additional click reaction with a passive molecule such as hexynoic acid.

[0374] If the grafting is performed during the process, the grafting can be accomplished using any suitable grafting technique such as those disclosed herein. In any of the grafting methods, primers 54, 56 or 54', 56' react with the reactive groups of the functionalized layer 20A, or primers 58, 60 or 58', 60' react with the reactive groups of the functionalized layer 20B and do not have an affinity for the single-layer substrate 68.

[0375] In this example of the flow cell 10N, the functionalized regions 84, 86 are limited within a recess that includes portions of 12A and 12B (as in the flow cell 10H). In an array, each region 84, 86 within the recess can be isolated from each region 84, 86 in another recess by an adjacent gap region 26.

[0376] To further illustrate the present disclosure, examples are provided herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure. Non-limiting examples

[0377] Using an example of the method described with reference to FIGS. 12A-12H, PAZAM grafted with P5 primer and PAZAM grafted with P7 primer were deposited to form isolated pairs of patches / pads (each pair was similar to the patches / pads 46A, 46B shown in FIG. 12H).

[0378] In this example, glass was used as the base support and the multilayer stack was positioned on the glass. The multilayer stack included a first layer of nanoimprint lithography resin, an aluminum sacrificial layer, a poly(methyl methacrylate) lift-off layer, and a second layer of nanoimprint lithography resin.

[0379] Using a working stamp, the second layer of nanoimprint lithography resin was patterned as shown in FIG. 12A. Each layer was selectively removed using anisotropic oxygen plasma (for the first and second layers of nanoimprint lithography resin), CF4 / O2 plasma etching (for the poly(methyl methacrylate) lift-off layer), and diluted KOH-based photoresist developer (for the aluminum sacrificial layer) in a manner similar to that shown in FIGS. 12B-12D. These processes formed several isolated recesses, each of which was similar to the recess 12 shown in FIG. 12D.

[0380] Next, PAZAM was deposited. All the recesses were coated along with any exposed portions of the layers of the multilayer stack. Then, P5 primer was grafted onto the PAZAM. All unreacted azides were quenched by hexanoic acid grafting.

[0381] Selective etching (using KOH) was performed to remove the aluminum sacrificial layer in the region adjacent to the PAZAM (grafted with P5 primer) within the recesses. This exposed the region of the glass directly adjacent to the PAZAM patches / pads (grafted with P5 primer).

[0382] Next, PAZAM was deposited under high ionic strength (e.g., in the presence of 10×PBS). This formed patches / pads of PAZAM adjacent to the PAZAM grafted with the P5 primer within the recesses. Next, the P7 primer was newly grafted onto the PAZAM. The quenched azides on the PAZAM grafted with the P5 primer prevented the grafting of the P7 primer.

[0383] Next, the remaining poly(methyl methacrylate) lift-off layer was lift-off using acetone. Removal of the poly(methyl methacrylate) lift-off layer also removed the PAZAM (grafted with the P5 primer) positioned thereon, exposing any remaining portions of the aluminum sacrificial layer adjacent to the patches / pads. The remaining aluminum sacrificial layer was removed using a KOH etching process.

[0384] Next, oligonucleotides complementary to each of P5 and P7 were introduced onto the glass substrate with the pads / patches formed thereon. The complementary P5 oligo (P5’) had an Alexa Fluor™ 488 dye (manufactured by Thermo Fisher Scientific) attached thereto, and the complementary P7 oligo (P7’) had an Alexa Fluor™ 647 dye (manufactured by Thermo Fisher Scientific) attached thereto. Each oligo was hybridized to its respective primer. The surface was exposed to a 488 nm laser and a microscopic image was acquired. This image is shown in black and white in FIG. 17A. Next, the surface was exposed to a 647 nm laser and a microscopic image was acquired. This image is shown in black and white in FIG. 17B.

[0385] The gray regions in each of FIGS. 17A and 17B represent the patches / pads of the respective hydrogels. In FIG. 17A, the Alexa Fluor (TM) 488 dye (manufactured by Thermo Fisher Scientific) was excited. The gray region in FIG. 17A (which was green in the original image) corresponds to a patch / pad of PAZAM grafted with the P5 primer (having an Alexa Fluor (TM) 488 dye-labeled oligo hybridized thereto). In FIG. 17B, the Alexa Fluor (TM) 647 dye (manufactured by Thermo Fisher Scientific) was excited. The gray region in FIG. 17B (which was purple in the original image) corresponds to a patch / pad of PAZAM grafted with the P7 primer (having an Alexa Fluor (TM) 647 dye-labeled oligo hybridized thereto).

[0386] The images of FIGS. 17A and 17B show that the method resulted in the formation of isolated patches / pads, and within each patch / pad, the PAZAM grafted with the P5 primer was positioned on the right side and the PAZAM grafted with the P7 primer was positioned on the left side. Using these methods, different primer sets can be selectively positioned, which may be particularly suitable for simultaneous paired-end sequencing.

[0387] Addendum

[0388] It is to be understood that all combinations of the foregoing concepts and additional concepts, to be discussed in more detail below, are intended to be part of the subject matter of the invention disclosed herein (to the extent that the concepts are not mutually inconsistent). In particular, all combinations of the claimed subject matter that appear at the end of this disclosure are intended to be part of the subject matter of the invention disclosed herein. It is also to be understood that any terms that explicitly appear in, and may also appear in all disclosures incorporated by reference herein, should be given the meaning that most closely matches the particular concepts disclosed herein.

[0389] References throughout this specification to "one example", "another example", "an example", etc., mean that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. Additionally, it should be understood that, unless the context clearly dictates otherwise, elements described with respect to any example may be combined in any suitable manner in various examples.

[0390] Although some examples have been described in detail, it should be understood that the disclosed examples may be modified. Accordingly, the foregoing description should be considered non-limiting.

Claims

1. A flow cell comprising a base support, a multi-layer stack, and a recess, wherein the multi-layer stack is positioned on the base support, comprising a resin layer positioned on the base support, and a hydrophobic layer positioned on the resin layer, the resin layer contains resin, the hydrophobic layer contains a hydrophobic material, and the recess is defined in the multi-layer stack using the hydrophobic material and a portion of the resin, a first region of the recess comprises a first polymer hydrogel, and a first primer set attached to the first polymer hydrogel, a second region of the recess comprises a second polymer hydrogel, and a second primer set attached to the second polymer hydrogel, wherein the first primer set is different from the second primer set, a flow cell.

2. The first primer set comprises a non-cuttable first primer and a cuttable second primer, the second primer set comprises a cuttable first primer and a non-cuttable second primer, the flow cell according to claim 1.

3. The hydrophobic material is selected from the group consisting of fluorinated polymers, perfluorinated polymers, silicone polymers, and mixtures thereof, the flow cell according to claim 1.

4. The first and second polymer hydrogels have the same surface chemistry, the flow cell according to claim 1.

5. The resin is selected from the group consisting of polyhedral oligomeric silsesquioxane-based resins, epoxy resins, poly(ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof, the flow cell according to claim 1.

6. Defining a recess in a multi-layer stack comprising a hydrophobic layer on a resin layer, and imprinting using the depth of the hydrophobic layer and a portion of the depth of the resin layer, wherein the resin layer contains resin and the hydrophobic layer contains a hydrophobic material, applying a sacrificial layer on a first portion of the recess, thereby exposing a second portion of the recess, applying a first functionalized layer on the sacrificial layer and on the second portion of the recess, removing the sacrificial layer to expose the first portion of the recess, and applying a second functionalized layer on the first portion of the recess. Grafting one primer set onto the first functionalized layer; Including grafting another primer set onto the second functionalized layer, where the one primer set is different from the another primer set, method. **Claim 7**: The resin is selected from the group consisting of polyhedral oligomeric silsesquioxane - based resins, epoxy resins, poly(ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof; The hydrophobic material is selected from the group consisting of fluorinated polymers, perfluorinated polymers, silicone polymers, and mixtures thereof, the method according to claim 6. **Claim 8**: The application of the second functionalized layer is carried out under high ionic strength, the method according to claim 6. **Claim 9**: Pre - grafting the one primer set onto the first functionalized layer; Pre - grafting the another primer set onto the second functionalized layer, the method according to claim 6. **Claim 10**: After applying the first functionalized layer, grafting the one primer set onto the first functionalized layer; After applying the second functionalized layer, further including grafting the another primer set onto the second functionalized layer, the method according to claim 6. **Claim 11**: The one primer set includes a non - cleavable first primer and a cleavable second primer; The another primer set includes a cleavable first primer and a non - cleavable second primer, the method according to claim 9 or 10. **Claim 12**: The sacrificial layer is aluminum; Removing the sacrificial layer includes selective etching under acidic or basic conditions, the method according to claim 6. **Claim 13**: The sacrificial layer is copper; Removing the sacrificial layer includes selective etching using FeCl₃, the method according to claim 6. **Claim 14**: The sacrificial layer is a negative or positive photoresist; Removing the sacrificial layer includes selective etching using an organic solvent, the method according to claim 6. **Claim 15**: The sacrificial layer is silicon; Removing the sacrificial layer includes selective etching under basic conditions, the method according to claim 6.

Images