Antibodies that specifically bind to CD47 and antigen-binding fragments thereof

Abstract

The present invention provides an antibody and an antigen-binding fragment thereof that specifically bind to CD47, which have high specificity and stability, can specifically block the CD47-SIPRα pathway, does not cause erythrocyte aggregation within a certain concentration range, and can significantly inhibit tumor growth in vivo.

Description

Technical Field

[0001] The present invention relates to the field of antibody and antibody humanization modification research. In particular, the present invention relates to an antibody capable of specifically binding to CD47 and its antigen-binding fragment.

Background Art

[0002] CD47, also known as integrin associated protein (IAP), belongs to the immunoglobulin superfamily. Its structure mainly includes an extracellular immunoglobulin variable region-like domain, a highly hydrophobic five-transmembrane region, and a cytoplasmic tail region of the intracellular carboxyl terminus by alternative splicing. CD47 is widely expressed on the cell surface and can bind to the signal regulatory protein SIPRα, integrin, and thrombospondin TSP1, and is related to various physiological functions. Its main function is to inhibit the phagocytosis of macrophages by binding to SIPRα on the surface of phagocytic cells. SIPRα is also a member of the immunoglobulin superfamily and has an immunoreceptor tyrosine-based inhibitory motif (ITIM) rich in tyrosine in the intracellular region. When CD47 binds to SIPRα on the surface of macrophages, ITIM is phosphorylated and binds to downstream molecules SHP1 / SHP2, preventing the accumulation of myosin in the phagocytosis synapse submembrane and inhibiting phagocytosis. Usually, CD47 is a "self" signal, indicating "don't eat me" and can inhibit self-attack by phagocytosis. In pathological situations, CD47 is highly expressed in tumor cells and contributes to the escape of tumor cells from the surveillance of phagocytic cells (Science, 2000, 288(5473): 2051-2054; Trends in Cell Biology, 2001, 11(3): 130-135.).

[0003] According to tumor research, CD47 has been found to be expressed in a variety of human tumors, including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin lymphoma, multiple myeloma, bladder cancer, and other solid tumors. Tumor cells evade macrophage immune surveillance by upregulating high expression of CD47 and binding to SIPRα. Therefore, by blocking the interaction between CD47 and SIPRα (CD47 antibody or SIPRα-Fc), the phagocytic activity of macrophages against tumors can be activated, and the specific killing effect of CD8+ T cells against tumors can be exerted by presenting antigens from DC cells to CD8+ T cells (Current Opinion in Immunology, 2012, 24(2):225-232; Nature Medicine, 2015, 21(10):1209.).

[0004] Since CD47 is expressed in most tumor cells, antibodies that block the CD47-SIPRα pathway have broad application prospects and wide anti-tumor applications. According to research, CD47 is an immune checkpoint, and the efficacy can be enhanced by combining CD47 antibodies with drugs against other immune checkpoints CTLA4 / PD-1. However, since CD47 is also expressed on red blood cells, it is necessary to consider the safety of CD47 antibodies. According to research, for macrophages to exert phagocytic activity, in addition to blocking the "don't eat me" signal of CD47, a "eat me" signal via calreticulin (CRT) is required. Usually, calreticulin is highly expressed in tumor cells but not in normal cells. Also, when screening CD47 antibodies, selecting antibodies that do not cause red blood cell aggregation and adopting IgG4 type as the antibody can prevent macrophages from activating phagocytosis of red blood cells. There is still a need for CD47 antibodies in this field. Summary of the Invention

[0005] According to a first aspect, the present invention relates to an isolated anti-human CD47 antibody, an antigen-binding fragment thereof or a variant thereof, wherein the antibody or its antigen-binding fragment comprises a light chain variable region and / or a heavy chain variable region, wherein the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the light chain variable region are shown in SEQ ID No. 1, 2, and 3, respectively, and / or the amino acid sequence of HCDR1 of the heavy chain variable region is shown in SEQ ID No. 4, the amino acid sequence of HCDR2 of the heavy chain variable region has at least about 94% identity with SEQ ID No. 5 or 6, and the amino acid sequence of HCDR3 of the heavy chain variable region has at least about 78% identity with SEQ ID No. 7 or 8, or the amino acid sequences of the CDRs of the light chain variable region or heavy chain variable region shown have at least 70% identity, such as at least about 75%, about 80%, about 85%, about 90%, about 95% or more identity with the sequences shown in SEQ ID No. 1-8, respectively, and are variant sequences that retain the biological activity of the corresponding parental sequences, or, the amino acid sequences of the CDRs of the light chain variable region or heavy chain variable region are variant sequences that retain the biological activity of the corresponding parental sequences, obtained by deleting, substituting and / or adding one or more amino acid residues, such as 1, 2, 3 or 4 or more amino acid residues, to the sequences shown in SEQ ID NO: 1-8, respectively.

[0006] wherein the variant is one selected from chimeric antibodies, humanized antibodies or fully human antibodies.

[0007] In some embodiments, the heavy chain constant region sequence of the antibody is selected from the constant region sequences of any of human IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD, and / or the light chain constant region sequence of the antibody is selected from the κ chain or λ chain. Preferably, the heavy chain constant region sequence is selected from the constant region sequences of IgG1 or IgG4, and / or the light chain constant region sequence is selected from the constant region sequence of the light chain κ chain.

[0008] In some embodiments, the amino acid sequence of the light chain variable region of the CD47 chimeric antibody and its functional fragments is the one shown in SEQ ID NO.9 or 10, or has at least 70% identity with the sequence shown in SEQ ID No.9 or 10, such as at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity, and retains the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more amino acid residues, to the sequence shown in SEQ ID NO.9 or 10 and retaining the biological activity of the corresponding parental sequence, and / or the amino acid sequence of the heavy chain variable region is the one shown in SEQ ID NO.11 or 12, or has at least 70% identity with the sequence shown in SEQ ID No.11 or 12, such as at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity, and retains the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more amino acid residues, to the sequence shown in SEQ ID NO.11 or 12 and retaining the biological activity of the corresponding parental sequence, and / or The amino acid sequences of the light chain constant region and the heavy chain constant region of the CD47 chimeric antibody and its functional fragments are those shown in SEQ ID NO.13 and SEQ ID NO.14-16, respectively, or have at least 70% identity, such as at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.2%, about 99.5% or more identity with the sequences shown in SEQ ID No.13 and SEQ ID NO.14-16, respectively, and retain the biological activity of the corresponding parental sequences, or are mutant sequences obtained by deleting, substituting and / or adding one or more amino acid residues, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more amino acid residues, to the sequences shown in SEQ ID NO.13 and SEQ ID NO.14-16, respectively, and retain the biological activity of the corresponding parental sequences.

[0009] In some embodiments, the light chain variable region framework region of the anti-human CD47 antibody, its antigen-binding fragment or its variant comprises FR-L1, FR-L2, FR-L3 and FR-L4, the heavy chain variable region framework region comprises FR-H1, FR-H2, FR-H3 and FR-H4, and / or The amino acid sequence of the FR-L1 is shown in SEQ ID NO.17, The amino acid sequence of the FR-L2 is shown in SEQ ID NO.18, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 12th amino acid R is substituted with T, The amino acid sequence of the FR-L3 is shown in SEQ ID NO.19, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 31st amino acid Y is substituted with F, The amino acid sequence of the FR-L4 is shown in SEQ ID NO.20, The amino acid sequence of the FR-H1 is shown in SEQ ID NO.21, The amino acid sequence of the aforementioned FR-H2 is shown in SEQ ID NO.22, The amino acid sequence of the aforementioned FR-H3 is shown in SEQ ID NO.23, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 8th amino acid E is substituted with T, The 11th amino acid S is substituted with N, The 31st amino acid A is substituted with V, and / or The amino acid sequence of the aforementioned FR-H4 is shown in SEQ ID NO.24.

[0010] In some embodiments, the amino acid sequence of the light chain variable region is shown in any of SEQ ID No.25-27, and / or the amino acid sequence of the heavy chain variable region is shown in any of SEQ ID No.28-33, or has at least 70% identity, such as at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity with the amino acid sequence shown in SEQ ID NO.25-27 or 28-33, and is a mutant sequence that retains the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more amino acid residues, to the sequence shown in SEQ ID NO.25-27 or 28-33, and retains the biological activity of the corresponding parental sequence.

[0011] Preferably, the light chain variable region sequence is shown in SEQ ID NO.26 or 27, and / or the heavy chain variable region sequence is shown in SEQ ID NO.33.

[0012] In this field, when identity is mentioned, since the length of the amino acid sequence must be a natural number, the actually calculated identity value is not a finite percentage such as 95%, but may be a number close to a percentage such as 95%. For example, for the variable region sequence of the 117th amino acid residue, when only one amino acid residue changes, the corresponding identity percentage is actually a percentage close to 99.15%, but for convenience, it is well known that such a number is simply denoted as 99% in this specification.

[0013] In some embodiments, the antigen-binding fragment is one or more selected from F(ab’)2, Fab’, Fab, Fd, Fv, scFv, bispecific antibody, camel antibody, CDR, and the minimal unit of antibody recognition (dAb), and preferably, the antigen-binding fragment is Fab, F(ab’)2 or scFv.

[0014] Another aspect of the present invention relates to an isolated nucleic acid molecule selected from the following: (1) DNA or RNA encoding an anti-human CD47 antibody, its antigen-binding fragment or its variant as described above; (2) A nucleic acid that is completely complementary to the nucleic acid defined in (1).

[0015] Another aspect of the present invention relates to a vector containing the nucleic acid molecule ligated effectively as described above, and preferably, the vector is an expression vector.

[0016] One aspect of the present invention relates to a host cell containing the nucleic acid molecule or vector as described above.

[0017] Another aspect of the present invention relates to a composition containing an anti-human CD47 antibody, its antigen-binding fragment or its variant, the nucleic acid molecule, the vector or the host cell as described above, and a pharmaceutically acceptable carrier, diluent or excipient.

[0018] Another aspect of the present invention relates to a method for producing an anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof as described above, the method comprising: culturing the host cell as described above under culture conditions suitable for the expression of the anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof, and optionally isolating and purifying the resulting product.

[0019] Another aspect of the present invention relates to the use of an anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof as described above, a nucleic acid molecule as described above, a vector as described above, or a host cell as described above in the manufacture of a medicament for preventing and / or treating a CD47-mediated disease or disorder, such as an autoimmune disease, an immune response against a transplant, an allergic reaction, an infectious disease, a neurodegenerative disease, and a tumor.

[0020] Another aspect of the present invention relates to an anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof as described above, a nucleic acid molecule as described above, a vector as described above, or a host cell as described above for preventing and / or treating a CD47-mediated disease or disorder, such as an autoimmune disease, an immune response against a transplant, an allergic reaction, an infectious disease, a neurodegenerative disease, and a tumor.

[0021] Another aspect of the present invention relates to a method for preventing and / or treating a CD47-mediated disease or disorder, such as an autoimmune disease, an immune response against a transplant, an allergic reaction, an infectious disease, a neurodegenerative disease, and a tumor, comprising administering to a subject in need thereof an anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof as described above, a nucleic acid molecule as described above, a vector as described above, or a host cell as described above.

[0022] In some embodiments, the autoimmune disease is one or more selected from arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, glomerulonephritis, dilated cardiomyopathy, Sjögren's syndrome, atopic and contact dermatitis, polymyositis, scleroderma, periarteritis nodosa, rheumatic fever, vitiligo, insulin-dependent diabetes mellitus, Behçet's disease, and chronic thyroiditis. Preferably, the autoimmune disease is one or more selected from arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, glomerulonephritis, rheumatic fever, vitiligo, insulin-dependent diabetes mellitus, and chronic thyroiditis. More preferably, the autoimmune disease is one or more selected from rheumatoid arthritis, psoriasis, multiple sclerosis, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, insulin-dependent diabetes mellitus, and chronic thyroiditis.

[0023] In some embodiments, the immune response to the graft includes, for example, graft-versus-host disease.

[0024] In some embodiments, the allergic reaction is one or more selected from urticaria, eczema, angioneurotic edema, allergic rhinitis, bronchial asthma, laryngeal edema, food allergic gastroenteritis, and anaphylactic shock. Preferably, the allergic reaction is one or more selected from urticaria, eczema, allergic rhinitis, bronchial asthma, and anaphylactic shock. More preferably, the allergic reaction is one or more selected from allergic rhinitis, bronchial asthma, and anaphylactic shock.

[0025] In some embodiments, the infectious disease refers to a local tissue and systemic inflammatory response caused by the invasion of pathogens such as viruses, bacteria, fungi, parasites, and specific toxins into the human body. Examples of pathogenic viruses include, for example, HIV, hepatitis viruses (types A, B, and C), herpes viruses (e.g., VZV, HSV-1, HAV-6, HSV-II, and CMV, Epstein-Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackievirus, coronavirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, JC virus, and arbovirus. Pathogenic bacteria include, for example, Treponema pallidum, Chlamydia, Rickettsia, Mycobacterium, Staphylococcus, Streptococcus, Pneumococcus, Meningococcus, and Gonococcus (conococci), Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Corynebacterium diphtheriae, Salmonella, Bacillus subtilis, Vibrio cholerae, Clostridium tetani, Clostridium botulinum, Bacillus anthracis, Yersinia pestis, Leptospira bacteria, and Borrelia burgdorferi.Pathogenic fungi include, for example, Candida spp. (such as Candida albicans, Candida krusei, Candida glabrata, Candida tropicalis, etc.), Cryptococcus neoformans, Aspergillus spp. (such as Aspergillus fumigatus, Aspergillus niger, etc.), Mucorales (such as mucor, Absidia, rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis, and Histoplasma capsulatum. Pathogenic parasites include, for example, Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondi, and Nippostrongylus brasiliensis.

[0026] In some embodiments, the neurodegenerative disease is one or more selected from Parkinson's disease, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, and Creutzfeldt-Jakob disease. Preferably, the neurodegenerative disease is one or more selected from Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. More preferably, the neurodegenerative disease is one or more selected from Parkinson's disease and Huntington's disease.

[0027] In some embodiments, the tumor is one or more selected from leukemia, lymphoma, myeloma, brain tumor, head and neck squamous cell carcinoma, non-small cell lung cancer, small cell lung cancer, nasopharyngeal carcinoma, esophageal cancer, gastric cancer, pancreatic adenocarcinoma, gallbladder cancer, liver cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine sarcoma, prostate cancer, bladder cancer, urothelial cancer, renal cell carcinoma, osteosarcoma, melanoma, and Merkel cell carcinoma. Preferably, the tumor is one or more selected from lymphoma, myeloma, head and neck squamous cell carcinoma, non-small cell lung cancer, small cell lung cancer, nasopharyngeal carcinoma, esophageal cancer, gastric cancer, liver cancer, colorectal cancer, breast cancer, cervical cancer, endometrial cancer, prostate cancer, urothelial cancer, renal cell carcinoma, osteosarcoma, and melanoma. More preferably, the tumor is one or more selected from lymphoma, head and neck squamous cell carcinoma, non-small cell lung cancer, gastric cancer, liver cancer, colorectal cancer, cervical cancer, urothelial cancer, renal cell carcinoma, and melanoma.

[0028] In some embodiments, the subject is selected from mammals, including but not limited to humans and / or other primates. Mammals include commercially relevant mammals such as, for example, cows, pigs, horses, goats, cats, dogs, mice, and / or rats.

[0029] In some embodiments, the anti-human CD47 antibody, antigen-binding fragment thereof, or variant thereof, nucleic acid molecule, vector, or host cell of the present invention is used by conventional administration methods in the art, such as parenteral routes, for example, intravenous administration.

[0030] In other words, the present invention obtained an anti-CD47 monoclonal antibody by hybridoma means and screened antibodies that do not cause hemagglutination. By adopting an IgG4-type antibody, a humanized IgG4 antibody that can specifically block the CD47-SIPRα pathway and does not cause hemagglutination within a certain concentration range can be obtained.

[0031] The antibody and its functional fragment provided by the present invention can specifically bind to human CD47 at a K of 1 nM or less, have the activity of blocking the binding between CD47 and the receptor, mediate the phagocytosis of tumor cells by macrophages, and / or do not cause hemagglutination, and are used for preventing and / or treating autoimmune diseases, immune responses against transplants, allergic reactions, infectious diseases, neurodegenerative diseases, tumors, and the like. D and is used for preventing and / or treating autoimmune diseases, immune responses against transplants, allergic reactions, infectious diseases, neurodegenerative diseases, tumors, etc.

Brief Description of the Drawings

[0032] Hereinafter, in order to more clearly explain the specific embodiments of the present invention or the technical solutions in the prior art, the drawings necessary for describing the specific embodiments or the prior art will be briefly introduced. It should be noted that the drawings in the following description are only a part of the embodiments of the present invention. Those skilled in the art can also obtain other drawings based on these drawings on the premise of not making creative efforts.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Mode for Carrying Out the Invention

[0033] Definition The term "CD47" refers to integrin associated protein (IAP), and may be a CD47 molecule derived from any mammal, and in some embodiments, is a CD47 molecule derived from a primate, and in some embodiments, may be a CD47 molecule derived from a human.

[0034] As used herein, the terms "anti-CD47 antibody", "anti-CD47", "CD47 antibody" or "antibody that binds to CD47" refer to an antibody that can bind with sufficient affinity to a CD47 protein or a fragment thereof such that the antibody can be used as a diagnostic agent and / or a therapeutic agent targeting CD47. In some embodiments, the anti-CD47 antibody binds to an epitope of CD47 that is conserved in diverse CD47s.

[0035] The term "antibody" refers to an immunoglobulin molecule or a fragment of an immunoglobulin molecule that has the ability to bind to an epitope of an antigen. Naturally occurring antibodies typically comprise a tetramer and are usually composed of at least two heavy (H) chains and at least two light (L) chains. Immunoglobulins include the isotypes IgG, IgA, IgM, IgD and IgE, and their corresponding heavy chains are the μ chain, δ chain, γ chain, α chain and ε chain, respectively. Igs of the same class can also be divided into different subclasses depending on differences in the amino acid composition of the hinge region and the number and position of the disulfide bonds in the heavy chain. For example, IgG may be divided into subtypes IgG1, IgG2, IgG3, IgG4, and IgA may be divided into subtypes IgA1 and IgA2. Light chains are divided into κ chains and λ chains by the constant region.

[0036] As used herein, the term "antibody" is used in the broadest sense and refers to a protein containing an antigen-binding site, including natural and artificial antibodies of various structures, including but not limited to full antibodies and antigen-binding fragments of antibodies.

[0037] The "variable region" or "variable domain" refers to the domain of the heavy or light chain of an antibody that is involved in the binding of the antibody to its antigen. Each heavy chain of an antibody is composed of a heavy chain variable region (abbreviated as VH herein) and a heavy chain constant region (abbreviated as CH herein), and the heavy chain constant region is usually composed of three domains (CH1, CH2, and CH3). Each light chain is composed of a light chain variable region (abbreviated as VL herein) and a light chain constant region (abbreviated as CL herein). The heavy and light chain variable regions typically are responsible for antigen recognition, while the heavy and light chain constant regions can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells), Fc receptors, and the first component of the classical complement system (C1q). The heavy and light chain variable regions contain binding regions that interact with antigens. The VH and VL regions may be further subdivided into hypervariable regions (HVRs) called "complementary determining regions (CDRs)", and intervening between them are regions called more conserved "framework regions" (FRs). Each VH and VL is composed of three CDR domains and four FR domains, and are arranged in the order of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 from the amino terminus to the carboxyl terminus.

[0038] The term "complementary determining region" or "CDR region" or "CDR" (which may be used interchangeably herein with the hypervariable region "HVR") refers to a region of the antibody variable domain that forms a loop (the "hypervariable loop") that is highly variable in sequence and structurally defined, and / or contains antigen contact residues (the "antigen contact points"). The CDRs are primarily responsible for binding to the epitopes of antigens. In this specification, the three CDRs of the heavy chain are called HCDR1, HCDR2, and HCDR3, and the three CDRs of the light chain are called LCDR1, LCDR2, and LCDR3.

[0039] It should be noted that the CDR boundaries of the variable regions of the same antibody obtained based on different numbering schemes may be different. That is, the CDR sequences of the same antibody variable region defined by different numbering schemes are different. Therefore, when limiting an antibody using a specific CDR sequence defined in the present invention, the scope of said antibody further includes antibodies in which the variable region sequence contains said specific CDR sequence but the so-called CDR boundaries are different from the boundaries of the specific CDR defined in the present invention by applying different schemes (for example, rules or combinations of different numbering schemes).

[0040] The terms "monoclonal antibody", "monoclonal antibody" or "monoclonal antibody composition" refer to an antibody obtained from a substantially homogeneous group of antibody molecules as an antibody molecule preparation of a single molecular composition, that is, the group containing individual antibodies is the same except for naturally occurring mutations that may be present in small amounts. A typical monoclonal antibody composition exhibits a single binding specificity and affinity for a specific epitope. In some embodiments, a monoclonal antibody may be composed of two or more Fab domains, thereby improving the specificity for two or more targets. The terms "monoclonal antibody" or "monoclonal antibody composition" are not limited to any specific production method (for example, recombinant, transgenic, hybridoma, etc.).

[0041] The terms "diabody", "bifunctional antibody", "bispecific antibody", "bispecific antibody" or "BsAb" refer to those having two different antigen-binding sites, capable of binding to two target antigens simultaneously, and having the function of mediating another special functional effector molecule while exerting the targeting property of the antibody. The mediated special functional effector molecule may be a toxin, an enzyme, a cytokine, a radionuclide, etc. The two arms of the bispecific antibody that bind to the antigen may each be derived from Fab, Fv, ScFv or dSFv, etc.

[0042] The term "polyclonal antibody" refers to a preparation of different antibodies against different antigenic determinants ("epitopes").

[0043] The term "antigen-binding fragment of an antibody" refers to a fragment, portion, region or domain of an antibody that can bind to an epitope (which may be obtained, for example, by cleavage, recombination, synthesis, etc.). The antigen-binding fragment can include one, two, three, four, five or all six CDR domains of such an antibody, and can exhibit different specificities, affinities or selectivities even though it can bind to the epitope. Preferably, the antigen-binding fragment includes all six CDR domains of the antibody. The antigen-binding fragment of an antibody may be part of a single polypeptide chain (e.g., scFv), or may include a single polypeptide chain, or may be part of two or more polypeptide chains (each having an amino terminus and a carboxyl terminus) (e.g., diabody, Fab fragment, F(ab')2 fragment, etc.), or includes two or more polypeptide chains.

[0044] Examples of antigen-binding fragments included in the present invention include: (a) a Fab' or Fab fragment which is a monovalent fragment consisting of VL, VH, CL and CH1 domains; (b) an F(ab')2 fragment which is a divalent fragment containing two Fab fragments linked by a disulfide bond in the hinge domain; (c) an Fd fragment consisting of a VH region and a CH1 domain; (d) an Fv fragment consisting of a VL region and a VH region of one arm of an antibody; (e) a single-chain antibody (single chain Fv, scFv) which is a recombinant protein obtained by linking antibody VH and VL with a binding peptide segment by genetic engineering techniques; (f) a dAb fragment which basically consists of a VH region and is also called a domain antibody (Holt et al., Trends Biotechnol., 21(11):484-90) (Ward et al., Nature, 341, 544-546 (1989)); (g) a camelid or nanobody (Revets et al., Expert Opin Biol Ther., 5(1):111-24) and (h) an isolated complementarity-determining region (CDR).

[0045] The term "chimeric antibody" refers to an antibody in which, as long as it exhibits a desired biological activity, a part of the heavy chain and / or light chain is derived from a specific species or is identical or homologous to the corresponding sequence of an antibody belonging to a specific antibody class or subclass, while the remaining part of the chain is derived from another species or is identical or homologous to the corresponding sequence of an antibody belonging to another antibody class or subclass and fragments of such antibodies. The present invention provides variable region antigen-binding sequences derived from human antibodies. For this reason, the chimeric antibodies mainly focused on in this specification include antibodies having one or more human antigen-binding sequences (e.g., CDRs) and containing one or more non-human antibody-derived sequences, e.g., sequences of FR or C regions. Note that the chimeric antibodies described in this specification refer to antibodies containing human variable region antigen-binding sequences of one antibody class or subclass and other sequences derived from other antibody classes or subclasses, e.g., sequences of FR or C regions.

[0046] The term "humanized antibody" refers to an antibody in which CDR sequences derived from other mammalian species, such as mouse species, are transplanted into human framework sequences. Separate framework region modifications can be made in the human framework sequences.

[0047] The term "human antibody" or "fully human antibody" ("humAb" or "HuMab") includes antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present invention can contain amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by in vitro random mutagenesis or site-directed mutagenesis, or during gene rearrangement, or by somatic mutations in vivo).

[0048] Variant antibodies are also included within the scope of the present invention. For this reason, variants of the sequences recited in this application are also included within the scope of the present invention. Other variants of antibody sequences having improved affinity can be obtained by using methods known in the art, and these variants are also included within the scope of the present invention. For example, amino acid substitutions can be used to obtain antibodies having further improved affinity. Or, codon optimization of the nucleotide sequence can be used to improve the translation efficiency of the expression system in antibody production.

[0049] The sequences of such variant antibodies have a sequence homology of 70% or more (e.g., 80%, 85%, 90%, 95%, 97%, 98%, 99% or more) with the sequences recited in this application. Such sequence homology is obtained by calculating with respect to the full length of the reference sequence (i.e., the sequences recited in this application).

[0050] Amino acid residues in the present invention are numbered according to IMGT (registered trademark) (the international ImMunoGeneTics information system) (registered trademark) or Kabat, E.A., Wu, T.T., Perry, H.M., Gottesmann, K.S. & Foeller, C., (1991), Sequences of Proteins of Immunological Interest, 5th Edition, NIH Publication No. 91-3242, U.S. Department of Health and Human Services; Chothia, C. & Lesk, A.M., (1987), Canonical structures For The Hypervariable domains Of Immunoglobulins., J. Mol. Biol., 196, 901-917. Unless otherwise specified, amino acid residues in the present invention are numbered according to the Kabat EU index numbering system.

[0051] The phrase that an antibody or its antigen-binding fragment "specifically" binds to a region (i.e., an epitope) of another molecule means that it reacts or binds to said epitope more frequently, more rapidly, and for a longer duration and / or with greater affinity than to other epitopes. In some embodiments, the antibody or its antigen-binding fragment of the present invention has an affinity of at least 10 -7 M, such as 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M or more for binding to h with CD47 and Preferably, the antibody or its antigen-binding fragment binds under physiological conditions (e.g., in vivo). Thus CD47 and Specific binding refers to the ability of this antibody or its antigen-binding fragment to have the above specificity and / or to bind under such conditions CD47 by Suitable methods for determining said binding are known in the art.

[0052] In the context of an antibody binding to a designated antigen, the term "binding" usually refers to about 10 -6M or less of K D refers to binding with an affinity corresponding thereto, and this K D is at least 10-fold, for example at least 100-fold, at least 1,000-fold lower than the binding affinity of this antibody for non-specific antigens other than the specified antigen or an antigen closely related thereto (for example, BSA, casein).

[0053] As used herein, the term "k d " (sec-1 or 1 / s) refers to the dissociation rate constant of a specific antibody-antigen interaction. The said value is also called the k off value.

[0054] As used herein, the term "k a " (M-1 x sec-1 or 1 / Msec) refers to the association rate constant of a specific antibody-antigen interaction.

[0055] As used herein, the term "K D " (M) refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and is obtained by dividing k d by k a .

[0056] As used herein, the term "K A " (M-1 or 1 / M) refers to the association equilibrium constant of a specific antibody-antigen interaction, and is obtained by dividing k a by k d .

[0057] In some embodiments, for the antibody or antigen-binding fragment thereof of the present invention, it is sufficient that only a part of the CDR (i.e., a subgroup of CDR residues necessary for binding, called SDR) is bound by the humanized antibody. Depending on molecular modeling and / or experience, or based on prior studies as described in Gonzales, N.R. et al., (2004), SDR Grafting Of A Murine Antibody Using Multiple Human GermLine Templates To Minimize Its Immunogenicity, Mol. Immunol., 41:863-872 (for example, residues H60-H65 in CDR H2 are usually unnecessary), CDR residues that do not contact the relevant epitope and are not located in the SDR can be identified from Kabat CDR regions located outside the Chothia hypervariable loops (see Kabat et al., (1992), Sequences of Proteins of Immunological Interest, National Institutes of Health, publication No. 91-3242; Chothia, C. et al., (1987), Canonical Structures For The Hypervariable Regions Of Immunoglobulins, J. Mol. Biol., 196:901-917). In such humanized antibodies, at positions where one or more CDR residues that are donors are absent or the entire CDR that is a donor is omitted, the amino acid occupying this position may be the amino acid occupying the corresponding position (numbered according to Kabat) in the acceptor antibody sequence. Such substitutions potentially reduce the number of mouse amino acids in the humanized antibody and are thus potentially advantageous in reducing potential immunogenicity. However, substitutions can also cause changes in affinity, and it is preferable to avoid a significant decrease in affinity. Substitution positions within the CDR and the amino acids to be substituted can also be selected according to experience.

[0058] Using the fact that the loss of functional binding occurs when a single amino acid of a CDR residue is changed (Rudikoff, S. et al., (1982), Single Amino Acid Substitution Altering Antigen-binding Specificity, Proc. Natl. Acad. Sci. (USA)) 79(6):1979-1983), alternative functional CDR sequences can be systematically identified. In a preferred method for obtaining such mutant CDRs, mutations are induced in the polynucleotide encoding the CDR (e.g., by random mutagenesis or site-directed mutagenesis) to generate a CDR having substituted amino acid residues. By comparing the identity of the relevant residues in the original (functional) CDR sequence with the identity of the substituted (non-functional) mutant CDR sequence, the substitution score of this substituted BLOSUM62.iij can be identified. The BLOSUM system provides an amino acid substitution matrix created by analyzing a sequence database for use in reliable comparisons (Eddy, S.R., (2004), Where Did The BLOSUM62 Alignment Score Matrix Come From?, Nature Biotech., 22(8):1035-1036; Henikoff, J.G., (1992), Amino acid substitution matrices from protein blocks), Proc. Natl. Acad. Sci. (USA), 89:10915-10919; Karlin, S. et al., (1990), Methods For Assessing The Statistical Significance Of Molecular Sequence Features By Using General Scoring Schemes), PNAS, 87:2264-2268; Altschul, S.F., (1991), Amino Acid Substitution Matrices From An Information Theoretic Perspective, J. Mol. Biol., 219, 555-565).Currently, the most advanced BLOSUM database is the BLOSUM62 database (BLOSUM62.iij). Table 1 shows the BLOSUM62.iij substitution scores (the higher the score, the more conservative the substitution, and thus the more likely this substitution will not affect the function). For example, an antigen-binding fragment containing the obtained CDR. is CD47 and If it cannot bind, the BLOSUM62.iij substitution score is considered not to be sufficiently conservative, and a new candidate substitution with a higher substitution score is selected and generated. Thus, for example, if the original residue is glutamic acid (E) and the non-functional substitution residue is histidine (H), the BLOSUM62.iij substitution score is 0, and a more conservative change (e.g., aspartic acid, asparagine, glutamine or lysine) is preferred. [Table 1]

[0059] Therefore, the present invention takes into account the use of random mutagenesis in the identification of improved CDRs. Under the background of the present invention, conservative substitutions may be defined by substitutions within one or more amino acid categories in the following three tables.

[0060] [Table 2] [Table 3] [Table 4] More conservative substitution groups include valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine and asparagine-glutamine.

[0061] In some embodiments, the hydrophilic amino acids are selected from Arg, Asn, Asp, Gln, Glu, His, Tyr and Lys.

[0062] Furthermore, another amino acid group can also be created using, for example, the principles described in Creighton, (1984), Proteins: Structure and Molecular Properties, W.H. Freeman and Company).

[0063] Thus, the sequences of the CDR variants of the antibodies or antigen-binding fragments thereof included can differ from the sequences of the CDRs of the parental antibody by substitution, for example, substitution of 4, 3, 2, or 1 amino acid residue. According to an embodiment of the present invention, the amino acids in the CDR region may be substituted with conservative substitutions as defined in the above three tables.

[0064] "Homology" or "sequence identity" refers to the percentage of identical residues between a polynucleotide or polypeptide sequence variant and a non-variant sequence after aligning the sequences and introducing gaps. In a specific embodiment, the polynucleotide and polypeptide variants have at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% polynucleotide or polypeptide homology with the polynucleotide or polypeptide described herein.

[0065] Such variant polypeptide sequences have 70% or more (i.e., 80%, 85%, 90%, 95%, 97%, 98%, 99% or more) sequence identity with the sequences recited in the present application. In other embodiments, the present invention provides polypeptide fragments comprising continuous extended segments of various lengths of the amino acid sequences disclosed herein. For example, where applicable, the peptide sequences provided by the present invention include continuous peptides of at least about 5, 10, 15, 20, 30, 40, 50, 75, 100, 150 or more of one or more sequences disclosed in the present invention, and all peptides having intermediate lengths therebetween.

[0066] The term "treatment" refers to improving, alleviating, reducing or reversing the progression or severity of a disease or medical condition, or improving, alleviating, reducing or reversing one or more symptoms or side effects of such a disease or medical condition. In the present invention, "treatment" also refers to a method for obtaining a beneficial or promising clinical outcome, where "beneficial or promising clinical outcome" includes, but is not limited to, symptom alleviation, whether partial or complete, detectable or undetectable, reduction in the degree of a medical condition or disease, a stable (i.e., non-worsening) state of a disease or medical condition, delay or alleviation of the progression of a state of a disease or medical condition, improvement or reduction of a state of a disease or medical condition, and remission of a disease or medical condition.

[0067] The term "prevention" refers to preventing or inhibiting the progression of at least one symptom of a disease or medical condition by administering the antibody of the present invention and its functional fragments. This term further includes treating a subject in remission to prevent or inhibit recurrence.

[0068] The antibody of the present invention may be a monoclonal antibody produced by recombinant DNA.

[0069] The antibody of the present invention may have any isotype. The selection of the isotype is usually determined by the desired effector function (e.g., ADCC induction). Exemplary isotypes are IgG1, IgG2, IgG3, and IgG4. Either the human kappa or lambda light chain constant region can be used. If necessary, the class of the anti-CD47 antibody of the present invention can be converted by known methods. For example, the first IgG antibody of the present invention can be converted to an IgM antibody of the present invention. In addition, the IgG subclass can be converted to another subclass by class-switching technology. For example, IgG1 can be converted to IgG2. Therefore, the effector function of the antibody of the present invention can be converted to, for example, IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibodies by isotype switching for various therapeutic applications. In some embodiments, the antibody of the present invention is an IgG4 antibody. When the amino acid sequence of the antibody is almost the same as this isotype for other isotypes, this antibody belongs to a specific isotype.

[0070] In some embodiments, the antibody of the present invention is a full-length antibody, preferably an IgG antibody. In other embodiments, the antibody of the present invention is an antibody-antigen binding fragment or a single-chain antibody.

[0071] In some embodiments, the anti-CD47 antibody is a monovalent antibody, preferably a monovalent antibody having a deletion in the hinge region as described in WO2007059782, which is incorporated herein by reference in its entirety. Thus, in some embodiments, the antibody is a monovalent antibody, where the anti-CD47 antibody is constructed by the following method: i) providing a nucleic acid construct encoding the light chain of the monovalent antibody, the construct comprising a nucleotide sequence encoding the VL region of a selected antigen-specific anti-CD47 antibody and a nucleotide sequence encoding the constant CL region of an Ig, where the nucleotide sequence encoding the VL region of the selected antigen-specific antibody and the nucleotide sequence encoding the CL region of the Ig are operably linked, and in the case of the IgG1 subclass, the nucleotide sequence encoding the CL region has already been modified such that in the presence of polyclonal human IgG or when administered to an animal or human, this CL region does not contain any amino acids capable of forming a disulfide or covalent bond with another peptide containing the identical amino acid sequence of this CL region; ii) providing a nucleic acid construct encoding the heavy chain of the monovalent antibody, the construct comprising a nucleotide sequence encoding the VH region of a selected antigen-specific antibody and a nucleotide sequence encoding the constant CH region of a human Ig, where the nucleotide sequence encoding the CH region has already been modified such that in the presence of polyclonal human IgG or when administered to an animal or human, the regions corresponding to the hinge region and other regions of the CH region (e.g., the CH3 region, as required for the Ig subclass) do not contain any amino acid residues involved in forming a disulfide or covalent or stable non-covalent bond between heavy chains with another peptide containing the identical amino acid sequence of the CH region of the human Ig, where the nucleotide sequence encoding the VH region of the selected antigen-specific antibody and the nucleotide sequence encoding the CH region of the Ig are operably linked; iii) providing a cell expression system for producing the monovalent antibody; iv) co-expressing the nucleic acid constructs of (i) and (ii) in the cells of the cell expression system of (iii) to produce the monovalent antibody.

[0072] Similarly, in some embodiments, the anti-CD47 antibody is a monovalent antibody, (i) the variable region of an antibody of the invention as described herein or the antigen-binding portion of said domain, and (ii) a domain comprising the CH region of an immunoglobulin or its CH2 and CH3 domains, wherein this CH region or its domain has been modified such that the domains corresponding to the hinge region and, if the immunoglobulin is not of the IgG4 subclass, other domains of the CH region (e.g., the CH3 domain) do not contain any amino acid residues that can form a disulfide bond with the same CH region or form other covalent or stable non-covalent inter-heavy chain linkages with the same CH region in the presence of polyclonal human IgG.

[0073] In some other embodiments, the heavy chain of the monovalent antibody is modified such that the entire hinge region is deleted.

[0074] In other embodiments, the sequence of the monovalent antibody is modified such that it does not contain any acceptor sites for N-linked glycosylation.

[0075] The present invention further comprises a "bispecific antibody", wherein the anti-CD47 binding region (e.g., the CD47 binding region of an anti-CD47 monoclonal antibody) is part of a bivalent or multivalent bispecific framework targeting one or more epitopes (e.g., the second epitope can include an epitope of an active transport receptor, whereby this bispecific antibody exhibits improved cell transfer across a biological barrier (e.g., the blood-brain barrier)). Thus, in other embodiments, a monovalent Fab of an anti-CD47 antibody can be linked to a Fab or scfv targeting another different protein to produce a bispecific antibody. The bispecific antibody can have a dual function, for example, enhancing the therapeutic function conferred by the anti-CD47 binding region and the transport function of binding to a receptor molecule and transferring across a biological barrier (e.g., the blood-brain barrier).

[0076] The antibodies and antigen-binding fragments thereof of the present invention further comprise single-chain antibodies. A single-chain antibody is a peptide in which the Fv domains of the heavy and light chains are linked. In some embodiments, the present invention provides a single-chain Fv (scFv), wherein the heavy and light chains in the Fv of the anti-CD47 antibody of the present invention are linked by a flexible peptide (typically about 10, 12, 15 or more amino acid residues) to form a single peptide chain. Methods for producing such antibodies are described, for example, in US 4,946,778; Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenberg and Moore ed., Springer-Verlag, New York, pages: 269-315 (1994); Bird et al., Science, 242, 423-426 (1988); Huston et al., PNAS USA 85, 5879-5883 (1988) and McCafferty et al., Nature, 348, 552-554 (1990). When using only a single VH and VL, the single-chain antibody is monovalent, when using two VH and VL, it is bivalent, or when using two or more VH and VL, it is multivalent.

[0077] The antibodies of the present invention can be produced by any technique known in the art and can be used alone or in combination, for example, without being limited to any chemical, biological, genetic or enzymatic technique. Usually, the amino acid sequence of the desired sequence is known, and those skilled in the art can easily produce the antibodies by standard techniques for producing polypeptides. For example, these antibodies can be synthesized by known solid-phase methods, preferably using a commercially available peptide synthesizer (e.g., a device manufactured by Applied Biosystems, Foster City, California) and synthesizing these antibodies according to the manufacturer's instructions. Alternatively, the antibodies of the present invention can be synthesized by recombinant DNA techniques known in the art. For example, after incorporating the DNA sequence encoding the antibody into an expression vector and introducing these vectors into a eukaryotic or prokaryotic host suitable for the expression of the required antibody, the antibody as a DNA expression product can be obtained, and then the antibody can be isolated from the host using known techniques.

[0078] Comprising any "suitable" number of modified amino acids and / or binding to a coupling substituent, the antibodies of the present invention and antigen-binding fragments thereof can be modified. In such cases, "suitable" is usually determined by the ability to at least substantially retain the CD47 selectivity and / or CD47 specificity associated with the non-derivatized parental anti-CD47 antibody. The inclusion of one or more modified amino acids can contribute, for example, to an increase in the polypeptide serum half-life, a reduction in polypeptide antigenicity, or an improvement in polypeptide storage stability. Modifications to one or more amino acids can be made, for example, co-translationally during recombinant production or post-translationally (e.g., N-linked glycosylation in the N-X-S / T sequence during expression in mammalian cells), or by synthetic means. Non-limiting examples of modified amino acids include glycosylated amino acids, sulfated amino acids, isoprenylated (e.g., farnesylated, geranylgeranylated) amino acids, acetylated amino acids, acylated amino acids, polyethylene glycolylated amino acids, biotin acylated amino acids, carboxylated amino acids, phosphorylated amino acids, and the like. References for performing amino acid modifications are well known in the art and include, for example, Walker, (1998), Protein Protocols On CD-Rom, Humana Press, Totowa, New Jersey. The modified amino acids may be selected, for example, from glycosylated amino acids, polyethylene glycolylated amino acids, farnesylated amino acids, acetylated amino acids, biotin acylated amino acids, amino acids conjugated to lipid moieties, or amino acids conjugated to organic derivatizing agents.

[0079] The antibodies of the present invention and their antigen-binding fragments can also increase the circulation half-life by covalently binding to a polymer and performing chemical modification. Exemplary polymers and methods for linking them to peptides can be found, for example, in US 4,766,106; US 4,179,337; US 4,495,285 and US 4,609,546. Also, exemplary polymers include polyoxyethylated polyols and polyethylene glycol (PEG) (for example, with a molecular weight between about 1,000 and 40,000 D, for example between about 2,000 and 20,000 D, for example PEG with a molecular weight between about 3,000 and 12,000 D).

[0080] The term "subject" refers to a warm-blooded animal, preferably a mammal (such as a human, domestic and farm animals, zoo animals, sports animals or pet animals, for example dogs, cats, cows, horses, sheep, pigs, goats, rabbits, etc.), more preferably a human. In one embodiment, the subject may be a "patient", i.e., a warm-blooded animal, more preferably a human who is awaiting admission, or receiving medical care, or is the subject of a medical program or disease progression monitoring. In one embodiment, the subject is an adult (for example, a subject 18 years of age or older). In other embodiments, the subject is a child (for example, a subject under 18 years of age). In one embodiment, the subject is male. In other embodiments, the subject is female.

[0081] In one embodiment of the present invention, the sample is a biological sample. Examples of biological samples include, but are not limited to, diseased tissue, body fluids, preferably blood, more preferably serum, plasma, synovial fluid, bronchoalveolar lavage fluid, sputum, lymph fluid, ascites, urine, amniotic fluid, peritoneal fluid, cerebrospinal fluid, pleural fluid, pericardial fluid, and tissue lysates and extracts prepared from alveolar macrophages, but are not limited thereto.

[0082] In one embodiment of the present invention, the term "sample" means a sample taken from an individual prior to any analysis.

[0083] Thus, in some embodiments, the anti-CD47 antibodies and antigen-binding fragments thereof of the present invention include full antibodies, such as IgG (subclasses IgG1, IgG2, IgG3, and IgG4), IgA (subclasses IgA1 and IgA2), IgM, and IgE; antigen-binding fragments, such as SDR, CDR, Fv, dAb, Fab, Fab2, Fab’, F(ab’)2, Fd, scFv, camel antibodies, or nanobodies; variant sequences of the antibodies or their antigen-binding fragments, such as variant sequences having at least 80% sequence identity with the above antibodies or their antigen-binding fragments. In some embodiments, the present invention further includes derivatives containing anti-CD47 or its antigen-binding fragment, such as chimeric antibodies, humanized antibodies, fully human antibodies, recombinant antibodies, and bispecific antibodies derived from full antibodies.

[0084] According to another aspect, the present invention relates to an expression vector encoding one or more polypeptide chains of the antibody or its antigen-binding fragment of the present invention. Such an expression vector can be used to recombinantly produce the antibody or its antigen-binding fragment of the present invention.

[0085] In the present invention, the expression vector may be any suitable DNA or RNA vector including chromosomal vectors, non-chromosomal vectors, and synthetic nucleic acid vectors (including nucleic acid sequences of a set of appropriate expression control elements). Examples of such vectors include derivatives of SV40, bacterial plasmids, phage DNA, baculoviruses, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral nucleic acid (RNA or DNA) vectors. In some embodiments, the nucleic acid encoding the anti-CD47 antibody is contained in a naked DNA or RNA vector, such as a linear expression element (e.g., as described in Sykes and Johnston, Nat Biotech, 12, 355-59 (1997)), a small nucleic acid vector (e.g., as described in US 6,077,835 and / or WO00 / 70087), a plasmid vector (e.g., pBR322, pUC19 / 18 or pUC118 / 119), a nucleic acid vector of minimal size (e.g., as described in Schakowski et al., MoI Ther, 3, 793-800 (2001)), or a precipitated nucleic acid vector construct, such as a CaPO4 precipitated construct (e.g., as described in WO00 / 46147; Benvenisty and Reshef, PNAS USA 83, 9551-55 (1986); Wigler et al., Cell, 14, 725 (1978) and Coraro and Pearson, Somatic Cell Genetics, 2, 603 (1981)). Such nucleic acid vectors and their use are well known in the art (see, for example, US5,589,466 and US5,973,972).

[0086] In some embodiments, the vector is suitable for expressing the anti-CD47 antibody or an antigen-binding fragment thereof in bacterial cells. Examples of such vectors include, for example, BlueScript (Stratagene), pIN vectors (Van Heeke & Schuster, J Biol Chem, 264, 5503-5509 (1989)), pET vectors (Novagen, Madison, Wisconsin), and the like.

[0087] The expression vector may be a vector suitable for expression in a yeast system. Any vector suitable for expression in a yeast system can be employed. Suitable vectors include, for example, vectors containing a constitutive or inducible promoter (such as the α-factor, alcohol oxidase, and PGH) (see, for review, F. Ausubel et al., ed., Current Protocols in Molecular Biology, Greene Publishing and Wiley InterScience, New York (1987); Grant et al., Methods in Enzymol, 153, 516 - 544 (1987); Mattanovich, D. et al., Methods Mol. Biol., 824, 329 - 358 (2012); Celik, E. et al., Biotechnol. Adv., 30(5), 1108 - 1118 (2012); Li, P. et al., Appl. Biochem. Biotechnol., 142(2), 105 - 124 (2007); Boer, E. et al., Appl. Microbiol. Biotechnol., 77(3), 513 - 523 (2007); van der Vaart, J.M., Methods Mol. Biol., 178, 359 - 366 (2002) and Holliger, P., Methods Mol. Biol., 178, 349 - 357 (2002)).

[0088] In the expression vector of the present invention, the nucleic acid encoding the anti - CD47 antibody can include any suitable promoter, enhancer, and other elements contributing to expression or combinations thereof. Examples of such elements include strong - expression promoters (such as the human CMV IE promoter / enhancer and RSV, SV40, SL3 - 3, MMTV, and HIV LTR promoters), effective poly(A) terminator sequences, an origin of replication for plasmid production in Escherichia coli, an antibiotic resistance gene as a selection marker, and / or convenient cloning sites (such as a polylinker). The nucleic acid can also include an inducible promoter relative to a constitutive promoter (such as CMV IE).

[0089] According to another aspect, the present invention relates to a recombinant eukaryotic or prokaryotic host cell (e.g., a transfectoma) that produces an antibody of the present invention, an antigen-binding fragment thereof, or a bispecific molecule of the present invention. Examples of host cells include yeast, bacteria, and mammalian cells (e.g., CHO or HEK cells). For example, in some embodiments, the present invention provides a cell comprising a nucleic acid stably integrated into the cell genome, the genome comprising a nucleic acid sequence encoding an anti-CD47 antibody of the present invention or an antigen-binding fragment thereof. In other embodiments, the present invention provides a cell comprising a non-integrating nucleic acid (e.g., a plasmid, cosmid, phagemid, or linear expression element), the nucleic acid comprising a sequence encoding an anti-CD47 antibody of the present invention or an antigen-binding fragment thereof.

[0090] The antibodies of the present invention and antigen-binding fragments thereof can be produced in different cell lines, such as human cell lines, non-human mammalian cell lines, and insect cell lines, such as CHO cell lines, HEK cell lines, BHK-21 cell lines, mouse cell lines (e.g., myeloma cell lines), fibrosarcoma cell lines, PER.C6 cell lines, HKB-11 cell lines, CAP cell lines, and HuH-7 human cell lines (Dumont et al., 2015, Crit Rev Biotechnol., Sep. 18, 1-13., the content of which is incorporated herein by reference).

[0091] The antibody of the present invention and the medium are appropriately isolated by a general immunoglobulin purification method, which is, for example, protein A-sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0092] The present invention further relates to a composition, the composition comprising, consisting of, or consisting essentially of an antibody of the present invention.

[0093] As used herein, with respect to a composition, "consisting essentially of" means that at least one of the antibodies of the present invention as described above is the only therapeutic agent or reagent having biological activity in the composition.

[0094] In one embodiment, the composition of the present invention is a pharmaceutical composition and further comprises a pharmaceutically acceptable excipient, diluent or carrier.

[0095] The term "pharmaceutically acceptable carrier" refers to an excipient that does not cause adverse, allergic or other untoward reactions when administered to animals, preferably humans. It includes any solvent, dispersion medium, coating layer, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. When administered to humans, the formulations should meet the standards of sterility, pyrogenicity, general safety and purity required by a regulatory agency (e.g., the FDA office or the EMA).

[0096] The present invention further relates to a medicament, which comprises, consists of or consists essentially of the antibody of the present invention.

[0097] In some embodiments, the glycosylation of the antibodies of the present invention is modified. For example, non-glycosylated antibodies (i.e., antibodies that are not glycosylated) can be produced. By changing the glycosylation, for example, the affinity of the antibody for an antigen can be increased or the ADCC activity of the antibody can be altered. Such modifications to carbohydrates may be achieved, for example, by changing one or more glycosylation sites within the antibody sequence. For example, by performing one or more amino acid substitutions, the glycosylation sites in one or more variable region frameworks can be eliminated, thereby eliminating glycosylation at this site. Such non-glycosylation can improve the affinity of the antibody for an antigen. U.S. Patent Nos. 5,714,350 and 6,350,861 to Co et al. (incorporated herein by reference) describe such methods in more detail. Alternatively, antibodies having a modified glycosylation type can be produced, such as hypofucosylated or afucosylated antibodies having a reduced amount or no fucosyl residues or antibodies having an added bisecting GlcNac structure. It has already been demonstrated that such modified fucosylation modes improve the ADCC ability of antibodies. Such modifications to carbohydrates may also be achieved, for example, by expressing the antibody in a host cell having a modified glycosylation mechanism. Cells having a modified glycosylation mechanism are described in the art and may be used as host cells, and by expressing the recombinant antibody of the present invention in this host cell, an antibody having modified glycosylation is produced. For example, EP1176195 to Hang et al. (incorporated herein by reference) describes a cell line having a functionally disrupted FUT8 gene, which encodes a fucosyltransferase, so that antibodies expressed in such a cell line exhibit hypofucosylation or lack of fucosyl residues.Accordingly, in some embodiments, the human antibodies (preferably monoclonal antibodies) of the present invention may be produced by recombinant expression in a cell line that exhibits a hypofucosylated or afucosylated mode, e.g., a mammalian cell line lacking expression of the FUT8 gene encoding fucosyltransferase. Presta's PCT disclosure WO03 / 035835 (incorporated herein by reference) describes mutant CHO cell lines, Lec13 cells, which result in hypofucosylation of antibodies expressed in this host cell because of their reduced ability to attach fucose to carbohydrates linked to Asn(297) (see also Shields, R.L. et al., 2002 J. Biol. Chem. 277:26733-26740). PCT disclosure WO99 / 54342 of Umana et al. (incorporated herein by reference) describes that by expressing a glycosyltransferase modified with a glycoprotein by an engineered cell line (e.g., β(1,4)-N-acetylglucosaminyltransferase III (GnTIII)), antibodies expressed in the engineered cell line exhibit an added bisecting GlcNAc structure, resulting in an improvement in the ADCC activity of the antibody (see also Umana et al., 1999 Nat. Biotech. 17:176-180). Eureka Therapeutics further described a genetically engineered CHO mammalian cell capable of producing an antibody having a modified mammalian glycosylation mode lacking fucose residues (http: / / www.eurekainc.com / a&boutus / companyoverview.html). Alternatively, the human antibodies (preferably monoclonal antibodies) of the present invention can be produced in yeast or filamentous fungi, which are used for mammalian-like glycosylation modes and can produce antibodies lacking fucose as a glycosylation mode (see, e.g., EP1297172B1).

[0098] The antibody of the present invention acts on human CD47 and specifically recognizes CD47 expression on the surface of human tumor cells, thereby blocking the inhibitory signaling pathway transmitted by the binding of CD47 to the receptor SIRPα, promoting the phagocytosis reaction of tumors via macrophages, and providing a new method for immunotherapy against tumors. The antibody of the present invention can be used, for example, in autoimmune diseases such as arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, glomerulonephritis, dilated cardiomyopathy, Sjogren's syndrome, atopic and contact dermatitis, polymyositis, scleroderma, periarterial polyarteritis, rheumatic fever, vitiligo, insulin-dependent diabetes, Behcet's disease, and chronic thyroiditis, immune responses against transplants, allergic reactions, infectious diseases, neurodegenerative diseases such as Parkinson's disease, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, and Creutzfeldt-Jakob disease, and tumors such as leukemia, lymphoma, myeloma, brain tumors, head and neck squamous cell carcinomas, non-small cell lung cancers, nasopharyngeal carcinomas, esophageal carcinomas, gastric carcinomas, pancreatic adenocarcinomas, gallbladder carcinomas, liver carcinomas, colorectal carcinomas, breast carcinomas, ovarian carcinomas, cervical carcinomas, endometrial carcinomas, uterine sarcomas, prostate carcinomas, bladder carcinomas, renal cell carcinomas, and melanomas for prevention and / or treatment.

[0099] In some embodiments, the present invention relates to the following technical solutions.

[0100] The first invention is an isolated anti-human CD47 antibody, an antigen-binding fragment thereof, or a variant thereof, wherein the antibody or the antigen-binding fragment thereof comprises a light chain variable region and / or a heavy chain variable region, wherein the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the light chain variable region are shown in SEQ ID No. 1, 2, and 3, respectively, and / or the amino acid sequence of HCDR1 of the heavy chain variable region is shown in SEQ ID No. 4, the amino acid sequence of HCDR2 of the heavy chain variable region has at least about 94% identity with SEQ ID No. 5 or 6, and the amino acid sequence of HCDR3 of the heavy chain variable region has at least about 78% identity with SEQ ID No. 7 or 8, or The amino acid sequences of the CDRs of the light chain variable region or heavy chain variable region shown have at least 70% identity with the sequences shown in SEQ ID No. 1-8, respectively, and are mutant sequences that retain the biological activity of the corresponding parental sequences, or The amino acid sequences of the CDRs of the light chain variable region or heavy chain variable region are mutant sequences that retain the biological activity of the corresponding parental sequences, obtained by deleting, substituting and / or adding one or more amino acid residues to the sequences shown in SEQ ID NO: 1-8, respectively. Here, the mutant is one selected from chimeric antibodies, humanized antibodies or fully human antibodies.

[0101] A second invention is the anti-human CD47 antibody, antigen-binding fragment thereof or mutant thereof according to the first invention, wherein the heavy chain constant region sequence of the antibody is selected from the constant region sequences of any of human IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD, and / or the light chain constant region sequence of the antibody is selected from the κ chain or λ chain, Preferably, the heavy chain constant region sequence is selected from the constant region sequences of IgG1 or IgG4, and / or the light chain constant region sequence is selected from the constant region sequence of the light chain κ chain.

[0102] In the third invention, the amino acid sequence of the light chain variable region of the CD47 chimeric antibody or its functional fragment is the one shown in SEQ ID NO.9 or 10, or has at least 70% identity with the sequence shown in SEQ ID No.9 or 10 and retains the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues to the sequence shown in SEQ ID NO.9 or 10 and retaining the biological activity of the corresponding parental sequence, and / or the amino acid sequence of the heavy chain variable region is the one shown in SEQ ID NO.11 or 12, or has at least 70% identity with the sequence shown in SEQ ID No.11 or 12 and retains the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues to the sequence shown in SEQ ID NO.11 or 12 and retaining the biological activity of the corresponding parental sequence, and / or The anti-human CD47 antibody, its antigen-binding fragment or its mutant according to the first or second invention, wherein the amino acid sequences of the light chain constant region and the heavy chain constant region of the CD47 chimeric antibody and its functional fragment are the ones shown in SEQ ID NO.13 and SEQ ID NO.14-16 respectively, or have at least 70% identity with the sequences shown in SEQ ID No.13 and SEQ ID NO.14-16 respectively and retain the biological activity of the corresponding parental sequences, or are mutant sequences obtained by deleting, substituting and / or adding one or more amino acid residues to the sequences shown in SEQ ID NO.13 and SEQ ID NO.14-16 respectively and retaining the biological activity of the corresponding parental sequences.

[0103] In the fourth invention, the light chain variable region framework region of the anti-human CD47 antibody, its antigen-binding fragment or its mutant includes FR-L1, FR-L2, FR-L3 and FR-L4, the heavy chain variable region framework region includes FR-H1, FR-H2, FR-H3 and FR-H4, and / or The amino acid sequence of the aforementioned FR-L1 is shown in SEQ ID NO. 17, The amino acid sequence of the aforementioned FR-L2 is shown in SEQ ID NO. 18, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 12th amino acid R is substituted with T, The amino acid sequence of the aforementioned FR-L3 is shown in SEQ ID NO. 19, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 31st amino acid Y is substituted with F, The amino acid sequence of the aforementioned FR-L4 is shown in SEQ ID NO. 20, The amino acid sequence of the aforementioned FR-H1 is shown in SEQ ID NO. 21, The amino acid sequence of the aforementioned FR-H2 is shown in SEQ ID NO. 22, The amino acid sequence of the aforementioned FR-H3 is shown in SEQ ID NO. 23, or is an amino acid sequence obtained by any one or any combination of the following substitutions: The 8th amino acid E is substituted with T, The 11th amino acid S is substituted with N, The 31st amino acid A is substituted with V, and / or The amino acid sequence of the aforementioned FR-H4 is shown in SEQ ID NO. 24, the anti-human CD47 antibody, its antigen-binding fragment or its variant described in the first or second invention.

[0104] The fifth invention is that the amino acid sequence of the light chain variable region is shown in any one of SEQ ID No. 25-27, and / or the amino acid sequence of the heavy chain variable region is shown in any one of SEQ ID No. 28-33, or is a mutant sequence having at least 70% identity with the amino acid sequence shown in SEQ ID NO. 25-27 or 28-33 and retaining the biological activity of the corresponding parental sequence, or is a mutant sequence obtained by deleting, substituting and / or adding one or more amino acid residues to the sequence shown in SEQ ID NO. 25-27 or 28-33 and retaining the biological activity of the corresponding parental sequence. Preferably, the light chain variable region sequence is shown in SEQ ID NO. 26 or 27, and / or the heavy chain variable region sequence is shown in SEQ ID NO. 33, and the anti-human CD47 antibody, its antigen-binding fragment or its mutant according to the first or second invention.

[0105] The sixth invention is that the antigen-binding fragment is one or more selected from F(ab’)2, Fab’, Fab, Fd, Fv, scFv, bispecific antibody, camel antibody, CDR and the minimum unit of antibody recognition (dAb), and preferably, the antigen-binding fragment is Fab, F(ab’)2 or scFv, and the anti-human CD47 antibody, its antigen-binding fragment or its mutant according to any one of the first to fifth inventions.

[0106] The seventh invention is an isolated nucleic acid molecule selected from the following.

[0107] (1) DNA or RNA encoding the anti-human CD47 antibody, its antigen-binding fragment or its mutant according to any one of the first to sixth inventions; (2) A nucleic acid that is completely complementary to the nucleic acid defined in (1).

[0108] The eighth invention is a vector containing the nucleic acid molecule according to the seventh invention effectively ligated, and preferably, the vector is an expression vector.

[0109] The ninth invention is a host cell containing the nucleic acid molecule described in the seventh invention or the vector described in the eighth invention.

[0110] The tenth invention is a composition comprising an anti-human CD47 antibody, an antigen-binding fragment thereof or a variant thereof described in any one of the first to sixth inventions, the nucleic acid molecule described in the seventh invention, the vector described in the eighth invention or the host cell described in the ninth invention, and a pharmaceutically acceptable excipient, diluent and / or vector.

[0111] The eleventh invention is a method for producing an anti-human CD47 antibody, an antigen-binding fragment thereof or a variant thereof described in any one of the first to sixth inventions, the method comprising culturing the host cell described in the ninth invention under culture conditions suitable for the expression of the anti-human CD47 antibody, an antigen-binding fragment thereof or a variant thereof, and optionally isolating and purifying the obtained product.

[0112] The twelfth invention is the use of an anti-human CD47 antibody, an antigen-binding fragment thereof or a variant thereof described in any one of the first to sixth inventions, the nucleic acid molecule described in the seventh invention, the vector described in the eighth invention or the host cell described in the ninth invention in the manufacture of a medicament for preventing and / or treating an autoimmune disease, an immune response against a transplant, an allergic reaction, an infectious disease, a neurodegenerative disease and a tumor, preferably, the autoimmune disease is one or more selected from arthritis, rheumatoid arthritis, psoriasis, multiple sclerosis, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, glomerulonephritis, dilated cardiomyopathy, Sjogren's syndrome, atopic and contact dermatitis, polymyositis, scleroderma, periarteritis nodosa, rheumatic fever, vitiligo, insulin-dependent diabetes mellitus, Behcet's disease and chronic thyroiditis, preferably, the immune response against the transplant is graft-versus-host disease, and preferably, the allergic reaction is one or more selected from urticaria, eczema, angioneurotic edema, allergic rhinitis, bronchial asthma, laryngeal edema, food allergic gastroenteritis, anaphylactic shock, Preferably, the infectious disease refers to local tissue and systemic inflammatory reactions caused by the invasion of pathogens such as viruses, bacteria, fungi, parasites, and specific toxins into the human body. Preferably, the neurodegenerative disease is one or more selected from Parkinson's disease, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, and Creutzfeldt-Jakob disease. Preferably, the tumor is one or more selected from leukemia, lymphoma, myeloma, brain tumor, head and neck squamous cell carcinoma, non-small cell lung cancer, nasopharyngeal carcinoma, esophageal cancer, gastric cancer, pancreatic adenocarcinoma, gallbladder cancer, liver cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine sarcoma, prostate cancer, bladder cancer, renal cell carcinoma, and melanoma.

[0113] When a range of values is provided, unless otherwise specifically stated herein, each inserted value, one-tenth of the unit up to the lower limit, between the upper and lower limits of this range, and any other such value or inserted value within any of the said ranges are all to be understood as being included within the scope of the present invention. The upper and lower limits of these smaller ranges, which may be independently included within smaller ranges, are also included in the present invention, except for specifically excluded limits and except for specifically excluded boundaries within the said range. When the range includes one or two limits, ranges excluding one or two included boundaries are also included in the present invention.

[0114] Unless otherwise defined, all technical or scientific terms used herein shall be meant to have the ordinary meaning as understood by those skilled in the art to which the present invention pertains. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, but currently, preferred methods and materials are disclosed. All publications mentioned herein are hereby incorporated by reference in their entirety.

[0115] On the one hand, the examples provided in the present invention are for explaining the manufacturing process of the antibodies of the present invention. This manufacturing process is only for explaining the related methods and is not limiting. It is known to those skilled in the art that various modifications can be made to the present invention without departing from the spirit of the present invention. Such modifications are also included within the scope of the present invention. On the other hand, the examples provided in the present invention are for showing the characteristics and merits of the antibodies of the present invention, but the present invention is not limited to these characteristics and merits.

[0116] Hereinafter, the embodiments of the present invention will be described in detail together with examples. It should be understood by those skilled in the art that the following examples are only for explaining the present invention and should not be regarded as limiting the scope of the present invention. When specific conditions are not specified in the examples, they are carried out according to normal conditions or the conditions proposed by the manufacturing manufacturer. Reagents or equipment not specified by the manufacturing manufacturer are ordinary products available on the market.

[0117] Example Example 1 Production of Mouse-Derived Anti-Human CD47 Monoclonal Antibody 1.1 Immunization of Animals As experimental animals, 6- to 8-week-old female BALB / c mice purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. were used. After allowing the mice to acclimatize to the environment for one week, immunization was initiated. For the primary immunization, 50 μg of recombinant human CD47-Fc protein (Acrobiosystems (Beijing) Co., Ltd., catalog number CD7-H5256) and Freund's complete adjuvant (Sigma-Aldrich, catalog number F5881) were used. The two were mixed to form an emulsion, which was then administered intraperitoneally to the mice. Two weeks later, booster immunization was performed. For the booster immunization, 25 μg of recombinant human CD47-Fc protein and Freund's incomplete adjuvant (Sigma-Aldrich, catalog number F5806) were used. The two were mixed to form an emulsion, which was then administered intraperitoneally to the mice. Booster immunization was performed in the same manner every two weeks, for a total of three times. On the 10th day after the final immunization, blood was collected from the orbital venous plexus of the mice and serum was separated by centrifugation. The antibody titer against recombinant human CD47-Fc protein was measured by ELISA. Mice with high antibody titers were selected to produce hybridomas by fusion. Three days before fusion, 50 μg of recombinant human CD47-Fc protein without adjuvant was administered intraperitoneally. On the day of fusion, the spleen was aseptically removed, 15% fetal bovine serum (FBS) (Corning, catalog number 35-076-CV) was added to DMEM medium (Dulbecco's modified Eagle's medium, Gibco, catalog number 11965) to prepare a single spleen cell suspension, 0.25 μM of CpG ODN (InvivoGen, catalog number tlrl-1826-1) was added, and the cells were stimulated for 24 h. Electro-fusion was performed using a BTX ECM2001 electro-fusion device (Harvard Apparatus, catalog number 45-0010).

[0118] 1.2, Production of Hybridoma Cells Myeloma cells SP2 / 0 in the logarithmic growth phase (purchased from the Cell Bank of the Chinese Academy of Sciences) were collected, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, the cells were suspended in incomplete DMEM medium and then counted. The required number of cells was taken, and washed twice with E-fusion buffer consisting of 0.3 M mannitol (Sigma, catalog number M8429), 0.1 mM ammonium sulfate (Sigma, catalog number M7774), and 0.1 mM calcium chloride (Sigma, catalog number C5670), and centrifuged at 1000 rpm for 5 min. At the same time, spleen cells were washed twice with E-fusion buffer and centrifuged at 240 g for 6 min. Myeloma cells and spleen cells were mixed at a certain ratio, washed once with E-fusion buffer in a 50 mL plastic centrifuge tube, and centrifuged at 240 g for 6 min. The supernatant was discarded, and the bottom of the centrifuge tube was gently tapped with the palm of the hand to loosen the precipitated cells and make them uniform. 2 mL of E-fusion buffer / (1 - 1.5) * Add E-fusion buffer to 10E7 spleen cells, add 2 mL of the cell mixture to each fusion cell (Harvard Apparatus, catalog number 45 - 0107) with a 10 mm interval, check the parameter settings, and just press Automatic Start. After fusion, use a pipette under sterile conditions to carefully transfer the cell suspension from the fusion tank to a 50 mL centrifuge tube containing 28 mL of HAT medium (DMEM + HAT, Sigma, catalog number: H0262 - 10VL), let it stand at 37 °C for 10 min, and add the HAT medium to the cell number (3 - 5) * Add at 10E4 / well and spread on the plate, and incubate in a 37 °C, 5% CO2 incubator. After 5 days, replace it with 1 / 2 medium with HAT medium. After 7 - 10 days, replace the HAT medium with HT medium (DMEM + HT, Sigma, catalog number H0137 - 10VL). Regularly observe the growth status of hybridoma cells. When the cells grow until they cover more than 1 / 10 of the bottom area of the well, aspirate the supernatant for antibody detection. Expand and culture the cells of the positive clone and cryopreserve them.

[0119] 1.3 Screening and Identification of Clones The culture supernatants of hybridomas were screened for anti-human CD47 antibodies using ELISA. Recombinant human CD47 (purchased from Beijing Sinobiological) was coated onto a 96-well high-binding ELISA plate (Coster, catalog number 42592) at a coating concentration of 1 μg / mL with a coating volume of 100 μL / well using a carbonate buffer solution at pH = 9.6. The coating was performed overnight at 4°C. The plate was washed 5 times with PBST buffer. Blocking was carried out with PBST buffer containing 1% bovine serum albumin (BSA) at 300 μL / well and incubated at 25°C for 1 hr. The plate was washed 5 times with PBST buffer. Culture supernatant samples and positive serum controls were added at 100 μL / well and incubated at 25°C for 1 hr. The plate was washed 5 times with PBST buffer. Then, anti-mouse IgG antibody labeled with horseradish peroxidase (Abcam, catalog number Ab7068), diluted 1:10,000 with PBST buffer containing 1% BSA, was added at 100 μL / well and incubated at 25°C for 1 hr. The plate was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read using a microplate reader. OD 450nm Based on the strength of OD 450nm , positive clones that could secrete anti-human CD47 selective antibodies were selected.

[0120] Using ELISA, it was measured whether the anti-human CD47 selective antibody secreted from the positive clone could block the binding of CD47 / SIRPα. Recombinant human CD47-Fc (purchased from Acrobiosystems (Beijing) Co., Ltd.) was coated on a 96-well high-adsorption ELISA plate at a coating concentration of 1 μg / mL with a coating volume of 100 μL / well using a carbonate buffer solution at pH = 9.6. The coating was performed overnight at 4°C. It was washed 5 times with PBST buffer. Blocking was performed with 300 μL / well of PBST buffer containing 1% BSA and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. An anti-human CD47 selective antibody sample was added at 50 μL / well, and SIRPα (purchased from Acrobiosystems (Beijing) Co., Ltd.) labeled with biotin at a concentration of 4 nM (final concentration 2 nM) was added at 50 μL / well and incubated at 25°C for 90 min. It was washed 5 times with PBST buffer. Then, Streptavidin-HRP (BD Pharmingen, catalog number 554066) diluted 1:1000 with PBST buffer containing 1% BSA was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read with a microplate reader. An anti-human CD47 selective antibody that can inhibit the binding of human CD47-Fc / SIRPα labeled with biotin has neutralizing activity. Positive clones capable of secreting anti-human CD47 neutralizing antibodies were selected according to the strength of the blocking ability.

[0121] CD47 is highly expressed in red blood cells (RBCs). Some anti-CD47 antibodies can cause red blood cell aggregation. It was measured whether the anti-human CD47 neutralizing antibody secreted from the positive clone could cause red blood cell aggregation. After adding DPBS (Gibco, catalog number: 14190250) to healthy human whole blood subjected to internal anticoagulation treatment, the supernatant was removed by centrifugation, the red blood cells at the bottom of the centrifuge tube were collected, washed repeatedly 3 times, and then the red blood cells were resuspended in DPBS to obtain a 2% red blood cell suspension. This suspension was added to a low-adsorption 96-well plate (Coster, catalog number 3879) at 50 μL / well, and serially diluted anti-human CD47 antibody samples and a positive control (anti-CD47 antibody of clone number CC2C6, Biolegend, catalog number 323102) were added at 50 μL / well and mixed uniformly. The plate was placed in a 37 °C incubator and incubated for 2 hr. Then, it was observed and photographed.

[0122] The results are shown in Table 5. Multiple anti-human CD47 clones have strong CD47 binding activity and blocking activity to CD47 / SIRPα. Among them, the in vitro activity of the monoclonal antibody derived from the CD47-18-5 clone mouse is shown in Figure 1. The results of red blood cell aggregation are shown in Figure 2. The CD47-5-65, CD47-8-21, and CD47-16-5 clones can cause human red blood cell aggregation, while the CD47-5-191, CD47-18-5, and CD47-18-10 clones did not cause red blood cell aggregation.

[0123]

Table 5

[0124] 1.4. Measurement of monoclonal antibody sequence The antibody DNA sequences were measured for clones obtained by screening that simultaneously have antigen-binding activity and antigen-neutralizing activity and do not cause hemagglutination in vitro. First, cell mRNA was extracted using the RNAprep Pure kit (Tiangen, DP419). Next, the total RNA extracted from the hybridoma was reverse-transcribed using the SMART 5’ RACE kit (Clontech, catalog number 634849) to synthesize the first strand of human CD47 cDNA, and primers for the variable region for PCR amplification, VHGSP: GATTACGCCAAGCTTGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT (SEQ ID NO:36) and VLGSP: GATTACGCCAAGCTTGATGGATCCAGTTGGTGCAGCATCAGC (SEQ ID NO:37), were designed respectively. The target band obtained by PCR amplification was cloned into the linearized pRACE vector (Clontech, catalog number: 634859) by the in-fusion method, monoclonal was selected, and DNA sequencing was performed.

[0125] Example 2 Production of Chimeric Anti-Human CD47 Monoclonal Antibody The light chain variable region sequence of the antibody obtained by PCR amplification of the CD47-18-5 clone is shown in SEQ ID NO:9, and the heavy chain variable region sequence of the antibody is shown in SEQ ID NO:11. By excluding the framework region sequence based on the mouse variable region sequence, the complementary determining region sequence can be obtained. Here, the amino acid sequences of the three complementary determining regions LCDR1, LCDR2, and LCDR3 of the light chain are shown in SEQ ID NO:1, 2, and 3, respectively. The amino acid sequences of the three complementary determining regions HCDR1, HCDR2, and HCDR3 of the heavy chain are shown in SEQ ID NO:4, 5, and 7, respectively. The chimeric CD47 monoclonal antibodies constructed from the CD47-18-5 clone are named mAb-18-5 and mAb-18-5 N297A, respectively. The light chains of both antibodies are those in which the light chain variable region (SEQ ID NO:9) of the CD47-18-5 clone is linked to the light chain constant region (sequence SEQ ID NO:13). The heavy chain of the mAb-18-5 antibody is that in which the heavy chain variable region (SEQ ID NO:11) is linked to the heavy chain constant region (sequence SEQ ID NO:14), and the heavy chain of the mAb-18-5 N297A antibody is that in which the heavy chain variable region (SEQ ID NO:11) is linked to the heavy chain constant region (sequence SEQ ID NO:15). The light chain variable region sequence of the antibody obtained by PCR amplification of the CD47-18-10 clone is shown in SEQ ID NO:10, and the heavy chain variable region sequence of the antibody is shown in SEQ ID NO:12. By excluding the framework region sequence based on the mouse variable region sequence, the complementary determining region sequence can be obtained. Here, the amino acid sequences of the three complementary determining regions LCDR1, LCDR2, and LCDR3 of the light chain are shown in SEQ ID NO:1, 2, and 3, respectively. The amino acid sequences of the three complementary determining regions HCDR1, HCDR2, and HCDR3 of the heavy chain are shown in SEQ ID NO:4, 6, and 8, respectively.The chimeric CD47 monoclonal antibodies constructed from the CD47-18-10 clone are named mAb-18-10 and mAb-18-10 N297A respectively. The light chains of both antibodies are those in which the variable region of the light chain (SEQ ID NO:10) and the constant region of the light chain (sequence SEQ ID NO:13) of the CD47-18-10 clone are linked. The heavy chain of the mAb-18-10 antibody is that in which the variable region of the heavy chain (SEQ ID NO:12) and the constant region of the heavy chain (sequence SEQ ID NO:14) are linked. The heavy chain of the mAb-18-10 N297A antibody is that in which the variable region of the heavy chain (SEQ ID NO:12) and the constant region of the heavy chain (sequence SEQ ID NO:15) are linked. Table 6 shows the sequence information of the variable region of the light chain, the constant region of the light chain, the variable region of the heavy chain, and the constant region of the heavy chain of the obtained chimeric antibodies.

[0126]

Table 6

[0127] Gene synthesis (Suzhou GenScript Biotech Co., Ltd.) was performed on the genes encoding the amino acid sequences of the light and heavy chains of the above antibodies to obtain nucleotide sequences, which were then cloned into the eukaryotic expression vector X0GC. Subsequently, the expression vector was transfected into the ExpiCHO cell line (ExpiCHO TM , catalog number A29133, invitrogen). One day before transfection, the cells were inoculated and resuspended in fresh ExpiCHO TM expression medium (ExpiCHO TM Expression Medium, catalog number A29100, invitrogen) at a cell density of 35×10 5 cells / mL. The cell density counted on the day of transfection should be within the range of (70 - 200)×10 5 cells / mL and the survival rate should be over 95%. The cells were diluted with pre-warmed ExpiCHO TM expression medium to a final density of 60×10 5 cells / mL. According to the transfection volume, OptiPROTM In medium (Catalog No. 12309, Invitrogen), plasmid and transfection reagent ExpiFectamine TM CHO reagent (Catalog No. A29131, Invitrogen) was diluted respectively, and the final concentration of the plasmid was 0.5 μg / mL. The diluted transfection reagent was gently added to the plasmid and allowed to stand for 1 - 5 min. Then, the plasmid-transfection reagent complex was added to the cells, which were placed in a cell incubator and incubated at 125 rpm, 37 °C, and 8% CO2 on a shaker. On the day after transfection, ExpiFectamine TM CHO enhancer (Catalog No. A29131, Invitrogen) and ExpiCHO TM Feed (Catalog No. A29101 - 02, Invitrogen) were supplemented, and the cell incubator was set at 125 rpm, 32 °C, and 5% CO2 on a shaker. The supernatant of the cell culture transfected for 10 days was collected by centrifugation.

[0128] Example 3 Binding Activity and Kinetic Constants between Chimeric Anti-Human CD47 Monoclonal Antibody and Human CD47 Using a carbonate buffer solution with pH = 9.6, recombinant human CD47 (purchased from Beijing Sinobiological) was coated on a 96-well high-binding ELISA plate at a coating concentration of 1 μg / mL with a coating amount of 100 μL / well. The coating was carried out overnight at 4°C. It was washed 5 times with PBST buffer. Blocking was performed at 25°C for 1 hr with 300 μL / well of PBST buffer containing 1% BSA. It was washed 5 times with PBST buffer. Anti-human CD47 antibody samples and control CC-90002 (derived from patent sequence WO2016109415) were added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. Then, anti-mouse IgG antibody labeled with horseradish peroxidase (Abcam, catalog number Ab7068), diluted 1:10000 with PBST buffer containing 1% BSA, was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read with a microplate reader. The results are shown in Figure 3. The anti-human CD47 chimeric monoclonal antibodies mAb-18-5, mAb-18-5 N297A, mAb-18-10, and mAb-18-10 N297A have good human CD47 binding affinity and stronger binding activity than the control CC-90002.

[0129] The binding kinetic constants between the anti-human CD47 chimeric monoclonal antibody and its antigen human CD47 were detected using a Biacore X100 instrument (purchased from GE). This instrument measures the binding and dissociation between molecules bound and coated on a biochip and test molecules by optical surface plasmon resonance technology. The main reagent used is a Protein A chip (GE Healthcare, 29-1275-57). The experimental process is briefly described as follows. The anti-human CD47 chimeric antibody was diluted in a running buffer (1×HBS-EP + 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% surfactant P20, pH 7.4). In the capture and binding steps, an antibody with a concentration of 2 μg / mL was injected at a rate of 10 μL / min for 60 seconds. In the binding step, the antigen CD47 was diluted to multiple concentrations with the running buffer and injected at a rate of 30 μL / min for 120 seconds each. In the dissociation step, the running buffer was injected at a rate of 10 μL / min for 600 seconds. The regeneration condition was a 10 mM glycine salt solution, pH 1.5. The binding kinetic constants and dissociation kinetic constants were analyzed and calculated using the Biacore X100 evaluation software. The binding kinetic constants, dissociation kinetic constants, and dissociation equilibrium constants of the anti-human CD47 chimeric antibody are shown in Table 7. From the data, it was shown that the anti-human CD47 chimeric monoclonal antibody is equivalent to or better than the binding and dissociation parameters of CC-90002.

[0130]

Table 7

[0131] Example 4 Species Specificity and Binding Specificity of Chimeric Anti-Human CD47 Monoclonal Antibody The species specificity of the anti-human CD47 chimeric monoclonal antibody was measured by ELISA. Using a carbonate buffer solution at pH = 9.6, recombinant human CD47, cynomolgus monkey CD47, rat CD47, and mouse CD47 (all purchased from Beijing Sinobiological) were coated on a 96-well high-binding ELISA plate at a coating concentration of 1 μg / mL with a coating volume of 100 μL / well. The coating was carried out overnight at 4°C. It was washed 5 times with PBST buffer. Blocking was performed at 25°C for 1 hr with 300 μL / well of PBST buffer containing 1% BSA. It was washed 5 times with PBST buffer. A sample of the anti-human CD47 chimeric monoclonal antibody serially diluted with PBST buffer containing 1% BSA was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. Then, an anti-human IgG antibody labeled with horseradish peroxidase (Chemicon, catalog number AP309P) diluted 1:10000 with PBST buffer containing 1% BSA was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read using a microplate reader.

[0132] The species specificity of the anti-human CD47 chimeric monoclonal antibody was confirmed by flow cytometry FACS. Normal human RBC, cynomolgus monkey RBC, rat RBC, and mouse RBC cells donated internally were collected. They were washed once with cold PBS (GIBCO, catalog number 14190) containing 2% FBS (Hyclone, catalog number SH30084.03). The RBCs were placed at 2×10 per tube 6The cells were resuspended in 100 μL of cold PBS containing 2% FBS, and 100 μL of serially diluted anti-human CD47 antibody samples and control CC-90002, isotype control were added. The tubes for flow cytometry were incubated on ice for 30 min. They were washed twice with PBS containing 2% FBS. They were resuspended in 200 μL of cold PBS containing 2% FBS and FITC-labeled anti-human IgG antibody (Beijing Zhongshan Jinqiao, catalog number ZF0306) diluted at 1:1000. They were incubated on ice in the dark for 30 min. They were washed twice with PBS containing 2% FBS. They were resuspended in 500 μL of cold PBS. This cell suspension was detected and analyzed by flow cytometry (BD, FACS Calibur), and the fluorescence intensity of RBC cells was read.

[0133] The binding specificity of the anti-human CD47 chimeric monoclonal antibody was measured by ELISA. Using a carbonate buffer solution at pH = 9.6, at a coating concentration of 1 μg / mL with a coating amount of 100 μL / well, recombinant human PD-1, CD28, CTLA4, ICOS, BTLA, CD47, PD-L2, CD80, CD86, B7-H2, CD47, SIRPα, SIRPγ (all purchased from Sinobiological) were coated on a 96-well high-binding ELISA plate. The coating was carried out overnight at 4°C. It was washed 5 times with PBST buffer. Blocking was performed at 25°C for 1 hr with 300 μL / well of PBST buffer containing 1% BSA. It was washed 5 times with PBST buffer. The anti-human CD47 chimeric monoclonal antibody sample serially diluted with PBST buffer containing 1% BSA, the control CC-90002, and the isotype control were added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. Then, an anti-human IgG antibody labeled with horseradish peroxidase (Chemicon, catalog number AP309P) diluted 1:10000 with PBST buffer containing 1% BSA was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read with a microplate reader.

[0134] The results are shown in Figure 4A and Table 8. The anti-human CD47 chimeric monoclonal antibody can bind to human CD47 and cynomolgus CD47, and their affinities are similar, but it does not bind to rat and mouse CD47, showing species specificity. At the same time, as shown in Figure 4B, the anti-human CD47 chimeric monoclonal antibody also has strong binding specificity, binds only to CD47, and does not bind to B7 family members, CD28 family members, and SIRPγ.

[0135]

Table 8

[0136] Example 5 Blocking Activity of Chimeric Anti-Human CD47 Monoclonal Antibody against the Binding of CD47 to Receptor Using a carbonate buffer solution with pH = 9.6, at a coating concentration of 1 μg / mL with a coating amount of 100 μL / well, recombinant human CD47-Fc (purchased from Acrobiosystems (Beijing) Co., Ltd.) was coated on a 96-well high-binding ELISA plate. The coating was carried out overnight at 4°C. It was washed 5 times with PBST buffer. Blocking was performed at 300 μL / well with PBST buffer containing 1% BSA and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. An anti-human CD47 antibody sample was added at 50 μL / well, and SIRPα (purchased from Acrobiosystems (Beijing) Co., Ltd.) labeled with biotin at a concentration of 4 nM (final concentration was 2 nM) was added at 50 μL / well and incubated at 25°C for 90 min. It was washed 5 times with PBST buffer. Then, streptavidin-HRP (BD Pharmingen, catalog number 554066) diluted 1:1000 with PBST buffer containing 1% BSA was added at 100 μL / well and incubated at 25°C for 1 hr. It was washed 5 times with PBST buffer. The chromogenic substrate TMB was added at 100 μL / well and allowed to develop color at room temperature for 10 min. The color development was stopped by adding 100 μL / well of 1 M H2SO4. The absorbance at 450 nm was read with a microplate reader.

[0137] The results are shown in Figure 5. The anti-human CD47 chimeric monoclonal antibody has a blocking activity against CD47 / SIRPα similar to CC-90002.

[0138] Example 6 Phagocytic Activity against Tumor Cells Mediated by Chimeric Anti-Human CD47 Monoclonal Antibody Production of mature human macrophages: Human PBMC cells (Lonza, catalog number CC-2702) were revived and collected. The human PBMC cells were at 5×10 6Resuspended in serum-free RPMI 1640 medium (Gibco, catalog number 11875) at a cell density of / mL and inoculated into a cell culture bottle, and incubated in a carbon dioxide incubator at 37°C for 90 min. Discarded the culture supernatant and suspended cells, incubated the adherent cells in complete medium (RPMI 1640 containing 10% FBS), and added 25 ng / mL of M-CSF (Beijing Sinobiological, catalog number 11792-HNAN), and incubated for 7 days. Then, collected the macrophages and resuspended them in complete medium (RPMI 1640 containing 10% FBS) containing 25 ng / mL of M-CSF and 50 ng / mL of IFN-γ (Beijing Sinobiological, catalog number 11725-HNAS). Inoculated this cell suspension into a 48-well cell culture plate at 50,000 cells / well and incubated for 1 day to mature and prepare the macrophages.

[0139] Stained Raji tumor cells (purchased from Beijing Union Cell Resource Center, catalog number: 3111C0001CCC000046) by referring to the instructions of the CFSE kit (Life technology, catalog number C34554). Briefly, diluted CFSE with PBS to a working concentration of 5 μM, preheated it at 37°C, centrifuged at 1000 rpm for 5 min to collect Raji cells, resuspended Raji in the preheated CFSE working solution, and incubated at 37°C for 15 min. Washed once with complete medium, resuspended in complete medium, incubated for 30 min, washed twice more with complete medium, and resuspended in complete medium for preparation.

[0140] The 48-well plates were washed three times with complete medium. Raji cells after CFSE staining, test anti-human CD47 antibody samples, control CC-90002, and isotype control were incubated for 15 min in advance, then added to 48-well culture plates and incubated in a carbon dioxide incubator at 37 °C for 2 h. After incubation, the 48-well plates were washed three times with complete medium, wheat germ agglutinin diluted with complete medium, alexa fluor 555 (Life technologies, catalog number W32464) was added at 10 μg / mL, and incubated in the dark for 15 min. The 48-well plates were further washed three times with complete medium, 4% paraformaldehyde was added and fixed for 15 min. The 48-well plates were further washed three times with complete medium, and complete medium was added. Images were taken with a fluorescence microscope and the cell numbers were counted. The calculation method of the phagocytosis index (%) is as follows: the number of green-labeled Raji cells phagocytosed / the number of red-labeled macrophages present × 100.

[0141] The results are shown in Figure 6. The anti-human CD47 chimeric monoclonal antibody can mediate the phagocytosis of Raji tumor cells by macrophages and is equivalent to or more active than CC-90002.

[0142] Example 7 Effect of chimeric anti-human CD47 monoclonal antibody on red blood cells CD47 is highly expressed in red blood cells (RBCs). Some anti-CD47 antibodies can cause agglutination of red blood cells. Whether the anti-human CD47 chimeric monoclonal antibody causes agglutination of red blood cells was measured. DPBS was added to healthy human whole blood with internally donated anticoagulation treatment and resuspended, then the supernatant was removed by centrifugation, the red blood cells at the bottom of the centrifuge tube were collected, washed repeatedly 3 times, and then the red blood cells were resuspended in DPBS to make a 2% red blood cell suspension. This suspension was added to a low-adsorption 96-well plate at 50 μL / well, and step-diluted anti-human CD47 chimeric monoclonal antibody samples and a positive control (anti-CD47 antibody of clone number CC2C6, Biolegend, catalog number 323102) were added at 50 μL / well and mixed uniformly. The plate was placed in a 37 °C incubator and incubated for 2 hours, then observed and photographed.

[0143] The results are shown in Figure 7. Only the positive control caused human red blood cell agglutination, while mAb-18-5 and mAb-18-10 did not cause red blood cell agglutination.

[0144] Example 8 Pharmacodynamic study of chimeric anti-human CD47 monoclonal antibody as an antitumor drug In this example, the inhibitory effect of the chimeric anti-human CD47 monoclonal antibody on the growth of Raji tumor xenografts inoculated into NCG mice was detected. Female NCG mice aged 6 - 8 weeks (purchased from Nanjing Institute of Biomedicine) were used as experimental materials. After the mice were allowed to adapt to the environment for 1 week, each mouse was inoculated with 5×10 6 human Raji lymphoma cells. When the tumor volume reached about 150 mm 3 the mice were grouped into groups of 6 according to tumor volume and set as a solvent control group, a CC-90002 control group, an anti-human CD47 chimeric monoclonal antibody mAb-18-5 administration group, and an anti-human CD47 chimeric monoclonal antibody mAb-18-5 N297A administration group, respectively. They were intraperitoneally administered twice a week for 2 consecutive weeks at a dose of 35 nmol / kg. The tumor volume was measured twice a week from the day of administration, and its major axis a and minor axis b were measured. The calculation formula for tumor volume is tumor volume (mm 3)=(a×b 2 ) was divided by 2.

[0145] The results are shown in Figure 8. The anti-human CD47 chimeric monoclonal antibody mAb-18-5 had anti-tumor activity, significantly inhibited the growth of Raji transplanted tumors inoculated into NCG mice, and its efficacy was equivalent to that of CC-90002.

[0146] Example 9 Production of Humanized Anti-Human CD47 Monoclonal Antibody The humanized anti-human CD47 monoclonal antibody is obtained based on the method described by Leung et al. (1995, Molecule Immunol 32:1413-27).

[0147] From the GermLine database, a humanized template that most closely matches the variable region sequence of the mouse-derived antibody was selected. Here, the template for the light chain variable region is IGKV1-17 * 02, and the sequence is shown in SEQ ID NO:34. The template for the heavy chain variable region is IGHV1-69 * 01, and the sequence is shown in SEQ ID NO:35. The CDR regions of the mouse-derived antibody were transplanted into the selected humanized template and replaced with the CDR regions of the human template to obtain the light chain variable region of the transplanted humanized antibody, the sequence of which is shown in SEQ ID NO:25. The sequence of the heavy chain variable region of the transplanted humanized antibody is shown in SEQ ID NO:28. Sites were selected from SEQ ID NO:25 and SEQ ID NO:28 for back mutation. The obtained light chain variable region sequences are shown in SEQ ID NO:26 and 27, and the obtained heavy chain variable region sequences are shown in SEQ ID NO:29-33. The light chain variable region was ligated with the light chain constant region (sequence SEQ ID NO:13) to obtain the corresponding full-length light chain sequences, and the heavy chain variable region was ligated with the heavy chain constant region (sequence SEQ ID NO:14) to obtain the corresponding full-length heavy chain sequences. Screening for affinity and stability yielded usable humanized sequences, and the sequence information of the light and heavy chain variable regions of the obtained humanized sequences is shown in Table 9.

[0148]

Table 9

[0149] Example 10 Antigen-binding Activity of Humanized Anti-human CD47 Monoclonal Antibody The humanized CD47 monoclonal antibodies were named BH3008b and BH3011b. Here, the variable regions corresponded to Z11 and Z12 respectively. The light chain variable region was linked to the light chain constant region (sequence SEQ ID NO: 13), and the heavy chain variable region was linked to the heavy chain constant region (sequence SEQ ID NO: 16). As described above, the antigen-binding activity of the humanized anti-human CD47 monoclonal antibody was detected. The results are shown in Figure 9. The humanized anti-human CD47 monoclonal antibodies BH3008b and BH3011b had good human CD47 binding affinity and were equivalent to the binding activity with the control CC-90002.

[0150] Example 11 Blocking Activity of Humanized Anti-human CD47 Monoclonal Antibody on the Binding of CD47 to Receptor As described above, the blocking activity of the humanized anti-human CD47 monoclonal antibody on the binding of CD47 to the receptor was detected.

[0151] The results are shown in Figure 10. The humanized anti-human CD47 monoclonal antibodies BH3008b and BH3011b had blocking activity on CD47 / SIRPα similar to that of CC-90002.

[0152] Example 12 Binding Kinetic Constants of Humanized Anti-human CD47 Monoclonal Antibody and Human CD47 As described above, the binding kinetic constants of the anti-human CD47 humanized monoclonal antibody and its antigen human CD47 were detected using a Biacore X100 instrument. The binding kinetic constants, dissociation kinetic constants, and dissociation equilibrium constants of the anti-human CD47 humanized antibody are shown in Table 10. According to the data, it was shown that the binding and dissociation parameters of the anti-human CD47 humanized monoclonal antibodies BH3008b, BH3011b, and CC-90002 were equivalent.

[0153]

Table 10

[0154] Example 13: Effect of Humanized Anti-Human CD47 Monoclonal Antibody on Red Blood Cells As described above, it was measured whether the anti-human CD47 humanized monoclonal antibodies BH3008b, BH3011b and the control CC-90002 caused red blood cell aggregation. Here, the positive control was the anti-CD47 antibody of clone number CC2C6, Biolegend, catalog number 323102.

[0155] The results are shown in Figure 11. Only the positive control caused human red blood cell aggregation, while CC-90002, BH3008b, and BH3011b did not cause red blood cell aggregation.

[0156] Example 14: Detection of Purity and Thermal Stability of Humanized Anti-Human CD47 Monoclonal Antibody by Size Exclusion Chromatography (SE-HPLC) The Waters Xbridge BEH200 chromatography column (Catalog No.: 186007640) was used. The mobile phase was 0.1 mol / L NaCl buffer, pH 6.7, the flow rate was 0.8 mL / min, the chromatography column temperature was 25 °C, the sample cell temperature was 4 °C, the detection wavelength was 280 nm. The sample was diluted to 1 mg / mL with the sample buffer DPBS, and the sampling volume was 10 μL. Data processing was performed on the experimental results by the Agilent high performance liquid chromatography 1260 system station, and the ratio of the main peak, which is the purity, was calculated by the area normalization method. The SE-HPLC purity of the above-prepared humanized anti-human CD47 monoclonal antibodies BH3008b and BH3011b was detected. To determine the thermal stability of these monoclonal antibodies, the above samples were placed under high temperature conditions of 40 °C, sampled at the 2nd week and the 4th week respectively, and SE-HPLC detection was performed to observe the thermal stability, and the results are shown in Table 11. The humanized anti-human CD47 antibodies all showed good and equivalent stability.

[0157]

Table 11

[0158] Example 15 Detection of Charge Variants of Humanized Anti-Human CD47 Monoclonal Antibodies by Ion Exchange Chromatography (IEX) A cation exchange chromatography column MabPac SCX-10, 4 mm×250 mm (Thermo, catalog number: 78655) was used. 20 mmol / L morpholinoethanesulfonic acid (MES) (pH 5.6) and 60 mmol / L sodium chloride were used as mobile phase A, and 10 mmol / L MES (pH 5.6) and 300 mmol / L sodium chloride were used as mobile phase B. The flow rate was 0.6 mL / min, the column temperature was 25 °C, the sample cell temperature was 4 °C, the detection wavelength was 280 nm, and the sample injection volume was 40 μL (1 mg / mL). The elution method was to run for 43 min with a linear gradient of 10 - 55%. Data processing was performed on the experimental results by an Agilent high performance liquid chromatography 1260 system station, and the percentage of peak area was calculated by the area normalization method. IEX detection was performed on the above-prepared humanized anti-human CD47 monoclonal antibodies BH3008b and BH3011b. To determine the chemical stability of these monoclonal antibodies, the above samples were placed under high temperature conditions of 40 °C, sampled at the second week and the fourth week respectively, and IEX detection was performed to observe the change in the ratio of charge variants, and the results are shown in Table 12. The changes in the ratio of charge variants of the humanized anti-human CD47 antibody were all low.

[0159]

Table 12

[0160] Example 16 Pharmacodynamic study of humanized anti-human CD47 monoclonal antibody as an antitumor drug In this example, the inhibitory effect of the humanized anti-human CD47 monoclonal antibody on the growth of Raji tumor xenografts inoculated into NCG mice was detected. Female NCG mice aged 6 - 8 weeks (purchased from Nanjing Institute of Biomedicine) were used as experimental materials. After the mice were allowed to adapt to the environment for 1 week, 5×10 6 Raji human lymphoma cells were inoculated per mouse. When the tumor volume reached about 150 mm 3When it reached this point, the mice were divided into groups of 6 each according to tumor volume, and were set as a solvent control group, a CC-90002 control group, a group administered with the anti-human CD47 humanized monoclonal antibody BH3008b, and a group administered with the anti-human CD47 humanized monoclonal antibody BH3011b, respectively. They were intraperitoneally administered twice a week for 2 consecutive weeks at a dosage of 17.5 nmol / kg. The tumor volume was measured twice a week from the administration day, and its major axis a and minor axis b were measured. The calculation formula for the tumor volume was tumor volume (mm 3 ) = (a × b 2 ) / 2.

[0161] The results are shown in Figure 12. The anti-human CD47 humanized monoclonal antibodies BH3008b and BH3011b had antitumor activity, significantly inhibited the growth of Raji transplanted tumors inoculated into NCG mice, and the efficacy was equivalent to that of CC-90002.

[0162] Finally, each of the above examples is for explaining the technical solution of the present invention and is not intended to limit it. Although the present invention has been described in detail with reference to the above examples, for those skilled in the art, it is still possible to modify the technical solutions described in the above examples or equivalently replace some or all of their technical features. It should be understood that these modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions according to the examples of the present invention.

Claims

**Claim 1** An isolated anti-human CD47 antibody or an antigen-binding fragment thereof, comprising a light chain variable region and a heavy chain variable region, wherein the light chain variable region comprises an amino acid sequence that is LCDR1 shown in SEQ ID NO. 1, an amino acid sequence that is LCDR2 shown in SEQ ID NO. 2, and an amino acid sequence that is LCDR3 shown in SEQ ID NO. 3, the heavy chain variable region (1) comprises an amino acid sequence that is HCDR1 shown in SEQ ID No. 4, an amino acid sequence that is HCDR2 shown in SEQ ID No. 5, and an amino acid sequence that is HCDR3 shown in SEQ ID No. 7, or (2) comprises an amino acid sequence that is HCDR1 shown in SEQ ID No. 4, an amino acid sequence that is HCDR2 shown in SEQ ID No. 6, and an amino acid sequence that is HCDR3 shown in SEQ ID No. 8, the anti-human CD47 antibody or an antigen-binding fragment thereof. **Claim 2** The anti-human CD47 antibody or an antigen-binding fragment thereof according to claim 1, wherein the anti-human CD47 antibody or an antigen-binding fragment thereof is a chimeric antibody or a humanized antibody. **Claim 3** The anti-human CD47 antibody or an antigen-binding fragment thereof according to claim 1 or 2, wherein the heavy chain constant region sequence of the antibody is selected from the constant region sequences of any one of human IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD, and / or the light chain constant region sequence of the antibody is selected from the κ chain or the λ chain. **Claim 4** The anti-human CD47 antibody or an antigen-binding fragment thereof according to claim 3, wherein the heavy chain constant region sequence is selected from the constant region sequences of IgG1 or IgG4, and / or the light chain constant region sequence is selected from the constant region sequence of the κ chain. **Claim 5** The anti-human CD47 antibody or an antigen-binding fragment thereof according to any one of claims 1 to 4, wherein the light chain variable region has an amino acid sequence shown in SEQ ID NO. 9 or 10, and / or the heavy chain variable region has an amino acid sequence shown in SEQ ID NO. 11 or 12, and / or the amino acid sequences of the light chain constant region and the heavy chain constant region are each shown in any one of SEQ ID NO. 13 and SEQ ID NO. 14 - 16. **Claim 6** The light chain variable region framework region of the anti-human CD47 antibody or its antigen-binding fragment includes FR-L1, FR-L2, FR-L3, and FR-L4, and the heavy chain variable region framework region includes FR-H1, FR-H2, FR-H3, and FR-H4. The amino acid sequence of the FR-L1 is shown in SEQ ID NO.

17. The amino acid sequence of the FR-L2 is shown in SEQ ID NO. 18, or is an amino acid sequence obtained by the following substitution in the sequence of SEQ ID NO.

18. The 12th amino acid R is substituted with T. The amino acid sequence of the FR-L3 is shown in SEQ ID NO. 19, or is an amino acid sequence obtained by the following substitution in the sequence of SEQ ID NO.

19. The 31st amino acid Y is substituted with F. The amino acid sequence of the FR-L4 is shown in SEQ ID NO.

20. The amino acid sequence of the FR-H1 is shown in SEQ ID NO.

21. The amino acid sequence of the FR-H2 is shown in SEQ ID NO.

22. The amino acid sequence of the FR-H3 is shown in SEQ ID NO. 23, or is an amino acid sequence obtained by any one or any combination of the following substitutions in the sequence of SEQ ID NO.

23. The 8th amino acid E is substituted with T. The 11th amino acid S is substituted with N. The 31st amino acid A is substituted with V, and / or The amino acid sequence of the FR-H4 is shown in SEQ ID NO.

24. The amino acid residues are numbered according to the Kabat numbering system. The anti-human CD47 antibody or its antigen-binding fragment according to any one of claims 1 to 5.

7. The light chain variable region has the amino acid sequence shown in any one of SEQ ID Nos. 25-27, and / or The heavy chain variable region has the amino acid sequence shown in any one of SEQ ID Nos. 28-33. The anti-human CD47 antibody or its antigen-binding fragment according to any one of claims 1 to 6.

8. The light chain variable region has the amino acid sequence shown in SEQ ID NO. 26 or 27, and / or The heavy chain variable region has the amino acid sequence shown in SEQ ID NO.

33. The anti-human CD47 antibody or its antigen-binding fragment according to claim 7.

9. The antigen-binding fragment is F(ab') ２ , Fab', Fab, Fd, Fv, scFv, or one or more selected from bispecific antibodies, the anti-human CD47 antibody or antigen-binding fragment thereof according to any one of claims 1 to 8.

10. The antigen-binding fragment is Fab, F(ab') ２ or scFv, and the anti-human CD47 antibody or antigen-binding fragment thereof according to claim 9.

11. (1)A DNA or RNA encoding an anti-human CD47 antibody or an antigen-binding fragment thereof according to any one of claims 1 to 10; (2)An isolated nucleic acid molecule selected from a nucleic acid that is completely complementary to the nucleic acid defined in (1).

12. An expression vector containing the nucleic acid molecule according to claim 11 ligated effectively.

13. A host cell containing the nucleic acid molecule according to claim 11 or the expression vector according to claim 12.

14. A composition comprising an anti-human CD47 antibody or an antigen-binding fragment thereof according to any one of claims 1 to 10, the nucleic acid molecule according to claim 11, the expression vector according to claim 12, or the host cell according to claim 13, and one or more pharmaceutically acceptable carriers, diluents, or excipients.

15. Culturing the host cell according to claim 13 under culture conditions suitable for the expression of the anti-human CD47 antibody or an antigen-binding fragment thereof, and optionally isolating and purifying the obtained product. A method for producing an anti-human CD47 antibody or an antigen-binding fragment thereof according to any one of claims 1 to 10.

16. Use of an anti-human CD47 antibody or an antigen-binding fragment thereof according to any one of claims 1 to 10, the nucleic acid molecule according to claim 11, the expression vector according to claim 12, or the host cell according to claim 13 in the manufacture of a medicament for preventing and / or treating a disease or disorder mediated by CD47.

17. The use according to claim 16, wherein the disease or disorder is a tumor.

18. The use according to claim 17, wherein the tumor is one or more selected from leukemia, lymphoma, myeloma, brain tumor, head and neck squamous cell carcinoma, non-small cell lung cancer, nasopharyngeal carcinoma, esophageal cancer, gastric cancer, pancreatic adenocarcinoma, gallbladder cancer, liver cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine sarcoma, prostate cancer, bladder cancer, renal cell carcinoma, melanoma.

Images