Composition for relieving suppression of RE1 silencing transcription factor target gene

Peptides that bind to CTDSP1 are used to inhibit REST activity, addressing the repression of REST target genes and offering potential therapeutic benefits for various neurological conditions.

JP7699588B2Active Publication Date: 2025-06-27ALCAMENA STEM CELL THERAPEUTICS LLC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022529775
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-10-01
Filing Date
2020-11-20
Publication Date
2025-06-27
Estimated Expiration
2040-11-20

AI Technical Summary

Technical Problem

Current technologies lack effective methods to inhibit the activity of RE1 silencing transcription factor (REST) target genes, which are repressed by REST and are crucial for neuronal development and function.

Method used

Development of peptides, such as TEDLEPPEPPLPKEN, EDLEPPEPPLPK, nekplppeppeldet, and kplppeppelde, that bind to C-terminal domain small phosphatase 1 (CTDSP1) to inhibit REST activity, promoting the expression of REST target genes.

Benefits of technology

The peptides effectively inhibit REST activity, leading to increased expression of REST target genes, which is beneficial for treating conditions such as traumatic brain injury, epilepsy, and chronic pain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007699588000040
    Figure 0007699588000040
  • Figure 0007699588000041
    Figure 0007699588000041
  • Figure 0007699588000042
    Figure 0007699588000042
Patent Text Reader

Abstract

The present invention relates to compounds, compositions, and methods for derepressing RE1 silencing transcription factor (REST) ​​target genes. In particular, peptides having the sequences TEDLEPPEPPLPKEN (SEQ ID NO: 1) and EDLEPPEPPLPK (SEQ ID NO: 15), or the inverse sequence consisting of D-amino acids (reverse inversion, RI) nekplppeppeldet (SEQ ID NO: 16) and kplppeppelde (SEQ ID NO: 17), are disclosed for inhibiting REST activity. The peptides are useful for the treatment, prevention, and amelioration of traumatic brain injury, epilepsy, dementia, Huntington's disease (HD), chronic pain, brain tumors (including glioblastoma multiforme), pancreatic cancer, diabetes, peripheral nerve injury, and other conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 939,149, filed Nov. 22, 2019, and U.S. Provisional Patent Application No. 63 / 086,248, filed Oct. 1, 2020, the disclosures of which are incorporated herein by reference. Sequence Listing: This application includes a sequence listing submitted electronically in ASCII format, which is hereby incorporated by reference in its entirety. The ASCII copy created on January 8, 2021 is named 09097_001_PCT_SL.txt and is 120,717 bytes in size.

[0002] Methods, compounds, and compositions for relieving the repression of RE1 silencing transcription factor (REST) target genes are provided. In particular, peptides having the sequences of TEDLEPPEPPLPKEN (SEQ ID NO: 1) and EDLEPPEPPLPK (SEQ ID NO: 15), or reverse sequences consisting of D-amino acids (retro-inverted, RI) nekplppeppeldet (SEQ ID NO: 16) and kplppeppelde (SEQ ID NO: 17) are disclosed for inhibiting REST activity. The peptides are useful for the treatment, prevention, and improvement of traumatic brain injury, epilepsy, dementia, Huntington's disease (HD), chronic pain, brain tumors (including glioblastoma multiforme), pancreatic cancer, diabetes, peripheral nerve injury, and the like.

Background Art

[0003] Repressor element 1 (RE1) silencing transcription factor (REST) is a repressor of hundreds of neuronal cell genes 1The target represents genes necessary for the phenotype of terminally differentiated neurons and includes genes encoding voltage- and ligand-dependent ion channels, their receptors, growth factors, and axon guidance proteins (Bruce AW et al, Proc Natl Acad Sci U S A 101, 10458-10463 (2004); Conaco C et al, Proc Natl Acad Sci U S A 103, 2422-2427 (2006); Mortazavi A et al, Genome Res 16, 1208-1221 (2006); and Otto SJ et al, J Neurosci 27, 6729-6739 (2007); all of which are incorporated herein by reference). Thus, during neuronal development, REST is gradually regulated to form the phenotype of mature neurons (Ballas et al, 2005 supra). The importance of this event has been demonstrated by gain-of-function studies showing that the persistence of REST inhibits the differentiation of terminal neurons (Mandel G et al, Proc Natl Acad Sci U S A 108, 16789-16794 (2011) and Gao Z ei a I, J Neurosci 31, 9772-9786 (2011); both of which are incorporated herein by reference).

[0004] Little is known about the transcriptional or post-transcriptional regulation of REST (Ballas N et al 2005 supra; Ballas N et al, Neuron 31, 353-365 (2001); and Kojima T et al, Brain Res Mol Brain Res 90, 174-186 (2001); all of which are incorporated herein by reference). However, two phosphorylation sites of REST (serines 861 and 864) control neuronal differentiation through interaction with C-terminal domain small phosphatase 1 (CTDSP1). 2 When CTDSP1 removes phosphate from serines 861 and 864, the REST protein is stabilized and neuronal differentiation is suppressed. 2-4 .

Summary of the Invention

Means for Solving the Problems

[0005] This specification discloses methods, compounds, and compositions for developing peptides having high affinity for CTDSP1.

[0006] Disclosed herein are methods, compounds, and compositions for binding C-terminal domain small phosphatase 1 (CTDSP1).

[0007] Disclosed herein are REST phosphorylation mimetic peptides, TEDLEPPEPPLPKEN (SEQ ID NO: 1), EDLEPPEPPLPK (SEQ ID NO: 15), nekplppeppeldet (SEQ ID NO: 16), and kplppeppelde (SEQ ID NO: 17), which bind to CTDSP1 to inhibit REST activity. Lowercase letters indicate D-amino acids, which are resistant to degradation and can thus lengthen the half-life of the peptide without impairing binding affinity. 5 。

[0008] Disclosed herein are 98 REST phosphorylation mimetic peptide variants (RPP V )(SEQ ID NOS: 18-117), which inhibit CTDSP1 activity against REST to varying degrees (Figure 25).

[0009] Disclosed herein are intracellular transport peptides such as cell-penetrating peptides (CPP) and / or endosomal escape sequences (SEQ ID NOS: 118-137 and 140-159) that can be fused to RPP (SEQ ID NOS: 1 and 15-17) or RPP V (SEQ ID NOS: 18-117) at the N-terminus or C-terminus to improve intracellular transport. Further disclosed are linkers (SEQ ID NOS: 138, 139, 160, and 161) that can be inserted between RPP or RPP V and one of the peptides listed in Table 7 to improve intracellular transport.

[0010] In this specification, in order to improve the binding affinity and stability (lengthen the half-life of the peptide), RPP (SEQ ID NO: 1 and 15-17) or RPP cyclized by fusion with an intracellular transport peptide (SEQ ID NO: 118-137 and 140-159) at the N or C terminus V (SEQ ID NO: 18-117) is disclosed. Examples of the cyclized fusion proteins are SEQ ID NO: 2, 5, 12, 13, and 14.

[0011] In this specification, RPP (SEQ ID NO: 1 and 15-17) or RPP fused with an intracellular transport peptide (SEQ ID NO: 118-137 and 140-159) at the N or C terminus V (SEQ ID NO: 18-11 7) is disclosed to promote the degradation of the REST protein. Examples of the fusion proteins are SEQ ID NO: 2, and 4-14.

[0012] In this specification, the REST phosphorylation-mimicking peptide of SEQ ID NO: 1 and 15-17 or the RPP of SEQ ID NO: 18-117 fused with an intracellular transport peptide (SEQ ID NO: 118-137 and 140-159) at the N or C terminus V is disclosed to promote the expression of the REST target gene. Examples of the fusion proteins are SEQ ID NO: 2, 4-14.

[0013] In this specification, the RPP of SEQ ID NO: 1 and 15-17 or the RPP of SEQ ID NO: 18-117 fused with an intracellular transport peptide (SEQ ID NO: 118-137 and 140-159) at the N or C terminus V is disclosed to be advantageous for the treatment of animals having a disease or condition related to REST or CTDSP1. By administering a therapeutically effective amount of the compound to the animal, the expression of the REST target gene is increased, or BDNF is increased. Examples of the fusion proteins are SEQ ID NO: 2 and 4-14.

[0014] In this specification, the RPP of SEQ ID NO: 1 and 15-17 or the RPP of SEQ ID NO: 18-117 fused with an intracellular transport peptide (SEQ ID NO: 118-137 and 140-159) VIt is disclosed to be useful for the treatment of traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumors (including glioblastoma multiforme), or pancreatic cancer in animals. Examples of the fusion proteins are SEQ ID NO: 2 and SEQ ID NOs: 4 to 14.

[0015] The accompanying drawings are incorporated and form a part of the specification. The drawings are for the purpose of explaining the principles of the present invention together with the above-described general description and the detailed description of the exemplary embodiments and methods described hereinafter.

Brief Description of the Drawings

[0016]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Table 1

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

DETAILED DESCRIPTION OF THE INVENTION

[0017] In one embodiment, the present invention provides a method (described in Examples 1-3) for developing a peptide having a high affinity for CTDSP1. Importantly, this method generates a peptide having a high affinity for CTDSP1 using peptide evolution technology.

[0018] In an embodiment, the present invention provides a peptide of SEQ ID NO: 1 and SEQ ID NOs: 15 to 17, or a peptide having at least 50%, more preferably at least 60%, still more preferably at least 70%, still more preferably at least 80%, still more preferably at least 90%, or still more preferably at least 95% similarity to SEQ ID NO: 1 and SEQ ID NOs: 15 to 17. These peptides or similar peptides are referred to herein as REST phosphorylation-mimicking peptides (RPP). However, it is important that the glutamic acids in the RPP, particularly the glutamic acids at positions 5 and 8 of SEQ ID NO: 1, positions 4 and 7 of SEQ ID NO: 15, positions 8 and 11 of SEQ ID NO: 16, and positions 6 and 9 of SEQ ID NO: 17, must be maintained.

[0019] In an embodiment, the present invention provides an RPP V (SEQ ID NOs: 18 to 117), or an RPP V (SEQ ID NOs: 18 to 117) having at least 50%, more preferably at least 60%, still more preferably at least 70%, still more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95% similarity. In this specification, the peptide or a similar peptide is referred to as a REST phosphorylation-mimicking peptide variant (RPP V )(SEQ ID NOs: 18 to 117). However, it is important that the glutamic acids of SEQ ID NOs: 18 to 67, particularly the glutamic acids at positions corresponding to positions 5 and 8 of SEQ ID NO: 1, must be maintained. For the retro-inverse sequence (RPP V RI )(SEQ ID NOs: 68 to 117), positions 8 and 11 of SEQ ID NO: 16 must be maintained.

[0020] In an embodiment, the present invention provides an RPP (SEQ ID NO: 1 and SEQ ID NOs: 15 to 17) or an RPP VA fusion protein between (SEQ ID NOs: 18 to 117) and an intracellular transport peptide (SEQ ID NOs: 118 to 137 and 140 to 159) or a peptide having at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95% similarity is provided.

[0021] Identity / similarity between two or more nucleic acid sequences or between two or more amino acid sequences is expressed in relation to the identity or similarity between the sequences. The identity of a sequence can be measured as a percentage of identity, and the higher the percentage, the higher the identity. The similarity of a sequence can be measured in relation to the percentage of similarity (taking into account conservative amino acid substitutions), and the higher the percentage, the higher the similarity.

[0022] Methods for alignment of sequences for comparison are well known in the art. For various programs and alignment algorithms: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, which discuss in detail methods of sequence alignment and homology calculations.

[0023] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) can be utilized from the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and several sources on the Internet for use in connection with the sequence analysis programs BLASTP, BLASTN, BLASTX, TBLASTN AND TBLASTX. Additional information can be found on the NCBI website (www.ncbi.nlm.nih.gov).

[0024] BLASTN is used for comparison of nucleic acid sequences and BLASTP for comparison of amino acid sequences. If the two sequences being compared have homology, the homologous regions will be displayed as aligned sequences in the specified output file. If the two sequences being compared do not have homology, no aligned sequences will be displayed in the specified output file.

[0025] Once aligned, the number of matches is determined by counting the number of positions at which the same nucleotide or amino acid residue is shown in both sequences. The percent sequence identity is determined by multiplying the value obtained by dividing the number of matches by either the length of the identified sequence or a window length (such as 100 consecutive nucleotides or amino acid residues from the identified sequence) by 100. For example, 1 5When aligned with a test sequence having 54 nucleotides, a nucleic acid sequence having 1166 matches has 75.0% identity with the test sequence (1166 / 1554*100 = 75.0). The value of the percent sequence identity is rounded to the second decimal place. For example, 75.11, 75.12, 75.13, 75.14 are truncated to 75.1, and 75.15, 75.16, 75.17, 75.18, 75.19 are rounded up to 75.2. The length value is always an integer. In another example, a target sequence containing a region of 15 nucleotides that aligns with 20 consecutive nucleotides from the sequence identified as follows shares a region of 75% sequence identity with the identified sequence (i.e., 15 / 20*100 = 75).

[0026] For the comparison of amino acid sequences with more than about 30 amino acids, the default BLOSUM62 matrix is set to the default parameters (gap existence cost 11, 1 per residue gap cost 5), and the Blast2 sequence function is used. Homologs are typically characterized by having at least 70% or more sequence identity counted in a full-length alignment with an amino acid sequence using gap BLASTP against databases such as the NCBI Basic Blast 2.0, nr or swissprot databases. Queries searched with the BLASTN program are filtered with DUST (Hancock and Armstrong, 1994, Comput. Appl. Biosci.10:67-70). For other programs, SEG is used. Manual alignment is also possible. Furthermore, proteins with higher similarity, when evaluated by this method, will show an increase in the percentage identity, such as at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the protein. When aligning short peptides (about 30 amino acids or less), the Blast 2 sequence function is used, the PAM30 matrix is set to the default parameters (open gap 9, extension gap 1 penalty), and alignment is performed. Proteins with even higher similarity to the reference sequence, when evaluated by this method, will show an increase in the percentage identity, such as at least about 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the protein. Regarding sequence identity, when comparing a sequence that is less than the entire sequence, homologs will typically have at least 75% sequence identity over a short window of 10-20 amino acids, and can have at least 85%, 90%, 95%, or 98% sequence identity depending on their identity to the reference sequence. The method for determining sequence identity in such short windows is described on the NCBI website.

[0027] One indicator that two nucleic acid molecules are closely related is that, as described above, the two molecules hybridize to each other under stringent conditions. Due to the degeneracy of the genetic code, nucleic acid sequences that do not show a high degree of identity may still encode the same or similar (conserved) amino acid sequences. By taking advantage of this degeneracy to modify nucleic acid sequences, multiple nucleic acid molecules can be generated that all encode substantially the same protein. Another (not necessarily cumulative) indicator that two nucleic acid sequences are substantially identical is that the polypeptide encoded by the first nucleic acid immunologically cross-reacts with the polypeptide encoded by the second nucleic acid.

[0028] In certain embodiments, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) may, for example, be fused to another peptide to enable cell entry. Preferably, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) is fused to a peptide sequence that enables cell entry and escape from endosomes. More preferably, the cell entry and escape peptide sequences are either of SEQ ID NOs: 118 - 137 and 140 - 159. RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) and the cell-penetrating peptide (CPP) (SEQ ID NOs: 118 - 137 and 140 - 159) may be directly fused, or may include a linker sequence (such as SEQ ID NOs: 138, 139, 160 or 161) connecting them. Cells or tissues are provided with RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) VAdministration of the peptides (SEQ ID NOs: 18 - 117) results in their localization in the nucleus (Figure 3, SEQ ID NO: 4, and Figure 4, SEQ ID NO: 4), causes degradation of REST (Figure 5, SEQ ID NO: 4), increases the expression of genes targeted by REST (Figure 7, SEQ ID NO: 4, Figure 8, SEQ ID NO: 1, Figure 9, linear_SEQ ID NO: 4 and cyclic_SEQ ID NO: 2, Figure 10, SEQ ID NO: 9, Figure 14, SEQ ID NO: 12, Figure 15, SEQ ID NOs: 13 and 14, and Figure 16, SEQ ID NO: 12), and induces neuronal differentiation (Figure 11, SEQ ID NOs: 5 - 11, Figure 12, SEQ ID NO: 9, and Figure 13, SEQ ID NO: 13).

[0029] The present invention has found that RPP (SEQ ID NOs: 1 and 15 - 17) binds to CTDSP1 and inhibits the activity of REST. As shown by the binding curves in Figures 2 and 3, RPP has a low pM affinity for CTDSP1. In cells and animals, RPP binds to CTDSP1 and inhibits CTDSP1 from binding to REST.

[0030] Increased REST and the associated suppression of neural genes underlie the pathologies of the following diseases and disorders:

[0031] [Traumatic brain injury] - Traumatic brain injury (TBI) results in loss of cognitive ability due to neuronal death. To improve the recovery of cognitive ability after TBI, it is necessary to address two issues: 1) reducing neuronal death following injury, and 2) regenerating lost neurons.

[0032] The expression level of REST increases dramatically in the brain after TBI (Figure 19). Consistently, several studies have shown that brain injury due to acute ischemia induces the expression of REST in neurons, resulting in neuronal death. 7-9 These studies have shown that removing REST improves the survival rate of neurons. 7-9 This has great clinical significance. For example, an increase in REST value is correlated with an increase in the frequency of seizures that often occur after brain injury. 10-12 In animal models of brain injury, inhibiting REST significantly reduces the incidence of seizures. 13、14Moreover, REST, which chronically increases after TBI, is highly likely to be involved in neurodegenerative diseases resulting from a history of brain injury. 15-17 In both in vitro and in vivo studies, removing REST has been shown to improve the survival 7-9 and function 14、18 and regeneration 2、19-24 of nerve cells. Therefore, targeting REST after TBI is thought to be able to reduce the effects of brain injury and counteract the risk of developing related age-related neurodegenerative diseases such as Alzheimer's disease. 17、25

[0033] The evidence that neurogenesis improves cognitive function in TBI patients comes from studies showing that increased neurogenesis is associated with improved learning, memory, and other cognitive functions 26-30 and, conversely, studies showing that inhibition of neurogenesis by antiproliferative agents, radiation, or genetic manipulation impairs the hippocampal-dependent type of memory. 29-33 In addition, deficits in neurogenesis are associated with many diseases that cause cognitive impairment, such as developmental disorders (microcephaly 34 , macrocephaly 35 , autism 35 ), and neurodegenerative diseases (dementia, Alzheimer's disease, etc.). 36 Experimental treatments (blood transfusions, growth factors and neurotrophic factors, stem cell transplantation, etc. 10,37-49 ) focus on the regeneration of nerve cells. These attempts have been unable to stimulate the neurogenesis necessary for the recovery of cognitive function because, at least under the conditions of TBI, the terminal differentiation of neural progenitor cells cannot occur. 26、28、50-57 The final differentiation of neural progenitor cells into nerve cells is blocked at one checkpoint by the RE1 silencing transcription factor called REST.

[0034] [Peripheral neuropathy] - Nerve regeneration in patients with peripheral nerve injury (PNI) is inhibited by at least two methods. First, there is a decrease in neurotrophic factors (NTFs) that support the growth, survival, and differentiation of developing and mature nerve cells. 58 Second, the expression of genes necessary for synaptic plasticity, including axonal elongation, vesicle transport, and ion conductance, is reduced.59 These two phenomena occur simultaneously with the expression of REST induced by injury. 60 Therefore, removing REST can reverse the inhibition of nerve regeneration and accelerate recovery from PNI. Inhibiting CTDSP1 with RPP promotes the degradation of REST (Figure 6), promotes the differentiation of nerve cells (Figures 11, 12, 13), and increases the expression of NTF (Figures 7, 9, 10, 16). This indicates the potential of RPP (SEQ ID NO: 1, 15-17) or RPP V (SEQ ID NO: 18-117) fused to CPP (SEQ ID NO: 118-137, 140-159) for nerve regeneration stimulation.

[0035] [Chronic Pain] - Many of the genes suppressed in the central and peripheral circuits during chronic pain are direct or indirect targets of repressor element 1 (RE1) silencing transcription factor (REST), a nerve cell gene expression inhibitor in stem cells, neural progenitor cells, and non-neural cells. 61-63 Normally, in healthy nerve cells, active degradation is carried out so that this powerful nerve cell gene suppressor is not left on chromatin, and the level of REST is kept low. 64-69 Before transitioning to neuropathic pain, the REST level significantly increases in the nerve cells of the peripheral nerves of mice and rats after peripheral nerve injury, and then spikes occur in the nerve cells of the central nervous system where pain stimuli are processed and experienced. 60、70、71 Activation of REST after nerve injury leads to a decrease in the expression of genes necessary for the normal excitability of sensory nerve cells, including potassium channel K V 4.3 (Kcnd3) and K V 7.2 (Kcnq2), sodium channel Na V 1.8 (Scn10a), and mu-opioid receptor OPRM1 (Figure 18). 60、72-74 Studies using mouse and rat peripheral nerve injury (PNI) models have been published as evidence for inhibiting REST to relieve chronic pain. 60,72-74 In mice, gene knockdown of REST in sensory nerve cells after PNI results in mu-opioid receptors in the dorsal root ganglia 60,72,73 , Na V1.8 60,72,73 、K V 4.3 72,73,75 、and K V 7.2 72,73 the gene expression of recovered, and the K+M-type current of C nerve fibers recovered to normal 60 hypersensitivity and allodynia 72-74 decreased, and the morphine analgesic effect in the chronic pain model 60,74 was restored (see Table 12). Disrupting the REST repressor complex using an optimized REST mimic that targets the mSin3 binding site, an adaptor protein that contributes to the transcriptional repression of many genes including REST targets, resulted in the recovery of C fiber function, the reduction of hypersensitivity and allodynia, and the restoration of the morphine analgesic effect in chronic pain model mice (Table 12). 74 In rats, knockdown of REST controlled the transition from acute to chronic pain, demonstrated a decrease in hypersensitivity and allodynia, and restored the muscarinic analgesic effect (Table 12). 72,73 .

[0036]

Table 2

[0037] In the studies shown in Table 12, we recognized a discrepancy in the reduction of hypersensitivity between mouse conditional knockout (cKO) studies (complete knockout) without hypersensitivity and downregulation of REST target genes after injury (Table 12) and rat siRNA knockdown studies in which allodynia (up to 45%) and hypersensitivity (up to 65%) were only partially reduced after injury. Since the bioavailability of siRNA is limited by its size (over 13,000 kD) and poor intracellular transport due to entrapment in endosomes, the knockout effect is considered to be more potent than the knockdown of siRNA.

[0038] The study in Table 12 is recognized as lacking in rigor in that no power analysis has been performed to determine the number of animals per group and there are doubts about the statistical analysis due to the small number of animals. Some studies use a poorly predictive partial sciatic nerve ligation (pSNL) model or the recommended spared nerve injury (SNI) chronic pain model. Most of these studies target only males. However, despite these drawbacks, the results of the studies are consistent and thus support the in vivo efficacy evaluation of the chronic pain therapeutics we propose. Furthermore, since the activity of REST is highly conserved in mammals, these studies are considered to provide strong conceptual support for testing the regulation of REST in humans.

[0039] We discovered that REST becomes a degradation target when serine 861 and 864 are phosphorylated. REST is stabilized by dephosphorylation of these sites by C-terminal domain small phosphatase 1 (CTDSP1). 2-4 CTDSP1 is expressed in non-neuronal tissues like REST and contributes to the silencing of neuronal genes through interaction with REST. As a result, we concluded that inhibiting CTDSP1 is sufficient to promote the degradation of REST and stimulate gene expression. To support this conclusion, we have demonstrated that knocking down CTDSP1 in mesenchymal progenitor cells (MPCs) and nerves results in the expression of REST target genes and axon regeneration. 76 。 We exploited the mechanistic understanding of the REST-CTDSP1 interaction to develop a cyclic phosphorylation-mimicking peptide that encompasses the relevant regulatory region of REST. 77。The REST phosphorylation-mimicking peptide (RPP) has several pharmacological properties. It has high stability due to its cyclic structure and D-amino acid composition (e.g., SEQ ID NOs: 9, 12, 13, 14, 16, 17, 68-117). It also has a low pM binding affinity that exceeds many antibodies (Figures 2 and 3), suggesting a low risk of off-target effects. Its small size (<3.5 kD) indicates a bioavailability similar to that of small molecule drugs. Our preliminary data show that our mimetic inhibits the activity of CTDSP1, reduces the REST protein level, and as a result, induces the expression of neural genes necessary for proper neuronal activity. 77 。

[0040] Most importantly, our approach is predicted to be safe and effective for the following reasons. 1) It acts selectively on nuclear targets that serve as triggers for regenerative responses, such as after nerve injury. The basal organization of chromatin does not permit the epigenetic "writing" of a new set of instructions. However, nerve injury causes a coordinated, extensive, and migrating reorganization of nucleosomes, i.e., the Genomic Transient Intermediate State (GTIS): a transient nucleosome structure suitable for epigenetic reprogramming for the required response. 78-81 。 2) Since the drug has a very high binding affinity (low pM), there are no off-target effects (Figures 2 and 3). 3) We propose a short treatment period of less than one month. REST is a gatekeeper of terminal differentiation of neurons, 64,82 and this is the basis for our short treatment period, which is a process that irreversibly commits cells to their lineage. 83 。Neural progenitor cells, which are also GTIS, have an epigenetic similarity to neurons in chronic pain states and differentiate terminally within a few days after induction. 63。RPP has consistently shown the ability to induce neuronal differentiation (measured by MAP2-positive cells, a marker of neuronal differentiation) within 7 days (Figures 11, 12, 13). Once the process is initiated and the cells are committed, further treatment is not necessary. Therefore, the pain relief obtained by this early treatment is expected to be sustained. 4) In an ex vivo DRG neuronal cytotoxicity test measuring necrosis, the drug was shown to have no toxicity to neurons (Figure 17). 5) Since REST and CTDSP1 are mainly involved in neurogenesis, inhibiting their activities in damaged adult cells is expected to have sufficient tolerance. 6) The safety of peptide pharmaceuticals is attractive as a treatment strategy. Currently, more than 68 peptide pharmaceuticals are on the market, with a global sales volume exceeding $14.7 billion, and 140 are in clinical development. 84,85 。

[0041] [Innovation] [First-in-class drug candidate] Developed the first drug targeting REST, a transcriptional repressor of neuronal genes. Published literature has shown that the expression of REST contributes to chronic pain (Table 12). After PNI, the expression of REST and CTDSP1 increases in both the peripheral nervous system (Figure 18) and the central nervous system, causing dysfunction. 7-9 。That inhibiting REST relieves chronic pain has been reported in several studies using rats. 60,72-74 。

[0042] [Innovative drug design] Destabilize REST by inhibiting CTDSP1, a phosphatase that protects REST from degradation. 3, a cyclic phosphorylation-mimicking cell-penetrating peptide that enables the expression of neuron-specific genes, was developed. CTDSP1, like REST, is expressed predominantly in non-neuronal cell types except after neuronal injury. This inhibitor is novel in that it directly targets the transcriptional checkpoint that immediately controls the genes necessary for inducing regeneration. It overcomes the problems of targeting transcription factors and creating therapeutic agents for serine phosphatases. For the latter, there is also an approach focusing on phosphoprotein phosphatase (PPP) and metal-dependent protein phosphatase (PPM). 86 . However, CTDSP1 is not only dependent on metal ions for its activity, but is a haloacid dehalogenase (HAD) that uses two aspartic acid catalysts. 87 . This catalytic site allows for specific inhibition, as shown by the success of developing therapeutic agents for similar enzymes such as HIV-1 protease. 88-91 . Finally, CTDSP1 has a proline-dependent substrate preference not seen in other serine phosphatases, and this was utilized to improve the binding and stability of this drug.

[0043] [Preliminary data] REST suppresses gene expression by binding to chromatin at the repressor element-1 (RE-1) site near the regulatory regions of neuronal genes, including ion channels, growth factors, and axon guidance proteins. 1 . Therefore, before stem cells such as neural progenitor cells (NPCs) terminally differentiate, it is necessary to first target and degrade REST to express the necessary neuronal genes. 64 . REST is protected from degradation by CTDSP1, which is a necessary and sufficient condition for preventing the expression of neuronal genes. 2 . Dominant-negative CTDSP1, which can bind to phosphorylated targets but not catalyze dephosphorylation, induces the terminal differentiation of P19 stem cells. 92 .

[0044] We have previously shown that the interaction between CTDSP1 and REST depends on the phosphorylation of serines 861 and 864 of REST by the MAP kinase ERK2, and that mutating these serines to alanine increases the stability of REST. 2-4 It was hypothesized that a non-hydrolyzable phosphorylation mimic of this REST regulatory region could decrease the activity of CTDSP1 and promote the degradation of REST. To test this hypothesis, we developed a REST phosphorylation mimic peptide, or RPP 77 and evaluated its dose-dependent effects on REST and REST targets. RPP contains amino acids 858 - 870 from REST, with serines 861 and 864 mutated to glutamic acid, which can mimic the form of phosphoserine and the overall charge. At the C-terminus, a cell-penetrating peptide rich in arginine and an endosomal escape sequence derived from HIV-Tat and HA2, respectively, were fused. These are used to deliver peptides and proteins to cultured mammalian cells and living tissues and to facilitate passage through the blood-brain barrier (BBB). 93-96。

[0045] We examined whether RPP decreased REST protein (Figure 6). The left panel shows by Western blot (WB) that RPP decreased REST (exogenous + endogenous) levels in HEK cells. The right panel shows quantification by WB analysis of the total amount of REST protein (exogenous + endogenous), which was overall decreased by 58.3% in HEK cells administered RPP (Figure 6).

[0046] In in vitro binding assays, RPP had a low pM affinity for CTDSP1 and a slow off-rate (Figures 2 and 3). In in vitro phosphatase inhibition assays, RPP inhibited the target CTDSP1 at low nM concentrations but did not inhibit the activity of off-target PP5, PP1, PPM1H, PPM1A, or PP3CA at 10 μM (Figure 26). In cell permeability and stability assays of MPC, RPP translocated into the nucleus (Figures 4 and 5), which was consistent with the localization profiles of both REST and CTDSP1. 92,97。The level of RPP remained stable even after 6 days of culture.

[0047] Inhibiting REST in a rodent chronic pain model suppresses the downregulation of Na V 1.8, K V 4.3, K V 7.2, and OPRM1, as established (see Table 12). Based on these studies, we examined whether inhibiting CTDSP1 could stimulate the expression of REST target genes associated with chronic pain. Also, NBFL cells (without HIVTAT-HA2) transfected with RPP or administered linear or circular RPP showed an increase in the mRNA of K V 4.3 (2-fold to 4-fold maximum, respectively) (Figures 8 and 9).

[0048] We found that 3 μM of RPP (SEQ ID NOs: 5-11) increased the differentiation of human neural progenitor cells (iPSCs) by 2- to 2.7-fold compared to the control, as measured by MAP2 (mature neuron marker) expression normalized by DAPI (nucleus) (Figure 11), and that 1 μM of RPP (SEQ ID NOs: 9 and 13) increased the differentiation of human neural progenitor cells (iPSCs) by up to 36% and 3-fold for TUJ1 and up to 33% and 2-fold for MAP2 (neuron markers), respectively, as measured by expression normalized by DAPI (nucleus) (Figures 12 and 13). No increase in cell death was observed compared to the control (data not shown). The basis for using this screen is that removing REST in neural progenitor cells has been shown to induce neuronal differentiation 22 and this is a readout of neuronal gene ensemble depression.

[0049] As a preliminary assessment of efficacy and toxicity, RPP was used at 0, 1, 3, or 10 μM for 48 hours in an ex vivo culture of all DRG neurons to measure K V 4.3 (Figure 14), K V 7.2 (Figure 14), Na V1.8 (Figures 14 and 15), and the induction of OPRM1 (Figure 14), and the potential to cause neurotoxicity (Figure 17) were evaluated. 3 μM of SEQ ID NO: 12 induced K V 4.3, K V 7.2, Na V 1.8, and OPRM1 by approximately 0-fold, 6-fold, 3-fold, and 3-fold, respectively (Figure 14). 3 μM of SEQ ID NOs: 13 and 14 induced Na V 1.8 by approximately 6-fold and 13-fold, respectively (Figure 15). 10 μM of SEQ ID NO: 12 induced K V 4.3, K V 7.2, Na V 1.8, and OPRM1 by approximately 2-fold, 7-fold, 5-fold, and 4-fold, respectively (Figure 14). In the lactate dehydrogenase LDH cytotoxicity test, RPP SEQ ID NO: 12 showed no toxicity at 0, 1, 3, and 10 μM (Figure 16). As expected, the positive control (Triton, n = 6) was toxic (Figure 17).

[0050] [Epilepsy] - Epilepsy is an uncontrolled electrical activity in the brain that causes confusion, loss of consciousness, and uncontrolled movements. 98 It is the result of abnormal regulation of ion channels and receptors including SCN1A (Na V 1.1), SCN2A (Na V 1.2), SCN1B (Na V β subunit 1), KCNQ2 (Kv7.2), and KCNQ3 (Kv7.3), which are targets of REST. 14,99 The fundamental cause of epilepsy is an increase in the level of REST in the nucleus of nerve cells. 100 .

[0051] [Diabetes] - Pancreatic β-cells and nerve cells share similar transcriptional pathways involving the elimination of REST in their differentiation programs. 101 Downregulation of REST target genes due to overexpression of REST in β-cells reduces insulin secretion. 102,103 .

[0052] [Alzheimer's disease] - In Alzheimer's disease, acetylcholine and choline acetyltransferase (ChAT), a transferase necessary for the synthesis of acetylcholine, are severely reduced. The decrease in the concentration of this enzyme contributes to the memory and cognitive impairments associated with Alzheimer's disease. When the REST concentration in the brain increases, ChAT is suppressed. 16 .

[0053] [Huntington's disease] - In Huntington's disease, the movement of REST from the cytoplasm to the nucleus of nerve cells is thought to cause the nerve cell degeneration associated with this disease. 104-106 .

[0054] [Brain tumors including glioblastoma multiforme] - Brain tumors such as glioblastoma multiforme (GBM) originate from brain tumor-initiating cells (BTIC), which are cancer stem cells, and become cancerous by showing strong self-renewal ability. These cells are resistant to radiation and chemotherapy and become proliferative several months after treatment. 107-109 . The RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides fused with CPP (SEQ ID NO: 118 - 137 and 140 - 159) may prevent tumor formation by terminally differentiating BTIC. Once terminally differentiated, the cells can no longer proliferate and seed new tumor species. 110 . What is important here is that terminal differentiation is different from differentiation achieved by other methods such as targeting chromatin remodeling using inhibitors of histone deacetylases (HDAC). Inhibition of these enzymes indiscriminately changes gene expression and cannot achieve the permanent terminal differentiation necessary to prevent the recurrence of GBM. Terminal differentiation from BTIC to nerve cells is inhibited at one checkpoint by REST. The importance of this suppressor in maintaining carcinogenicity is demonstrated by the increase in REST levels being associated with the recurrence of GBM 111-113 and the shortening of the disease-free survival period 112,114This is emphasized by the observation that it correlates with both. The dependence of BTIC on REST to maintain its carcinogenicity creates an opportunity for therapeutic intervention. REST is targeted for degradation by phosphorylation of serines 861 and 864, and these serines are kept dephosphorylated by CTDSP1, a small C-terminal domain phosphatase. 2 . Therefore, inhibiting CTDSP1 with RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) should relieve the REST - brake on terminal differentiation and prevent recurrence of GBM and other brain tumors.

[0055] [Pancreatic cancer] - REST levels are elevated in advanced, metastasis - positive pancreatic cancer cells. 115 Pancreatic cancer patients with high REST concentrations in the tumor have poor survival rates. 115 In in - vitro functional experiments, it has been shown that knocking down REST suppresses the proliferation, migration, invasion, and epithelial - mesenchymal transition of pancreatic cancer cells (AsPC - 1 and PANC - 1). 115 In in - vivo experiments (subcutaneous administration model in BALB / c nude mice, superior mesenteric vein injection BALB / c nude mouse model), it was shown that knocking down REST suppresses the growth and metastasis of xenograft tumors. 115 . Therefore, by inhibiting REST, the prognosis of patients with these diseases is improved. Accordingly, the present invention also relates to a method for inhibiting REST in a cell. Generally, this method involves contacting the cell with a peptide of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159). For example, a peptide of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V(SEQ ID NOs: 18 to 117) may enter the cells and the cells may be exposed for a time sufficient to affect REST activity. This method can be carried out either in vitro or in vivo. When carried out in vitro, this method can be used to study the activity of REST. It is for testing other compounds for their ability to supplement or antagonize the effect of RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V (SEQ ID NOs: 18 to 117), or for other reasons important to the researcher. When carried out in vivo, the method can be used as a method for treating a subject for one or more diseases or disorders associated with REST. According to the method of this aspect of the invention, preferably, the activity of REST is reduced. The step of contacting the cells can be any action that physically contacts the agent with one or more target cells. Thus, it can be by directly adding the agent to an in vitro culture of the cells to be contacted and allowing sufficient time for the agent to diffuse through the medium and contact at least one cell. Similarly, it may be by adding the agent to the cells in an aqueous environment. Alternatively, it can also be a method of administering the agent to a subject via any acceptable route of administration and allowing the subject's body to distribute the agent to the target cells through natural processes. Thus, in the in vivo method, it can be a method for local or systemic delivery of the agent to cells in all mammals and particularly animals including humans. According to this aspect, RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V (SEQ ID NOs: 18 to 117) can be used to treat or prophylactically treat a subject and to prepare a composition for use in the treatment.

[0056] In yet another embodiment, the present invention provides a method of treating a subject suffering from or at risk of suffering from a disease or disorder involving REST. Generally, the method involves administering RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) fused to CPP (SEQ ID NOs: 118-137 and 140-159) in an amount sufficient to affect the amount or activity of REST in the subject. In certain embodiments, binding of RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) fused to CPP (SEQ ID NOs: 118-137 and 140-159) to CTDSP1 results in suppression of intracellular REST activity. Generally, the method involves administering RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) fused to CPP (SEQ ID NOs: 118-137 and 140-159) in an amount sufficient to inhibit REST activity over a sufficient period of time. Often, the dosage and administration time are appropriate to see a change in one or more clinical symptoms of the disease or disorder, or to halt the progression of the disease or disorder to the stage where one or more clinical symptoms are seen. According to this embodiment, the agent can be used to therapeutically or prophylactically treat a subject and can be used to prepare a composition for use in treatment.

[0057] In one embodiment, the present invention provides a method for treating, alleviating, or improving traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumors (including glioblastoma multiforme), or pancreatic cancer in a subject. As used herein, the terms "treating" or "alleviating" or "improving" and similar terms include prevention and complete or partial treatment. These terms can also include improving treatment outcomes such as reducing symptoms, improving symptoms, reducing symptom severity, reducing disease incidence, and other changes in the patient's condition. This method is applicable to a subject suffering from traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumor (including glioblastoma multiforme), or pancreatic cancer in an animal, or a subject in need of treatment for traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumor (including glioblastoma multiforme), or pancreatic cancer in an animal, and involves administering RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) fused with CPP (SEQ ID NO: 118 - 137 and 140 - 159).

[0058] Administration of RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) fused with CPP (SEQ ID NO: 118 - 137 and 140 - 159) to the subject can be by any known acceptable route. Such routes include oral, transmucosal (e.g., nasal, inhalation, rectal, intrauterine or intravaginal, sublingual), intravenous (e.g., intravenous bolus injection, intravenous infusion), intraperitoneal, and subcutaneous, but are not necessarily limited thereto. Administration can similarly be by direct injection into a site (e.g., organ, tissue) containing the target cells (i.e., the cells to be treated). Furthermore, administration can follow any number of regimens. Thus, it can consist of a single administration or dosing of the agent, or multiple administrations or dosings over a period of time. Accordingly, for treatment, the step of administering can be repeated one or more times until the desired result is obtained. In an embodiment, the treatment can continue over a long period, such as weeks, months, years, etc. One skilled in the art can readily develop a dosing method suitable for an individual based on parameters known in the art. Thus, while this method contemplates controlling the disease or disorder, it is not necessarily required to eliminate it. Preferred routes of administration according to the present invention are oral and transmucosal.

[0059] The dosage will vary depending on the subject, the stage of the disease, the age of the subject, the general health of the subject, and various other known parameters routinely considered by those skilled in the medical art. As a general rule, a sufficient amount of the agent will be administered to effect a detectable change in the symptoms of the subject. Appropriate amounts are disclosed herein, and further appropriate amounts can be determined by those skilled in the art without undue experimentation.

[0060] RPP (SEQ ID NOs: 1 and 15-17) or RPP fused with CPP (SEQ ID NOs: 118-137 and 140-159) V (SEQ ID NOs: 18-117) is administered in a form that is acceptable, tolerable, and effective for the subject. Numerous pharmaceutical forms and formulations for biologically active agents are known in the art, and any and all of these are contemplated by the present invention. Thus, for example, it can be formulated into oral solutions, caplets, capsules, injections, infusions, suppositories, troches, tablets, creams or ointments, inhalants, and the like.

[0061] Those skilled in the art will readily optimize the effective dosage and dosing regimen according to medical practice and the clinical condition of the individual subject.

[0062] The dosing frequency depends on the pharmacokinetic parameters of the compound and the route of administration. The optimal pharmaceutical formulation will be determined by those skilled in the art according to the route of administration and the desired dosage. Such formulations may affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the administered agent. Depending on the route of administration, an appropriate dosage is calculated according to body weight, body surface area, or organ size. The use of animal models is particularly useful in facilitating the determination of the appropriate dosage of a therapeutic agent. Further refinement of the calculations necessary to determine the appropriate therapeutic dosage is routinely performed by those skilled in the art without undue experimentation in light of the dosage information and assays disclosed herein, as well as the pharmacokinetic data observed in animal or human clinical trials.

[0063] Typically, the appropriate dosage is confirmed by using an established assay for determining blood concentration in combination with relevant dose-response data. The final dosage will be determined by the physician taking into account factors that modify the action of the agent, such as the specific activity of the agent, the degree of injury and the patient's responsiveness, the patient's age, condition, weight, gender, and diet, and the degree of infection, administration time, and other clinical factors. As research progresses in the future, additional information such as the appropriate dosage and treatment duration for specific diseases and symptoms is likely to be obtained. However, such research is routine and within the scope of those skilled in the art. Typical dosages can be from about 0.6 mg (0.01 mg / kg) to about 60 g (1 g / kg) per week (in humans), more preferably per month.

[0064] It will be understood that the peptides, compositions, and treatment methods of the present invention are useful in the fields of human medicine and veterinary medicine. Accordingly, the subjects to be treated are mammalian animals such as humans. For veterinary purposes, for example, livestock such as cows, sheep, pigs, horses, and goats, companion animals such as dogs and cats, exotic animals and zoo animals, and laboratory animals such as mice, rats, rabbits, guinea pigs, and hamsters are targeted.

[0065] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) fused with CPP (SEQ ID NOs: 118 - 137 and 140 - 159) can be administered as a pharmaceutical or veterinary composition, such as a tablet, capsule, solution, or emulsion, to a subject animal in need thereof, preferably a mammalian animal such as a human. RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) fused with CPP (SEQ ID NOs: 118 - 137 and 140 - 159) can be present in a composition containing other components. Non-limiting examples of compositions suitable for the present invention are pharmaceutical compositions, for example, in the form of tablets, pills, capsules, multiparticulates (including granules, beads, pellets, and microencapsulated particles), powders, elixirs, syrups, suspensions, and solutions. The pharmaceutical composition will typically include a pharmaceutically acceptable diluent or carrier. The pharmaceutical composition is preferably adapted for parenteral (e.g., oral) administration. Compositions that can be administered orally can be in solid or liquid form, and in particular, can take the form of tablets, powders, suspensions, and syrups. Optionally, the composition includes one or more flavorings and / or colorants. Generally, therapeutic and nutritional compositions may include any substance that does not significantly inhibit the action of the agent on the subject.

[0066] Pharmaceutically acceptable excipients or carriers suitable for use in such compositions are well known in the pharmaceutical art. The compositions of the present invention can contain from 0.01 to 99% by weight of the agent. The compositions of the present invention are generally prepared in unit dosage forms. The excipients used in the preparation of these compositions are well known in the art.

[0067] Further examples of product forms for the composition are food supplements in the form of soft gels or hard capsules containing an encapsulating material selected from the group consisting of gelatin, starch, and modified starch, and starch derivatives such as glucose, sucrose, lactose, and fructose. The encapsulating material may optionally include cross-linking agents or polymerizing agents, stabilizers, antioxidants, light absorbers to protect photosensitive films, preservatives, and the like.

[0068] Generally, the term carrier can be used throughout this application to denote a composition with which the agent can be mixed and which can be considered a pharmaceutical carrier, food, dietary supplement, or meal supplement for the purposes of this application. The above materials can be considered carriers for the agent for the purposes of the present invention. In certain embodiments of the present invention, the carrier has little to no biological activity against REST in particular.

[0069] Further description will be omitted. Those skilled in the art will believe that the compounds of the present invention can be manufactured and utilized, and the methods described in the claims can be implemented using the above description and the following exemplary embodiments. Hereinafter, the present invention will be described with reference to examples. It should be understood that the present invention is not limited to the specific conditions or details described in the examples.

[0070] [Example 1 - Construction of His-CTDSP1 Plasmid] The codon-optimized (using the IDT codon optimization tool) CTDSP1 gene was cloned into the pBAD-HisA plasmid (Thermo Fisher Scientific). First, the pBAD-HisA plasmid was amplified using primers P33 and P34 (Table 1) into which HindIII and XhoI restriction sites were introduced. The PCR reaction solution (20 μL) was first heated at 95°C for 2.5 minutes, and then 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 6 minutes were repeated. After amplification, the PCR fragment was gel-purified using QIAGEN's gel band purification kit and digested with HindIII and XhoI restriction enzymes. All digested fragments were purified using QIAGEN's kit and ligated in appropriate combinations using T4 DNA ligase (NEB) according to the manufacturer's recommendations.

[0071] [Table 3]

[0072] The ligated fragments were transformed into 10G chemically competent cells (Lucigen) according to the manufacturer's protocol. The transformed cells were plated on LB plates containing 50 μg / mL ampicillin and cultured overnight at 37 °C. Colonies were examined for the presence of the insert by colony PCR. Colonies were picked and resuspended in 20 μl of sterile 0.9% sodium chloride solution. 1 μl of this solution was transferred to a PCR tube and amplified using Taq polymerase (New England Biolabs, cat# M0482S) and 30 pM of flanking primers. Each PCR reaction mixture (20 μL) was first heated at 95 °C for 2.5 minutes, followed by 30 cycles of denaturation at 94 °C for 15 seconds, annealing at 55 °C for 15 seconds, and extension at 72 °C for 1 minute. The amplification products were visualized by agarose gel electrophoresis. Clones with the correct insert were inoculated into a culture tube containing 5 mL of LB containing the appropriate antibiotic and cultured overnight at 37 °C. Subsequently, the construct was purified using the Monarch Plasmid Miniprep Kit (NEB).

[0073] [Example 2 - Expression and Purification Method of His-CTDSP1] His-CTDSP1 (Table 2; SEQ ID NO: 162). Escherichia coli (10G strain, Lucigen) carrying the pBAD-CTDSP1 construct was cultured overnight at 37 °C with vigorous shaking. Subsequently, 4 mL of the overnight culture was added to 500 mL of LB medium containing 50 μg / mL ampicillin in a 1 L flask, and shaking culture was performed at 37 °C. When the OD600 of the culture reached 0.4, arabinose was added to a final concentration of 0.02%, and shaking culture was performed at 30 °C for 16 hours. The next morning, the cells were spun down at the highest speed (Eppendorf centrifuge 5810R) and frozen at -80 °C. If necessary, the cell pellet was taken out of the freezer, cultured at room temperature, lysed with 4 mL of BPER protein lysis reagent (ThermoFischer), and the protein was purified using the HisPur Cobalt purification kit (ThermoFischer, Cat# 90091) by the method described by the manufacturer.

[0074]

Table 4

[0075] [Development of Peptides with High Affinity for CTDSP1 in Example 3] Peptide candidates were prepared using RNA display and protein evolution methods.

[0076] [Construction of RNA Display Library] Three libraries were constructed from the RPP variant. In all libraries, serines 861 and 864 were substituted with glutamic acid. Library 1 was constructed using primers P11 - P14 (Table 1). In Library 1, each position of the REST peptide was mutated. It was estimated to have 1×10 9 variants. In Library 2 (primers P14 - P18, Table 1), glutamic acid did not touch the degenerate oligo. This library was estimated to have 65×10 6 variants. In Library 3, there were mutations only in every other codon of the first and second glutamic acids. This library was estimated to generate only 65,000 variants.

[0077] In all three libraries, the RPP sequence (SEQ ID NO: 1) was diversified by synthetic degenerate oligos. For each codon, only one degenerate base was introduced so that four amino acids could be selected at the first or second position. The REST cassette was amplified as two fragments (left and right) from the pBAD construct and recombined by ligation (Figure 27). The left fragment was amplified with the flanking forward primer P23 (Table 1) and one of the reverse primers (11R - 22R, Table 1).

[0078] The right fragment was amplified with either a forward primer (11F - 22F, Table 1) or reverse primer P24 (Table 1). After heating the PCR reaction mixture (20 μL) at 95°C for 2.5 minutes, denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 40 seconds were repeated for 30 cycles. After amplification, the PCR fragments were gel - purified using a QIAGEN Gel Band Purification Kit and mixed, then ligated with T4 - DNA ligase. The ligation reaction mixture contained 20 μl of 10× ligation buffer, 100 ng of fragment mix, 0.5 μl of 100 mM ATP, 1 μl of T4 - DNA ligase (NEB cat# M0202S), and 1 μl of T4 polynucleotide kinase. This reaction mixture was incubated at room temperature, and PCR was performed using the flanking primers P17 and P20 (Table 1) as templates with the above - mentioned program. The PCR fragments were gel - purified using a QIAGEN Gel Band Purification Kit and used as templates for the mRNA display experiment.

[0079] For quality control, a portion of this library was cloned and sequenced. An aliquot of this library was digested with HindIII and XhoI restriction enzymes, purified using a QIAGEN kit, and then cloned into the pBAD vector as described for the above - mentioned CTDSP1 gene. Individual clones were sequenced by GeneWiz, and it was confirmed that the REST cassette was mutated normally and that most clones were ligated without frameshift mutations.

[0080] [In - vitro transcription] RNA was transcribed from the amplified library using the RiboMAX Large Scale RNA Production System T7 (Promega, Cat#P1300) according to the manufacturer's protocol and purified using an RNeasy Mini Kit (Qiagen, Cat#74104).

[0081] [Ligation of mRNA and DNA linker with puromycin] The XL-PSO oligonucleotide was synthesized by IDT. The sequence of the oligonucleotide is as follows: 5’-PsoC6-(uagccggug) 2’-OMc -AAAAAAAAAAAAAAA-Spacer9-Spaser9-ACC-Puro-3’ (SEQ ID NO: 330) . To ligate this oligonucleotide to mRNA, the following reagents were mixed in a PCR tube: 29.5 μl of RNase-free water, 1 μl of 1 M HEPES-KOH, pH 7.6, 5 μl of 1 M KCl, 2 μl of 25 mM spermidine, 0.5 μl of 125 mM EDTA, 8 μl of mRNA from the previous step, and 4 μl of 100 mM XL-PSO oligonucleotide. The PCR tube was set in a PCR apparatus and heated at 70 °C for 5 minutes, then cooled to 25 °C at a rate of 0.1 °C / second. Then, it was transferred onto an ice-cold 96-well plate and irradiated with a 365 nm hand-held UV lamp for 20 minutes. Then, the crosslinked RNA was purified using an RNeasy Mini Kit (Qiagen, Cat#74104).

[0082] [In vitro translation] For translation, a PUREexpress in vitro protein synthesis kit (NEB, Cat#E6800S) was used. The following reagents were mixed in a 1.5 ml tube: 20 μl of Solution A, 15 μl of Solution B, 0.5 μl of RNAsin Plus, 4.5 μl of water, and 10 μl of crosslinked RNA (1 μg / μl). This mixture was incubated at 37 °C for 2 hours.

[0083] [Purification of His-tagged Peptide] The RNA-peptide complex was purified using Ni-NTA magnetic beads (Qiagen, Cat# 36111). 100 μl of the beads were washed with 300 μl of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 0.005% Tween20), separated on a magnetic stand, and resuspended in 300 μl of wash buffer. 25 μl of the RNA-peptide complex from the previous step was added to the washed beads and incubated on an end-over-end shaker for 30 minutes at room temperature. After washing the beads three times with wash buffer, they were separated on a magnetic stand and eluted with 50 μl of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, 0.005% Tween20).

[0084] [Oligo d(T) 25 (SEQ ID NO: 331) [Purification with Magnetic Beads] Oligo d(T) 25 (SEQ ID NO: 331) The magnetic beads were purchased from New England Biolabs (Cat# S1419S). 100 μl of the bead suspension was washed with 500 μl of wash buffer I (20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 1 mM EDTA), incubated in the buffer, separated on a magnetic stand, and then resuspended in 50 μl of wash buffer I. 50 μl of the RNA-peptide complex from the previous step was mixed with 50 μl of binding buffer (100 mM Tris-HCl, pH 7.5, 1 M NaCl, 2 mM EDTA), heated at 65°C for 2 minutes, placed on ice for 1 minute, and then mixed with the washed beads. After incubating this mixture at room temperature for 5 minutes, it was washed twice with 500 μl of wash buffer I (20 mM Tris-HCl, pH 7.8, 500 mM NaCl, 1 mM EDTA) and then once with 500 μl of wash buffer II (20 mM Tris-HCl, pH 7.8, 200 mM NaCl, 1 mM EDTA).

[0085] [Cyclization of Peptide] Oligo d(T) 25 (SEQ ID NO: 331)The RNA-peptide complex conjugated to magnetic beads was incubated for 30 minutes with regular shaking in a cyclization buffer (20 mM Tris-HCl, pH 7.8, 0.00 M NaCl, 3 mM α,α”-dibromo-m-xylene (Sigma-Aldrich), 33% acetonitrile). After incubation, the beads were washed with wash buffer III (20 mM Tris-HCl, pH 7.8, 0.3 M NaCl, 5 mM 2-mercaptoethanol), and then with wash buffer IV (20 mM Tris-HCl, pH 7.8, 0.3 M NaCl, 0.5 M TCEP). Subsequently, they were washed with wash buffer I (20 mM Tris-HCl, pH 7.8, 500 mM NaCl, 1 mM EDTA) and wash buffer II (20 mM Tris-HCl, pH 7.8, 200 mM NaCl, 1 mM EDTA). 30 μl of elution buffer (20 mM Tris-HCl, pH 7.8) was added, and after incubation at 65 °C for 2 minutes, they were immediately separated with a magnetic bead stand, and the purified product was eluted from the beads.

[0086] [Affinity Selection] Affinity selection was performed on a NUNC Maxisorp plate (Thermo Fischer Scientific). His-CTDSP1 (Table 2; SEQ ID NO: 163) was dissolved in 100 μl of PBS, transferred to the wells of the Maxisorp plate, and cultured on an orbital shaker at room temperature for 2 hours. The plate wells were washed twice with PBS, blocked with casein (PBSC buffer or PBS containing 1% casein) with shaking at room temperature for 1 hour, and washed three times with PBS. The negative selection wells were cultured with 300 μl of PBSC solution to coat with casein only, and washed three times with PBS. The purified RNA-peptide complex was first added to these negative selection wells containing 100 μl of PBS, and cultured with shaking at room temperature for 20 minutes. Next, this solution was transferred to the positive selection wells (covered with His-CTDSP1) containing 125 μl of PBSC, and cultured with shaking at room temperature for 1 hour. 25 μl of purified His-CTDSP1 was added to each well, and off-target selection was performed by culturing for 3 minutes. After incubation, the wells were washed three times with PBS and used for cDNA synthesis.

[0087] [cDNA Synthesis and PCR] For cDNA synthesis, the SuperScript III First-Strand Synthesis System (Invitrogen, Cat#18080-051) was used. First, 2 μl of 50 mM primer P19 (Table 1) and 1 μl of dNTP solution were mixed in 16 μl of water, and this mixture was added to the wells of the Maxisorp plate. Next, the plate was cultured at 65°C for 5 minutes and then cooled at 4°C for 1 minute. Next, 20 μl of the mixture was transferred from the plate to a PCR tube, and 20 μl of a reaction mixture containing 4 μl of 10x buffer, 8 μl of 25 mM MgCl2, 4 μl of 0.1 M DTT, 2 μl of RNaseOUT, and 2 μl of Superscript III reverse transcriptase was added. This mixture was cultured at 50°C for 50 minutes, then 2 μl of RNAseH was added, and cultured at 37°C for 20 minutes.

[0088] DNA corresponding to the strong conjugates that survived the selection was amplified with primers P17 and P20 (Table 1). The amplification was performed using Vent™ DNA polymerase. The PCR reaction solution (20 μL) was heated at 95°C for 2.5 minutes, followed by 20 or 25 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds. After amplification, the PCR fragments were run on an agarose gel and purified using a QIAGEN Gel Band Purification Kit according to the manufacturer's protocol.

[0089] [Analysis of NGS data] The PCR reaction products of each cycle were subjected to next-generation sequence analysis. Amplicon-EZ service from GeneWiz was used. Unique sequences were quantified and the most abundant sequences were selected for further testing (Tables 3 and 3a).

[0090] [Table 5-1]

[0091] [Table 5-2]

[0092] [Table 6-1]

[0093]

[0094] [Example 4 - Construction and Expression of Peptide-GST Fusion] As a first step, the GST protein was cloned into the pET29 vector. GST was codon-optimized, flanked by HindIII and XhoI sites, and synthesized by IDT. It was amplified using primers P109 and P108 with Phusion DNA polymerase (NEB, cat#M0530S) (Table 1). The PCR reaction mixture (20 μL) was heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute. After amplification, the PCR fragment was gel-purified using QIAGEN's Gel Band Purification Kit according to the manufacturer's protocol.

[0095] The pET29 plasmid was amplified using primers P12 and P14 (Table 1) that introduced HindIII and XhoI restriction sites. The PCR reaction mixture (20 μL) was heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 6 minutes. After amplification, the PCR fragment was gel-purified with the QIAGEN Gel Band Purification Kit and digested with HindIII and XhoI restriction enzymes. All digested fragments were purified with the QIAGEN kit and ligated in appropriate combinations using T4 DNA ligase (NEB) according to the manufacturer's recommendation. The ligated fragments were transformed into 10G chemically competent cells and sequenced as described above. The expression construct of GST-RPP is shown in Table 4 (SEQ ID NO: 164).

[0096]

Table 7

[0097] The selected array was reproduced by PCR using the primers shown in Table 5, gel purified using the QIAGEN Gel Band Purification Kit, digested with HindIII and BamHI restriction enzymes, and cloned into the above pET vector in-frame with the GST tag. The ligated fragment was transformed into 10G chemically competent cells (Lucigen) according to the manufacturer's protocol. The transformed cells were plated on LB plates containing 25 μg / mL kanamycin and cultured overnight at 37°C. The next morning, the colonies were examined for the presence of the insert by colony PCR. The colonies were picked and resuspended in 20 μl of sterile 0.9% sodium chloride solution. 1 μl of this solution was transferred to a PCR tube and amplified with Taq polymerase (New England Biolabs, cat# M0482S) and 30 pM of flanking primers. Each PCR reaction (20 μL) was first heated at 95°C for 2.5 minutes, then denatured at 94°C for 15 seconds, annealed at 55°C for 15 seconds, and extended at 72°C for 1 minute for 30 cycles. The amplification products were visualized by agarose electrophoresis. Clones with the correct insert were inoculated into culture tubes containing 25 μg / mL kanamycin and cultured overnight at 37°C. The next morning, the construct was purified using the Monarch Plasmid Miniprep Kit (NEB). The construct was transformed into BL21(DE3) competent cells (Lucigen) as described above

[0098] [Purification of Peptide-GST Fusion] Escherichia coli (BL21 strain) with the selected construct was cultured overnight at 37°C with vigorous shaking. The next morning, 1 ml of the overnight culture was added to 100 ml of LB medium containing 25 μg / ml kanamycin in a 1 L flask and cultured with shaking at 37°C. When the OD600 of the culture reached 0.4, IPTG was added to a final concentration of 1 mM, and the culture was shaken at 30°C for 16 hours. The next morning, the cells were spun down at the maximum speed using an Eppendorf centrifuge 5810R and frozen at -80°C. If necessary, the cell pellet was taken out of the freezer, cultured at room temperature, and lysed with 3 ml of BPER protein lysis reagent (ThermoFischer). The peptide-GST fusion was purified using glutathione agarose (ThermoScientific, cat#16100) according to the manufacturer's instructions.

[0099] [Table 8-1]

[0100] [Table 8-2]

[0101] [Table 8-3]

[0102] [Table 8-4]

[0103] [Example 5 - Inhibition of CTDSP1 Phosphatase Activity by RPP and RPP Variants] [Results:] The top 51 most abundant RPP variants identified by RNA display / protein evolution screening are shown in Table 3 in descending order of abundance of peptides (V1 being the most abundant to V51 being the least abundant). The primers used to generate these peptides are shown in Table 5. Phosphatase activity screening (Table 6, Figure 25) was used to evaluate the ability of the top 51 RPPvs to inhibit CTDSP1 phosphatase activity at amino acids 861 and 864 on the endogenous phosphorylated REST peptide (TEDpSPPpPLPKEN (SEQ ID NO: 329) )

[0104] The phosphorylated REST peptide (TEDpSPPpPLPKEN (SEQ ID NO: 329) ) was synthesized by GeneScript. The phosphatase reaction was carried out at room temperature for 10 minutes with 10 mM Tris pH 8, 10 mM MgCl2, 100 nM CTDSP1, 0.5 μM phosphate sensor (Thermo Fischer), 50 μM REST peptide, and various concentrations of peptide-GST fusions. All assays were performed in 96-well plates (Corning P / N 3686) rinsed 10 times with water. Fluorescence was measured using a kinetic read with an excitation wavelength of 420 / 27 nm and an emission wavelength of 485 / 20 nm on a BioTek Synergy HTX.

[0105] As a result of the screening, RPP (V1) inhibited approximately 60% of the phosphatase activity relative to the control (GST) at 1 μM (Table 6, Figure 25). Some variants inhibited phosphatase activity better than RPP (Table 6, Figure 25). The most potent inhibitor was v33 which inhibited 100%, and v35 inhibited approximately 90% of the phosphatase activity (Table 6, Figure 25).

[0106]

Table 9

[0107] Figure 26, Table 13 - RPP SEQ ID NO: 12 inhibited CTDSP1 activity with an EC50 of approximately 20 nM, but did not affect the activities of several other phosphatases.

[0108] [Assay] The ability of RPP SEQ ID NO: 12 to inhibit CTDSP1 activity at amino acids 861 and 864 on the endogenous phosphorylated REST peptide (TEDpSPPpPLPKEN (SEQ ID NO: 329) ) was evaluated as described for Figure 26 above.

[0109] [Table 10]

[0110] [Example 6 - Binding Affinity of RPP Using Monolith (NanoTemper) and Biacore (GE Healthcare Life Sciences)] Expression constructs of His-CTDSP1 (Table 2; SEQ ID NO: 162) and GST-RPP (Table 4; SEQ ID NO: 164) were constructed and purified as described in Example 2. The His-tag on CTDSP1 (40 nM) was labeled with RED-trisNTA dye (20 nM) at a dye-to-CTDSP1 ratio of 3:1, and unbound dye was removed by gravity flow size exclusion. The binding affinity of linear GST-RPP (Table 4; SEQ ID NO: 165) to His-CTDSP1 (Table 2; SEQ ID NO: 163) was determined using Monolith (NanoTemper) according to the manufacturer's recommendations. The results of the binding assay are shown in Figure 2. RPP (Table 4; SEQ ID NO: 165) was evaluated for binding to His-CTDSP1 at several concentrations ranging from low pM to 0.5 μM. The K D corresponding to the binding of linear RPP to CTDSP1 was calculated to be 130 pM.

[0111] The binding affinity between linear GST-RPP (Table 4; SEQ ID NO: 165) and His-CTDSP1 (Table 2; SEQ ID NO: 163) was measured using a Biacore from GE Heathcare Life Sciences. 20 μL (5 μg / mL) of His-tagged CTDSP1 was immobilized on a CM5 chip (GE Healthcare Life Science) using amine coupling according to the Biacore-recommended protocol in 10 mM sodium acetate, pH 5.0 (cat# BR-1000-50, GE Healthcare Life Science). This purification yielded approximately 1300 RU of protein bound to the CM5 chip. Subsequently, the CM5 chip was washed with HBS-EP buffer (pH 7.4), and 120 μL of the analyte was injected. GST-RPP or GST alone (negative control) was injected at a flow rate of 30 μL / min in HBS-EP buffer (pH 7.4) at a concentration of 500 nM. The association time was 2 minutes and the dissociation time was 3 minutes. Finally, the bound protein was washed with 10 mM glycine-HCl, pH 1.5 (BR-1003-54, GE Health science) at a flow rate of 50 μL / min for 25 seconds. The binding of linear RPP to CTDSP1 resulted in the following. K D = 1.7 pM (Figure 3B, negative control is shown in Figure 3A).

[0112] [Example 7 - RPP and RPPv fused with cell-penetrating peptides (CPPs) and / or peptides that promote endosomal escape] Several RPPs and RPPvs were synthesized with the addition of a cell-penetrating peptide (CPP) and / or a peptide that promotes endosomal escape. The list of CPPs and linkers used is shown in Table 7.

[0113] [Table 11]

[0114] [Example 8 - RPP is internalized into mesenchymal progenitor cells and the sciatic nerve] [Mesenchymal progenitor cells (MPCs)] [Results] After culturing with RPP (SEQ ID NO: 4) for 4 hours and then culturing for 6 days, RPP remained within mesenchymal progenitor cells (MPCs) (FIGS. 4C and 4D), and became localized in the nucleus during the 6-day culture period (FIGS. 4E and 4F).

[0115] [Materials and Methods] [Administration and Cell Culture] MPCs were cultured as described 116 above, plated at 1.0×10 4 cells / cm 2 on the glass coverslips of 24-well plates, cultured overnight at 37° C., administered 100 nM of RPP (SEQ ID NO: 4) for 4 hours, and then the medium was changed. The cells were cultured for 6 days while changing the medium every 2 days. To evaluate the intracellular localization of RPP, MPCs were harvested at 24 hours and 72 hours.

[0116] [Immunohistochemistry] Phalloidin (Invitrogen) was used for cytoskeleton staining, Hoechst 333429 (Calbiochem) dye was used for nuclear visualization, and FLAG antibody (Sigma-Aldrich) was used for RPP visualization. Images were taken with a confocal laser scanning microscope.

[0117] [Sciatic Nerve] [Results] Linear RPP accumulates in the nuclei of sciatic nerve tissues (FIGS. 5A and 5B). [Materials and Methods] [Administration Method and Procedure] FIG. 5: The sciatic nerves (L3 and L4 regions) of Sprague Dawley rats were exposed (Schmitz and Beer, 2001) 117 and a 0.7 cm section was removed to form an approximately 1 cm segment defect after retraction of the nerve stump (Hems and Glasby, 1993) 118 and 1 mg of RPP (SEQ ID NO: 4) in PBS was injected into the damaged site, and the surgical incision was closed. After 48 hours, the animals were sacrificed and the spinal cord in the L4 to L6 regions was sectioned coronally.

[0118] [Rationality of Administration Level. Maximum Achievable Amount] [Test article identification] RPP (sequence number 4) Purity: 95% or more

[0119] Immunohistochemistry: Hoechst 333429 (Calbiochem) dye was used to visualize nuclei, and FLAG antibody (Sigma-Aldrich) was used to visualize RPPs. Images were taken with a light microscope.

[0120] Example 9 - Degradation of REST protein by RPP Results: RPP (SEQ ID NO: 4) reduced REST protein levels by 58% compared to vehicle control (Figure 6). Materials and Methods [Test article identification] RPP (sequence number 4) Purity: 95% or more

[0121] [Treatment and cell culture] HEK293 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% bovine serum. 100 nM of full-length human REST protein was added. 2 Transfection of HEK293 cells with RPP was performed in 80-90% confluent cultures in 35 mm dishes using Lipofectamine 2000 (Life Technologies) according to the manufacturer's recommendations. 24 hours after transfection, cells were treated overnight with 100 nM RPP (SEQ ID NO: 4) or vehicle control (PBS).

[0122] [Western blot analysis] Whole cell lysates were analyzed using the method described by Ballas et al. (2001) 119 Western blots were prepared according to the procedure described in. Anti-REST-C conjugated to infrared dye (Thermo Fisher) was used. 64 , anti-GAPDH (Abcam [6C5]), and anti-IgG were used as standard procedures and analyzed with an Odyssey infrared fluorescent imager (LiCor). Bar graphs are quantification of western blots using ImageJ (https: / / imagej.nih.gov / ij).

[0123] [Example 10 - RPP can be used to induce the expression of BDNF, NGF, K V 4.3, K V 7.2, Na V 1.8, and has no neurotoxicity and can be used to induce the expression of the mRNR of OPRM1] [Results] RPP can increase the expression of BDNF, NGF, K V 4.3, K V 7.2, Na V 1.8, and the expression of the mRNR of OPRM1 (Figs. 7, 8, 9, 10, 14, 15, 16, Table 15). RPP (SEQ ID NO: 12) does not cause necrosis in DRG neurons as shown by the LDH cytotoxicity assay of DRG neurons cultured with various concentrations of RPP for 48 hours (Fig. 17). *** = p < 0.001, n = 4, one-way ANOVA and Dunnett's test, error bar = SD

[0124] [Table 12]

[0125] [Fig. 7: Materials and Methods] [Test Article Identification] RPP (SEQ ID NO: 4) Purity: 95% or higher [Administration and Cell Culture] 100 nM RPP, HEK293 cells

[0126] [mRNA Extraction and Quantification Protocol] Cells were lysed with QIAsol (Qiagen), and total RNA was extracted using the RNeasy midi kit (Qiagen) according to the manufacturer's instructions. The purified RNA was quantified using a NanoDrop 2000 (ThermoFisher), and reverse transcription was performed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) with 2 ng / μL of RNA per reaction. For qRT-PCR, 5 μL of cDNA (equivalent to 10 ng of RNA) was mixed with 10 μL of SsoAdvanced® Universal SYBR® Green Supermix (BioRad) and 1 μL of each primer (final primer concentration of 500 nM each). The reaction was performed in three replicates using a QuantStudio® 7 Flex Real-Time PCR System (Applied Biosystems). The amplification data was analyzed using the comparative cycle threshold (ΔDCt) method with β-actin as a calibrator. The primers used were as follows. β-actin Forward: 5’-AGAGCACGAGCTGCCTGAC-3’ (SEQ ID NO: 332) , β-actin Reverse: 5’-GGATGCCACAGGACTCCA-3’ (SEQ ID NO: 333) , BDNF Forward: 5’TATTAGTGAGTGGGTAACGGCG3’ (SEQ ID NO: 334) , and BDNF Reverse: 5’GAAGTATTGCTTCAGTTGGCCTT3’ (SEQ ID NO: 335) .

[0127] [Figure 8: Materials and Methods] [Transient Transfection and Cell Culture] NFBL cells were grown as described above, seeded into 35 mm dishes at 120.0 M, cultured overnight at 37 °C, and transfected with 2 μg of REST (SEQ ID NO: 1)-IRES-GFP cDNA 2 using Lipofectamine 2000 (Life Technologies) according to the manufacturer's recommendations. After 48 hours of culture, the cells were sorted by fluorescence-activated cell sorting (FACS)

[0128] [Extraction and Quantification of mRNA] mRNA was extracted from GFP+ and - cells as described in Example 10. K V The mRNA level of 4.3 was measured using real-time RT-PCR 116 . Gene expression was normalized using β-actin (ACTB) as an internal housekeeping control. The β-actin primers used were the same as in Example 10. K V The primers for 4.3 were Forward: CTCACTACCACCTGCTGCTC (SEQ ID NO: 336) and Reverse: TCAGTCCGTCGTCGTCTGCTTTC (SEQ ID NO: 337) .

[0129] [Figure 9: Materials and Methods] [Plasmid] RPP (SEQ ID NOs: 2 and 4): One segment of this construct containing the T7 promoter, CPP, and His tag was synthesized by IDT as a gBlock (Table 8) and amplified using the primers described in Table 8. After heating the PCR reaction mixture (20 μL) at 95°C for 2.5 minutes, cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds were repeated 30 times. After amplification, the PCR fragment was gel-purified using QIAGEN's Gel Band Purification Kit according to the manufacturer's protocol.

[0130] The pET29 plasmid was amplified with primers: Forward: P12 and P14 (Table 1) introducing SbfI and XhoI restriction sites. After heating the PCR reaction mixture (20 μL) at 95°C for 2.5 minutes, cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 6 minutes were repeated 30 times. After amplification, the PCR fragment was gel-purified using the QIAGEN Gel Band Purification Kit and digested with SbfI and XhoI restriction enzymes. All digested fragments were purified using QIAGEN's kit and ligated in appropriate combinations using T4 DNA ligase (NEB) according to the manufacturer's recommendation. The ligated fragment was transformed into 10G chemically competent cells and sequenced.

[0131] The nucleotide sequence of RPP (Table 8) was assembled and digested with the restriction enzymes HindIII and BamHI. This fragment was cloned into the aforementioned pET vector in-frame with the CPP and His tag.

[0132] [Control Peptide] The control peptide (CP) was incorporated into the gBlock sequence shown in Table 9 and cloned into the pET vector. The sequence of CP is as shown in Table 9.

[0133] [In Vitro Expression] RPP (Table 8) or CP (Table 9) was expressed in vitro using the PureExpress In Vitro Protein Synthesis Kit (New England Biolabs). The RPP (SEQ ID NOs: 2 and 4) or CP sequence was amplified from the RPP (SEQ ID NOs: 2 and 4) or CP expression construct (Tables 8 and 9) with the primers shown in Table 8 and gel-purified using the QIAGEN Gel Band Purification Kit. The PCR reaction mixture (20 μL) was heated at 95°C for 2.5 minutes, followed by 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds. Next, 15 μL of the purified PCR fragment was mixed with 10 μL of Solution A and 7.5 μL of Solution B of the PureExpress In Vitro Protein Synthesis Kit (New England Biolabs) and incubated at 37°C for 2 hours. Then, 2 μL of DNAse I was added and incubated at 37°C for 20 minutes.

[0134] [Table 13]

[0135] [Table 14]

[0136] [Purification] The final solution of the in vitro expression step of RPP (SEQ ID NOs: 2 and 4) and CP was diluted to 100 μL and filtered through an Amicon Ultra-15 0.5 mL-100K column (Sigma) to remove ribosomes. The flow-through was added to 100 μL of washed Ni-NTA magnetic agarose beads (Qiagen) and washed with the wash buffer described by the manufacturer.

[0137] [Cyclization] RPP (SEQ ID NO: 2) was cyclized by mixing 2.65 mL of 1.33xPBS (66.5 mM phosphate buffer, 400 mM NaCl) and 1.32 mL of dibromo-m-xylene solution in acetonitrile (2.5 mg / mL) to make 500 μL of the cyclization solution and mixing with the beads. After incubation with the cyclization solution, the beads were washed once with wash buffer I (PBS with 25 mM imidazole, 0.5 μL / mL of mercaptoethanol), once with wash buffer II (PBS with 25 mM imidazole, 0.5 mM of TCEP), twice with wash buffer III (PBS with 25 mM imidazole), and eluted with 50 μL of elution buffer (PBS with 500 mM imidazole). Imidazole was removed using a Bio-Rad Micro Bio-Spin chromatography column.

[0138] [Administration and cell culture] NBFL cells (Figure 9) cultured in 6-well plates were administered 1 μM of linear (SEQ ID NO: 2) or cyclic (SEQ ID NO: 2) RPP (Table 8) or control peptide (Table 9) for 16 hours or 48 hours.

[0139] Mesenchymal progenitor cells (MPCs) (Figure 10) obtained from two patients were plated in 12-well plates and cultured in normal medium (DMEM, 10% FBS, PSF). Lyophilized RPP (SEQ ID NO: 9) was dissolved in water at a concentration of 5 mM (1 mg / 34.89, diluted to 3 μM with medium) and cultured with the cells for 48 hours. The control was water.

[0140] [mRNA extraction and quantification] After administration, the cells were lysed, and BDNF, NGF, K VThe mRNA levels of 4.3 were evaluated (Figure 9). The primers used are described for all except NGF. Forward: 5’TATCCTGGCCACACTGAGGT3’ (SEQ ID NO: 338) , and Reverse: TCCTGCAGGGACATTGCTC3’ (SEQ ID NO: 339) .

[0141] [Figure 10: Materials and Methods] MPC was cultured as described by Gervasi et al. 2020 76 .

[0142] [Figures 14, 15 and 16: Materials and Methods] L5 DRGs were dissected from adult male rats and placed in 12-well plates pre-coated with poly-D-lysine (PDL) and laminin, with the minimum amount of medium (B27 (GIBCO), 50 ng / ml NGF (Sigma-Aldrich), and 250 μl of Neurobasal®-A medium (GIBCO) supplemented with penicillin-streptomycin) added to enable adhesion to the culture plates. One day after plating, the DRGs were cultured with RPP (SEQ ID NO: 12: 1 μM, 3 μM, or 10 μM in culture medium, FIGS. 14 and 16; SEQ ID NO: 13 and 14: 3 μM, FIG. 15) for 48 hours. For RNA expression analysis, the DRGs were lysed in 300 μl of Qiazol in a 1.5 ml tube containing bullet blender pink beads using a bullet blender tissue homogenizer (NextAdvance). Total RNA was extracted using the RNeasy midi kit (Qiagen) according to the manufacturer's instructions. The purified RNA was quantified using a NanoDrop 2000 (ThermoFisher), and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) with 2 ng / μl of RNA per reaction. For qRT-PCR, 5 μl of cDNA (equivalent to 10 ng of RNA) was mixed with 10 μl of SsoAdvanced® Universal SYBR® Green supermix (BioRad) and 1 μl of each primer (final primer concentration 500 nM each). The reaction was run in triplicate on a QuantStudio® 7Flex real-time PCR system (Applied Biosystems). The amplification data was analyzed using the comparative cycle threshold (ΔΔCt) method with β-actin as a calibrator. The primers were as follows. β-actin: F-AGAGCTATGAGCTGCCTGAC (SEQ ID NO: 340) , R-GGATGCCACAGGACTCCA (SEQ ID NO: 333) ; K V 4.3: F-AGCTGTGCCTCAGAACTAGGCTTT (SEQ ID NO: 341) , R-TACCAGAAAGACGCAGGGATGCTT (SEQ ID NO: 342) ; K V7.2: F-CCGGCAGAACTCAGAAGAAG (SEQ ID NO: 343) 、R-TTTGAGGCCAGGGGTAAGAT (SEQ ID NO: 344) ; OPRM1: F-TTCCTGGTCATGTATGTGATTGTA (SEQ ID NO: 345) 、R-GGGCAGTGTACTGGTCGCTAA (SEQ ID NO: 346) 。

[0143] [Figure 17: Materials and Methods] [Cytotoxicity assay] The cytotoxicity of RPP (SEQ ID NO: 12) was evaluated using the LDH-Gl O (registered trademark) cytotoxicity assay (Promega) according to the manufacturer's instructions. After culturing with RPP treatment or 2% Triton X-100 (inducing necrosis) for 15 minutes, the medium was collected 48 hours later. The medium was diluted 1:50 with LDH storage buffer (200 mM Tris-HCl (pH 7.3), 10% glycerol, 1% BSA). To confirm the linear range of this assay, an LDH titration curve was also measured together with the test samples. 50 μl of diluted medium or LDH serial dilutions were incubated with 50 μl of LDH detection reagent (50 μl of LDH detection enzyme mixture, 0.25 μl of reducing enzyme substrate) for 40 minutes. Luminescence was recorded with an Infinite M200 Pro (Tecan) device.

[0144] [Example 11 - RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) peptides can be used for inducing neural differentiation]

[0145] [Approach 1] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V(SEQ ID NOs: 18 - 117) To determine whether the peptide is most effective in promoting human neurogenesis and differentiation, an in vitro screening assay using neural stem progenitor cells (NSPCs) of the NCRM-1 / XCL-1 iPSC line will be employed. The NCRM-1 / XCL-1 iPSCs were generated from CD34+ human umbilical cord blood cells by episomal plasmid reprogramming 121 and differentiated into neural stem progenitor cells (NSPCs) by the embryoid body (EB) method 122 . The NSPCs of NCRM-1 / XCL-1 are positionally naive NSPCs and can be rapidly differentiated into neurons 123 . Therefore, it is ideal for a wide range of toxicology and phenotypic screening platforms 124-126 .

[0146] To perform high-throughput screening in a 96-well plate assay, two engineered NCRM-1 / XCL-1 lines are used. RPP (SEQ ID NOs: 1 and 15 - 17) fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) or RPP V (SEQ ID NOs: 18 - 117) To determine whether the peptide is cytotoxic, an NCRM-1 / XCL-1 line expressing NanoLuc® luciferase under the control of the CMV promoter is used. In this line, the CMV-nanoluciferase-halotag (CMV-NLHT) construct was inserted into the safe harbor AAVS1 locus of Chr.19q by transcription activator-like effector nuclease (TALENs) (Figure 20a). Luciferase activity is used as a rapid surrogate indicator of CMV-NLHT cell number. Using this method, time-course data are collected to measure toxicity due to long-term exposure to the drug. RPP (SEQ ID NOs: 1 and 15 - 17) fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) or RPP V (SEQ ID NOs: 18 - 117) If the peptide shows a toxicity level that results in a loss of more than 10% of the luciferase signal, it will be confirmed using the CellTox® Green Cytotoxicity Assay.

[0147] RPP (SEQ ID NOs: 1 and 15-17) or RPP V V To evaluate the pro-neural differentiation promoting effect of the (SEQ ID NOs: 18-117) peptide, the second engineered NCRM-1 / XCL-1 strain will be used. In this strain, NanoLuciferase-HaloTag (NLHT) has been knocked into the MAP2 transcription start site (TSS) (Chr.2) using Zinc Finger Nucleases (ZFN) (Figure 20b). The expression of MAP2 increases with neural differentiation in NCRM-1 / XCL-1 cultures 127 and this was reproduced by an increase in luciferase activity in the MAP2-NHLT culture (Figure 20c). The luciferase activity in the medium was used as an alternative indicator of MAP2-NLHT neural differentiation, and time-course data were collected to track in real-time the differentiation effect of RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) fused to CPP (SEQ ID NOs: 118-137 and 140-159). By this method, it becomes possible to rapidly compare the neural differentiation rates of cultures treated with RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159). A positive neural differentiation effect is independently verified by qRT-PCR expression screening of two cohorts of cell fate marker genes 121 . They are the cohort of NSPC and pluripotency marker genes of LIN28A, RPS27L, IFITM2, IGFBP3, ANXA1; and the cohort of neural marker genes of C1ORF61, IGLON5, IGSF11, CHL1, SOX9. Luciferase activity and qRT-PCR values are reported as mean ± standard error of the mean (SEM). Statistically significant drug effects on the neural cell differentiation rate are determined by one-way analysis of variance (ANOVA) using Tukey's multiple comparison test.

[0148] [Expected Results and Alternatives] RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides administered to human NSPCs are predicted to promote neuronal differentiation as measured by an increase in MAP2 luciferase activity, a decrease in the expression of NSPC / pluripotency markers, and an increase in the expression of neuronal markers, compared to vehicle control.

[0149] RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides may require data collection at alternative time points if the time profile of NCRM-1 / XCLs marker expression is shifted by the effect of the peptides. If the luciferase screen lacks sensitivity to evaluate the differentiation-promoting effect of RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides, it is possible to evaluate neuronal differentiation using qRT-PCR data.

[0150] [Materials and Methods] [Plasmid] CMV-nanoluciferase-halotag (CMV-NLHT) is commercially available from Promaga.

[0151] [Cell Lines and Cell Culture] iPS cells of NCRM-1 / XCL-1 were generated by episomal plasmid reprogramming from CD34+ human umbilical cord blood cells 121 and differentiated into neural stem progenitor cells (NSPCs) by the embryoid body (EB) method as described above 122 and then differentiated into neurons 123 . The method of inserting the CMV-nanoluciferase-halotag (CMV-NLHT) construct into the safe harbor AAVS1 locus on Chr.19q by transcription activator-like effector nuclease (TALENS) (NCRM-1 / XCL-1 cell line) was previously described by Papapetrou et al., 2016 128It has been described. The method of knocking in Nano luciferase-HaloTag (NLHT) to the transcription start site (TSS) of MAP2 (Chr.2 of the NCRM-1 / XCL-1 cell line) using Zinc Finger Nucleases (ZFN) has already been described 127 。

[0152] [Luciferase assay] The method for measuring CMV-NLHT cell count and neural differentiation (MAP2-NLHT) is as described by Fritz et al., 2017 127 and He et al., 2011 129 and has already been described.

[0153] [qRT-PCR screen] The qRT-PCR method for screening cell fate marker genes has already been described by Chou et al., 2011 121 and has already been described.

[0154] [Approach 2] Using the following "Neuron-to-Blank" protocol, human pluripotent stem cells (neural stem cells (NSC)-NL5) 7 days after RPP administration (Figure 11 (SEQ ID NOs: 5-11, 3 μM); Figure 12 (SEQ ID NO: 9, 1 μM); Figure 13 (SEQ ID NO: 13 (Figure 27), 1 μM)) were differentiated. 1. Matrigel was coated on a 24-well culture plate (Black Visiplate) (12 mL / well, 37 °C, 30 minutes). 2. NSCs-NLS (refer to the following medium) were plated at 0.5×10 5 per well.

[0155]

Table 15

[0156] 3. After 24 hours (when the cells are 70% confluent or more), the medium was changed to neural differentiation medium (described below), and test peptides or water controls at various concentrations were added (Figure 11, 12, 13, Table 14). The neural cell differentiation medium with the addition of new test peptides and controls was replaced every 2 days for 5 consecutive days.

[0157]

Table 16

[0158] 4. On the 7th day, the cells were fixed with 4% formaldehyde in 1xPBS for 30 minutes. 5. The cells were immunolabeled overnight with mouse anti-TUJ1 (1:1000) and rabbit anti-Map2 (1:500). Then, they were labeled with 2nd antibodies (anti-mouse 488, anti-rabbit 568, DAPi) for 1 hour. 6. Data collection was performed using a BioTek plate reader a. DAPI: Excitation 360 / 40; Emission 460 / 20, Gain 35 b. Alexa488: Excitation 485 / 20; Emission 528 / 20, Gain 50 c. Alexa568: Excitation 560 / 20; Emission 620 / 10, Gain 75

[0159] [Results] In Figure 11, 3 μM of RPP (SEQ ID NO: 5-11) increased the differentiation of NSC-NL5 after 7 days (1.7 - 2.7-fold) as measured by MAP2 (mature neuron marker) expression normalized to DAPI (nucleus), compared to the control. In Figure 12, 1 μM of RPP (SEQ ID NO: 9) increased NSC-NL5 differentiation by approximately 35% after 7 days as measured by TUJ1 and MAP2 neuron markers (normalized to DAPI (nucleus)), compared to the control. In Figure 13, 0.1 and 1 μM of RPP (SEQ ID NO: 13) increased NSC-NL5 differentiation after 7 days as measured by TUJ1 (60% and 3-fold increase respectively) and MAP2 (27% and 2-fold increase respectively) neuron markers (normalized to DAPI (nucleus) and compared to the control). The basis for using this screen is that it has been shown that removing REST in neural progenitor cells induces neuronal differentiation 22 , because ensemble depression of neuronal genes can be read out.

[0160] [Example 12 - RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) can be used for improving motor and cognitive functions after traumatic brain injury]

[0161] [Approach] In a rat model of TBI, determine whether there are changes in the survival of neurons and the amount of neurogenesis by treating with RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159). Correlate these indicators with the results of histopathology and functional recovery to clarify the effectiveness of the REST peptide after TBI. It has been shown that REST mRNA increases around the lesion after injury (Figure 19). We use a well - characterized rat model of controlled cortical impact (CCI) 6,130-134 .

[0162] Male and female Sprague - Dawley rats (about 250 - 300 g males, 150 - 200 g females) are injured unilaterally on the right parietal cortex with CCI (5 mm in diameter, 4 m / s velocity, 2 mm depth). Sham animals are treated the same way without any impact. Six hours after CCI, the rats are implanted with a cannula attached to an osmotic minipump into the right ventricle to deliver the control or RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) via an intracerebroventricular catheter (ICV) (0.17 μg / hour). Six hours is a translational relevant realistic initial treatment window to determine the effect of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159), and are infused until sacrifice. The first cohort examined the acute effects of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) on neuronal cell death and proliferation at 3 dpi. The second cohort examined the effects of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) on functional and morphological recovery and neurogenesis at 30 dpi. To do this, rats were sacrificed at two different time points. For each cohort, 12 groups were prepared in a 3 (control peptide, 2 doses of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159)) × 2 (sham, CCI) × 2 (male / female) design. Male and female rats will be run on different days so that sex - specific differences in response to injury, behavior, or RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) can be identified. Rats were intraperitoneally injected with BrdU (50 mg / kg) daily for the first week to determine the fate of proliferating and mature cells (first cohort: daily injection from 1 - 3 dpi, sacrificed 2 hours after the final injection; second cohort: daily injection from 1 - 7 dpi). Previous experience suggests that 16 rats / group are needed for important behavioral data (second cohort) and 8 rats / group for immunohistochemistry (first cohort).

[0163] In the second cohort, to examine how treatment with RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) affects function compared to the control group, motor and cognitive behaviors were examined at different time points after heavy metal injury or sham injury. Rats are trained before injury to obtain baseline measurements of motor function in beam walk, rotarod, and open field tests. Rats are examined for recovery of motor function in both beam walk and rotarod at 1, 3, 7, and 10 days after injury. The open field test is performed at 4, 12, and 22 days post-injury (dpi). Recognition memory is evaluated in a novel object recognition test conducted at 20 dpi. Data are analyzed by repeated measures two-way analysis of variance (ANOVA) and Dunnett's post hoc correction. Spatial memory and learning are determined by the Morris water maze (MWM) assay starting at 25 dpi. In all trials, swim speed and latency to find the hidden platform are recorded. In the probe trial conducted on the 5th day of training, the time the rat stays at the location where the hidden platform used to be is measured. Also, a visible platform test is performed for each rat to confirm that there are few differences in vision among the animals. Two-way ANOVA with Tukey's multiple comparison correction is used to determine whether the RPP (SEQ ID NOs: 1 and 15-17) or RPP V fused with CPP (SEQ ID NOs: 118-137 and 140-159) 135 .

[0164] After functional evaluation, 8 rats in one group are sacrificed by transcardial perfusion, and the brains are removed and processed. At both 3 dpi and 30 dpi, sections are stained with cresyl violet, and the size of the lesion is determined by measuring 12 sections at 500 μm intervals. The volume of the lesion is expressed as a percentage of the volume of the ipsilateral hemisphere. Serial coronal sections including the prefrontal cortex, the subventricular zone (SVZ) of the dorsal hippocampus, and the dentate gyrus (DG) are examined. The total number of BrdU-positive cells (detected with anti-BrdU) in different hippocampal regions and SVZ is counted using stereology, and the RPP (SEQ ID NOs: 1 and 15-17) or RPP V(SEQ ID NOs: 18 - 117) The peptide determines whether it changes the survival of newly proliferated cells after injury. To identify the proliferated cells at 3 dpi and determine the fate of maturation at 30 dpi, the sections are co - stained with different cell - specific markers. Examples of cell - specific markers include NeuN (mature neurons), SOX2 (neural stem cells), DCX (neural progenitor cells), GFAP or ALDH1L1 (astrocytes), Iba1 (microglia), NG2 (oligodendrocyte progenitor cells, OPCs), APC or GSTpi (mature oligodendrocytes), etc. Compare the number of BrdU / NeuN double - positive cells in the DG and olfactory bulb at 30 dpi among different treatment groups, and RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused with CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) Determine whether the peptide increases neurogenesis after injury.

[0165] Also, determine whether BrdU + neural progenitor cells and mature neurons are moving away from the DG or SVZ towards different regions of the hippocampus, such as the lesion site or the RMS (rostral migratory stream). In addition to the neurogenic niche, by examining the total number of each BrdU + cell type in the peripheral region, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused with CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) It can be determined whether the peptide changes the pathology after injury. RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused with CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) Since the peptide is thought to enhance the survival rate of neurons, quantify the number of degenerated neurons (fluoro - Jade C) and the number of surviving neurons (NeuN) in the perifolium at both time points. To show the difference in the amount of myelin, the corpus callosum is examined with Luxol fast blue. Using the unbiased optical fractionator method, cells in the neurogenic region, the area surrounding the lesion, the anastomotic flow, and the olfactory bulb are counted to obtain accurate cell specificity and counts of proliferating cells. All data are analyzed by two-way ANOVA with Dunnett's post hoc correction. RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) The distribution of the peptide is examined in sections by staining with FLAG antiserum. Eight animals in each of the remaining groups (second cohort) are sacrificed and the brain is rapidly removed. Brain regions ipsilateral and contralateral to the lesion are punched out and snap frozen for RNA and protein isolation. The expression level of REST is measured by Western blot, the expression level of BDNF is measured by qRT-PCR, and the expression levels in the area surrounding the lesion and the neurogenic niche are compared with the control group.

[0166] [Expected Results and Alternatives] RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) The peptide is expected to reduce the lesion volume after CCI at both 3 dpi and 30 dpi by enhancing the survival of nerve cells. RPP (SEQ ID NOs: 1 and 15-17) or RPP V To directly evaluate the effect of RPP (SEQ ID NOs: 1 and 15-17) or RPP (SEQ ID NOs: 18-117) peptide treatment on nerve cell survival, both degenerating and surviving nerve cells are examined at both time points. V Due to the significant early neuroprotective effect of RPP (SEQ ID NOs: 1 and 15-17) or RPP (SEQ ID NOs: 18-117) peptide in the peroneal region, motor function is thought to be improved in the first week. In mice, it has previously been found that the maximum nerve cell death occurs at 3 dpi after CCI 136 but in rats, it may be necessary to examine a different time point. In addition, RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V peptides (SEQ ID NOs: 18 to 117) are expected to show increased neurogenesis in animals treated with them compared to animals treated with control peptides. Our data show whether treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V (SEQ ID NOs: 18 to 117) peptides results in an increase in DCX+ precursors in different brain regions at 3 dpi or an increase in BrdU+ / NeuN+ mature neurons in the hippocampus, olfactory bulb, or perilesional area at 30 dpi. By correlating these data with the behavioral results, it will be possible to confirm whether treatment with RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V (SEQ ID NOs: 18 to 117) peptides improves the performance of the MWM assay or the novel object recognition assay. 135 In this way, it will be possible to determine whether RPP (SEQ ID NOs: 1 and 15 to 17) or RPP V (SEQ ID NOs: 18 to 117) peptides have any adverse effects on inflammation or cell proliferation.

[0167] [Materials and Methods] [Test System] Species: Male and female Sprague-Dawley rats. Age at the start of the test: Approximately 22 to 29 weeks Body weight at the start of the test: Approximately 250 - 300 g for males and 150 - 200 g for females.

[0168] [Research Plan] For each cohort (Cohort 1 and Cohort 2), 3 (control peptide, 2 doses of RPP (SEQ ID NOs: 1 and 15 to 17) or RPP VThere are 12 groups with the design of (peptides with SEQ ID NOs: 18 - 117) × 2 (sham, CCI) × 2 (male / female). In the first cohort (immunohistochemistry), there are 8 animals / group, and in the second cohort (behavior), there are 16 animals / group.

[0169] [Rationality of dosage] The high dose is set as the maximum achievable dose (about 0.17 μg / h), and the low dose is the estimated effective dose based on the cerebrospinal fluid (CSF) drug level approximated to the effective dose determined in Example 13.

[0170] [Route of administration] An osmotic minipump is attached to the cannula placed in the right ventricle and administered via an intracerebroventricular catheter (ICV). [Frequency of administration] Continuous infusion until sacrifice. [Interval between administrations] First cohort: 3 dpi, second cohort: 30 dpi [Environmental conditions] 2 animals / cage, food and water are provided ad libitum.

[0171] [Test article identification] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (peptides with SEQ ID NOs: 18 - 117) [Purity] 95% or higher. [Preparation of dosage form] It is carried out collectively every 4 days. [Assay and stability of dosage form] The stability and concentration of the dosage form are evaluated on the 1st and 7th days of the first week of the test start. The acceptable concentration range is ±10% of the nominal value.

[0172] [Controlled cortical impact (CCI) model] The CCI model is as reported previously. 6,130-134 。Administration of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (peptides with SEQ ID NOs: 18 - 117), or control (vehicle only) is started 6 hours after CCI.

[0173] [Immunohistochemistry] The method has been already described by Xiong, Y et al. in 2007 and 2008 135,137 as previously described. [Morris water maze] method was already described by Choi et al., 2006 138 as already described by

[0174] [Example 13 - RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) can be used for improving regeneration after peripheral nerve injury]

[0175] [Approach] For functional recovery after peripheral nerve injury (PNI), neurotrophic factors (NTFs) are required, and their presence or absence serves as a biomarker indicating the strength of the regenerative response 139,140 . Several NTF genes such as brain - derived neurotrophic factor (BDNF), nerve growth factor (NGF), pleiotrophin (PTN), and neurotrophin - 3 (NTF - 3) are known to have their REST expression suppressed by injury, and we have shown that RPP (SEQ ID NO: 2) can reverse this transcriptional repression, at least in the case of BDNF and NGF (Figures 7, 9, 10, 16) 141,142 .

[0176] 1) By real - time quantitative reverse transcription PCR (qRT - PCR) analysis, it was found that NBFL cells administered with 1 μM of linear (SEQ ID NO: 4) or circular (SEQ ID NO: 2) RPP for 16 hours or 48 hours induced an increase in the mRNA expression of BDNF and NGF (see Figures 9, A, and B and the following table).

[0177] [Table 17]

[0178] 2) RPP (SEQ ID NO: 9, 3 μM) increased NTFs BDNF and NGF by approximately 2 - fold and 3 - fold, respectively, after 48 hours compared to the water control. From this, it was confirmed that RPP is activated in MPC (Figure 10). MPC was cultured in general medium as previously described by Gerevasi et al., 2020 76 as previously described by

[0179] 3) In mesenchymal progenitor cells (MPCs) isolated from male and female patients with musculoskeletal trauma, the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides that are fused to CPP (SEQ ID NOs: 118-137 and 140-159) are quantified for their effect on the expression of NGF, BDNF, PTN, and NTF-3. MPCs are present at the peripheral nerve injury site and are characterized extensively 143 . MPCs are harvested during normal and pre-planned surgical procedures using a standard isolation protocol developed by Dr. Leon Nesti 116,143 . MPCs obtained from three different subjects are cultured and expanded. First, the cells are passaged four times without neural induction, and the baselines of the transcription and protein level expression of REST and NTF are established by qRT-PCR and Western blot (WB). Next, as described by Bulken-Hoover et al. 144 , expansion is repeated with neural induction. Briefly, MPCs are enhanced in pre-induction medium for 2 days, then with all-trans retinoic acid (RA) for 1 day, and then cultured in neural induction medium for 7 days. The neural induction medium is changed every 3 days. On day 7 after introduction, the levels of REST and NTF are evaluated. It is expected that with the induction of neural cells, the expression of REST decreases, and concomitantly the expression of NTF increases.

[0180] To evaluate the efficacy of induction of the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides that are fused to CPP (SEQ ID NOs: 118-137 and 140-159) on NTF expression in MPCs, first the cytotoxicity of the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides is evaluated to establish the administration. Briefly, MPC is RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159), at four dose levels up to 10 μM, in a pre - introduction medium in which RA has been replaced with the (SEQ ID NOs: 18 - 117) peptide, or plated for 1 day in a pre - introduction medium (containing RA). Each treatment group has three technical replicates and three biological replicates, and cytotoxicity is determined using the MTT assay 145 To lower the level of REST and raise the level of NTF, the optimal concentration of the RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptide fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) is determined by performing a dose - response (3 dose levels) on days 1, 3, and 6 post - treatment (dpt) in a neural induction medium in which the RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptide has been replaced with RA. Administration of the RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptide is based on the findings of the MTT assay 145 . The negative control and positive control are neural induction medium - or + RA, respectively. The gene expression and protein amounts of REST and NTF are quantified by qRT - PCR and WB 139,146 Cells are harvested at 1, 4, and 7 dpt, and RNA and protein are separated from the cell lysate. Following two - way ANOVA, Tukey's post - hoc test is performed to compare the - and + controls at the designated time points with the RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V(SEQ ID NOS: 18 - 117) A comparison is made with the peptide administration group. The population mean is reported as mean ± SD, and is considered statistically significant if the p-value is 0.05 or less. Statistical analysis is performed using the SAS statistical package (SAS Institute, Cary NC).

[0181] 4) The ability of RPP (SEQ ID NO: 12) to induce the expression of BDNF and NGF was evaluated in an ex vivo culture of whole DRG neurons (derived from L5, male SD rats) at 0, 0.3, 1, 3, and 10 μM (Figure 16). RPP increased the expression of BDNF by approximately 25% at 0.3, 1, and 3 μM and by 75% at 10 μM. RPP increased NGF by approximately 50% and 2-fold at 3 μM and 10 μM, respectively (Figure 15). No effect was seen at 1 μM, and no conclusion could be drawn at 0.3 μM as n = 1 (Figure 16).

[0182] 5) RPP (SEQ ID NO: 12) was evaluated in an LDH cell toxicity assay performed on ex vivo cultured whole DRG neurons (derived from L5, male SD rats). RPP showed no toxicity at 0, 1, 3, and 10 μM (Figure 17). As expected, the positive control (2% Triton) showed neurotoxicity, as indicated by an increase of 90,000 RLU.

[0183] 6) RPP (SEQ ID NOS: 1 and 15 - 17) fused to CPP (SEQ ID NOS: 118 - 137 and 140 - 159) or RPP V (SEQ ID NOS: 18 - 117) peptides are evaluated for their ability to induce NTF expression and stimulate regeneration in both motor and sensory ex vivo nerve models through the use of spinal cord and isolated dorsal root ganglion (DRG) extracts, respectively. 147 Both models are widely used to study the neuroprotective and trophic properties of growth factors. 148 。 Segments of 10 mm of intact DRG are extracted from both sides (L4 - L6) of the spinal column of (6 rats) and cultured (Figures 21 and 22). 149,150The remaining spinal cord material is preserved for use in culturing motor neuron - associated spinal cord slices. These spinal cords are cut transversely at 300 - μm intervals with a microtome, and the slices are transferred to culture inserts with semi - permeable membranes and acclimated to the culture conditions for one week. 149,150 Culture inserts containing organotypic spinal cord slices from one - week - old animals have a stable population of surviving motor neurons and are then transferred to 6 - well plates for an additional 7 - day culture.

[0184] All in vitro explant cultures are maintained in Neurobasal / B27 medium for two weeks to allow extensive outgrowth of neuronal processes. 147 To induce physical damage, a glass Pasteur pipette is used to wound delicate neuronal processes 6 mm from the periphery of the DRG ganglia and the gray - white matter junction of the abdominal spinal cord slices. Ex - vivo cultures are treated with RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides (0, 1, 3, or 10 μM) starting 24 hours after injury.

[0185] The regenerative capacity of damaged neurites (motor and sensory neurons) is determined by monitoring cell viability and measuring axonal outgrowth. Cell viability is evaluated 7 days later by labeling live and dead cells with calcein - AM and ethidium homodimer - 1, respectively. Neurite outgrowth, an indicator of neuronal regeneration, is measured on days 1, 4, and 7. Grayscale micrographs of the scratch area are acquired with a Zeiss AxioObserver microscope coupled to a monochrome digital camera. 151 The number, length, and total area of the sprouts regenerated within the scratch area are analyzed using ImageJ. 152 。

[0186] NGF exerts much of its functional activity through the TrkA receptor of DRG, its receptor. 153 PTN has been found to mainly cause an increase in axonal outgrowth in motor neurons. 150,154。BDNF and NTF-3 are present in both motor and sensory nerves. Quantify the gene expression level and protein amount of NTF by qRT-PCR and WB 139,146 。Tissues were collected from each ex vivo system at 1, 4, and 7 dpi, and RNA and protein lysates were isolated. Two-way analysis of variance and Tukey's post hoc test were performed to compare between the control group and the RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptide administration groups at the specified time points. The population mean values are reported as mean ± SD, and are considered statistically significant if the p-value is 0.05 or less. Statistical analysis is performed using SAS software (SAS Institute, Cary NC).

[0187] 7) Evaluate the ability of RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptide to improve regeneration and functional recovery after sciatic nerve defect in vivo in 100 rats. It was revealed that RPP accumulated in the sciatic nerve nuclei of the spinal cord 48 hours after injecting RPP into the sciatic nerve injury site (Figure 4). RPP (SEQ ID NO: 1 and 15-17) or RPP fused to CPP (SEQ ID NO: 118-137 and 140-159) V (SEQ ID NO: 18-117) peptide can be tested for a higher maximum feasible dose (MFD) by intravenous (IV) administration as compared to intramuscular (IM) or subcutaneous (SC) administration. Also, IV administration can avoid first-pass metabolism associated with oral or intraperitoneal (IP) administration. The dosing concentrations in the regeneration and functional recovery tests are determined based on the determination of the single IV dose range for one month using Sprague-Dawley rats, i.e., the results of the toxicity and toxicokinetic tests. After the completion of 1), the dose range determination toxicity test is started as soon as possible. Briefly, in this test, four dose levels up to 1000 mg / kg or the maximum tolerated dose or MFD are used as recommended by the FDA guidance (M3(R2), 2009). The number of animals assigned to each group shall be as follows. For this test: 10 / sex / group; for TK: 3 / sex / control group and 9 / sex / dosing group. Animals are evaluated for body weight, food intake, clinical chemistry, hematology, urine examination, organ weights, histopathology (major 8 tissues), and toxicokinetics.

[0188] In the regeneration and functional recovery test, Sprague-Dawley rats are intravenously administered with RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptides fused to CPP (SEQ ID NO: 118-137 and 140-159) as three dosing groups (TBD) + control (10 / sex / group) using a long-term intravenous catheter once a week for 6 weeks. 155 All animals are anesthetized and the sciatic nerve is exposed. 156 A 0.7 cm portion is resected, and after retracting the nerve stump, a segmental defect of about 1 cm is formed. 157 The nerve is repaired using a decellularized nerve graft. Then, the surgical incision is closed and the nerve is allowed to regenerate over 6 weeks. Only in the dosing groups, RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptides fused to CPP (SEQ ID NO: 118-137 and 140-159) are administered. During the 6-week period, the functional recovery and tolerance to the administration of RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptides fused to CPP (SEQ ID NO: 118-137 and 140-159) are evaluated. Once a week, the body weight and body temperature of the rats are recorded, and a toe-spreading reflex test (measuring the maximum foot width of the injured leg to examine motor nerve function) is performed. 156Gait trajectory analysis (digitized) is performed every two weeks, and electrophysiological studies 158 are conducted. Briefly, electrophysiological tests are performed on the sciatic nerve of rats. Electrical stimulation is applied to the original sciatic nerve trunk using a single pulse shock (1 mA, 0.1 ms) at a point 5 mm proximal to the graft suture site. The compound muscle action potential (CMAP) of the gastrocnemius muscle is recorded from 1 V to 12 V or until the upper limit of CMAP is reached. For comparison, normal CMAPs from the contralateral sciatic nerve that has not undergone surgery are also recorded. The recovery rate is determined by the ratio of the CMAP of the injured hind limb to the CMAP of the contralateral normal hind limb. 159,160 。

[0189] At the end of the 6th week, not only the sciatic nerve but also the ventral horn (VH) and DRG of the spinal cord related to the L4 - L6 nerve roots are harvested. 161,162 Nerve regeneration is evaluated histologically. The proximal end, distal end, and central part of the graft are prepared for transmission electron microscopy (TEM) through cross-sections, and myelination along the graft is evaluated. 163,164 Briefly, ultra-thin sections of approximately 70 nm are cut from the nerve using an ultramicrotome and stained with uranyl acetate and lead citrate. 10 - 15 fields are selected for analysis from random sections, and the number and size of myelinated fibers are quantified. The average fiber density is calculated as described above. 73 。 In addition to TEM, IHC to visualize β-tubulin III to measure the direct growth of axons, S100 to measure the infiltration and growth of Schwann cells into the graft, von Willebrand factor to evaluate angiogenesis and capillary infiltration of the healing nerve, and Luxol blue staining to measure myelination within the graft 165,166 are used to create additional sections from the same nerve. The ventral horn and DRG are evaluated for changes related to the RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides fused to CPP (SEQ ID NO: 118 - 137 and 140 - 159) in the cell bodies of damaged motor and sensory nerves. Take images of the stained tissues with an optical microscope, quantify the intensity and area ratio of the positive reaction of anatomically matched tissues using ImageJ software (https: / / imagej.nih.gov / ij), and compare the nerve regeneration rates between groups. 165 The DRG neurons of the damaged nerves are counted as described above and compared with the undamaged DRGs on the contralateral side. 167 NTF (BDNF, NGF, PTN, NTF-3), CTDSP1, and REST are examined by qPCR and WB.

[0190] [Expected Results and Alternatives] When mesenchymal progenitor cells (MPCs) are treated with RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) + neural induction medium (-retinoic acid, RA), it is expected that the expression of neurotrophic factors (NTFs) will increase and the level of REST will decrease compared to the neural induction medium -RA, but it will be the same as the neural induction medium +RA. RPP (SEQ ID NOs: 1 and 15-17) or RPP V An ex vivo model treated with (SEQ ID NOs: 18-117) peptides is expected to have increased neurite outgrowth compared to the untreated group due to a decrease in REST levels. RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) The regenerative effect of the peptides may not be significant if there are no supporting cells that can secrete neurotrophic factors in vivo after nerve cell damage.

[0191] As an alternative experiment, it includes co-culturing neural support cells (such as Schwann cells and mesenchymal stem cells) with the extracts of dorsal root ganglia (DRGs) and spinal cord enriched with motor and sensory neurons before treatment with RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) before injury and subsequent treatment. Subsequently, the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) are analyzed for their ability to assist in the regeneration of transected nerves in a rat model. The rats treated with the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) are expected to show improved recovery compared to control rats as determined by histology, electrophysiology, and functional evaluation. Also, the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) are predicted to increase NTF expression and decrease REST protein levels. If signs of recovery and removal of REST blockade are not observed, direct injection into the target site (i.e., the graft site or intrathecal space) will be used to increase the local concentration of the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159).

[0192] [Materials and Methods] [Cell Culture] The collection, culture, and neurotrophic induction of MPCs are as described above 168 . Briefly, MPCs are plated in pre-induction medium for 2 days, then enhanced with all-trans retinoic acid (RA) for 1 day, and then plated in neuroinduction medium for 7 days. The neuroinduction medium is changed every 3 days. On day 7 after induction, the levels of REST and NTF are evaluated.

[0193] [qRT-PCR] The method described in Example 10. [Western Blot Analysis] Whole cell lysates are as described by Ballas et al., 2001 119It was prepared according to the following procedure. Western blot was performed using anti-REST-C64, anti-NTF (using commercially available antibodies), anti-GAPDH (abcam [6C5]), and anti-IgG conjugated with infrared dye (Thermo Fisher) according to the standard procedure, and analyzed with an Odyssey infrared fluorescence imager (LiCor).

[0194] [Test Article Identification] RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptide. Purity is 95% or higher. [Preparation of Dosage Form] It is carried out every 4 days in batches. [Evaluation and Stability of Dosage Form] The stability and concentration of the dosage form are evaluated on the 1st and 7th days of the first week of the start of the test. The allowable concentration range is ±10% of the nominal value.

[0195] [Vertebrate Animals] Adult male and female Sprague-Dawley rats (about 250-300 g male, 150-200 g female) were used to determine the effect of RPP (SEQ ID NO: 1 and 15-17) or RPP V (SEQ ID NO: 18-117) peptide in improving the recovery from PNI. In this study, 100 rats aged 8-11 weeks are required. The rats are obtained from Charles River Laboratories

[0196] [Procedure Description] Surgery: All rats are anesthetized with isoflurane (4% induction, 3% maintenance) prior to all surgical procedures. 2) Organotypic spinal cord cultures are prepared from the lumbar spinal cord of postnatal day 8 Sprague Dawley rats using the techniques described above (Rothstein et al., 1993; Corse et al., 1999). Briefly, rats are sacrificed quickly, the lumbar spinal cord is removed and placed in Gey's balanced salt solution (Gibco) containing glucose (6.4 mg / L). Under aseptic conditions in a laminar flow hood, the meninges are carefully removed and the lumbar spinal nerve roots are transected. The spinal cord is placed on an agar film and sectioned at 300 μm intervals from L2 to L5 using a McIlwain tissue chopper. Individual spinal cord sections are carefully transferred to the Millicell-CM (Millipore) permeable membranes of 6-well culture plates using Gey's balanced salt / glucose solution. Five spinal cord sections are placed on each membrane. Each well is filled with 1 mL of a medium consisting of 50% minimum essential medium, 25 mM Hepes, 25% Hank's balanced salt solution, D-glucose (25.6 mg / L), 25% heat-inactivated horse serum, and 2 mM L-glutamine. The cultures are maintained for 1 week in a humidified incubator at 37 °C and 5% CO2 with medium changes every 3 days. After 1 week, the slices are transferred to another 6-well culture plate and cultured for an additional 7 days to stabilize and extend the neurites before any treatment is applied.

[0197] 3) The sciatic nerve is exposed 117 (Figs. 21, 22), and a 0.7 cm segment is excised to create an approximately 1 cm segmental defect after retracting the nerve stumps (Hems and Glasby, 1993). The nerve is repaired using a decellularized nerve graft. The surgical incision is then closed and the nerve is allowed to regenerate for 6 weeks. Group 1 (control) undergoes excision of approximately 1 cm of the sciatic nerve and transplantation of a 1 cm decellularized allograft nerve. Groups 2 to 5 undergo excision of 1 cm of the sciatic nerve and transplantation of a 1 cm decellularized allograft, and RPP (SEQ ID NOs: 1 and 15 to 17) or RPP fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) at the drug concentrations determined in the dose range determination study.V (SEQ ID NOs: 18 - 117) The peptide is intravenously injected weekly. All animals are sacrificed at 6 weeks.

[0198] [Behavioral Evaluation] To evaluate functional recovery and tolerance to peptide treatment, animals are observed for up to 6 weeks. Weekly, the body weight and body temperature of the rats are recorded, and a toe splay reflex test (measuring the maximum foot width of the injured leg to examine motor nerve function) is performed. 117 Analysis of the walking track is performed every 2 weeks, and electrophysiological examinations are carried out before sacrifice at 6 weeks.

[0199] [Electrophysiological Evaluation] Electrophysiological examinations are performed according to the conventional method. 158 Briefly, the sciatic nerve of the rat is re-exposed, and electrical stimulation (single pulse shock, 1 mA, 0.1 ms) is applied to the original sciatic nerve trunk 5 mm proximal to the graft suture point. CMAP is recorded from the belly of the gastrocnemius muscle from 1 V to 12 V, or until the upper limit of CMAP is reached. For comparison, normal CMAP from the contralateral, non-operated sciatic nerve is also recorded. A GrassTech S88X stimulator (Astro-Med Inc.) is used for the test, and PolyVIEW16 data acquisition software (Astro-Med Inc.) is used for recording. The recovery rate is the ratio of CMAP of the injured hind limb of the rat to CMAP of the contralateral normal hind limb. 158 .

[0200] [Sacrifice] The rats are sacrificed at 6 weeks after injury. After sacrifice, histological evaluation of axonal growth, remyelination, MPC cell activity at the injury site, anterior horn cell and DRG activity, and angiogenesis of the regenerated nerve through the graft is performed. The gastrocnemius and anterior tibial muscles of each rat are harvested after sacrifice, and the total weight is evaluated to quantify atrophy.

[0201] [Justification] After PNI, complex interactions of cells and molecules are observed among all cells inherent in the vascular system, immune system, and peripheral nervous system. Since the order and interactions of various cells, signaling molecules, cell-cell interactions, circuits, etc. that occur after trauma are not fully understood, it is currently impossible to model them in vitro. Furthermore, the RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159) may affect not only neural progenitor cells and adult neurons but also other cell types, and it is considered important to evaluate them in vivo from the perspective of PNI. The FDA also requires proof of in vivo efficacy before approving an IND application for a biological product, which further justifies that these experiments be in vivo. Rats are used because behavioral studies after PNI have shown their reliability in this type of experiment. Therefore, there is a wealth of literature providing a detailed framework for the planning and execution of the experiments. Rats are more intelligent and larger than mice, so they have a higher ability to distinguish changes in functional recovery after injury. The physiological functions of rats are more similar to humans than those of mice, and the translational relevance of experimental data can be better. Furthermore, the REST pathway we are targeting is conserved in rats.

[0202] [Minimization of pain and suffering] Rats are anesthetized with isoflurane (3-4%) due to segmental peripheral nerve deficits. After surgery, the animals are allowed to recover on a warming pad until they can move. Rats are administered acetaminophen (6 mg / ml in drinking water) for 2 days after surgery and additional doses are given if signs of pain or suffering are observed. Rats are observed daily by both laboratory and veterinary staff, and animals determined to be in pain are treated or euthanized according to veterinary advice. [Euthanasia] The euthanasia used is in accordance with the recommendations of the "Guidelines on Euthanasia of Animals" of the American Veterinary Medical Association.

[0203] [Example 14 - RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides can be used for the prevention and treatment of chronic pain] [Completed evaluation]: Activation of REST after nerve injury results in a decrease in the expression of several genes necessary for the normal excitability of sensory neurons, such as potassium channel K V 4.3 (Kcnd3) and K V 7.2 (Kcnq2), sodium channel Na V 1.8 (Scn10a), and mu - opioid receptor OPRM1 60、72-74 . Studies using mouse and rat peripheral nerve injury (PNI) models have been published as a basis for inhibiting REST to relieve chronic pain 60,72-74 .

[0204] 1) By real - time quantitative reverse transcription PCR (qRT - PCR) analysis, when 1 μM of linear (SEQ ID NO: 4) or circular (SEQ ID NO: 2) RPP was administered to NBFL cells for 16 hours or 48 hours, it was found that the mRNA expression of K V 4.3 increased (C in Figure 9 and Table 16 below).

[0205]

Table 18

[0206] 4) RPP (SEQ ID NO: 12; 0 (water), 1, 3, or 10 μM) was cultured in ex - vivo culture of whole DRG (derived from L5, SD female rats) for 48 hours, and the possibility of inducing the expression of chronic pain - related genes K V 4.3, K V 7.2, Na V 1.8, OPRM1 was evaluated (Figure 14). RPP doubled the expression of K V 4.3 at 10 μM compared to the control, increased the expression of K V 7.2 by 7.5 - fold and 9 - fold at 3 μM and 10 μM respectively, and Na VThe expression of 1.8 was increased 2.9-fold and 4.8-fold at 3 μM and 10 μM, respectively, and the expression of OPRM1 was increased at 3 μM and 10 μM, respectively (see Figure 14). RPP SEQ ID NOs: 13 and 14 were evaluated for Na in the ex vivo culture of all DRGs (L5, male Sprague-Dawley rats) after a 48-hour administration period at 3 μM. V The expression of 1.8 was evaluated. SEQ ID NOs: 13 and 14 increased the Na1.8 expression 6-fold and 13-fold, respectively, compared to the control (Figure 15). V The expression of 1.8 was increased 6-fold and 13-fold (Figure 15).

[0207] 5) RPP (SEQ ID NO: 12) did not show neurotoxicity in the LDH assay performed on all ex vivo cultured DRG neurons (derived from L5, male Sprague-Dawley rats). RPP did not increase the RLU level compared to the control. As expected, the positive control (2% Triton) increased the RLU 90,000-fold (Figure 17).

[0208] [Planned Evaluation] [Objective 1]: To determine the pharmacokinetics, distribution, and dosage of RPP (SEQ ID NOs: 1 and 15-17) or RPP (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159). V To determine the pharmacokinetics, distribution, and dosage of RPP (SEQ ID NOs: 1 and 15-17) or RPP (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159).

[0209] [Sub-objective 1.1] Develop and validate a liquid chromatography-tandem mass spectrometry (LC-MS / MS) method for detecting (in the range of 10-10,000 ng / mL) in the plasma, CSF, and tissues of rats and monkeys.

[0210] [Sub-objective 1.2] Conduct exploratory pharmacokinetic (PK) studies using Sprague-Dawley rats to determine the administration route in in vivo animal studies and in clinical settings. 1000 mg / kg of RPP (SEQ ID NOs: 1 and 15-17) or RPP (SEQ ID NOs: 18-117) peptides fused to CPP (SEQ ID NOs: 118-137 and 140-159). V(SEQ ID NOs: 18 - 117) Peptides are administered IV, SC, or PO, and plasma samples are collected at 5 minutes, 30 minutes, 4 hours, 8 hours, 24 hours, and 48 hours (2 / gender / time point). Peak drug concentration (C max ), area under the curve (AUC), and half-life (t 1 / 2 ) are evaluated. To evaluate the penetration of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) Peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) into the central and peripheral nervous systems, target tissues (CSF, brain, lumbar spinal cord, dorsal root ganglion (DRG)) are also collected at euthanasia, and drug concentration is measured. RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) Peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) are detected by a validated LS-MS / MS method (SUBAIM1.1).

[0211] [Sub - objective 1.3] To determine the dosage in the rat efficacy test (Objective 2), a single - dose range confirmation test is performed in SD rats using the optimal administration route revealed by SUBAIM1.1. Based on the PK data of SUBAIM1.1, four dose levels + vehicle control (3 / gender / group) are selected. The high dose (HD) needs to identify the limiting dose (maximum feasible dose (MFD), maximum tolerated dose (MTD), and / or exposure saturation). The low dose is administered in 1 / 3 increments. Animals are evaluated daily for survival rate and clinical symptoms (signs of abnormalities and pain or distress). Blood is collected at six time points selected based on the PK data of SUBAIM1.1 after administration, and C max , AUC, and t 1 / 2 are evaluated. Tissues (DRG, lumbar spinal cord, brain) for evaluating gene changes in the efficacy test are collected at euthanasia, and the concentration of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) Peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) is evaluated.

[0212] [Objective 2]: To evaluate the effect of RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides on chronic pain.

[0213] It was revealed that administration of RPP to the sciatic nerve transection site accumulates in the nuclei of motor neurons in the lumbar (L4-L6) spinal cord 48 hours later (Figure 4). To evaluate the effect of our drug on pain, a preclinical SNI model using the sciatic nerve is used. SNI is established as an animal model of neuropathic pain, and robust and long-term changes in thermal sensitivity, peripheral and central morphine analgesia, and decreased c-fiber perception occur 74 . Furthermore, it has already been shown by us and other researchers that SNI induces the expression of REST and its target genes involved in chronic pain (Figure 18 and Table 12 respectively) 60,72-74 . Furthermore, as we predicted, an increase in CTDSP1 levels was observed (Figure 18).

[0214] RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides, the chronic pain reduction effect is determined in the first phase and the persistence of pain reduction is determined in the second phase. Using the SNI sciatic nerve rat model, it is tested whether RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides reduce chronic neuropathic pain. RPP (SEQ ID NOs: 1 and 15-17) or RPP V (SEQ ID NOs: 18-117) peptides, or vehicle, or oxycodone, a standard therapeutic agent used in the treatment of neuropathic pain, is administered. The experimental procedures for the first phase are summarized in Table 17 below.

[0215]

Table 19

[0216] For this purpose, a total of 3122-month-old SD rats (equal numbers of males and females) are required. The sample size of 12 rats per group has 80% power to detect a difference of 1.20 standard deviations in pain assessment. The power analysis was performed at 5% (two-sided significance level) based on an independent samples t-test. In the efficacy study, rats are randomly assigned to the experimental groups (n = 12 / group) shown in the right table. For each of the 10 randomly assigned groups of rats, stimulus-induced and non-stimulus-induced behavioral tests, morphological, immunohistochemical analysis, quantitative RT-PCR (qRT-PCR) analysis, and WB analysis are performed. At the time of euthanasia, blood sampling is performed at two time points (14 days and 28 days) after the start of drug administration to evaluate standard PK parameters. The DRG and brain are extracted, and the concentrations of OPRM1, Na V 1.8, K V 4.3, K V 7.2 are measured. Furthermore, tissues are collected for LC-MS / MS analysis to measure the rpp concentration.

[0217] Surgery: SNI or sham surgery (surgery to expose nerve branches without damaging the nerves) is performed as described above 169 . Briefly, rats are anesthetized and the common peroneal nerve and tibial nerve are ligated. Leaving the peroneal nerve, the third branch of the sciatic nerve, intact, 2-4 mm segments of each nerve distal to the ligation are cut and removed. The peroneal nerve shows an increased response to noxious and non-noxious stimuli from day 4 after injury in the ipsilateral innervated area, stabilizes on day 7, and is maintained up to 6 months. The 7 days after injury are recognized as the onset period of chronic neuropathic pain and are translationally relevant.

[0218] Drug / Vehicle: Administration starts on the 5th day after surgery. RPP (SEQ ID NOs: 1 and 15-17) fused to CPP (SEQ ID NOs: 118-137 and 140-159) or RPP VFor the peptides (SEQ ID NOs: 18 to 117), the test route, number of times, and drug concentration are determined based on the PK test of Specific Objective 1. For oxycodone, the administration route and effective exposure amount in rats approximating the effective exposure amount in humans are known (oxycodone 0.56 mg / kg and 0.2 mL vehicle). 170 。

[0219] Behavioral test: The effects on pain transmission and motor function are evaluated every other day starting from 1 day before surgery and on the 4th day after surgery. Using both stimulus-induced and non-stimulus-induced behavioral tests, RPP (SEQ ID NOs: 1 and 15 to 17) or RPP fused to CPP (SEQ ID NOs: 118 to 137 and 140 to 159) V The functional effects of the peptides (SEQ ID NOs: 18 to 117) are measured compared to oxycodone and vehicle. In recent years, the translationality of several stimulus-induced behavioral tests has become a problem, and stimulus-induced, non-stimulus-induced, and operant or voluntary behavioral tests have come to be used. In this proposal, the von Frey test and the thermal pain test, which are the most widely used and translational stimulus-induced behavioral tests, non-stimulus-induced gait analysis, and the place avoidance / escape paradigm for measuring the pain avoidance state are used 171 。Recent studies have shown the value of including gait analysis to detect subtle improvements or deteriorations in animal models 172 。The rat handlers and evaluators performing the behavioral tests are blinded to which experimental / control group the rats are randomly assigned to. Each animal is given a unique animal number. A secret color code is used to designate the control and experimental groups. This code is revealed only after analysis.

[0220] Stimulus-induced behavioral test: Hyperalgesia to mechanical stimuli: The mechanical withdrawal thresholds of the left and right hindlimbs are examined using a von Frey (Bioseb, Chaville, France) consisting of a hand-held force transducer with a plastic tip. The plastic tip of the force transducer is applied to the medial plantar surface for examination of the saphenous nerve and to the lateral plantar surface for examination of the sciatic nerve (peroneal nerve).

[0221] Thermal hypersensitivity: Heat hyperalgesia is measured based on a published method modified to use a laser as the heat source. 173 A laser with a wavelength of 808 nm is used as the heat source (output 2 W, beam diameter on the skin 3 mm), and the skin pores related to the nerve to be examined are irradiated. Due to the small beam size, the relevant skin membrane can be specifically targeted. For the sciatic nerve and saphenous nerve, the withdrawal latency of the limbs due to heat stimulation is recorded with a 10-second cut-off point.

[0222] Non-stimulus-induced behavioral test: Gait analysis: Sciatic nerve motor function is evaluated using the DigitGait and Sciatic Nerve Index 172 . Briefly, using the DigitGait developed and optimized in our laboratory and commercially available from the Rodent Behavioral Core, sciatic nerve function is measured before injury and on the 7th, 14th, and 28th days after surgery. The rats are placed on an electric treadmill in a DigitGait holder, set at a speed of 20 cm / sec, and the recordings of all animals are made. The function of the affected hind limb is analyzed by the sciatic nerve index program.

[0223] Place escape / avoidance: This method was devised to test the hypothesis that rats will avoid the environment associated with mechanical stimulation of the hyperalgesic site. It has been reported that injured rats develop sensitivity to changes in escape / avoidance behavior after administration of analgesics (Baastrup et al. 2010). 174 . The brain-dependent escape / avoidance paradigm test was reported by LaBuda and Fuchs (2000) 171 and depends on escape / avoidance learning for a novel avoidance environment. The animals are examined only once by the treating investigator who received the same training 3 - 5 weeks after injury. The test is conducted at the USU Rat Behavior Core. The animals are acclimated to the light and sound environment in the test room for at least 1 hour. In this test, rats are allowed to freely move between the "non-avoidable" dark side and the "avoidable" light side of an enclosed room with a mesh floor, and can be easily accessed from below with von Frey filaments. When the rat is in the dark place, either the injured hind limb or, when in the bright place, the uninjured hind limb is routinely stimulated. Mechanical stimuli (von Frey filaments) sufficient to elicit a withdrawal response in the injured forepaw are applied to the outer plantar surface of one hind paw every 15 seconds for 30 minutes, depending on the position of the animal during that time. Escape-avoidance behavior is defined as movement from the dark to the light area. The proportion of time spent on the white side of the box and the number of times of going back and forth between the black and white sides are recorded. The cumulative time on the white side and the total number of crossings are used as indices of escape-avoidance learning.

[0224] Euthanasia: For morphological and immunohistochemical analysis, rats are anesthetized with ketamine / xylazine (80 - 100 mg / kg + 10 mg / kg, i.p., 21-gauge needle), and then perfused transcardially with 300 ml of phosphate-buffered saline (pH 7.4) followed by 300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer. After perfusion, the nerves, DRGs, and spinal cord are dissected, post-fixed in 4% paraformaldehyde for 24 hours, and cryoprotected with 30% sucrose for 24 hours. Tissue samples are cut into 10-μm sections using a cryostat (Leica CM3050 S, Leica Biosystems, Wetzlar, Germany).

[0225] Histology: After euthanasia and nerve collection, the sections are stained with hematoxylin and eosin dyes. The expression levels and distributions of OPRM1, Na V 1.8, K V 4.3, K V 7.2 are evaluated by immunofluorescence.

[0226] Gene expression analysis: For gene expression analysis of the sciatic nerve and related DRGs and spinal cord segments, the REST target genes OPRM1, Na V 1.8, K V 4.3, K V7.2, and control genes (Hprt, Gapd, Rn18s) are evaluated by qRT-PCR.

[0227] Protein expression analysis: Protein expression analysis of sciatic nerve-related DRG is performed for OPRM1, Na V 1.8, K V 4.3, K V 7.2 by SDS-PAGE immunoblotting. GAPDH is used as a loading control.

[0228] Statistical approach: For behavioral data, the results are presented as mean ± standard error of the mean (SEM). Two-way ANOVA is used to evaluate the animal groups based on the time after treatment. The Bonferroni-Holm method is used for the adjustment of multiple comparisons. Two-sided statistical significance is established as P < 0.05. In immunohistochemical analysis, two-way ANOVA is used to compare the means of not only the group and time effects but also the interaction. In the case of qRT-PCR, the values are reported as mean ± standard error of the mean (SEM). The statistically significant drug effect on gene expression is determined by one-way ANOVA using Tukey's multiple comparison test.

[0229] The outline of the experimental procedure for the second phase is as shown in Table 18 below.

[0230]

Table 20

[0231] In the second phase, the persistence of pain reduction of RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides fused to CPP (SEQ ID NO: 118 - 137 and 140 - 159) is examined. In this study, RPP (SEQ ID NO: 1 and 15 - 17) or RPP V(SEQ ID NOs: 18 - 117) The dose of the peptide (low, medium, high) and the drug administration period (14 or 28 days) used are those determined to be the most effective in the first phase. The same methodology as in the above-mentioned first-phase efficacy test is implemented. After the end of the drug administration period (14 days or 28 days), the pain response and motor function of the rats are monitored every other day for 30 days for behavioral evaluation, which is different. The rats are euthanized on the 30th day. A total of 722 months-old SD rats (equal numbers of males and females) are required for this test. The sample size of 12 rats per group has 80% power to detect a difference of 1.20 standard deviations in the evaluation of pain. The power analysis was based on an independent samples t-test and was performed at a 5% (two-sided significance level). The rats are randomly assigned to the experimental groups in the right table. For each of the randomly assigned 10 groups of rats, stimulated and non-stimulated behavioral tests, morphological, immunohistochemical analysis, quantitative RT-PCR (qRT-PCR) analysis, and WB analysis are performed.

[0232] [Objective 3]: RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V Toxicological and safety pharmacological evaluation of the peptide (SEQ ID NOs: 18 - 117)

[0233] To support human first-injection, as recommended by FDA guidance M3(R2), S2B, S6(R1), S7A, S7B 175 - 179, in two species, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V Perform in vitro cardiac and genotoxicity and in vivo toxicity, safety pharmacology, and toxicokinetics evaluations of the peptide (SEQ ID NOs: 18 - 117). For both species, the administration route is selected based on the results of the PK evaluation in Objective 1.

[0234] [Sub - objective 3.1] Single - dose range - finding study in monkeys: Evaluate 4 dose levels + vehicle control in 3 monkeys / sex / group. It is necessary to identify the MTD, MFD, and / or exposure saturation for HD. The low doses are administered in 1 / 3 increments. Blood is collected at 6 time points (to be determined based on the PK data collected in Objective 1), and C max , AUC, t 1 / 2 are evaluated. Daily, survival rate and clinical signs are evaluated.

[0235] [Sub - objectives 3.2 and 3.3] Toxicity studies using rats (3.2) and monkeys (3.3): The administration period is 4 weeks for both species, supporting the administration period in humans and a 6 - week recovery period. The administration period is selected from the high stability of rpp observed in cell assays. Use 3 dose levels + vehicle control. The high dose is the maximum tolerated volume confirmed in the dose - range - finding studies (rats in Objective 1.2 and monkeys in Objective 3.1). The MD is 1 / 3 lower than the HD value from the AUC in the range - finding study. The LD approximates the effective dose in the in - vivo efficacy study (Objective 2). The dosing interval is, for each species, the t V of the RPP (SEQ ID NO: 1 and 15 - 17) or RPP 1 / 2 fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159). In the rat study, there are 15 / sex / group. At the end of the administration period, 10 / sex / group are sacrificed, and at the end of the recovery period, 5 / sex / vehicle are sacrificed. Additionally, 9 / sex / rpp group and 3 / sex / vehicle group are assigned to the toxicokinetic part of this study. In the monkey study, perform toxicology testing and TK testing on all animals (3 / sex / group in this study, 2 / sex / group during the recovery period). Evaluate the following toxicological parameters in both species: Clinical observations, body weight, food intake, ophthalmic examinations (fundus examination and slit - lamp examination), and a standard battery of clinical chemistry, visceral weights, and histological parameters are evaluated.

[0236] Monkeys have non - surgical remote measurement functions 179 as recommended in FDA guidance S7A179 Respiration (tidal volume, hemoglobin oxygen saturation, etc.) measured using and the electrocardiogram recording will be evaluated. Cardiovascular system evaluation will be performed twice, before treatment, after the first dose, and at the end of the recovery period (if necessary). The records will be qualitatively evaluated by a consulting cardiologist. All waveforms will be qualitatively evaluated to detect rhythm or conduction disorders, including evaluation of the PR and QRS intervals. 179,180 Rats will be used to evaluate central nervous system function using the modified Irwin's Functional Observation Battery max TK evaluation from plasma (C 1 / 2 , AUC, t

[0237] [Sub - objective 3.4] In - vitro hERG assay 177 : Inhibition of the hERG channel is a common cause of the QT - prolongation syndrome and is also correlated with arrhythmias that can cause ventricular fibrillation and sudden cardiac death. To examine whether the RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides fused with CPP (SEQ ID NO: 118 - 137 and 140 - 159) inhibit hERG channel current, electrophysiological evaluation of hERG channel current will be performed in CHO cells treated with the RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptide (10 μM) or positive control (cisapride, 0.03 μM) at high concentrations of CPP (SEQ ID NO: 118 - 137 and 140 - 159). Each cell will function as its own positive control. Whole - cell recordings will be performed using conventional voltage - clamp techniques.

[0238] [Sub - objective 3.5] Genotoxicity: The RPP (SEQ ID NO: 1 and 15 - 17) or RPP V (SEQ ID NO: 18 - 117) peptides fused with CPP (SEQ ID NO: 118 - 137 and 140 - 159) will be evaluated in - vitro using OECD - compliant Ames and in - vitro chromosomal aberration assay (S2B, November 1997) 176 to determine genotoxicity.

[0239] [Objective 4]: Assessment of the potential for abuse of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides

[0240] Since the expression of opioid receptor genes is suppressed by REST, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides may enhance the ligand effects of endogenous opioid receptors such as endorphins. 181,182 Furthermore, recent studies have shown that the expression of REST increases in DRG and PAG (Periaqueductal gray area) under pain - associated conditions. 183,184 . To examine whether RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides induce reward - seeking behavior, the conditioned place preference (CPP) of the behavioral assay widely used to examine the rewarding properties of drugs is used to evaluate the effects on rats. 185-189 The CPP test is an established method that demonstrated morphine reward - seeking behavior in the SNI animal model.

[0241] First, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides are administered (route undetermined) to naive rats, and the CPP test is performed. To achieve consistency with Objective 2, oxycodone is used instead of morphine as a positive control, and saline is injected into another group of rats as a negative control.

[0242] The device consists of three compartments. The two outer compartments are designed to have different characteristics (e.g., white wall and black wall), and the central compartment has no special characteristics. Each test consists of three phases. [Phase I Pretest (Day 1)]: After administering saline, place the rats in the central compartment and open the gate to allow them to move between the other compartments. Monitor the rats for 15 minutes and determine the baseline preference by recording the time spent in each room. The average spontaneous preference time for the compartments is determined. Rats that spend more than 60% of the test time in one room are judged to be biased and excluded from the experiment. [Phase II Conditioning (Days 2 - 7)]: Administer vehicle or RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) to the rats, and then randomly assign / condition one compartment to receive RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) and the other compartment to receive vehicle. The dose of RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptides fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) is determined based on the concentration that produces a measurable effect on mechanical and thermal hyperalgesia as determined in Objective 2. The treatment compartments and administration order of the drug and vehicle are balanced across all groups to avoid bias. In this phase, six consecutive 30 - minute conditioning sessions are performed. Also, conditioning with oxycodone is performed in another group. [Phase III Test (Day 8)]: The difference between the time spent in the drug - paired compartment during post - conditioning and the time spent during pre - conditioning is determined for RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V(SEQ ID NOs: 18 - 117) Used to evaluate the degree of place conditioning induced by the peptide 190 .

[0243] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) The peptide is evaluated using 8 groups of 12 injured rats (SNI vs sham; oxycodone, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptide, and conditioning with saline). The sample size of 12 rats per group has 80% power to detect a difference of 1.20 standard deviations in pain assessment. The power analysis is based on an independent samples t - test with a 5%, two - sided significance level. Rats are randomly assigned to the experimental groups. Rats are randomly assigned to receive SNI or sham surgery. The von Frey test is performed 1 day before injury, 4 days after injury, and 8 days after injury to observe the pain state. The CPP test is performed on day 8 after injury as described above. The researcher conducting the behavioral test is blinded to which experimental / control group the rat was randomly assigned to. Each animal is assigned a unique animal number. A secret color code is used to designate the control and experimental groups. This code is revealed only after analysis. The animals are euthanized and the samples are analyzed as described in Objective 2.

[0244] [Predicted Results and Alternatives] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V (SEQ ID NOs: 18 - 117) peptide is predicted to lower the REST level of damaged neurons and appropriately restore the expression of ion channels required for excitability. At the behavioral level, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V(SEQ ID NOs: 18 - 117) The peptide should return the stimulated or unstimulated induced behavioral tests of SNI rats to baseline. Furthermore, from its mechanism of action, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) The peptide is not considered to be toxic. However, if abuse potential is indicated by drug administration, RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V Confirm this positive result with a progressive ratio (PR) schedule of reinforcement during administration of the (SEQ ID NOs: 18 - 117) peptide.

[0245] [Example 15 - RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) The peptide can be used to prevent recurrence of glioblastoma multiforme (GBM).

[0246] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V Evaluate the (SEQ ID NOs: 18 - 117) peptide for its effects on brain tumor initiating cells (BTIC) and its neurogenic and anti - cancer efficacy in vivo.

[0247] Test article (RPP (SEQ ID NOs: 1 and 15 - 17) or RPP fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) V (SEQ ID NOs: 18 - 117) peptide) activity is evaluated in primary cultured BTICs derived from 10 grade IV GBM patients obtained at the Mayo Clinic by the method we established 191-193 and obtained at the Mayo Clinic. Cells (0.25×10 4Plate them in medium (250 μL), and administer 5 μL of vehicle or three dose levels of the test article within the optimal dose range (determined in the neuronal differentiation assay described in Example 13) for 0, 2, 4, or 8 days (this test), and then wash out the test article and allow to recover for 8 days (recovery period). Markers for pluripotency (Sox2 and Nestin), proliferation (Ki67), cell death (caspase 3), and differentiation (MAP2, neurons, and GFAP, glia) are monitored by WB and RT-PCR on days 0, 2, 4, 8 of the administration period (this test) and days 10, 13, 16 of the recovery period (3 / TC well / group per day).

[0248] Primary cultured BTICs obtained from 10 grade IV GBM patients are used in the intracranial xenograft nude mouse model as previously described by us and others. 191,192,194 . Briefly, cells (5×10 4 ) are suspended in 5 μL of PBS (control) or PBS containing any of the dose levels of three TBDs (based on the above BTIC neurogenic assay) and administered using an automated syringe pump with a guide screw system 112,195 . The injection coordinates are X: 1.5; Y: 1.34; Z: -3.5, targeting the striatum of mice with high reliability of tumor engraftment 196 . Mice were measured for survival rates at weeks 4, 8, 16, 20 using the Kaplan-Meier method 197 and then tumor size and invasiveness (H&E staining), cell death (TUNEL), and proliferation (anti-human nucleus) were evaluated by postmortem histopathology (3 / sex / group for all treatments).

[0249] Statistical methods: Numerical values are presented as mean ± standard error of the mean (SEM) or standard deviation (SD). Statistical significance is determined by applying the appropriate parametric or non-parametric Student's t-test or one-way analysis of variance (ANOVA). Briefly, the ratios of total REST to phosphorylated REST in different control and drug candidate treatments are statistically verified using the Kruskal-Wallis test. Differences in marker expression between BTIC control and cultures of drug candidates and xenografts are statistically tested using Tukey's multiple comparison test. Differences in tumor size and invasiveness between mice injected with BTICs administered control or test substances are statistically tested by Mann-Whitney U test, and differences in survival rates are tested by log-rank test and Cox proportional hazards test 198 statistically.

[0250] [Predicted Results] At each time point, mice with xenografts of test substances administered BTICs are expected to have no tumors or less invasive tumors, more cell death (TUNEL), and less GBM proliferation (anti-human nucleus) compared to controls. Also, mice administered test substances and BTICs are expected to have an extended survival period compared to BTICs alone.

[0251] [Materials and Methods] [Test System] [Cells] Primary culture brain tumor initiating cells (BTICs) were obtained from 10 patients with grade IV GBM. Methods for extraction and propagation of BTICs have already been described by Dr. Alfredo Quinones-Hinojosa and his research team 191-193 . [Species / Strain] Nu / nu Harlan Sprague Dawley mice [Age] 6 weeks at the start of the test [Body Weight] At the start of the test Male: 20 - 30 g, Female: 18 - 35 g

[0252] [Test Substance Identification] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V fused to CPP (SEQ ID NOs: 118 - 137 and 140 - 159) [Purity] 95% or higher by HPLC [Preparation and Stability of Dosage Form] RPP (SEQ ID NOs: 1 and 15 - 17) or RPP V(SEQ ID NOs: 18 to 117) Peptides and vehicle controls are prepared weekly in batches. The concentration of the dosage form is evaluated at the beginning of each week. The acceptable concentration range is ±10% of the nominal value. [Vehicle] Water

[0253] [Research Plan] [Neurogenic Test Content of Test Substance] [Dosage] Three dosage levels of test substance + vehicle control. The dosage of the test substance is determined based on the results of the neuronal differentiation test described in Example 11. [Administration] Administration is carried out every other day while changing the medium. [Duration] This test: 0, 2, 4, 8 days; Recovery period: 2, 5, 8 days. [Number of Replicates] Three tissue culture (TC) wells per group. [Dosage] 5 μL [Analysis Parameters] Markers for pluripotency (Sox2, Nestin), proliferation (Ki67), cell death (caspase 3), and differentiation (MAP2, neurons, GFAP, glia) are monitored by WB and RT-PCR on days 0, 2, 4, 8 of the administration period (this test) and days 10, 13, 16 of the recovery period (3 / TC well / group per day) (Table 10).

[0254]

Table 21

[0255] [Anticancer Effect of Test Substance Against BTIC in Mice] [Dosage] Three dosage levels of test substance + vehicle control. The dosage of the test substance is determined based on the results of the neurogenic test. [Frequency of Administration] Single administration [Route] Automatic syringe pump via a guide screw system 112,195 . The injection coordinates are X: 1.5; Y: 1.34; Z: -3.5, targeting the striatum of the mouse, which is a highly reliable site for tumor engraftment. 196 . [Vehicle] Phosphate Buffered Saline (PBS) [Number of animals] 3 / gender / group [Dosage] 5 μL [Analysis parameters] For mice, the survival rate was measured using the Kaplan-Meier method at 4, 8, 16, and 20 weeks. 197 After that, the tumor size, invasiveness (H&E staining), cell death (TUNEL), and proliferation (anti-human nucleus) were evaluated by postmortem histopathology (Table 11).

[0256]

Table 22

[0257] [Environmental conditions] [Housing] 2 animals / cage, 12-hour light-dark cycle. [Diet] Diet and water are available ad libitum.

[0258] The sequences of SEQ ID NOs: 1 to 324 are shown in Table 19 below.

[0259]

Table 23-1

[0260]

Table 23-2

[0261]

Table 23-3

[0262]

Table 23-4

[0263]

Table 23-5

[0264]

Table 23-6

[0265]

Table 23-7

[0266]

Table 23-8

[0267]

Table 23-9

[0268]

Table 23-10

[0269]

Table 23-11

[0270]

Table 23-12

[0271] Although specific presently preferred embodiments of the present invention have been specifically described herein, it will be apparent to those skilled in the art to which the present invention pertains that various modifications and variations of the embodiments shown and described herein can be made without departing from the spirit and scope of the present invention.

[0272] [References (excluding the specification and examples)] 1 Bruce, A. W. et al. Genome-wide analysis of repressor element 1 silencing transcription factor / neuron-restrictive silencing factor (REST / NRSF) target genes. Proc Natl Acad Sci U S A 101, 10458-10463, doi:10.1073 / pnas.04018271010401827101 [pii] (2004). 2 Nesti, E., Corson, G. M., McCleskey, M., Oyer, J. A. & Mandel, G. C-terminal domain small phosphatase 1 and MAP kinase reciprocally control REST stability and neuronal differentiation. Proc Natl Acad Sci U S A 111, E3929-3936, doi:1414770111 [pii]10.1073 / pnas.1414770111 (2014). 3 Nesti, E. METHODS AND COMPOSITIONS USEFUL IN MANIPULATING THE STABILITY OF RE1 SILENCING TRANSCRIPTION FACTOR. US, PTC patent (2014, 2015). 4 Nesti, E. Harnessing the master transcriptional repressor REST to reciprocally regulate neurogenesis.. Neurogenesis 2, doi:10.1080 / 23262133.2015.1055419 (2015). 5 Calderone, A. et al. Ischemic insults derepress the gene silencer REST in neurons destined to die. J Neurosci 23, 2112-2121, doi:23 / 6 / 2112 [pii] (2003). 6 Kaneko, N., Hwang, J. Y., Gertner, M., Pontarelli, F. & Zukin, R. S. Casein kinase 1 suppresses activation of REST in insulted hippocampal neurons and halts ischemia-induced neuronal death. J Neurosci 34, 6030-6039, doi:34 / 17 / 6030 [pii]10.1523 / JNEUROSCI.4045-13.2014 (2014). 7 Noh, K. M. et al. Repressor element-1 silencing transcription factor (REST)- dependent epigenetic remodeling is critical to ischemia-induced neuronal death. Proc Natl Acad Sci U S A 109, E962-971, doi:1121568109 [pii]10.1073 / pnas.1121568109 (2012). 8 Abe, K. Therapeutic potential of neurotrophic factors and neural stem cells against ischemic brain injury. J Cereb Blood Flow Metab 20, 1393-1408, doi:10.1097 / 00004647-200010000-00001 (2000). 9 Kan Ding, P. K. G., and Ramon Diaz-Arrastia. in Translational Research in Traumatic Brain Injury (ed Grant G Laskowitz D) Ch.14, (Taylor and Francis, 2016). 10 Pasquina, P., Kirtley, R. & Ling, G. Moderate-to-severe traumatic brain injury. Semin Neurol 34, 572-583, doi:10.1055 / s-0034-1396010 (2014). 11 Hwang, J. Y., Kaneko, N., Noh, K. M., Pontarelli, F. & Zukin, R. S. The gene silencing transcription factor REST represses miR-132 expression in hippocampal neurons destined to die. J Mol Biol 426, 3454-3466, doi:10.1016 / j.jmb.2014.07.032 (2014). 12 McClelland, S. et al. The transcription factor NRSF contributes to epileptogenesis by selective repression of a subset of target genes. Elife 3, e01267 (2014). 13 Lu, T. et al. REST and stress resistance in ageing and Alzheimer's disease. Nature 507, 448-454, doi:nature13163 [pii]10.1038 / nature13163 (2014). 14 Orta-Salazar, E. et al. REST / NRSF-induced changes of ChAT protein expression in the neocortex and hippocampus of the 3xTg-AD mouse model for Alzheimer's disease. Life sciences 116, 83-89, doi:10.1016 / j.lfs.2014.09.013 (2014). 15 Sharp, D. J., Scott, G. & Leech, R. Network dysfunction after traumatic brain injury. Nat Rev Neurol 10, 156-166, doi:10.1038 / nrneurol.2014.15 (2014). 16 Roopra, A., Dingledine, R. & Hsieh, J. Epigenetics and epilepsy. Epilepsia 53 Suppl 9, 2-10, doi:10.1111 / epi.12030 (2012). 17 Bergsland, M., Covacu, R., Perez Estrada, C., Svensson, M. & Brundin, L. Nitric oxide-induced neuronal to glial lineage fate-change depends on NRSF / REST function in neural progenitor cells. Stem Cells 32, 2539-2549, doi:10.1002 / stem.1749 (2014). 18 Conaco, C., Otto, S., Han, J. J. & Mandel, G. Reciprocal actions of REST and a microRNA promote neuronal identity. Proc Natl Acad Sci U S A 103, 2422-2427, doi:0511041103 [pii]10.1073 / pnas.0511041103 (2006). 19 Covey, M. V., Streb, J. W., Spektor, R. & Ballas, N. REST regulates the pool size of the different neural lineages by restricting the generation of neurons and oligodendrocytes from neural stem / progenitor cells. Development 139, 2878-2890, doi:dev.074765 [pii]10.1242 / dev.074765 (2012). 20 Gao, Z. et al. The master negative regulator REST / NRSF controls adult neurogenesis by restraining the neurogenic program in quiescent stem cells. J Neurosci 31, 9772-9786, doi:31 / 26 / 9772 [pii]10.1523 / JNEUROSCI.1604-11.2011 (2011). 21 Kohyama, J. et al. BMP-induced REST regulates the establishment and maintenance of astrocytic identity. J Cell Biol 189, 159-170, doi:jcb.200908048 [pii]10.1083 / jcb.200908048 (2010). 22 Mandel, G. et al. Repressor element 1 silencing transcription factor (REST) controls radial migration and temporal neuronal specification during neocortical development. Proc Natl Acad Sci U S A 108, 16789-16794, doi:1113486108 [pii]10.1073 / pnas.1113486108 (2011). 23 Vincent, A. S., Roebuck-Spencer, T. M. & Cernich, A. Cognitive changes and dementia risk after traumatic brain injury: implications for aging military personnel. Alzheimers Dement 10, S174-187, doi:10.1016 / j.jalz.2014.04.006 (2014). 24 Kirn, J. R. The relationship of neurogenesis and growth of brain regions to song learning. Brain Lang 115, 29-44, doi:S0093-934X(09)00135-7 [pii]10.1016 / j.bandl.2009.09.006 (2010). 25 Oomen, C. A., Bekinschtein, P., Kent, B. A., Saksida, L. M. & Bussey, T. J. Adult hippocampal neurogenesis and its role in cognition. Wiley Interdiscip Rev Cogn Sci 5, 573-587, doi:10.1002 / wcs.1304 (2014). 26 Samuels, I. S. et al. Deletion of ERK2 mitogen-activated protein kinase identifies its key roles in cortical neurogenesis and cognitive function. J Neurosci 28, 6983-6995, doi:28 / 27 / 6983 [pii]10.1523 / JNEUROSCI.0679-08.2008 (2008). 27 Shors, T. J. et al. Neurogenesis in the adult is involved in the formation of trace memories. Nature 410, 372-376, doi:10.1038 / 35066584 (2001). 28 Villeda, S. A. et al. The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature 477, 90-94, doi:10.1038 / nature10357 (2011). 29 Bird, C. M. & Burgess, N. The hippocampus supports recognition memory for familiar words but not unfamiliar faces. Curr Biol 18, 1932-1936, doi:10.1016 / j.cub.2008.10.046 (2008). 30 T.J. Shors, G. M., A. Beylin, M. Zhao, T. Rydel, E. Gould. Neurogenesis in the adult is involved in the formation of trace memories. Nature 410, 372-376 (2001). 31 VanElzakker, M., Fevurly, R. D., Breindel, T. & Spencer, R. L. Environmental novelty is associated with a selective increase in Fos expression in the output elements of the hippocampal formation and the perirhinal cortex. Learn Mem 15, 899-908, doi:10.1101 / lm.1196508 (2008). 32 Thornton, G. K. & Woods, C. G. Primary microcephaly: do all roads lead to Rome? Trends Genet 25, 501-510, doi:10.1016 / j.tig.2009.09.011 (2009). 33 Ghaziuddin, M., Zaccagnini, J., Tsai, L. & Elardo, S. Is megalencephaly specific to autism? J Intellect Disabil Res 43 (Pt 4), 279-282 (1999). 34 Kuhn, H. G., Cooper-Kuhn, C. M., Boekhoorn, K. & Lucassen, P. J. Changes in neurogenesis in dementia and Alzheimer mouse models: are they functionally relevant? Eur Arch Psychiatry Clin Neurosci 257, 281-289, doi:10.1007 / s00406-007-0732-4 (2007). 35 Baker, M. Tumours spark stem-cell review. Nature 457, 941, doi:10.1038 / 457941a (2009). 36 Brederlau, A. et al. Transplantation of human embryonic stem cell-derived cells to a rat model of Parkinson's disease: effect of in vitro differentiation on graft survival and teratoma formation. Stem Cells 24, 1433-1440, doi:2005-0393 [pii]10.1634 / stemcells.2005-0393 (2006). 37 Burns, T. C., Verfaillie, C. M. & Low, W. C. Stem cells for ischemic brain injury: a critical review. J Comp Neurol 515, 125-144, doi:10.1002 / cne.22038 (2009). 38 Carlson, A. P., Schermer, C. R. & Lu, S. W. Retrospective evaluation of anemia and transfusion in traumatic brain injury. J Trauma 61, 567-571, doi:10.1097 / 01.ta.0000231768.44727.a200005373-200609000-00007 [pii] (2006). 39 Carmeliet, P. & Storkebaum, E. Vascular and neuronal effects of VEGF in the nervous system: implications for neurological disorders. Semin Cell Dev Biol 13, 39- 53, doi:10.1006 / scdb.2001.0290S1084952101902903 [pii] (2002). 40 Choe, Y., Kozlova, A., Graf, D. & Pleasure, S. J. Bone morphogenic protein signaling is a major determinant of dentate development. J Neurosci 33, 6766- 6775, doi:33 / 16 / 6766 [pii]10.1523 / JNEUROSCI.0128-13.2013 (2013). 41 Erdo, F. et al. Host-dependent tumorigenesis of embryonic stem cell transplantation in experimental stroke. J Cereb Blood Flow Metab 23, 780-785, doi:10.1097 / 01.WCB.0000071886.63724.FB (2003). 42 Greig, N. H. et al. Incretin mimetics as pharmacologic tools to elucidate and as a new drug strategy to treat traumatic brain injury. Alzheimers Dement 10, S62-75, doi:S1552-5260(13)02925-7 [pii]10.1016 / j.jalz.2013.12.011 (2014). 43 Kaplan, G. B., Vasterling, J. J. & Vedak, P. C. Brain-derived neurotrophic factor in traumatic brain injury, post-traumatic stress disorder, and their comorbid conditions: role in pathogenesis and treatment. Behav Pharmacol 21, 427-437, doi:10.1097 / FBP.0b013e32833d8bc9 (2010). 44 Knoepfler, P. S. Deconstructing stem cell tumorigenicity: a roadmap to safe regenerative medicine. Stem Cells 27, 1050-1056, doi:10.1002 / stem.37 (2009). 45 Luca Longhia,, Elisa R. Zaniera, Nicolas Royob, Nino Stocchettia, Tracy K. McIntosha. Stem cell transplantation as a therapeutic strategy for traumatic brain injury. Transplant Immunology 15, 134-148 (2005). 46 Robertson, C. S. et al. Effect of erythropoietin and transfusion threshold on neurological recovery after traumatic brain injury: a randomized clinical trial. JAMA 312, 36-47, doi:1884575 [pii]10.1001 / jama.2014.6490 (2014). 47 Salim, A. et al. Role of anemia in traumatic brain injury. J Am Coll Surg 207, 398- 406, doi:S1072-7515(08)00322-0 [pii]10.1016 / j.jamcollsurg.2008.03.013 (2008). 48 Deng, W., Aimone, J. B. & Gage, F. H. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat Rev Neurosci 11, 339-350, doi:nrn2822 [pii]10.1038 / nrn2822 (2010). 49 Goldman, S. A. & Nottebohm, F. Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Natl Acad Sci U S A 80, 2390-2394 (1983). 50 Gould, E., Beylin, A., Tanapat, P., Reeves, A. & Shors, T. J. Learning enhances adult neurogenesis in the hippocampal formation. Nat Neurosci 2, 260-265, doi:10.1038 / 6365 (1999). 51 Kirn, J. R. & Nottebohm, F. Direct evidence for loss and replacement of projection neurons in adult canary brain. J Neurosci 13, 1654-1663 (1993). 52 Mu, Y. & Gage, F. H. Adult hippocampal neurogenesis and its role in Alzheimer's disease. Mol Neurodegener 6, 85, doi:1750-1326-6-85 [pii]10.1186 / 1750-1326-6-85 (2011). 53 Pytte, C. L., Gerson, M., Miller, J. & Kirn, J. R. Increasing stereotypy in adult zebra finch song correlates with a declining rate of adult neurogenesis. Dev Neurobiol 67, 1699-1720, doi:10.1002 / dneu.20520 (2007). 54 Scharff, C., Kirn, J. R., Grossman, M., Macklis, J. D. & Nottebohm, F. Targeted neuronal death affects neuronal replacement and vocal behavior in adult songbirds. Neuron 25, 481-492, doi:S0896-6273(00)80910-1 [pii] (2000). 55 Seib, D. R. et al. Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell 12, 204-214, doi:S1934- 5909(12)00644-3 [pii]10.1016 / j.stem.2012.11.010 (2013). 56 Deister, C. & Schmidt, C. E. Optimizing neurotrophic factor combinations for neurite outgrowth. J Neural Eng 3, 172-179, doi:10.1088 / 1741-2560 / 3 / 2 / 011 (2006). 57 Zhao, Y. et al. Brain REST / NRSF Is Not Only a Silent Repressor but Also an Active Protector. Mol Neurobiol 54, 541-550, doi:10.1007 / s12035-015-9658-4 (2017). 58 Uchida, H., Ma, L. & Ueda, H. Epigenetic Gene Silencing Underlies C-Fiber Dysfunctions in Neuropathic Pain. Journal of Neuroscience 30, 4806-4814, doi:10.1523 / JNEUROSCI.5541-09.2010 (2010). 59 Rose, K. et al. Transcriptional repression of the M channel subunit Kv7.2 in chronic nerve injury. Pain 152, 742-754, doi:10.1016 / j.pain.2010.12.028 (2011). 60 Costigan, M. et al. Multiple chronic pain states are associated with a common amino acid-changing allele in KCNS1. Brain 133, 2519-2527, doi:10.1093 / brain / awq195 (2010). 61 Ueda, H. et al. A mimetic of the mSin3-binding helix of NRSF / REST ameliorates abnormal pain behavior in chronic pain models. Bioorg Med Chem Lett 27, 4705- 4709, doi:10.1016 / j.bmcl.2017.09.006 (2017). 62 Zhang, J., Chen, S. R., Chen, H. & Pan, H. L. RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons. J Biol Chem 293, 19078-19091, doi:10.1074 / jbc.RA118.005846 (2018). 63 Banerjee, P. N., Filippi, D. & Allen Hauser, W. The descriptive epidemiology of epilepsy-a review. Epilepsy Res 85, 31-45, doi:10.1016 / j.eplepsyres.2009.03.003 (2009). 64 Mucha, M. et al. Transcriptional control of KCNQ channel genes and the regulation of neuronal excitability. J Neurosci 30, 13235-13245, doi:10.1523 / JNEUROSCI.1981-10.2010 (2010). 65 Escayg, A. et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet 24, 343-345, doi:10.1038 / 74159 (2000). 66 Martin, D. et al. REST represses a subset of the pancreatic endocrine differentiation program. Dev Biol 405, 316-327, doi:10.1016 / j.ydbio.2015.07.002 (2015). 67 Abderrahmani, A. et al. Neuronal traits are required for glucose-induced insulin secretion. FEBS Lett 565, 133-138, doi:10.1016 / j.febslet.2004.04.002 (2004). 68 Martin, D. et al. Functional significance of repressor element 1 silencing transcription factor (REST) target genes in pancreatic beta cells. Diabetologia 51, 1429-1439, doi:10.1007 / s00125-008-0984-1 (2008). 69 Rigamonti, D. et al. Loss of huntingtin function complemented by small molecules acting as repressor element 1 / neuron restrictive silencer element silencer modulators. J Biol Chem 282, 24554-24562, doi:10.1074 / jbc.M609885200 (2007). 70 Sipione, S. et al. Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses. Hum Mol Genet 25, 210, doi:10.1093 / hmg / ddv416 (2016). 71 Zuccato, C. et al. Huntingtin interacts with REST / NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nat Genet 35, 76-83, doi:10.1038 / ng1219 (2003). 72 Bao, S. et al. Targeting cancer stem cells through L1CAM suppresses glioma growth. Cancer Res 68, 6043-6048, doi:10.1158 / 0008-5472.CAN-08-1079 (2008). 73 Jackson, M., Hassiotou, F. & Nowak, A. Glioblastoma stem-like cells: at the root of tumor recurrence and a therapeutic target. Carcinogenesis 36, 177-185, doi:10.1093 / carcin / bgu243 (2015). 74 Liu, G. et al. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma. Mol Cancer 5, 67, doi:10.1186 / 1476-4598-5-67 (2006). 75 Persano, L., Rampazzo, E., Basso, G. & Viola, G. Glioblastoma cancer stem cells: role of the microenvironment and therapeutic targeting. Biochem Pharmacol 85, 612-622, doi:10.1016 / j.bcp.2012.10.001 (2013). 76 Conti, L. et al. REST controls self-renewal and tumorigenic competence of human glioblastoma cells. PLoS One 7, e38486, doi:10.1371 / journal.pone.0038486 (2012). 77 Kamal, M. M. et al. REST regulates oncogenic properties of glioblastoma stem cells. Stem Cells 30, 405-414, doi:10.1002 / stem.1020 (2012). 78 Wagoner, M. P. & Roopra, A. A REST derived gene signature stratifies glioblastomas into chemotherapy resistant and responsive disease. BMC Genomics 13, 686, doi:10.1186 / 1471-2164-13-686 (2012). 79 Taylor, P. et al. REST is a novel prognostic factor and therapeutic target for medulloblastoma. Mol Cancer Ther 11, 1713-1723, doi:10.1158 / 1535-7163.MCT- 11-0990 (2012). 80 Jin, H. et al. Identification of RE1-Silencing Transcription Factor as a Promoter of Metastasis in Pancreatic Cancer. Front Oncol 9, 291, doi:10.3389 / fonc.2019.00291 (2019).

[0273] References (Examples only) 1 Bruce, A. W. et al. Genome-wide analysis of repressor element 1 silencing transcription factor / neuron-restrictive silencing factor (REST / NRSF) target genes. Proc Natl Acad Sci U S A 101, 10458-10463, doi:10.1073 / pnas.04018271010401827101 [pii] (2004). 2 Nesti, E., Corson, G. M., McCleskey, M., Oyer, J. A. & Mandel, G. C-terminal domain small phosphatase 1 and MAP kinase reciprocally control REST stability and neuronal differentiation. Proc Natl Acad Sci U S A 111, E3929-3936, doi:1414770111 [pii]10.1073 / pnas.1414770111 (2014). 3 Nesti, E. METHODS AND COMPOSITIONS USEFUL IN MANIPULATING THE STABILITY OF RE1 SILENCING TRANSCRIPTION FACTOR. US, PTC patent (2014, 2015). 4 Nesti, E. Harnessing the master transcriptional repressor REST to reciprocally regulate neurogenesis.. Neurogenesis 2, doi:10.1080 / 23262133.2015.1055419 (2015). 5 Arranz-Gibert, P. et al. Immunosilencing peptides by stereochemical inversion and sequence reversal: retro-D-peptides. Sci Rep 8, 6446, doi:10.1038 / s41598-018-24517-6 (2018). 6 Hall, E. D., Bryant, Y. D., Cho, W. & Sullivan, P. G. Evolution of post-traumatic neurodegeneration after controlled cortical impact traumatic brain injury in mice and rats as assessed by the de Olmos silver and fluorojade staining methods. J Neurotrauma 25, 235- 247, doi:10.1089 / neu.2007.0383 (2008). 7 Calderone, A. et al. Ischemic insults derepress the gene silencer REST in neurons destined to die. J Neurosci 23, 2112-2121, doi:23 / 6 / 2112 [pii] (2003). 8 Kaneko, N., Hwang, J. Y., Gertner, M., Pontarelli, F. & Zukin, R. S. Casein kinase 1 suppresses activation of REST in insulted hippocampal neurons and halts ischemia-induced neuronal death. J Neurosci 34, 6030-6039, doi:34 / 17 / 6030 [pii]10.1523 / JNEUROSCI.4045- 13.2014 (2014). 9 Noh, K. M. et al. Repressor element-1 silencing transcription factor (REST)-dependent epigenetic remodeling is critical to ischemia-induced neuronal death. Proc Natl Acad Sci U S A 109, E962-971, doi:1121568109 [pii]10.1073 / pnas.1121568109 (2012). 10 Abe, K. Therapeutic potential of neurotrophic factors and neural stem cells against ischemic brain injury. J Cereb Blood Flow Metab 20, 1393-1408, doi:10.1097 / 00004647-200010000- 00001 (2000). 11 Kan Ding, P. K. G., and Ramon Diaz-Arrastia. in Translational Research in Traumatic Brain Injury (ed Grant G Laskowitz D) Ch.14, (Taylor and Francis, 2016). 12 Pasquina, P., Kirtley, R. & Ling, G. Moderate-to-severe traumatic brain injury. Semin Neurol 34, 572-583, doi:10.1055 / s-0034-1396010 (2014). 13 Hwang, J. Y., Kaneko, N., Noh, K. M., Pontarelli, F. & Zukin, R. S. The gene silencing transcription factor REST represses miR-132 expression in hippocampal neurons destined to die. J Mol Biol 426, 3454-3466, doi:10.1016 / j.jmb.2014.07.032 (2014). 14 McClelland, S. et al. The transcription factor NRSF contributes to epileptogenesis by selective repression of a subset of target genes. Elife 3, e01267 (2014). 15 Lu, T. et al. REST and stress resistance in ageing and Alzheimer's disease. Nature 507, 448- 454, doi:nature13163 [pii]10.1038 / nature13163 (2014). 16 Orta-Salazar, E. et al. REST / NRSF-induced changes of ChAT protein expression in the neocortex and hippocampus of the 3xTg-AD mouse model for Alzheimer's disease. Life sciences 116, 83-89, doi:10.1016 / j.lfs.2014.09.013 (2014). 17 Sharp, D. J., Scott, G. & Leech, R. Network dysfunction after traumatic brain injury. Nat Rev Neurol 10, 156-166, doi:10.1038 / nrneurol.2014.15 (2014). 18 Roopra, A., Dingledine, R. & Hsieh, J. Epigenetics and epilepsy. Epilepsia 53 Suppl 9, 2- 10, doi:10.1111 / epi.12030 (2012). 19 Bergsland, M., Covacu, R., Perez Estrada, C., Svensson, M. & Brundin, L. Nitric oxide- induced neuronal to glial lineage fate-change depends on NRSF / REST function in neural progenitor cells. Stem Cells 32, 2539-2549, doi:10.1002 / stem.1749 (2014). 20 Conaco, C., Otto, S., Han, J. J. & Mandel, G. Reciprocal actions of REST and a microRNA promote neuronal identity. Proc Natl Acad Sci U S A 103, 2422-2427, doi:0511041103 [pii]10.1073 / pnas.0511041103 (2006). 21 Covey, M. V., Streb, J. W., Spektor, R. & Ballas, N. REST regulates the pool size of the different neural lineages by restricting the generation of neurons and oligodendrocytes from neural stem / progenitor cells. Development 139, 2878-2890, doi:dev.074765 [pii]10.1242 / dev.074765 (2012). 22 Gao, Z. et al. The master negative regulator REST / NRSF controls adult neurogenesis by restraining the neurogenic program in quiescent stem cells. J Neurosci 31, 9772-9786, doi:31 / 26 / 9772 [pii]10.1523 / JNEUROSCI.1604-11.2011 (2011). 23 Kohyama, J. et al. BMP-induced REST regulates the establishment and maintenance of astrocytic identity. J Cell Biol 189, 159-170, doi:jcb.200908048 [pii]10.1083 / jcb.200908048 (2010). 24 Mandel, G. et al. Repressor element 1 silencing transcription factor (REST) controls radial migration and temporal neuronal specification during neocortical development. Proc Natl Acad Sci U S A 108, 16789-16794, doi:1113486108 [pii]10.1073 / pnas.1113486108 (2011). 25 Vincent, A. S., Roebuck-Spencer, T. M. & Cernich, A. Cognitive changes and dementia risk after traumatic brain injury: implications for aging military personnel. Alzheimers Dement 10, S174-187, doi:10.1016 / j.jalz.2014.04.006 (2014). 26 Kirn, J. R. The relationship of neurogenesis and growth of brain regions to song learning. Brain Lang 115, 29-44, doi:S0093-934X(09)00135-7 [pii]10.1016 / j.bandl.2009.09.006 (2010). 27 Oomen, C. A., Bekinschtein, P., Kent, B. A., Saksida, L. M. & Bussey, T. J. Adult hippocampal neurogenesis and its role in cognition. Wiley Interdiscip Rev Cogn Sci 5, 573- 587, doi:10.1002 / wcs.1304 (2014). 28 Samuels, I. S. et al. Deletion of ERK2 mitogen-activated protein kinase identifies its key roles in cortical neurogenesis and cognitive function. J Neurosci 28, 6983-6995, doi:28 / 27 / 6983 [pii]10.1523 / JNEUROSCI.0679-08.2008 (2008). 29 Shors, T. J. et al. Neurogenesis in the adult is involved in the formation of trace memories. Nature 410, 372-376, doi:10.1038 / 35066584 (2001). 30 Villeda, S. A. et al. The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature 477, 90-94, doi:10.1038 / nature10357 (2011). 31 Bird, C. M. & Burgess, N. The hippocampus supports recognition memory for familiar words but not unfamiliar faces. Curr Biol 18, 1932-1936, doi:10.1016 / j.cub.2008.10.046 (2008). 32 T.J. Shors, G. M., A. Beylin, M. Zhao, T. Rydel, E. Gould. Neurogenesis in the adult is involved in the formation of trace memories. Nature 410, 372-376 (2001). 33 VanElzakker, M., Fevurly, R. D., Breindel, T. & Spencer, R. L. Environmental novelty is associated with a selective increase in Fos expression in the output elements of the hippocampal formation and the perirhinal cortex. Learn Mem 15, 899-908, doi:10.1101 / lm.1196508 (2008). 34 Thornton, G. K. & Woods, C. G. Primary microcephaly: do all roads lead to Rome? Trends Genet 25, 501-510, doi:10.1016 / j.tig.2009.09.011 (2009). 35 Ghaziuddin, M., Zaccagnini, J., Tsai, L. & Elardo, S. Is megalencephaly specific to autism? J Intellect Disabil Res 43 ( Pt 4), 279-282 (1999). 36 Kuhn, H. G., Cooper-Kuhn, C. M., Boekhoorn, K. & Lucassen, P. J. Changes in neurogenesis in dementia and Alzheimer mouse models: are they functionally relevant? Eur Arch Psychiatry Clin Neurosci 257, 281-289, doi:10.1007 / s00406-007-0732-4 (2007). 37 Baker, M. Tumours spark stem-cell review. Nature 457, 941, doi:10.1038 / 457941a (2009). 38 Brederlau, A. et al. Transplantation of human embryonic stem cell-derived cells to a rat model of Parkinson's disease: effect of in vitro differentiation on graft survival and teratoma formation. Stem Cells 24, 1433-1440, doi:2005-0393 [pii]10.1634 / stemcells.2005-0393 (2006). 39 Burns, T. C., Verfaillie, C. M. & Low, W. C. Stem cells for ischemic brain injury: a critical review. J Comp Neurol 515, 125-144, doi:10.1002 / cne.22038 (2009). 40 Carlson, A. P., Schermer, C. R. & Lu, S. W. Retrospective evaluation of anemia and transfusion in traumatic brain injury. J Trauma 61, 567-571, doi:10.1097 / 01.ta.0000231768.44727.a200005373-200609000-00007 [pii] (2006). 41 Carmeliet, P. & Storkebaum, E. Vascular and neuronal effects of VEGF in the nervous system: implications for neurological disorders. Semin Cell Dev Biol 13, 39-53, doi:10.1006 / scdb.2001.0290S1084952101902903 [pii] (2002). 42 Choe, Y., Kozlova, A., Graf, D. & Pleasure, S. J. Bone morphogenic protein signaling is a major determinant of dentate development. J Neurosci 33, 6766-6775, doi:33 / 16 / 6766 [pii]10.1523 / JNEUROSCI.0128-13.2013 (2013). 43 Erdo, F. et al. Host-dependent tumorigenesis of embryonic stem cell transplantation in experimental stroke. J Cereb Blood Flow Metab 23, 780-785, doi:10.1097 / 01.WCB.0000071886.63724.FB (2003). 44 Greig, N. H. et al. Incretin mimetics as pharmacologic tools to elucidate and as a new drug strategy to treat traumatic brain injury. Alzheimers Dement 10, S62-75, doi:S1552- 5260(13)02925-7 [pii]10.1016 / j.jalz.2013.12.011 (2014). 45 Kaplan, G. B., Vasterling, J. J. & Vedak, P. C. Brain-derived neurotrophic factor in traumatic brain injury, post-traumatic stress disorder, and their comorbid conditions: role in pathogenesis and treatment. Behav Pharmacol 21, 427-437, doi:10.1097 / FBP.0b013e32833d8bc9 (2010). 46 Knoepfler, P. S. Deconstructing stem cell tumorigenicity: a roadmap to safe regenerative medicine. Stem Cells 27, 1050-1056, doi:10.1002 / stem.37 (2009). 47 Luca Longhia, , Elisa R. Zaniera, Nicolas Royob, Nino Stocchettia, Tracy K. McIntosha. Stem cell transplantation as a therapeutic strategy for traumatic brain injury. Transplant Immunology 15, 134-148 (2005). 48 Robertson, C. S. et al. Effect of erythropoietin and transfusion threshold on neurological recovery after traumatic brain injury: a randomized clinical trial. JAMA 312, 36 - 47, doi:1884575 [pii]10.1001 / jama.2014.6490 (2014). 49 Salim, A. et al. Role of anemia in traumatic brain injury. J Am Coll Surg 207, 398 - 406, doi:S1072 - 7515(08)00322 - 0 [pii]10.1016 / j.jamcollsurg.2008.03.013 (2008).

[0274] 50 Deng, W., Aimone, J. B. & Gage, F. H. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat Rev Neurosci 11, 339 - 350, doi:nrn2822 [pii]10.1038 / nrn2822 (2010). 51 Goldman, S. A. & Nottebohm, F. Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Natl Acad Sci U S A 80, 2390 - 2394 (1983). 52 Gould, E., Beylin, A., Tanapat, P., Reeves, A. & Shors, T. J. Learning enhances adult neurogenesis in the hippocampal formation. Nat Neurosci 2, 260-265, doi:10.1038 / 6365 (1999). 53 Kirn, J. R. & Nottebohm, F. Direct evidence for loss and replacement of projection neurons in adult canary brain. J Neurosci 13, 1654-1663 (1993). 54 Mu, Y. & Gage, F. H. Adult hippocampal neurogenesis and its role in Alzheimer's disease. Mol Neurodegener 6, 85, doi:1750-1326-6-85 [pii]10.1186 / 1750-1326-6-85 (2011). 55 Pytte, C. L., Gerson, M., Miller, J. & Kirn, J. R. Increasing stereotypy in adult zebra finch song correlates with a declining rate of adult neurogenesis. Dev Neurobiol 67, 1699-1720, doi:10.1002 / dneu.20520 (2007). 56 Scharff, C., Kirn, J. R., Grossman, M., Macklis, J. D. & Nottebohm, F. Targeted neuronal death affects neuronal replacement and vocal behavior in adult songbirds. Neuron 25, 481- 492, doi:S0896-6273(00)80910-1 [pii] (2000). 57 Seib, D. R. et al. Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell 12, 204-214, doi:S1934-5909(12)00644-3 [pii]10.1016 / j.stem.2012.11.010 (2013). 58 Deister, C. & Schmidt, C. E. Optimizing neurotrophic factor combinations for neurite outgrowth. J Neural Eng 3, 172-179, doi:10.1088 / 1741-2560 / 3 / 2 / 011 (2006). 59 Zhao, Y. et al. Brain REST / NRSF Is Not Only a Silent Repressor but Also an Active Protector. Mol Neurobiol 54, 541-550, doi:10.1007 / s12035-015-9658-4 (2017). 60 Uchida, H., Ma, L. & Ueda, H. Epigenetic Gene Silencing Underlies C-Fiber Dysfunctions in Neuropathic Pain. Journal of Neuroscience 30, 4806-4814, doi:10.1523 / JNEUROSCI.5541-09.2010 (2010). 61 Alvarado, S. et al. Peripheral nerve injury is accompanied by chronic transcriptome-wide changes in the mouse prefrontal cortex. Mol Pain 9, 21, doi:10.1186 / 1744-8069-9-21 (2013). 62 Hammer, P. et al. mRNA-seq with agnostic splice site discovery for nervous system transcriptomics tested in chronic pain. Genome Res 20, 847-860, doi:10.1101 / gr.101204.109 (2010). 63 Willis, D. E., Wang, M., Brown, E., Fones, L. & Cave, J. W. Selective repression of gene expression in neuropathic pain by the neuron-restrictive silencing factor / repressor element-1 silencing transcription (NRSF / REST). Neuroscience Letters 625, 20-25, doi:10.1016 / j.neulet.2015.12.003 (2016). 64 Ballas, N., Grunseich, C., Lu, D. D., Speh, J. C. & Mandel, G. REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 121, 645-657, doi:S0092-8674(05)00285-0 [pii]10.1016 / j.cell.2005.03.013 (2005). 65 Chong, J. A. et al. REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. Cell 80, 949-957, doi:0092-8674(95)90298-8 [pii] (1995). 66 Mortazavi, A., Leeper Thompson, E. C., Garcia, S. T., Myers, R. M. & Wold, B. Comparative genomics modeling of the NRSF / REST repressor network: from single conserved sites to genome-wide repertoire. Genome Res 16, 1208-1221, doi:gr.4997306 [pii]10.1101 / gr.4997306 (2006). 67 Otto, S. J. et al. A new binding motif for the transcriptional repressor REST uncovers large gene networks devoted to neuronal functions. J Neurosci 27, 6729-6739, doi:27 / 25 / 6729 [pii]10.1523 / JNEUROSCI.0091-07.2007 (2007). 68 Schoenherr, C. J. & Anderson, D. J. Silencing is golden: negative regulation in the control of neuronal gene transcription. Curr Opin Neurobiol 5, 566-571, doi:0959-4388(95)80060-3 [pii] (1995). 69 Schoenherr, C. J., Paquette, A. J. & Anderson, D. J. Identification of potential target genes for the neuron-restrictive silencer factor. Proc Natl Acad Sci U S A 93, 9881-9886 (1996). 70 Rose, K. et al. Transcriptional repression of the M channel subunit Kv7.2 in chronic nerve injury. Pain 152, 742-754, doi:10.1016 / j.pain.2010.12.028 (2011). 71 Costigan, M. et al. Multiple chronic pain states are associated with a common amino acid- changing allele in KCNS1. Brain 133, 2519-2527, doi:10.1093 / brain / awq195 (2010). 72 Zhang, F. et al. Repressor element 1-silencing transcription factor drives the development of chronic pain states. Pain, doi:10.1097 / j.pain.0000000000001633 (2019). 73 Zhang, J., Chen, S. R., Chen, H. & Pan, H. L. RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons. J Biol Chem 293, 19078-19091, doi:10.1074 / jbc.RA118.005846 (2018). 74 Ueda, H. et al. A mimetic of the mSin3-binding helix of NRSF / REST ameliorates abnormal pain behavior in chronic pain models. Bioorg Med Chem Lett 27, 4705-4709, doi:10.1016 / j.bmcl.2017.09.006 (2017). 75 Uchida, H., Sasaki, K., Ma, L. & Ueda, H. Neuron-restrictive silencer factor causes epigenetic silencing of Kv4.3 gene after peripheral nerve injury. Neuroscience 166, 1-4, doi:10.1016 / j.neuroscience.2009.12.021 (2010). 76 Gervasi NM., D. A., Clark DM., Dingle M,, Pisarchik AV., Nesti LJ. C-terminal domain small phosphatase 1 (CTDSP1) regulates growth factor expression and axonal regeneration. Journal of Translational Medicine Manuscripted submitted for publication. (2020). 77 Nesti, E., Pisarchik, A. COMPOSITIONS AND METHODS FOR DEREPRESSING RE1 SILENCING TRANSCRIPTION FACTOR TARGET GENES. USA patent (2019). 78 Cole, L. A., Kurscheid, S., Nekrasov, M., Domaschenz, R., Dennis, J. H., Tremethick, D. J. Redefining the nucleosomal architecture of active and inactive promoters in the context of cellular plasticity and cancer. Nature Communications revision returned (2020). 79 Ren, Y., Vera, D. L., Hughes, K. A. & Dennis, J. H. Stimulation of the Drosophila immune system alters genome-wide nucleosome occupancy. Genom Data 3, 146-147, doi:10.1016 / j.gdata.2015.01.001 (2015). 80 Sexton, B. S. et al. The spring-loaded genome: nucleosome redistributions are widespread, transient, and DNA-directed. Genome Res 24, 251-259, doi:10.1101 / gr.160150.113 (2014). 81 Sexton, B. S. et al. Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response. Oncotarget 7, 6460-6475, doi:10.18632 / oncotarget.6841 (2016). 82 Lunyak, V. V. & Rosenfeld, M. G. No rest for REST: REST / NRSF regulation of neurogenesis. Cell 121, 499-501, doi:10.1016 / j.cell.2005.05.003 (2005). 83 Dirks, P. B. Making a commitment: neurons refuse cancer's advances. Nat Neurosci 22, 507-508, doi:10.1038 / s41593-019-0373-8 (2019). 84 Kaspar, A. A. & Reichert, J. M. Future directions for peptide therapeutics development. Drug Discov Today 18, 807-817, doi:10.1016 / j.drudis.2013.05.011 (2013). 85 Hamzeh-Mivehroud, M., Alizadeh, A. A., Morris, M. B., Bret Church, W. & Dastmalchi, S. Phage display as a technology delivering on the promise of peptide drug discovery. Drug Discovery Today 18, 1144-1157, doi:10.1016 / j.drudis.2013.09.001 (2013). 86 Hoekstra, E., Peppelenbosch, M. P. & Fuhler, G. M. Meeting report europhosphatase 2015: Phosphatases as drug targets in cancer. Cancer Research 76, 193-196, doi:10.1158 / 0008- 5472.CAN-15-2091 (2016). 87 Shi, Y. Serine / Threonine Phosphatases: Mechanism through Structure. Cell 139, 468-484, doi:10.1016 / j.cell.2009.10.006 (2009). 88 Sussman, F., Villaverde, M. C., L. Dominguez, J. & Danielson, U. H. On the Active Site Protonation State in Aspartic Proteases: Implications for Drug Design. Current Pharmaceutical Design, Volume 19, Number 2319, 4257-4275, doi:10.1002 / (SICI)1520- 667X(1998)10:1<19::AID-MCS3>3.0.CO;2-1 (2013). 89 Anobom, C. D. et al. From structure to catalysis: Recent developments in the biotechnological applications of lipases. BioMed Research International 2014, doi:10.1155 / 2014 / 684506 (2014). 90 Blundell, T. L., Jhoti, H. & Abell, C. High-Throughput Crystallography for Lead Discovery in Drug Design. Nature Reviews Drug Discovery 1, 45-54, doi:10.1038 / nrd706 (2002). 91 Weir, M. R. Renin inhibitors: novel agents for renoprotection or a better angiotensin receptor blocker for blood pressure lowering Current opinion in nephrology and hypertension 16, 416-421, doi:10.1097 / MNH.0b013e328209fe00 (2007). 92 Yeo, M. et al. Small CTD phosphatases function in silencing neuronal gene expression. Science 307, 596-600, doi:307 / 5709 / 596 [pii]10.1126 / science.1100801 (2005). 93 Fulda, S., Wick, W., Weller, M. & Debatin, K. M. Smac agonists sensitize for Apo2L / TRAIL- or anticancer drug-induced apoptosis and induce regression of malignant glioma in vivo. Nature Medicine 8, 808-815, doi:10.1038 / nm735 (2002). 94 Noguchi, H. et al. A new cell-permeable peptide allows successful allogeneic islet transplantation in mice. Nature Medicine 10, 305-309, doi:10.1038 / nm994 (2004). 95 Pooga, M. et al. Cellular translocation of proteins by transportan. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15, 1451-1453, doi:10.1096 / fj.00-0780fje (2001). 96 Schwarze, S. R., Ho, A., Vocero-Akbani, A. & Dowdy, S. F. In vivo protein transduction: delivery of a biologically active protein into the mouse. Science (New York, N.Y.) 285, 1569-1572, doi:10.1126 / science.285.5433.1569 (1999). 97 Yeo, M., Lin, P. S., Dahmus, M. E. & Gill, G. N. A Novel RNA Polymerase II C-terminal Domain Phosphatase That Preferentially Dephosphorylates Serine 5. Journal of Biological Chemistry 278, 26078-26085, doi:10.1074 / jbc.M301791200 (2003). 98 Banerjee, P. N., Filippi, D. & Allen Hauser, W. The descriptive epidemiology of epilepsy-a review. Epilepsy Res 85, 31-45, doi:10.1016 / j.eplepsyres.2009.03.003 (2009). 99 Mucha, M. et al. Transcriptional control of KCNQ channel genes and the regulation of neuronal excitability. J Neurosci 30, 13235-13245, doi:10.1523 / JNEUROSCI.1981-10.2010 (2010).

[0275] 100 Escayg, A. et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet 24, 343-345, doi:10.1038 / 74159 (2000). 101 Martin, D. et al. REST represses a subset of the pancreatic endocrine differentiation program. Dev Biol 405, 316-327, doi:10.1016 / j.ydbio.2015.07.002 (2015). 102 Abderrahmani, A. et al. Neuronal traits are required for glucose-induced insulin secretion. FEBS Lett 565, 133-138, doi:10.1016 / j.febslet.2004.04.002 (2004). 103 Martin, D. et al. Functional significance of repressor element 1 silencing transcription factor (REST) target genes in pancreatic beta cells. Diabetologia 51, 1429-1439, doi:10.1007 / s00125-008-0984-1 (2008). 104 Rigamonti, D. et al. Loss of huntingtin function complemented by small molecules acting as repressor element 1 / neuron restrictive silencer element silencer modulators. J Biol Chem 282, 24554-24562, doi:10.1074 / jbc.M609885200 (2007). 105 Sipione, S. et al. Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses. Hum Mol Genet 25, 210, doi:10.1093 / hmg / ddv416 (2016). 106 Zuccato, C. et al. Huntingtin interacts with REST / NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nat Genet 35, 76-83, doi:10.1038 / ng1219 (2003). 107 Bao, S. et al. Targeting cancer stem cells through L1CAM suppresses glioma growth. Cancer Res 68, 6043-6048, doi:10.1158 / 0008-5472.CAN-08-1079 (2008). 108 Jackson, M., Hassiotou, F. & Nowak, A. Glioblastoma stem-like cells: at the root of tumor recurrence and a therapeutic target. Carcinogenesis 36, 177-185, doi:10.1093 / carcin / bgu243 (2015). 109 Liu, G. et al. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma. Mol Cancer 5, 67, doi:10.1186 / 1476-4598-5-67 (2006). 110 Persano, L., Rampazzo, E., Basso, G. & Viola, G. Glioblastoma cancer stem cells: role of the microenvironment and therapeutic targeting. Biochem Pharmacol 85, 612-622, doi:10.1016 / j.bcp.2012.10.001 (2013). 111 Conti, L. et al. REST controls self-renewal and tumorigenic competence of human glioblastoma cells. PLoS One 7, e38486, doi:10.1371 / journal.pone.0038486 (2012). 112 Kamal, M. M. et al. REST regulates oncogenic properties of glioblastoma stem cells. Stem Cells 30, 405-414, doi:10.1002 / stem.1020 (2012). 113 Wagoner, M. P. & Roopra, A. A REST derived gene signature stratifies glioblastomas into chemotherapy resistant and responsive disease. BMC Genomics 13, 686, doi:10.1186 / 1471- 2164-13-686 (2012). 114 Taylor, P. et al. REST is a novel prognostic factor and therapeutic target for medulloblastoma. Mol Cancer Ther 11, 1713-1723, doi:10.1158 / 1535-7163.MCT-11-0990 (2012). 115 Jin, H. et al. Identification of RE1-Silencing Transcription Factor as a Promoter of Metastasis in Pancreatic Cancer. Front Oncol 9, 291, doi:10.3389 / fonc.2019.00291 (2019). 116 Jackson, W. M. et al. Mesenchymal progenitor cells derived from traumatized human muscle. J Tissue Eng Regen Med 3, 129-138, doi:10.1002 / term.149 (2009). 117 Schmitz, H. C. & Beer, G. M. The toe-spreading reflex of the rabbit revisited--functional evaluation of complete peroneal nerve lesions. Lab Anim 35, 340-345, doi:10.1258 / 0023677011911930 (2001). 118 Hems, T. E. & Glasby, M. A. The limit of graft length in the experimental use of muscle grafts for nerve repair. J Hand Surg Br 18, 165-170 (1993). 119 Ballas, N. et al. Regulation of neuronal traits by a novel transcriptional complex. Neuron 31, 353-365, doi:10.1016 / s0896-6273(01)00371-3 (2001). 120 Symes, A. J. et al. Ciliary neurotrophic factor coordinately activates transcription of neuropeptide genes in a neuroblastoma cell line. Proc Natl Acad Sci U S A 90, 572-576, doi:10.1073 / pnas.90.2.572 (1993). 121 Chou, B. K. et al. Efficient human iPS cell derivation by a non-integrating plasmid from blood cells with unique epigenetic and gene expression signatures. Cell Res 21, 518-529, doi:10.1038 / cr.2011.12 (2011). 122 Swistowski, A. et al. Xeno-free defined conditions for culture of human embryonic stem cells, neural stem cells and dopaminergic neurons derived from them. PLoS One 4, e6233, doi:10.1371 / journal.pone.0006233 (2009). 123 Yan, Y. et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Transl Med 2, 862- 870, doi:10.5966 / sctm.2013-0080 (2013). 124 Efthymiou, A. et al. Functional screening assays with neurons generated from pluripotent stem cell-derived neural stem cells. J Biomol Screen 19, 32-43, doi:10.1177 / 1087057113501869 (2014). 125 Malik, N. et al. Compounds with species and cell type specific toxicity identified in a 2000 compound drug screen of neural stem cells and rat mixed cortical neurons. Neurotoxicology 45, 192-200, doi:10.1016 / j.neuro.2014.10.007 (2014). 126 Pei, Y. et al. Comparative neurotoxicity screening in human iPSC-derived neural stem cells, neurons and astrocytes. Brain Res 1638, 57-73, doi:10.1016 / j.brainres.2015.07.048 (2016). 127 Lischka, F. W. et al. Neonatal mouse cortical but not isogenic human astrocyte feeder layers enhance the functional maturation of induced pluripotent stem cell-derived neurons in culture. Glia 66, 725-748, doi:10.1002 / glia.23278 (2018). 128 Papapetrou, E. P. & Schambach, A. Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy. Mol Ther 24, 678-684, doi:10.1038 / mt.2016.38 (2016). 129 He, R. et al. Recombinant luciferase-expressing human cytomegalovirus (CMV) for evaluation of CMV inhibitors. Virol J 8, 40, doi:10.1186 / 1743-422X-8-40 (2011). 130 Jacqmain, J., Nudi, E. T., Fluharty, S. & Smith, J. S. Pre and post-injury environmental enrichment effects functional recovery following medial frontal cortical contusion injury in rats. Behav Brain Res 275, 201-211, doi:10.1016 / j.bbr.2014.08.056 (2014). 131 Monaco, C. M. et al. Environmental enrichment promotes robust functional and histological benefits in female rats after controlled cortical impact injury. Exp Neurol 247, 410-418, doi:10.1016 / j.expneurol.2013.01.007 (2013). 132 Shear, D. A. et al. Nicotinamide Treatment in Traumatic Brain Injury: Operation Brain Trauma Therapy. J Neurotrauma 33, 523-537, doi:10.1089 / neu.2015.4115 (2016). 133 Wagner, A. K., Postal, B. A., Darrah, S. D., Chen, X. & Khan, A. S. Deficits in novelty exploration after controlled cortical impact. J Neurotrauma 24, 1308-1320, doi:10.1089 / neu.2007.0274 (2007). 134 Zhang, J., Groff, R. F. & Dayawansa, S. Imipramine treatment increases cell proliferation following fluid percussion brain injury in rats. Neurol Res 35, 247-254, doi:10.1179 / 1743132813Y.0000000164 (2013). 135 Xiong, Y. et al. Histological and functional outcomes after traumatic brain injury in mice null for the erythropoietin receptor in the central nervous system. Brain Res 1230, 247-257, doi:10.1016 / j.brainres.2008.06.127 (2008). 136 Susarla, B. T., Villapol, S., Yi, J. H., Geller, H. M. & Symes, A. J. Temporal patterns of cortical proliferation of glial cell populations after traumatic brain injury in mice. ASN Neuro 6, 159-170, doi:10.1042 / AN20130034 (2014). 137 Xiong, Y. et al. Role of gender in outcome after traumatic brain injury and therapeutic effect of erythropoietin in mice. Brain Res 1185, 301-312, doi:10.1016 / j.brainres.2007.09.052 (2007). 138 Choi, S. H., Woodlee, M. T., Hong, J. J. & Schallert, T. A simple modification of the water maze test to enhance daily detection of spatial memory in rats and mice. J Neurosci Methods 156, 182-193, doi:10.1016 / j.jneumeth.2006.03.002 (2006). 139 Omura, T. et al. Different expressions of BDNF, NT3, and NT4 in muscle and nerve after various types of peripheral nerve injuries. J Peripher Nerv Syst 10, 293-300, doi:10.1111 / j.1085-9489.2005.10307.x (2005). 140 Zhang, J. Y., Luo, X. G., Xian, C. J., Liu, Z. H. & Zhou, X. F. Endogenous BDNF is required for myelination and regeneration of injured sciatic nerve in rodents. Eur J Neurosci 12, 4171-4180 (2000). 141 Zhao, Y. et al. Brain REST / NRSF Is Not Only a Silent Repressor but Also an Active Protector. Molecular Neurobiology 54, 541-550, doi:10.1007 / s12035-015-9658-4 (2017). 142 Charbord, J. et al. High throughput screening for inhibitors of REST in neural derivatives of human embryonic stem cells reveals a chemical compound that promotes expression of neuronal genes. Stem Cells 31, 1816-1828, doi:10.1002 / stem.1430 (2013). 143 Nesti, L. J. et al. Differentiation potential of multipotent progenitor cells derived from war- traumatized muscle tissue. J Bone Joint Surg Am 90, 2390-2398, doi:10.2106 / JBJS.H.00049 (2008). 144 Bulken-Hoover, J. D. et al. Inducible expression of neurotrophic factors by mesenchymal progenitor cells derived from traumatically injured human muscle. Mol Biotechnol 51, 128- 136, doi:10.1007 / s12033-011-9445-z (2012). 145 Mosmann, T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65, 55-63, doi:10.1016 / 0022- 1759(83)90303-4 (1983). 146 Chan, J. R., Cosgaya, J. M., Wu, Y. J. & Shooter, E. M. Neurotrophins are key mediators of the myelination program in the peripheral nervous system. Proc Natl Acad Sci U S A 98, 14661-14668, doi:10.1073 / pnas.251543398 (2001). 147 Leung, J. Y. et al. Metallothionein promotes regenerative axonal sprouting of dorsal root ganglion neurons after physical axotomy. Cell Mol Life Sci 69, 809-817, doi:10.1007 / s00018-011-0790-7 (2012). 148 Rothstein, J. D., Jin, L., Dykes-Hoberg, M. & Kuncl, R. W. Chronic inhibition of glutamate uptake produces a model of slow neurotoxicity. Proc Natl Acad Sci U S A 90, 6591-6595 (1993). 149 Corse, A. M. et al. Preclinical testing of neuroprotective neurotrophic factors in a model of chronic motor neuron degeneration. Neurobiol Dis 6, 335-346, doi:10.1006 / nbdi.1999.0253 (1999).

[0276] 150 Mi, R., Chen, W. & Hoke, A. Pleiotrophin is a neurotrophic factor for spinal motor neurons. Proc Natl Acad Sci U S A 104, 4664-4669, doi:10.1073 / pnas.0603243104 (2007). 151 Cargnin, F. et al. An RNA binding protein promotes axonal integrity in peripheral neurons by destabilizing REST. J Neurosci 34, 16650-16661, doi:10.1523 / JNEUROSCI.1650- 14.2014 (2014). 152 Rueden, C. T. et al. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics 18, 529-529, doi:10.1186 / s12859-017-1934-z (2017). 153 Woolf, C. J. Phenotypic modification of primary sensory neurons: the role of nerve growth factor in the production of persistent pain. Philos Trans R Soc Lond B Biol Sci 351, 441- 448, doi:10.1098 / rstb.1996.0040 (1996). 154 Fremin, C. et al. ERK2 but not ERK1 plays a key role in hepatocyte replication: an RNAi- mediated ERK2 knockdown approach in wild-type and ERK1 null hepatocytes. Hepatology 45, 1035-1045, doi:10.1002 / hep.21551 (2007). 155 River, C. Sergical Services, <https: / / www.criver.com / sites / default / files / resources / VascularCatheterSurgeryOptionsInfor mationSheet.pdf> (2018). 156 Beer, S. a. The toe-spreading reflex of the rabbit revisited--functional evaluation of complete peroneal nerve lesions. Laboratory Animals 35, 340-345 (2001). 157 Glasby, M. A. & Hems, T. E. Repairing spinal roots after brachial plexus injuries. Paraplegia 33, 359-361, doi:10.1038 / sc.1995.80 (1995). 158 Jin, J. et al. Functional motor recovery after peripheral nerve repair with an aligned nanofiber tubular conduit in a rat model. Regen Med 7, 799-806, doi:10.2217 / rme.12.87 (2012). 159 Han, D., Lu, J., Xu, L. & Xu, J. Comparison of two electrophysiological methods for the assessment of progress in a rat model of nerve repair. International Journal of Clinical and Experimental Medicine 8, 2392-2398 (2015). 160 Yekta?, A. et al. Perineural dexmedetomidine effects on sciatic nerve in rat. Brazilian Journal of Anesthesiology (English Edition) 67, 57-66, doi:10.1016 / j.bjane.2015.08.012 (2017). 161 Rigaud, M. et al. Species and strain differences in rodent sciatic nerve anatomy: implications for studies of neuropathic pain. Pain 136, 188-201, doi:10.1016 / j.pain.2008.01.016 (2008). 162 Sleigh, J. N., Weir, G. A. & Schiavo, G. A simple, step-by-step dissection protocol for the rapid isolation of mouse dorsal root ganglia. BMC Res Notes 9, 82, doi:10.1186 / s13104- 016-1915-8 (2016). 163 Ronchi, G. et al. Discrepancies in quantitative assessment of normal and regenerated peripheral nerve fibers between light and electron microscopy. J Peripher Nerv Syst 19, 224-233, doi:10.1111 / jns.12090 (2014). 164 Varejao, A. S. et al. Functional and morphological assessment of a standardized rat sciatic nerve crush injury with a non-serrated clamp. J Neurotrauma 21, 1652-1670, doi:10.1089 / neu.2004.21.1652 (2004). 165 Carriel, V., Garzon, I., Alaminos, M. & Cornelissen, M. Histological assessment in peripheral nerve tissue engineering. Neural Regen Res 9, 1657-1660, doi:10.4103 / 1673- 5374.141798 (2014). 166 Hazari, A., Wiberg, M., Johansson-Ruden, G., Green, C. & Terenghi, G. A resorbable nerve conduit as an alternative to nerve autograft in nerve gap repair. Br J Plast Surg 52, 653-657, doi:10.1054 / bjps.1999.3184 (1999). 167 Shi, T. J. et al. Effect of peripheral nerve injury on dorsal root ganglion neurons in the C57 BL / 6J mouse: marked changes both in cell numbers and neuropeptide expression. Neuroscience 105, 249-263 (2001). 168 Jackson, W. M. et al. Mesenchymal progenitor cells derived from traumatized muscle enhance neurite growth. J Tissue Eng Regen Med 7, 443-451, doi:10.1002 / term.539 (2013). 169 Kobiela Ketz A, B. K., Grunberg NE, Kasper CE,Osborne L, Pryor B, Tosini NL, Wu X, Anders JJ. Characterization of macrophage / microglial activation and effect of photobiomodulation in the spared nerve injury model of neuropathic pain.. Pain Medicine 5, 932-946, doi:10.1093 / pm / pnw144 (2016). 170 Whiteside, G. T., Adedoyin A, Leventhal L. Predictive validity of animal pain models? A comparison of the pharmacokinetic-pharmacodynamic relationship for pain drugs in rats and humans. Neuropharm, 767-775, doi:10.1016 / j.neuropharm.2008.01.001 (2008). 171 LaBuda, C. J. & Fuchs, P. N. A behavioral test paradigm to measure the aversive quality of inflammatory and neuropathic pain in rats. Exp Neurol 163, 490-494, doi:10.1006 / exnr.2000.7395 (2000). 172 Xu, Y. et al. Gait Assessment of Pain and Analgesics: Comparison of the DigiGait and CatWalk Gait Imaging Systems. Neurosci Bull 35, 401-418, doi:10.1007 / s12264-018- 00331-y (2019). 173 Hargreaves, K., Dubner, R., Brown, F., Flores, C. & Joris, J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32, 77-88, doi:10.1016 / 0304-3959(88)90026-7 (1988). 174 Baastrup, C., Jensen, T. S. & Finnerup, N. B. Pregabalin attenuates place escape / avoidance behavior in a rat model of spinal cord injury. Brain Res 1370, 129-135, doi:10.1016 / j.brainres.2010.11.008 (2011). 175 FDA. Guidance for industry (ed CDER; CBER) (FDA, https: / / www.fda.gov / downloads / Drugs / GuidanceComplianceRegulatoryInformation / Guidan ces / UCM074957.pdf, 1997). 176 FDA. S2B Genotoxicity: A Standard Battery for Genotoxicity Testing of Pharmaceuticals, <https: / / www.fda.gov / media / 71971 / download> (1997). 177 FDA. S7B Nonclinical Evaluation of the Potential for Delayed Ventricular Repolarization (QT Interval Prolongation) by Human Pharmaceuticals, <https: / / www.fda.gov / media / 72043 / download> (2005). 178 FDA. (ed CDER; CBER) (FDA, https: / / www.fda.gov / downloads / drugs / guidances / ucm073246.pdf, 2010). 179 FDA. (ed CDER; CBER) (FDA, https: / / www.fda.gov / downloads / drugs / guidances / ucm074959.pdf, July 2001). 180 Irwin, S. Comprehensive observational assessment: Ia. A systematic, quantitative procedure for assessing the behavioral and physiologic state of the mouse. Psychopharmacologia 13, 222-257 (1968). 181 Morrone, L., Scuteri, D., Rombola, L., Mizoguchi, H. & Bagetta, G. Opioids Resistance in Chronic Pain Management. Current Neuropharmacology 15, 444-456, doi:10.2174 / 1570159X14666161101092822 (2017). 182 Ploj, K., Roman, E. & Nylander, I. Long-term effects of short and long periods of maternal separation on brain opioid peptide levels in male Wistar rats. Neuropeptides 37, 149-156, doi:10.1016 / S0143-4179(03)00043-X (2003). 183 Zhu, C. et al. Neuron-restrictive silencer factor-mediated downregulation of μ-opioid receptor contributes to the reduced morphine analgesia in bone cancer pain. PAIN 158, 879- 890, doi:10.1097 / j.pain.0000000000000848 (2017). 184 Lu, C. e. et al. Neuron-restrictive silencer factor in periaqueductal gray contributes to remifentanil-induced postoperative hyperalgesia via repression of the mu-opioid receptor. Journal of the Neurological Sciences 352, 48-52, doi:10.1016 / j.jns.2015.03.018 (2015). 185 Schwartz, A. S. & Marchok, P. L. Depression of morphine-seeking behaviour by dopamine inhibition. Nature 248, 257-258 (1974). 186 Spyraki, C., Fibiger, H. C. & Phillips, A. G. Attenuation of heroin reward in rats by disruption of the mesolimbic dopamine system. Psychopharmacology 79, 278-283 (1983). 187 Phillips, A. G. & LePiane, F. G. Reinforcing effects of morphine microinjection into the ventral tegmental area. Pharmacology, biochemistry, and behavior 12, 965-968 (1980). 188 Phillips, A. G., LePiane, F. G. & Fibiger, H. C. Dopaminergic mediation of reward produced by direct injection of enkephalin into the ventral tegmental area of the rat. Life sciences 33, 2505-2511 (1983). 189 Prus AJ, J. J., Rosecrans JA. in Methods of Behavior Analysis in Neuroscience (ed Buccafusco JJ) Ch.4, (CRC Press / Taylor & Francis, 2009). 190 Carr, K. D., Bak, T. H., Simon, E. J. & Portoghese, P. S. Effects of the selective kappa opioid antagonist, nor-binaltorphimine, on electrically-elicited feeding in the rat. Life sciences 45, 1787-1792 (1989). 191 Galli, R. et al. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res 64, 7011-7021, doi:10.1158 / 0008-5472.CAN-04- 1364 (2004). 192 Garzon-Muvdi, T. et al. Regulation of brain tumor dispersal by NKCC1 through a novel role in focal adhesion regulation. PLoS Biol 10, e1001320, doi:10.1371 / journal.pbio.1001320 (2012). 193 Guerrero-Cazares, H., Chaichana, K. L. & Quinones-Hinojosa, A. Neurosphere culture and human organotypic model to evaluate brain tumor stem cells. Methods Mol Biol 568, 73-83, doi:10.1007 / 978-1-59745-280-9_6 (2009). 194 Tilghman, J. et al. Regulation of Glioblastoma Tumor-Propagating Cells by the Integrin Partner Tetraspanin CD151. Neoplasia 18, 185-198, doi:10.1016 / j.neo.2016.02.003 (2016). 195 Lal, S. et al. An implantable guide-screw system for brain tumor studies in small animals. J Neurosurg 92, 326-333, doi:10.3171 / jns.2000.92.2.0326 (2000). 196 Manton, C. A. et al. Induction of cell death by the novel proteasome inhibitor marizomib in glioblastoma in vitro and in vivo. Sci Rep 6, 18953, doi:10.1038 / srep18953 (2016). 197 Kaplan, E. L. M., P. Nonparametric estimation from incomplete observations. Journal of the American Statistical Association 53, 457-481, doi:10.2307 / 2281868 (1958). 198 Marubini E, V. M. C. Estimation of Survival Probabilities. Analysing survival data from clinical trials and observational studies. 41-81 (John Wiley and Sons, 1995).

Sequence Listing Free-Text

[0277] SEQ ID NO: 1 - Description of Artificial Sequence: Synthetic Peptide SEQ ID NO: 2 - Description of Artificial Sequence: Synthetic Polypeptide SEQ ID NO: 3 - Description of Artificial Sequence: Synthetic Polypeptide SEQ ID NO: 4 - Description of Artificial Sequence: Synthetic Polypeptide SEQ ID NO: 5 - Description of Artificial Sequence: Synthetic Polypeptide SEQ ID NO: 6 - Description of Artificial Sequence: Synthetic Polypeptide D-Amino Acid SEQ ID NO: 7 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid SEQ ID NO: 8 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid SEQ ID NO: 9 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid SEQ ID NO: 10 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid SEQ ID NO: 11 - Description of Artificial Sequence: Synthetic Peptide 2-Amino-tetradecanoic Acid D-Amino Acid SEQ ID NO: 12 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid 2-Amino-tetradecanoic Acid D-Amino Acid SEQ ID NO: 13 - Description of Artificial Sequence: Synthetic Peptide D-Amino Acid 2-Amino-tetradecanoic Acid D-Amino Acid 2-Amino-tetradecanoic Acid D-Amino Acid Description of Sequence No. 14 - Artificial Sequence: Synthetic Peptide D - Amino Acid 2 - Amino - tetradecanoic Acid D - Amino Acid Description of Sequence No. 15 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 16 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 17 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 18 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 19 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 20 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 21 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 23 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 24 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 25 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 26 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 27 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 28 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 29 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 30 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 31 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 33 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 34 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 35 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 36 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 37 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 38 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 39 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 40 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 41 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 43 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 44 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 45 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 46 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 47 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 48 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 49 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 50 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 51 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 53 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 54 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 55 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 56 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 57 - Artificial Sequence: Synthetic Polypeptide Description of Sequence No. 58 - Artificial Sequence: Synthetic Polypeptide Description of Sequence No. 59 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 50 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 61 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 63 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 64 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 65 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 66 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 67 - Artificial Sequence: Synthetic Peptide Description of Sequence No. 68 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 69 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 70 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 71 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 72 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 73 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 74 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 75 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 76 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 77 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 78 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 79 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 80 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 81 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 82 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 83 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 84 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 85 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 86 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 87 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 88 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 89 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 90 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 91 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 92 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 93 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 94 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 95 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 96 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 97 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 98 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 99 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 100 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 101 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 102 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 103 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 104 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 105 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 106 - Artificial Sequence: Synthetic Peptide D - Amino Acid Description of Sequence No. 107 - Artificial Sequence: Synthetic Polypeptide D - Amino Acid Description of Sequence No. 108 - Artificial Sequence: Synthetic Polypeptide D - Amino Acid Description of Sequence No. 109 - Artificial Sequence: Synthetic Peptide D - amino acid SEQ ID NO: 100 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 111 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 112 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 113 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 114 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 115 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 116 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 117 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 118 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 119 - Description of artificial sequence: Synthetic polypeptide SEQ ID NO: 120 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 121 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 122 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 123 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 124 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 125 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 126 - Description of artificial sequence: Synthetic peptide L - 2 - naphthylalanine SEQ ID NO: 127 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 128 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 129 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 130 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 131 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 132 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 133 - Description of artificial sequence: Synthetic peptide 2-aminotetradecanoic acid D-amino acid SEQ ID NO: 134 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 135 - Description of artificial sequence: Synthetic peptide 2-aminotetradecanoic acid SEQ ID NO: 136 - Description of artificial sequence: Synthetic peptide 2-aminotetradecanoic acid 2-aminotetradecanoic acid SEQ ID NO: 137 - Description of artificial sequence: Synthetic peptide 2-aminotetradecanoic acid SEQ ID NO: 138 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 139 - Description of artificial sequence: Synthetic peptide SEQ ID NO: 140 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 141 - Description of artificial sequence: Synthetic polypeptide D-amino acid SEQ ID NO: 142 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 143 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 144 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 145 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 146 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 147 - Description of artificial sequence: Synthetic peptide D-amino acid SEQ ID NO: 148 - Description of artificial sequence: Synthetic peptide D-amino acid L-2-naphthylalanine D - amino acid SEQ ID NO: 149 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 150 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 151 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 152 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 153 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 154 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 155 - Description of artificial sequence: Synthetic peptide D - amino acid 2 - Aminotetradecanoic acid D - amino acid SEQ ID NO: 156 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 157 - Description of artificial sequence: Synthetic peptide D - amino acid 2 - Aminotetradecanoic acid D - amino acid SEQ ID NO: 158 - Description of artificial sequence: Synthetic peptide D - amino acid 2 - Aminotetradecanoic acid D - amino acid 2 - Aminotetradecanoic acid D - amino acid SEQ ID NO: 159 - Description of artificial sequence: Synthetic peptide D - amino acid 2 - Aminotetradecanoic acid D - amino acid SEQ ID NO: 160 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 161 - Description of artificial sequence: Synthetic peptide D - amino acid SEQ ID NO: 162 - Description of artificial sequence: Synthetic polynucleotide Description of Sequence No. 163 - Artificial Sequence: Synthetic Polypeptide Description of Sequence No. 164 - Artificial Sequence: Synthetic Polynucleotide Description of Sequence No. 165 - Artificial Sequence: Synthetic Primer Description of Sequence No. 166 - Artificial Sequence: Synthetic Primer Description of Sequence No. 167 - Artificial Sequence: Synthetic Primer Description of Sequence No. 168 - Artificial Sequence: Synthetic Primer Description of Sequence No. 169 - Artificial Sequence: Synthetic Primer Description of Sequence No. 170 - Artificial Sequence: Synthetic Primer Description of Sequence No. 171 - Artificial Sequence: Synthetic Primer Description of Sequence No. 172 - Artificial Sequence: Synthetic Primer Description of Sequence No. 173 - Artificial Sequence: Synthetic Primer Description of Sequence No. 174 - Artificial Sequence: Synthetic Primer Description of Sequence No. 175 - Artificial Sequence: Synthetic Primer Description of Sequence No. 176 - Artificial Sequence: Synthetic Primer Description of Sequence No. 177 - Artificial Sequence: Synthetic Primer Description of Sequence No. 178 - Artificial Sequence: Synthetic Primer Description of Sequence No. 179 - Artificial Sequence: Synthetic Primer Description of Sequence No. 180 - Artificial Sequence: Synthetic Primer Description of Sequence No. 181 - Artificial Sequence: Synthetic Primer Description of Sequence No. 182 - Artificial Sequence: Synthetic Primer Description of Sequence No. 183 - Artificial Sequence: Synthetic Primer Description of Sequence No. 184 - Artificial Sequence: Synthetic Primer Description of Sequence No. 185 - Artificial Sequence: Synthetic Primer Description of Sequence No. 186 - Artificial Sequence: Synthetic Primer Description of Sequence No. 187 - Artificial Sequence: Synthetic Primer Description of Sequence No. 188 - Artificial Sequence: Synthetic Primer Description of Sequence No. 189 - Artificial Sequence: Synthetic Primer Description of Sequence No. 190 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 191 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 192 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 193 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 194 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 195 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 196 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 197 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 198 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 199 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 200 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 201 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 202 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 203 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 204 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 205 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 206 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 207 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 208 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 209 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 210 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 211 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 212 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 213 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 214 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 215 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 216 - Artificial Sequence: Synthetic Primer Description of SEQ ID NO: 217 - Artificial Sequence: Synthetic Primer Description of Sequence No. 218 - Artificial Sequence: Synthetic Primer Description of Sequence No. 219 - Artificial Sequence: Synthetic Primer Description of Sequence No. 220 - Artificial Sequence: Synthetic Primer Description of Sequence No. 221 - Artificial Sequence: Synthetic Primer Description of Sequence No. 222 - Artificial Sequence: Synthetic Primer Description of Sequence No. 223 - Artificial Sequence: Synthetic Primer Description of Sequence No. 224 - Artificial Sequence: Synthetic Primer Description of Sequence No. 225 - Artificial Sequence: Synthetic Primer Description of Sequence No. 226 - Artificial Sequence: Synthetic Primer Description of Sequence No. 227 - Artificial Sequence: Synthetic Primer Description of Sequence No. 228 - Artificial Sequence: Synthetic Primer Description of Sequence No. 229 - Artificial Sequence: Synthetic Primer Description of Sequence No. 230 - Artificial Sequence: Synthetic Primer Description of Sequence No. 231 - Artificial Sequence: Synthetic Primer Description of Sequence No. 232 - Artificial Sequence: Synthetic Primer Description of Sequence No. 233 - Artificial Sequence: Synthetic Primer Description of Sequence No. 234 - Artificial Sequence: Synthetic Primer Description of Sequence No. 235 - Artificial Sequence: Synthetic Primer Description of Sequence No. 236 - Artificial Sequence: Synthetic Primer Description of Sequence No. 237 - Artificial Sequence: Synthetic Primer Description of Sequence No. 238 - Artificial Sequence: Synthetic Primer Description of Sequence No. 239 - Artificial Sequence: Synthetic Primer Description of Sequence No. 240 - Artificial Sequence: Synthetic Primer Description of Sequence No. 241 - Artificial Sequence: Synthetic Primer Description of Sequence No. 242 - Artificial Sequence: Synthetic Primer Description of Sequence No. 243 - Artificial Sequence: Synthetic Primer Description of Sequence No. 244 - Artificial Sequence: Synthetic Primer Description of Sequence No. 245 - Artificial Sequence: Synthetic Primer Accession No. 246 - Description of Artificial Sequence: Synthetic Primer Accession No. 247 - Description of Artificial Sequence: Synthetic Primer Accession No. 248 - Description of Artificial Sequence: Synthetic Primer Accession No. 249 - Description of Artificial Sequence: Synthetic Primer Accession No. 250 - Description of Artificial Sequence: Synthetic Primer Accession No. 251 - Description of Artificial Sequence: Synthetic Primer Accession No. 252 - Description of Artificial Sequence: Synthetic Primer Accession No. 253 - Description of Artificial Sequence: Synthetic Primer Accession No. 254 - Description of Artificial Sequence: Synthetic Primer Accession No. 255 - Description of Artificial Sequence: Synthetic Primer Accession No. 256 - Description of Artificial Sequence: Synthetic Primer Accession No. 257 - Description of Artificial Sequence: Synthetic Primer Accession No. 258 - Description of Artificial Sequence: Synthetic Primer Accession No. 259 - Description of Artificial Sequence: Synthetic Primer Accession No. 260 - Description of Artificial Sequence: Synthetic Primer Accession No. 261 - Description of Artificial Sequence: Synthetic Primer Accession No. 262 - Description of Artificial Sequence: Synthetic Primer Accession No. 263 - Description of Artificial Sequence: Synthetic Primer Accession No. 264 - Description of Artificial Sequence: Synthetic Primer Accession No. 265 - Description of Artificial Sequence: Synthetic Primer Accession No. 266 - Description of Artificial Sequence: Synthetic Primer Accession No. 267 - Description of Artificial Sequence: Synthetic Primer Accession No. 268 - Description of Artificial Sequence: Synthetic Primer Accession No. 269 - Description of Artificial Sequence: Synthetic Primer Accession No. 270 - Description of Artificial Sequence: Synthetic Primer Accession No. 271 - Description of Artificial Sequence: Synthetic Primer Accession No. 272 - Description of Artificial Sequence: Synthetic Primer Sequence number 273 - Description of artificial sequence: Synthetic primer Sequence number 274 - Description of artificial sequence: Synthetic primer Sequence number 275 - Description of artificial sequence: Synthetic primer Sequence number 276 - Description of artificial sequence: Synthetic primer Sequence number 277 - Description of artificial sequence: Synthetic primer Sequence number 278 - Description of artificial sequence: Synthetic primer Sequence number 279 - Description of artificial sequence: Synthetic primer Sequence number 280 - Description of artificial sequence: Synthetic primer Sequence number 281 - Description of artificial sequence: Synthetic primer Sequence number 282 - Description of artificial sequence: Synthetic primer Sequence number 283 - Description of artificial sequence: Synthetic primer Sequence number 284 - Description of artificial sequence: Synthetic primer Sequence number 285 - Description of artificial sequence: Synthetic primer Sequence number 286 - Description of artificial sequence: Synthetic primer Sequence number 287 - Description of artificial sequence: Synthetic primer Sequence number 288 - Description of artificial sequence: Synthetic primer Sequence number 289 - Description of artificial sequence: Synthetic primer Sequence number 290 - Description of artificial sequence: Synthetic primer Sequence number 291 - Description of artificial sequence: Synthetic primer Sequence number 292 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others Sequence number 293 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others Sequence number 294 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others Sequence number 295 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others Sequence number 296 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others Sequence number 297 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 298 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 299 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 300 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 301 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 302 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 303 - Description of artificial sequence: synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 304 - Description of artificial sequence: synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 305 - Description of artificial sequence: synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 306 - Description of artificial sequence: synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 307 - Description of artificial sequence: synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 308 - Description of synthetic primer: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 309 - Description of synthetic primer: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 310 - Description of synthetic primer: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 311 - Description of synthetic primer: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 312 - Description of synthetic primer: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 313 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 314 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 315 - Description of artificial sequence: Synthetic primer a, c, t, g, unknown or others a, c, t, g, unknown or others a, c, t, g, unknown or others SEQ ID NO: 316 - Description of artificial sequence: Synthetic polynucleotide SEQ ID NO: 317 - Description of artificial sequence: Synthetic polynucleotide SEQ ID NO: 318 - Description of artificial sequence: Synthetic primer SEQ ID NO: 319 - Description of artificial sequence: Synthetic primer SEQ ID NO: 320 - Description of artificial sequence: Synthetic polynucleotide SEQ ID NO: 321 - Description of artificial sequence: Synthetic polynucleotide SEQ ID NO: 322 - Description of artificial sequence: Synthetic polynucleotide SEQ ID NO: 323 - Description of artificial sequence: Synthetic primer SEQ ID NO: 324 - Description of artificial sequence: Synthetic primer SEQ ID NO: 325 - Description of artificial sequence: Synthetic primer SEQ ID NO: 326 - Description of artificial sequence: Synthetic primer SEQ ID NO: 327 - Description of artificial sequence: Synthetic primer SEQ ID NO: 328 - Description of artificial sequence: Synthetic primer Accession No. 329 - Unknown description: REST peptide Phosphorylated Ser Phosphorylated Ser Accession No. 330 - Artificial sequence description: Synthetic oligonucleotide Accession No. 331 - Artificial sequence description: Synthetic oligonucleotide Accession No. 332 - Artificial sequence description: Synthetic primer Accession No. 333 - Artificial sequence description: Synthetic primer Accession No. 334 - Artificial sequence description: Synthetic primer Accession No. 335 - Artificial sequence description: Synthetic primer Accession No. 336 - Artificial sequence description: Synthetic primer Accession No. 337 - Artificial sequence description: Synthetic oligonucleotide Accession No. 338 - Artificial sequence description: Synthetic primer Accession No. 339 - Artificial sequence description: Synthetic primer Accession No. 340 - Artificial sequence description: Synthetic primer Accession No. 341 - Artificial sequence description: Synthetic primer Accession No. 342 - Artificial sequence description: Synthetic primer Accession No. 343 - Artificial sequence description: Synthetic primer Accession No. 344 - Artificial sequence description: Synthetic primer Accession No. 345 - Artificial sequence description: Synthetic primer Accession No. 346 - Artificial sequence description: Synthetic primer Accession No. 347 - Unknown description: REST peptide Accession No. 348 - Artificial sequence description: Synthetic primer D - Amino acid Accession No. 349 - Artificial sequence description: Synthetic polynucleotide Accession No. 350 - Artificial sequence description: Synthetic polypeptide

Claims

1. An isolated peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 15, 16, 17, 18, 22, 25, 31, 35, 60, 63, 64, 66, 68, 75, 81, 85, 110, 113, 114, and 116.

2. An isolated peptide which is a fusion peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 15, 16, 17, 18, 22, 25, 31, 35, 60, 63, 64, 66, 68, 75, 81, 85, 110, 113, 114, and 116, and a cell-penetrating peptide or an endosomal escape sequence fused to said amino acid sequence.

3. The isolated peptide according to claim 2, wherein the cell-penetrating peptide or the endosomal escape sequence is selected from the group consisting of SEQ ID NOs: 118-137 or 140-159.

4. The isolated peptide according to claim 2, wherein a linker connects the amino acid sequence and the cell-penetrating peptide or the endosomal escape sequence.

5. The isolated peptide according to claim 4, wherein the linker is selected from the group consisting of SEQ ID NOs: 138, 139, 160, and 161.

6. The isolated peptide according to claim 2, wherein the cell-penetrating peptide or the endosomal escape sequence is fused to the amino acid sequence at the N-terminus or the C-terminus.

7. The isolated peptide according to claim 6, wherein the fusion peptide is cyclized.

8. The isolated peptide according to claim 2, wherein the fusion peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 2 and 4-14.

9. The isolated peptide according to claim 1 or 2, which is used for inhibiting REST activity in vivo by contacting with CTDSP1.

10. The isolated peptide according to claim 1 or 2, which is used for treating traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumor (including glioblastoma multiforme), or pancreatic cancer in an animal.

11. The isolated peptide according to claim 1 or 2, which is used for treating, alleviating, or improving a disease selected from the group consisting of traumatic brain injury, chronic pain, peripheral nerve injury, epilepsy, diabetes, Alzheimer's disease, Huntington's disease, brain tumor (including glioblastoma multiforme), or pancreatic cancer by administering it to an animal in need thereof, and is effective for treating, alleviating, or improving said disease.

12. The isolated peptide according to claim 11, which binds to CTDSP1.

13. The isolated peptide according to claim 11, which is administered intravenously, subcutaneously, orally, or via mucosa.

14. The isolated peptide according to claim 11, which is administered multiple times over a certain period.

15. The isolated peptide according to claim 14, wherein the period is shorter than one month.

16. The isolated peptide according to claim 14, wherein the dosage is 0.01 mg / kg to 1 g / kg.

17. A pharmaceutical composition comprising the isolated peptide according to claim 1 or 2.

18. The pharmaceutical composition according to claim 17, wherein the isolated peptide is included in an oral solution, a caplet, a capsule, an injection, an infusion, a suppository, a lozenge, a tablet, a cream, an ointment, or an inhalant.

19. The pharmaceutical composition according to claim 17, which further comprises an excipient.

Citation Information

Patent Citations

  • Cell-penetrating peptide

    JP2006514602A

  • Direct reprogramming of somatic cells using ZSCAN4 and ZSCAN4-dependent genes

    JP2014513983A

  • Methods and compositions useful in manipulating the stability of re1 silencing transcription factor

    US20160031958A1