Use of GDF-5 variants for treating pain and cartilage destruction

The GDF-5 variant R399E, when injected intra-articularly, effectively addresses the challenges of osteoarthritis by promoting cartilage formation, reducing pain and inflammation, and halting disease progression, offering a unique solution to the limitations of existing treatments.

JP7700127B2Active Publication Date: 2025-06-30MERCK PATENT GMBH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022537606
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-12-18
Filing Date
2020-12-15
Publication Date
2025-06-30
Estimated Expiration
2040-12-15

AI Technical Summary

Technical Problem

Current treatments for osteoarthritis lack effective solutions that simultaneously address pain, inflammation, and structural changes in joint tissues, with no available therapy able to stop or reverse the disease progression.

Method used

The use of a GDF-5 variant, R399E, which is formulated for intra-articular injection, promotes cartilage formation while reducing bone formation, thereby addressing the structural changes and pain associated with osteoarthritis.

Benefits of technology

R399E demonstrates a rapid and sustained effect on pain reduction and improvement in joint tissue structure, preventing disease progression and normalizing joint homeostasis in both animal models and human tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007700127000003
    Figure 0007700127000003
  • Figure 0007700127000004
    Figure 0007700127000004
  • Figure 0007700127000005
    Figure 0007700127000005
Patent Text Reader

Abstract

The present invention relates to the use of a GDF-5 mutation variant with the amino acid exchange R399E for treating cartilage defects and pain, as well as pharmaceutical compositions of said GDF-5 variant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the use of a GDF-5 variant (R399E), its formulations, and therapeutic compositions for injection into patients suffering from osteoarthritis (OA) or other inflammatory joint diseases to reduce pain and inflammation.

Background Art

[0002] Osteoarthritis is the most common form of arthritis and affects millions of people worldwide. Osteoarthritis occurs when the protective cartilage that cushions the ends of bones wears away over time. Osteoarthritis can damage any joint, but this disorder most commonly affects the joints of the hands, knees, hips, and spine. The breakdown of cartilage homeostasis, regardless of its cause (aging, genetic predisposition, trauma, or metabolic disorders), induces profound phenotypic modifications of chondrocytes, which in turn promote the synthesis of a subset of factors that induce cartilage damage and target other joint tissues. Interestingly, many of these factors include components of the inflammatory pathway. Chondrocytes produce cytokines, chemokines, alarmin, prostaglandins, and adipokines and express numerous cell surface receptors for cytokines and chemokines, as well as toll-like receptors. These receptors activate intracellular signaling pathways involved in the inflammatory and stress responses of chondrocytes in OA joints (Houard et al., Curr. Reumathol Rep., Vol. 15, November 2013; 15(11):375). If there are only OA symptoms, they can be managed with analgesics for a certain period, but the damage to the joints cannot be reversed. By remaining active and maintaining a healthy weight, the progression of this disease can be slowed down and the improvement of pain and joint function can be supported. Nevertheless, there is no effective treatment available to stop or further reverse this disease. In most cases, both the destruction of the affected joints and the progression of pain significantly affect the patient's mobility, quality of life, and motor ability. In the case of patients with hip OA or knee OA, joint replacement surgery is often inevitable and the only treatment option, while in other joints, pain management is often the only option. According to recent literature, it has been shown that knee OA confirmed by X-ray is associated with a higher risk of cardiovascular disease, diabetes, and renal death, especially in people who develop this disease early or in obese people (Mendy et al., Int. J. Epidemiol. December 1, 2018; 47(6): 1821).

[0003] In 2015, it was reported that 10.5% (25.6 million) of non-institutionalized US adults had OA. Adults with OA incurred medical costs of $318.4 billion, which corresponded to 22.5% of the total medical costs of non-institutionalized US adults, and suffered $10.1 billion in wage losses. The prevalence of OA differed significantly by age (≥65 years, 25.3%), sex (female 13.3%; male 7.5%), and race / ethnicity (white 13.3%; African American 7.5%; Latino 4.2%; other 5.3%; P<0.001). Almost one-third (32.7%) of adults with OA received prescription opioids, compared with 13.8% of adults without OA (P<0.001). In regression analysis, adults with OA were significantly more likely to report moderate (adjusted odds ratio [AOR]=1.99 [95% CI: 1.65–2.40]) or severe (AOR=2.59 [2.21–3.04]) PIA, any functional limitation (AOR=2.51 [2.21–2.85]), and worse HRQoL in the SF-12 Physical Component Summary (adjusted beta=−3.88 [SE: 0.357]; P<0.001) than adults without OA. The adjusted incremental annual total medical costs and wage losses for adults with OA were $1,778 per person ($7,585 vs $5,807) and $189 per person ($740 vs $551), respectively, compared with adults without OA, amounting to an estimated national incremental direct cost of $45 billion and an estimated national incremental indirect cost of $1.7 billion (DOI: https: / / doi.org / 10.1016 / j.jval.2018.04.012).

[0004] Currently, there is no available treatment for osteoarthritis that demonstrates both beneficial effects on tissue structure pathology (cartilage, bone, synovium, meniscus, ligament) and rapid reduction of pain that is neither acute nor chronic. GDF-5 (Hotten et al., 1994, Biochem. Biophys Res. Commun. 204:646-652, NCBI accession number NM_000557, NP_000548) is a morphogen that has been shown to promote cell proliferation, differentiation, and / or tissue formation in several tissues. This protein is also known as bone morphogenetic protein-14 (BMP-14) or cartilage-derived morphogenetic protein-1 (CDMP-1). GDF-5 exhibits chondrogenic activity, and congenital GDF-5 mutations cause defects in the finger, wrist, and ankle joints of mice and humans (Storm et al., 1994; Thomas et al., 1997). The expression of GDF-5 is most prominently limited to the regions where joints are to develop and is one of the earliest markers of joint formation (Storm and Kingsley, 1999). BMP receptor signaling is required for the postnatal maintenance of articular cartilage (Rountree, 2004, PLoS Biol. November 2004, 2(1)). Treatment with wild-type GDF5 induces the formation of cartilage and bone. Therefore, a GDF5 single-point mutant in which the amino acid residue 399 arginine is replaced with glutamic acid was designed. Hereinafter referred to as R399E, R399E shows a reduction in bone-forming ability compared to wild-type GDF5 and maintains chondrogenic ability. R399E (GDF5 mutant) increases matrix production in primary porcine and human osteoarthritic chondrocytes (T. Mang, K. Kleinschmidt-Doerr, F. Ploeger, S. Lindemann, A. Gigout, DOI: https: / / doi.org / 10.1016 / j.joca.2018.02.176. April 2018, Volume 26, Supplement 1, Page S82).

[0005] R399E is claimed in International Publication No. WO 2013 / 083649 and shows an improved ability to induce chondrogenesis. The recombinant GDF-5 related proteins of this invention are particularly suitable for use in the treatment of diseases where cartilage formation is desirable but bone formation is not. Accordingly, another aspect of this invention is the use of the specified proteins, nucleic acids, vectors, or host cells in the treatment of such diseases. In particular, the said proteins, nucleic acids, vectors, or host cells are for use in the treatment of cartilage defects, or the treatment of traumatic fractures or detachments of cartilage, including osteoarthritis.

[0006] Field of GDF-5 GDF-5 related proteins that show an improved ability to induce bone formation and a reduced ability to induce bone formation. Such novel proteins are particularly useful in the treatment of cartilage defects where bone tissue formation is not desirable. Synovial joints are essential for the biomechanical function of the skeleton. Dysfunction as observed in arthritis diseases directly results in a severe loss of quality of life. Accordingly, joint biology has been the focus of extensive research over the years, leading to an understanding of joint anatomy and histology as well as the biomechanical properties and roles of articular cartilage and other components in joint function and maintenance.

[0007] GDF-5 (Hoetten et al., 1994, Biochem. Biophys Res. Commun. 204, pp. 646-652) is a morphogen that has been shown to promote cell proliferation, differentiation, and / or tissue formation in several tissues. This protein is also known as morphogenetic protein MP52, bone morphogenetic protein-14 (BMP-14), or cartilage-derived morphogenetic protein-1 (CDMP-1). GDF-5 exhibits chondrogenic activity, and congenital GDF-5 mutations cause defects in the finger joints, wrist joints, and ankle joints of mice and humans (Storm et al., 1994; Thomas et al., 1997). The expression of GDF-5 is most prominently limited to the regions where joints are to develop and is one of the earliest markers of joint formation (Storm and Kingsley, 1999). BMP receptor signaling is required for the postnatal maintenance of articular cartilage (Rountree, 2004, PLoS Biol. November 2004, 2(11)). GDF-5 is closely related to GDF-6 and GDF-7. These three proteins form distinct subgroups of the TGF-β superfamily and thus exhibit equivalent biological properties and a very high degree of amino acid sequence identity (see, e.g., Wolfman et al., 1997, J. Clin. Invest. 100, pp. 321-330). All family members are initially synthesized as larger precursor proteins and are then proteolytically cleaved at a cluster of basic residues approximately 110-140 amino acids from the C-terminus, thus releasing the C-terminal mature protein portion from the N-terminal prodomain. The mature polypeptides are structurally related and contain a conserved bioactive domain that includes six or seven canonical cysteine residues that carry the characteristic three-dimensional "cysteine knot" motif of these proteins. Native GDF-5-related proteins are homodimeric molecules that act primarily through interaction with a specific receptor complex composed mainly of type I and type II serine / threonine receptor kinases. The receptor kinases then activate Smad proteins, which in turn propagate the signal into the nucleus to regulate target gene expression.

[0008] Members of the GDF-5 / -6 / -7 subgroup have been repeatedly demonstrated to be important inductive and regulatory factors for bone and cartilage (Cheng et al., 2003, J. Bone and Joint Surg. 85A:1544-1552; Settle et al., 2003, Developm. Biol. 254:116-130). GDF-5 and related proteins bind and oligomerize to two types of membrane-bound serine-threonine kinase receptors designated type I and type II. Upon ligand binding, these complexes signal by phosphorylating members of the SMAD family of transcription factors, which upon activation enter the nucleus and regulate the transcription of responsive genes (Massague, 1996). Recent experiments have suggested the involvement of two different type I receptors, BMPR-IA and BMPR-IB, in skeletal patterning. Both receptors are expressed in a dynamic pattern during normal development. In several limb structures, for example, overlapping expression of BMPR-IA and BMPR-IB is observed in the interzone and perichondrium of joints (Mishina et al., 1995; Zou et al., 1997; Baur et al., 2000). With respect to the expression patterns of BMPR-IA and BMPR-IB, GDF-5 signaling should be achieved by interaction with both BMPR-IA and BMPR-IB (Chang et al., 1994; Zou et al., 1997). Null mutations in the bmpr-1b gene produce viable mice with defects in bone and joint formation that closely resemble those seen in GDF-5-deficient mice (Storm and Kingsley, 1996; Yi et al., 2000), but bmpr-Ia / mice are known to die early in embryogenesis (Mishina et al., 1995). However, conditional knockout of BMPR-IA under the control of the GDF-5-Cre driver circumvents embryonic lethality and produces viable mice with normally formed joints. However, postnatally, the articular cartilage within the joints wears away in a process reminiscent of osteoarthritis. This indicates the importance of this receptor in cartilage homeostasis and repair (Rountree et al., 2004).

[0009] The activity of wild-type proteins of the GDF-5 related protein family generally results in cartilage and bone formation. However, there are various medical conditions where cartilage formation is desirable but bone tissue formation is not. For example, in the case of joint defects, it is clear that cartilage formation is desirable but ossification should be avoided. Surprisingly, it has been found that it is possible to provide variants of GDF-5 related proteins that exhibit an improved ability to induce cartilage formation and a reduced ability to induce bone formation. This can be achieved by modifying the GDF-5 related protein (R399E) such that it shows an increased affinity for BMPR-IB and / or a reduced affinity for BMPR-IA, which is the subject of WO 2013 / 083649 pamphlet, the closest prior art. Wild-type GDF-5 binds to BMPR-IB with an affinity (KD about 8 - 27 pM) that is about 40 - 120 times higher compared to BMPR-IA (KD about 1 - 1.1 nM) in vitro. It has been found that by modifying the binding affinity of the GDF-5 related protein such that the affinity for BMPR-IB is increased while the affinity for BMPR-IA is reduced, cartilage formation is promoted while bone formation is reduced. This can be achieved by specific substitution of one or more amino acid residues related to the BMPR-IB and / or BMPR-IA binding sites in the amino acid sequence of the GDF-5 related protein.

[0010] The binding affinity of the GDF-5 related protein having specific substitutions is compared to that of the human wild-type GDF-5 related protein, particularly human wild-type GDF-5. To avoid misunderstanding and ambiguity, some terms frequently used herein are defined and exemplified as follows. The term "cysteine knot domain", as used herein, refers to a well-known and conserved cysteine-rich amino acid region that is present in the mature portion of TGF-beta superfamily proteins, such as human GDF-5, and forms a three-dimensional protein structure known as the cysteine knot. In this domain, the corresponding positions of cysteine residues relative to each other are important, and only minor changes are tolerated in order not to lose biological activity. It has been demonstrated that the biological function of this protein is sufficient with the cysteine knot domain alone (Schreuder et al. (2005), Biochem Biophys Res Commun. 329, 1076-86). The consensus sequence of the cysteine knot domain is well-known in the art. According to the definition provided herein, the cysteine knot domain of a protein begins with the first cysteine residue that contributes to the cysteine knot of the corresponding protein and ends with the residue following the last cysteine that contributes to the cysteine knot of the corresponding protein.

[0011] As used herein, the term "GDF-5 related protein" means any naturally occurring or artificially created protein that is very closely related to human growth / differentiation factor 5 (hGDF-5). A feature common to all GFD-5 related proteins is the presence of a cysteine knot domain having at least 60 percent amino acid identity to the 102 amino acid cysteine knot domain of human GDF-5 (amino acids 400-501). This is sufficient for the biological function of this protein. The term "GDF-5 related protein" includes proteins belonging to the group of GDF-5, GDF-6, and GDF-7 proteins derived from vertebrate or mammalian species, as well as their recombinant variants as long as such proteins exhibit the percentage of identity mentioned above with the cysteine knot domain of human GDF-5. The 60 percent threshold is well suited to distinguish members of the GDF-5 / -6 / -7 group of proteins and their variants from further proteins such as more distantly related GDFs and BMPs. Comparing the 102 amino acid cysteine knot domains of human GDF-5, human GDF-6, and human GDF-7 reveals a high degree of amino acid identity between such proteins. Human GDF-6 shares 87 (85 percent) identical residues with the cysteine knot domain of human GDF-5, and human GDF-7 shares 83 (81 percent) identical residues. The respective domains of GDF-5 / -6 / -7 molecules from other vertebrate and mammalian species identified to date also exhibit a very high percentage of identity of at least 75 percent (79 percent - 99 percent) when compared to human GDF-5. In contrast, GDFs and BMPs not belonging to the GDF-5 / -6 / -7 subgroup exhibit much lower identity values of less than 60 percent.

[0012] Non-limiting examples of vertebrate and mammalian GDF-5 related proteins include the precursor and mature proteins of human GDF-5 (disclosed as MP52 in WO 95 / 04819 and as human GDF-5 in Hotten et al., 1994, Biochem. Biophys Res. Commun. 204: 646-652), recombinant human (rh) GDF-5 / MP52 (WO 96 / 33215), MP52Arg (WO 97 / 06254); HMW human MP52s (WO 97 / 04095), CDMP-1 (WO 96 / 14335), mouse (Mus muscle) GDF-5 (U.S. Patent No. 5,801,014), rabbit (Oryctolagus cuniculus) GDF-5 (Sanyal et al., 2000, Mol Biotechnol. 16: 203-210), chicken (Gallus gallus) GDF-5 (NCBI accession number NP_989669), African clawed frog (Xenopus laevis) GDF-5 (NCBI accession number AAT99303), monomeric GDF-5 (WO 01 / 11041 and WO 99 / 61611), human GDF-6 / BMP-13 (U.S. Patent No. 5,658,882), mouse GDF-6 (NCBI accession number NP_038554), GDF-6 / CDMP-2 (WO 96 / 14335), human GDF-7 / BMP-12 (U.S. Patent No. 5,658,882), mouse GDF-7 (NCBI accession number AAP97721), GDF-7 / CDMP-3 (WO 96 / 143335). GDF-5 related proteins having additional mutations such as substitutions, additions, and deletions are also encompassed by the present invention so long as such additional mutations do not completely abolish biological protein activity.

[0013] Consideration Regarding Background Art There are no drugs available to treat both the pain and inflammation of OA patients rapidly, continuously, and simultaneously, and to continuously treat the structural changes of joint tissues and morphological features (cartilage, bone, synovium, meniscus, ligament).

[0014] Drugs that can assist in reducing the symptoms of osteoarthritis and mainly pain, but have no effect on the structure or may even show a negative effect, include the following: Acetaminophen. Acetaminophen (such as Tylenol) has been shown to help some people with osteoarthritis who have mild to moderate pain. Taking more acetaminophen than the recommended dose may cause liver damage. Non-steroidal anti-inflammatory drugs (NSAIDs). Commercially available NSAIDs such as ibuprofen (such as Advil, Motrin IB) and naproxen sodium (such as Aleve) taken at the recommended dose typically reduce osteoarthritis pain. Stronger NSAIDs are available by prescription. NSAIDs can cause stomach upset, cardiovascular problems, bleeding problems, and liver and kidney damage. NSAIDs in the form of gels applied to the skin covering the affected joint have fewer side effects and can similarly reduce pain. Duloxetine (Cymbalta). This drug, usually used as an antidepressant, is also approved for the treatment of chronic pain, including osteoarthritis pain. Cortisone injection. Injections of corticosteroid drugs can reduce joint pain. The number of cortisone injections a patient can receive each year is generally limited to 3 to 4 injections because this drug may worsen joint damage over time. An anti-NGF (nerve growth factor) antibody (tanezumab, Pfizer) is currently in clinical development for OA. This compound is highly effective in treating pain in OA patients, but like other analgesics, it does not show a beneficial effect on the underlying cause of the disease. In contrast, in a significant number of patients treated with anti-NGF, disease progression was significantly accelerated (RPOA = rapidly progressive OA). The overall incidence of RPOA was 6.3 percent in the tanezumab 5 mg group, 3.2 percent in the tanezumab 2.5 mg group, and 1.2 percent in the NSAID group. The inventors confirmed these negative effects of anti-NGF treatment in OA animal models of rats and rabbits.

[0015] Analgesics available for treating OA pain exhibit significant side effects and adverse events. None of them slow down or prevent disease progression, nor do they show a beneficial effect on joint structure. None of them show either a healing or beneficial biological activity on cartilage matrix production, nor do they restore the balance of the pathological shift in joint homeostasis. Some (tanezumab) even accelerated disease progression in OA patients.

[0016] Other available OA therapies are either surgical procedures or do not show a disease-modifying effect: Lubricant injection. Injection of hyaluronic acid can provide some cushioning to the knee and thus relieve pain, but studies suggest that such injections do not provide greater relief than a placebo and have no effect on structural changes and histopathology. Joint replacement. In joint replacement surgery (arthroplasty), the surgeon removes the damaged joint surfaces and replaces them with plastic and metal parts. Surgical risks include infection and thrombosis. Artificial joints can wear out or loosen and may ultimately need to be replaced.

[0017] There is one structure-modifying factor in clinical development for OA, but this molecule does not show a beneficial effect on OA pain. Fibroblast growth factor 18 (FGF18, sprifermin, Merck) has been shown to induce chondrocyte proliferation. Sprifermin increased the total femorotibial joint cartilage thickness by 0.5 mm in OA patients after 2 years in a Phase II trial. There was no statistically significant difference in the mean absolute change from baseline in the total WOMAC pain score for any of the sprifermin groups compared to placebo.

[0018] There is no treatment that slows or halts OA disease progression, shows a healing or beneficial biological activity on cartilage matrix production, restores the balance of the pathological shift in joint homeostasis, and at the same time affects OA pain. An effective disease-modifying OA treatment must be safe as a lifelong treatment because it is thought to be necessary to administer it repeatedly, especially when associated with systemic or anatomical changes. High systemic drug exposure after systemic treatment would increase the risk of unwanted systemic effects or effects on the cartilage, synovium, and bone of non-diseased joints. On the other hand, intra-articular injections are not recommended more frequently than six times a year. There are no compounds that show beneficial effects on the structure and pain of OA and are effective with intermittent treatment.

[0019] R399E shows a rapid and sustained effect on pain and, at the same dose, reduces cartilage destruction, induces the production of cartilage matrix, and normalizes joint homeostasis in OA animal models and human tissues, thereby preventing disease progression, making it the first therapeutic approach to do so. The in vivo beneficial effects of R399E on OA pain have been confirmed in two species (Figures 1 and 2). Also, the beneficial effects of R399E on the cartilage structure of OA have been confirmed in two species (Figures 15, 16, 17). Other known molecules, proteins, or combinations of prior art do not show beneficial effects on OA pain and cartilage structure. Furthermore, R399E reduces inflammation and cytokine release in related in vitro experiments using tissues and primary cells from healthy animals and in human OA joint replacements that enable the normalization of joint homeostasis (Figures 8, 9, 10, 11, 13). R399E inhibits PGE2 release in related healthy animal and human OA in vivo experiments and further inhibits NGF-induced PGE2 production in OA meniscus cells (Figures 8, 12). PGE2 is an important mediator of cartilage degradation and pain (Lee et al., Gene. September 25, 2013; 527(2):440-447). R399E shows an anti-catabolic effect by preventing the release of GAG (Chun et al., Tissue Eng. Regen Med July 5, 2019; 16(4):385-393), and in in vitro experiments in human OA tissues and cell cultures and healthy porcine cells, it reduces the release and expression of ADAMTS5, MMP13, and MMP1 (Figures 8, 13, 14). Matrix metalloproteinases such as ADAMTS5 and MMP13 play important roles in the development of OA (Bondeson et al., Clin Exp Rheumatol. January - February 2008; 26(1):139-145, and Xie et al., ChemMedChem. August 8, 2017; 12(15):1157-1168). R399E shows an anabolic promoting effect in healthy animals and human OA tissues and cell cultures (Figures 18, 19, 20, 21, 22).R399E shows induction of glycosaminoglycan and hydroxyproline synthesis and gene expression of collagen-II, collagen-VI, Sox9, and aggrecan in immunohistology and gene expression analysis (Figure 21). Treatment of human OA chondrocyte cell cultures with R399E shows an effect on chondrogenesis even at low dosing frequencies of R399E.

[0020] The anabolic promoting effect of R399E is also shown by upregulation of biomarkers such as proC2, proC6, and CILP-2, which are expected to show a positive trend in OA. This is shown for human OA tissue in Figure 23. R399E readily penetrates into cartilage and can be found within the cartilage matrix near cells 7 days after IA injection. In an IA rabbit PK study, R399E was found in synovial fluid and cartilage, and 6 μg of injected R399E was detectable by day 3. Injection of 60 μg of R399E could be detected in synovial fluid for 14 days and in cartilage for up to 7 days. Despite increased molecular stability compared to GDF5 wild type, the serum half-life did not exceed 3.20 hours and was quantifiable up to 72 hours in minipigs and rabbits. Also, in pharmacokinetic and non-clinical safety studies, there were no issues with the safety profile upon IA and IV application in rats, minipigs, and rabbits. Considering the low solubility of approximately 1 μg / mL in biological fluids at physiological pH, the inventors do not anticipate an increased safety risk due to increased stability.

[0021] Intermittent local (intra-articular) treatment with R399E is sufficient to show beneficial effects on pain and structure, with low systemic exposure and very short duration. In contrast to GDF5 wild type, R399E is rapidly absorbed from the surrounding fluid when cartilage is present. This not only makes intra-articular treatment with R399E very effective but also safe. R399E shows a rapid and sustained effect on pain in a translational osteoarthritis model at the same dosages and regimens that produce beneficial effects on structure. A model was used that allows comparison of the pharmacodynamic effects to those of drugs clinically effective against either pain (anti-NGF antibody, triamcinolone) or structure (surfermin).

Summary of the Invention

[0022] A preferred embodiment of the invention is the intra-articular (IA) injection of R399E into the joints of osteoarthritis patients with and without joint inflammation to reduce inflammation and pain and improve joint tissue structure. Furthermore, R399E reduces local cytokine and prostaglandin E2 production, thereby reducing joint inflammation and pain. R399E reduces local ADAMTS5 and MMP-13 production, thereby not only preventing cartilage cleavage but also further reducing joint inflammation and pain by preventing DAMP release, which can also prevent DAMP sensitization of neurons. Also, the reduction in cytokine production can restore responsiveness to endogenous BMP and the treatment itself by reducing the downregulatory effect on BMPR expression. R399E can directly induce extracellular matrix formation in osteoarthritis chondrocytes, thereby assisting in the structural repair of osteoarthritis joints.

[0023] IA inject R399E into the joint after a traumatic event to prevent cartilage or meniscus degradation and reduce inflammation. This will reduce the risk of later developing osteoarthritis. The present invention is based on the inventors' finding that it is possible to modify this protein such that its ability to induce chondrogenesis is enhanced and its ability to induce osteogenesis is reduced by making specific modifications to regions of the amino acid sequence of a GDF-5 related protein involved in binding to BMPR-IB and / or BMPR-IA. It has been found that proteins with increased affinity for BMPR-IB and / or decreased affinity for BMPR-IA can induce better chondrogenesis while reducing bone formation. Such properties are particularly prominent in proteins that exhibit both an increase in affinity for BMPR-IB and a decrease in affinity for BMPR-IA. The GDF-5 related proteins of the present invention can be obtained by chemical modification or genetic engineering techniques, and recombinant proteins are preferred. The proteins can be obtained by replacing at least one amino acid residue related to the BMPR-IB and / or BMPR-IA binding site in the amino acid sequence of the GDF-5 related protein.

[0024] The protein used for injection into patients suffering from OA or other inflammatory diseases is a variant of human GDF-5 in which the arginine residue at position 399 is replaced by glutamic acid (R399E). Referring to the mature sequence of GDF-5, this corresponds to the substitution at position 18. Surprisingly, it has been found that this protein variant has a significantly reduced affinity for BMPR-IA. In contrast, the affinity for BMPR-IB is hardly affected. Preferably, the GDF-5 related protein (R399E) of the present invention exists as an "isolated" protein. This means that the protein of the present invention is substantially separated from other protein and peptide molecules (e.g., other polypeptides of the protein of the natural source) present in the natural source of the isolated protein. For example, a recombinantly expressed peptide is considered to be isolated. According to a preferred embodiment of the present invention, the variant protein is a recombinant protein. Further, a peptide is also considered to be isolated when it has been modified by artificial intervention or is expressed by an organism other than its natural source. Further, an "isolated" protein does not contain other cellular substances that are naturally associated, or in the case of production by recombinant techniques, does not contain a cell culture medium, or in the case of chemical synthesis, does not contain a chemical precursor or a part of other chemical substances. In particular, an unpurified mixture or composition is excluded from the definition of an "isolated" protein.

[0025] A further subject of the present application is a pharmaceutical composition comprising a recombinant GDF-5 related protein or nucleic acid or vector or host cell according to the present invention. In principle, any pharmaceutical composition already disclosed in the context of GDF-5 related proteins is suitable. An expression vector or a host cell can be considered advantageous as an active substance in a pharmaceutical composition. Also, a combination of the protein according to the present invention with other proteins can be used in a preferred pharmaceutical composition. Of course, the present invention also includes pharmaceutical compositions containing further substances such as, for example, pharmaceutically acceptable additives or carriers. The formulation may include antioxidants, preservatives, colorants, flavorings and emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, and / or pharmaceutical adjuvants. For example, a suitable carrier or vehicle may be water for injection, physiological saline, or physiological saline mixed with a suitable carrier protein such as serum albumin. A preferred antioxidant for preparing the composition of the present invention is ascorbic acid.

[0026] The solvent or diluent of the pharmaceutical composition may be either aqueous or non-aqueous and may contain other pharmaceutically acceptable excipients capable of modifying and / or maintaining the pH, osmotic pressure, viscosity, clarity, scale, sterility, stability, dissolution rate, or aroma of the formulation. Similarly, the pharmaceutical composition according to the present invention may contain other components to modify and / or maintain the release rate of the pharmaceutically effective substance. Such modifying components are substances commonly used in the art for formulating a dosage for parenteral administration into either a unit dosage form or a multi-dose dosage form.

[0027] The final formulated pharmaceutical composition prepared according to the present invention can be stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations can be stored either in a ready-to-use form or, in the case of a lyophilized powder, for example, in a form that requires reconstitution prior to administration. The above and further suitable pharmaceutical formulations are known in the art and are described, for example, in Gus Remington’s Pharmaceutical Sciences (18th Edition, Mack Publishing Co., Eastern, Pennsylvania, 1990, pages 1435-1712). Such formulations can affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the pharmaceutically effective component.

[0028] Other effective administration forms include parenteral sustained release, i.e., delayed formulations, inhaled mists, or orally active formulations. For example, the sustained release formulation may contain a protein bound or incorporated into a particulate preparation of a polymeric compound (such as polylactic acid, polyglycolic acid, etc.) or liposomes. Also, the pharmaceutical composition according to the present invention may be formulated, for example, for parenteral administration by infusion or injection and may include sustained release or sustained circulation formulations. Such therapeutically administered parenteral compositions are typically in the form of a pyrogen-free parenterally acceptable aqueous solution containing a pharmaceutically effective component in a pharmaceutically acceptable carrier and / or diluent. The pharmaceutical composition may contain a matrix material, for example, when cartilage regeneration is intended. Proteins, nucleic acids, expression vectors, or host cells are advantageous when applied within and / or on the biocompatible matrix material. As used herein, the matrix material means a carrier or substrate that acts as a scaffold for cell recruitment, attachment, proliferation, and differentiation and / or as a potential delivery and storage device for the recombinant GDF-5-related proteins of the present invention. In contrast to a solid substrate, a carrier does not have a clearly defined surface and lacks a specific shape, and is an amorphous material composed of, for example, alkylcellulose, Pluronic® gelatin, polyethylene glycol, dextrin, vegetable oil, sugar, and other liquids and viscous substances.

[0029] Exemplary matrix materials are described, for example, in WO 98 / 21972 pamphlet. Such matrix materials are equally suitable for the proteins according to the present invention. The matrix material can be transplanted surgically into a patient, for example, in which case the protein or DNA encoding the protein can be slowly released from the matrix material and can then be effective over a long period of time. All types of matrix materials are useful in the present invention as long as they are biocompatible and selected for the region or indication of interest. The matrix material may be a natural material, a modified natural material, or similarly a synthetic material. All known substrates for morphogenetic proteins are included. For example, the extracellular matrix contains various collagens such as types I, II, V, IX, X, XI, and XIII, additional proteoglycans and glycosaminoglycans such as chondroitin sulfate, biglycan, decorin, and / or hyaluronic acid, or non-collagen proteins such as osteopontin, laminin, fibronectin, vitronectin, and cartilage matrix protein. Also, all of the natural materials mentioned can be used in an artificially modified form. For a non-limiting list of useful carriers and substrates, further reference may be made to Kirker-Head, 2000, Advanced Drug Delivery 43, pp. 65-92.

[0030] A further possibility relates to liposomal formulations comprising a recombinant GDF-5 related protein according to the present invention. The liposomes used in the above formulations are generally known to those skilled in the art. In particular, preferred liposomal formulations are disclosed in WO 2008 / 049588 pamphlet. More preferred liposomal formulations are described on pages 9-13 of WO 2008 / 049588 pamphlet. Furthermore, the GDF-5 variant protein (R399E) of the present invention can be administered in combination with other pharmaceutically active substances. The above pharmaceutically active substances may be, for example, analgesics such as topically effective analgesics, or other substances that show a positive effect on diseases where cartilage formation is desired, such as protease inhibitors. These are merely examples of possible additives, and those skilled in the art can easily add other excipients that are used in pharmaceutical preparations or are generally considered safe.

[0031] Due to the improved ability to induce chondrogenesis, the recombinant GDF-5 variant protein of the present invention is particularly suitable for use in the treatment of diseases where cartilage formation is desired but bone formation is not. Accordingly, another aspect of the present invention is the use of such a protein (R399E), nucleic acid, vector, or host cell in the treatment of such diseases. In particular, the protein, nucleic acid, vector, or host cell is for use in the treatment of cartilage defects, or for traumatic fractures or detachment of cartilage, especially age-related cartilage defects due to wear, for example, osteoarthritis, rheumatoid arthritis, sports disease-related injuries such as meniscus injuries or ligament ruptures, diseases that may affect cartilage such as chondrodystrophy, diseases characterized by growth disorders and subsequent chondro-ossification, achondrogenesis, costochondritis, intervertebral disc herniation and repair, relapsing polychondritis, and for the repair of cartilage defects associated with either benign or malignant tumors such as chondroma or chondrosarcoma. Another aspect is a method for treating a disease in which cartilage formation is desirable but bone formation is not desirable, the method comprising administering to a patient in need of such treatment a protein, nucleic acid, vector, or host cell according to the present invention.

[0032] As used herein, the term "treating" refers to reversing, alleviating, or inhibiting the progression of a disease, disorder, or condition, or one or more symptoms of such disease, disorder, or condition to which such term applies. Also, as used herein, "treating" can refer to reducing the probability or incidence of a disease, disorder, or condition occurring in a mammal as compared to an untreated control population or as compared to the same mammal prior to treatment. For example, as used herein, "treating" can refer to preventing a disease, disorder, or condition, including delaying or preventing the onset of the disease, disorder, or condition, or delaying or preventing symptoms associated with the disease, disorder, or condition. Also, as used herein, "treating" can refer to reducing the severity of a disease, disorder, or condition, or symptoms associated with such disease, disorder, or condition, in a mammal before the mammal experiences pain from the disease, disorder, or condition. Such prevention or reduction of the severity of a disease, disorder, or condition before pain is felt relates to administering a composition of the present invention as described herein to a subject that is not experiencing pain from the disease, disorder, or condition at the time of administration. Also, as used herein, "treating" can refer to preventing the recurrence of a disease, disorder, or condition, or the recurrence of one or more symptoms associated with such disease, disorder, or condition.

Brief Description of the Drawings

[0033]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11A-D

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Mode for Carrying Out the Invention

[0034] Table 1 Treatment scheme and study outline of KK-rat-14-09 Three different regimens and nine doses were tested in the rat ACLT + pMx OA model. The study was carried out with n = 10 animals per group. The numbers in the gray cells indicate the doses applied intra-articularly (IA) in ng in a total volume of 30 μl. Gait analysis was performed every 2 weeks and von Frey hypersensitivity test was performed at week 15 or 16. Table 2 Pain readings in the rat osteoarthritis model Symptomatic benefits of IA R399E treatment at different doses and regimens in the rat OA instability model. Only effects > 30% better than placebo are listed in this table. The most effective and sustainable effect was seen when rats were injected with 1350 ng twice every 6 weeks.

Examples

[0035] [Example 1] In a surgically induced chronic rat OA model, a single intra-articular (IA) injection of R399E, when administered 12 weeks after joint destabilization surgery, shows a significant effect on pain within 14 days in late-stage disease (see CB-rat-14-029, Figure 1). Since joint changes are equivalent to those found in OA patients (cartilage damage, osteophytes, subchondral sclerosis, gait impairment, and hypersensitivity based on inflammation), anterior cruciate ligament transection (ACLT) with medial meniscus (pMx) resection has been established in tissue as an unstable OA model in rodents. The gait difficulty symptoms determined by the catwalk test were used as a primary readout similar to the clinical questionnaire asking patients to rate the pain experienced while walking on a flat surface (see Ferreira-Gomes et al., The journal of pain: official journal of the American Pain Society. October 2008; 9(10):945-54. PubMed PMID: 18650131). ACLT + pMx surgery-induced joint instability led to punctate abnormal loading causing cartilage erosion on the medial tibial condyle as early as within 1 week (see Naveen et al., International journal of medical sciences. 2014; 11(1):97-105. PubMed PMID: 24396291. Pubmed Central PMCID: 3880996).

[0036] Lameness typically occurs one week after surgery (post-operative pain), followed by an asymptomatic period, and finally recurs during the late chronic OA phase. This late lameness period is understood to be the OA pain phase. To investigate whether a single injection of R399E can produce symptomatic benefits prior to the structural repair effect, in CB-rat-14-029, R3399E was administered as a single injection (3 doses IA) 12 weeks after ACLT + pMx surgery when lameness due to chronic OA pain was well established. After acclimating the rats to the test facility for 3 weeks, the rats were subjected to either sham surgery (skin incision) or ACLT + pMx surgery. To determine OA pain-related symptoms, lameness was determined using the CatWalk test at 10, 11, and 12 weeks after surgery. All rats showing lameness symptoms were randomized into four treatment groups (three groups with different doses of R399E and a placebo control), and a single IA injection was performed on the 81st day after ACLT + pMx surgery. Based on the gait parameter that was most sensitive to ACLT + pMx surgery during this 3-week period, the inventors identified 8 rats as asymptomatic and excluded them from the study. The remaining 40 rats were randomized into four groups based on lameness, and either IA placebo or R399E (90 ng, 900 ng, or 9000 ng / joint) was administered on the 80th day after surgery. As pre-specified in the analysis plan, the treatment effect was determined using the CatWalk test 1, 3, 7, and 14 days after this single injection, and the mean of all four measurements was compared between groups. During this period, it was identified that six gait parameters were significantly different between the sham + placebo group and the ACLT + pMx + placebo group, and therefore they were used to explain OA disease-related symptoms. The inventors found that during this period, immediately after injection, all of these disease-related gait parameters were positively affected by the injection of R399E. The percent benefit relative to placebo for all eligible parameters revealed that 900 ng / joint of R399E was the most efficient dose, producing a 60% symptomatic benefit. The lowest dose [90 ng / joint] showed little effect, and the highest dose [9000 ng / joint] produced a 40% benefit relative to placebo (see Figure 1).

[0037] [Example 1.1] In the same rat model used in Example 1, the effect of R399E on OA pain persists for at least 6 weeks until the next injection (see KK-rat-14-009, Figure 2, and Tables 1 and 2). KK-rat-14-009 was designed to investigate whether symptomatic benefits are shown in a chronic rat osteoarthritis pain model when chronic intra-articular (IA) injection of R399E is always administered at different doses and regimens using the same surgical rat OA model. Based on the in vitro EC50 for cartilage matrix production being 108 ng / ml (see Figure 20) and a dose of 2000 ng being effective every two weeks in a rabbit pre-study (data not shown), doses of 0.9 to 9000 ng per month, and doses of 135 ng, 1350 ng every 6 weeks, and 45 ng and 450 ng every two weeks were selected respectively (see Table 1). Rats were treated for 17 weeks after surgery, and symptoms were measured with a CatWalk gait analysis device and a von-Frey hyperalgesia test. During the course of the chronic disease (weeks 12 to 16 after surgery), untreated rats develop symptoms that can be measured as gait impairment by the CatWalk device or mechanical hyperalgesia by the von-Frey test. According to a pre-specified analysis plan, the inventors calculated the average of the CatWalk measurements from weeks 12 to 16 and considered a value 30% higher than the vehicle to be significant. For the von-Frey measurement at week 16, the vehicle control benefit limit was also defined as 30%.

[0038] Analysis of the gait difficulty determined by the CatWalk test revealed that a regimen of 45 ng every two weeks provided a 16% benefit over the ACLT + pMx + vehicle group. A regimen of 450 ng injected every two weeks reached a 20% benefit, but was still neither statistically significant nor meaningful. In the four-week regimen, 0.9 ng provided a 52% significant benefit over ACLT + pMx + vehicle, 9 ng showed no effect at 4.4%, 90 ng showed a statistically significant effect at 82%, 900 ng showed no effect at 1.4% over ACLT + pMx + vehicle, and 9000 ng showed no meaningful effect at 17%. The corresponding doses in the regimen of 135 ng / injection every six weeks showed a tendency of a 22% benefit over ACLT + pMx + vehicle, but the higher dose of 1350 ng / injection showed a statistically significant and meaningful benefit of 47% over ACLT + pMx + vehicle (see Figure 2 and Table 2).

[0039] In the von-Frey hyperalgesia test, injections every two weeks provided a 104% reduction in hypersensitivity at 45 ng, which was significant by two-sided t-test, and a 68% benefit at 450 ng. In the four-week regimen, again, 0.9 ng (71% benefit) and 90 ng (91% benefit) significantly reduced hypersensitivity, but 9 ng (-5%) and 9000 ng (-12%) showed no effect. However, in the von-Frey test, the 900 ng group also reached a 90% benefit over the vehicle, but there was no statistical significance. In the regimen every six weeks, the vehicle (vehicle) group showed less hypersensitivity, and the variability was higher than that of the vehicle group that was treated more frequently and did not reach statistical significance compared to the sham group. Injections of 135 ng every six weeks showed a 16% benefit over the vehicle, and 1350 ng showed a 70% effect (see Table 2).

[0040] [Example 2] In the surgical induction rabbit OA model, a single intra-articular injection of R399E showed a significant effect on pain within 6 hours. This effect lasted for at least 2 weeks until the next injection. This result was confirmed in two independent studies (see Figures 3 and 4). In KK-rabbit-16-01, anesthetized rabbits were positioned on a warming pad, and a 5% glucose solution was slowly infused intravenously during the operation. The right knee joint was shaved and disinfected. Using a scalpel and forceps, the skin, muscle, and capsule were opened. The patella was positioned laterally, and the adipose body was incised to expose the anterior cruciate ligament. The ligament was cut using small clamps and a scalpel. The anterior horn of the meniscus was exposed and detached from the meniscus-tibial ligament. After fixing with small forceps, the anterior half of the meniscus was resected. The joint was washed with sterile saline solution, and the capsule and skin were closed in three layers using absorbable suture material. The rabbits were kept in the cage until they fully recovered from the anesthesia and then returned to the group. Until the end of the study, the rabbits were able to move freely and jump in a 56m 2 cage. To evaluate joint loading, an ink capacitance test was performed. The body weight load on each hind limb was measured with a pressure plate and electronically recorded as the ratio of the right operated knee joint to the left unoperated knee joint of the same hind limb as follows: right limb / (right limb + left limb) * 100. The ink capacitance device used was specially made for well-trained group-housed rabbits, which was easy to handle and did not require fixation for immobilization. The rabbits were placed on this device, and the hind limbs were positioned at the center of the pressure measurement plate. To prevent the influence of the observer, the observer neither fixed nor touched the animal during the measurement. The measurement was controlled by the connected PC, and the data was automatically collected and did not depend on the observer. Each measurement took approximately 5 seconds and was manually stopped when stable data exceeding a minimum of 3 seconds was obtained. Rarely, when the animal did not remain stationary, the measurement was stopped and then repeated.

[0041] The ACLT + pMx surgery resulted in significant unloading of the right hind limb at 1, 2, 3, 5, 7, 9, 11, and 12 weeks post-surgery. The joint loading shifted from a 50:50% load of the right hind limb to the left hind limb to approximately a 66:34% load of the left (unoperated) to the right (operated) hind limb. Animals were injected intra-articularly (IA) with placebo (R399E vehicle), 0.6, 6, or 60 μg of R399E starting 1 week after surgery and then every 14 days for a total of 6 times. The animals were euthanized at week 13, 2 weeks after the last injection. Six hours after the first injection (first measurement), all test doses of R399E had already significantly restored the load on the right hind limb, resulting in an approximate left:right load ratio of 60:40. This represents a 36.5% benefit at 0.6 μg (p = 0.0023), 45.2% benefit at 6 μg (p = 0.0002), and 38.9% benefit at 60 μg (p = 0.0016) (see Figure 3).

[0042] [Example 3] In a surgically induced rabbit OA model, the onset of the R399E effect on pain after a single intra-articular injection was as immediate as that of clinically effective triamcinolone in the acute and early inflammatory stages 1 week after surgery. The effect of R399E on pain reached statistical significance at all doses, although the effect of triamcinolone was slightly lower (Figure 4). In KK-rabbit-17-01, the same surgically induced OA model and study design as in KK-rabbit-16-01 were used, with the aim of comparing the effect of R399E with the effect size of clinically effective triamcinolone in the initial and acute stages 1 week after surgery. As described above, osteoarthritis-like cartilage degradation was experimentally induced in 62 female 36 - 37-week-old New Zealand White (NZW) rabbits by transection of the anterior cruciate ligament (ACLT) and partial anterior resection of the medial meniscus (pMx). The animals were randomly assigned to 5 groups by body weight. Four groups received 0 μg (vehicle control, n = 13), 0.6 μg (n = 12), 6 μg (n = 13), and 60 μg (n = 13) of R399E in 200 μl vehicle per injection. An additional experimental group 5 (n = 11) was injected with triamcinolone (1 × IA injection at week 1 after surgery) to compare the pharmacological effect of R399E with triamcinolone, which has shown symptomatic efficacy in OA patients. Intra-articular (IA) treatment was initiated with the first injection 1 week after surgery. Triamcinolone and all test doses 0.6 μg (38.3% vs. vehicle, p < 0.01), 6 μg (48% vs. vehicle, p < 0.001), and 60 μg (42.7% vs. vehicle, p < 0.01) already showed a significant effect on pain 6 hours after the first injection (see Figure 4).

[0043] [Example 4] The pain-reducing effects of 6 and 60 μg of R399E injected IA into the operative knee during the acute early postoperative period in the rabbit OA model persisted for at least 2 weeks until the next injection, while the effect of 1.41 mg of triamcinolone was already gone 1 week after the first injection (Figure 5). In KK-rabbit-17-01, as described above, osteoarthritis-like cartilage degradation was experimentally induced in female rabbits by anterior cruciate ligament transection (ACLT) and partial anterior resection of the medial meniscus (pMx). Two weeks after surgery, >30% symptomatic effects compared to placebo were explained by 6 μg (35.7%, p = 0.0802) and 60 μg (40.8%, p = 0.0417) of R399E, and the symptomatic effect of triamcinolone (-11.6%, p = 0.89) was completely lost, and the animals showed an even higher tendency to reduction at that time than placebo-treated animals (see Figure 5).

[0044] [Example 5] IA injection of R399E also shows a beneficial effect on pain during the chronic phase of the surgically induced OA model in rabbits (Figure 6). Throughout the KK-Rabbit-16-01 experiment described above, the medium dose of 6 μg showed the highest observed average effect over time, with 49% at week 2, 57% at week 3, 55% at week 5, 60% at week 7, 69% at weeks 9 and 11, and 72% at week 12 (p = 0.0001 at all time points). The 0.6 μg (p = 0.0027) and 60 μg (p = 0.0001) groups reached approximately 40% of the maximum effect level relative to the vehicle at weeks 5 - 7. Thereafter, this effect size remained stable until the end of the study, although the effect of 0.6 μg (approx. 50% benefit) was slightly higher than that of 60 μg (approx. 40%) from week 9 onwards (see Figure 6).

[0045] [Example 6] In a surgically induced rabbit OA model, the effect size of R399E on pain after a single intra-articular injection is equivalent to that of clinically effective anti-NGF antibody treatment during the chronic phase of disease progression (Figure 7). Similar to Example 5 (time course of KK-Rabbit-16-01), in KK-Rabbit-17-01, the symptomatic benefit of R399E IA treatment persisted throughout the study. Injections were initiated 1 week after surgery and performed a total of 6 times at bi-weekly intervals. Groups 1 - 3 of this study were treated with R399E IA and group 4 was treated with placebo IA. In group 5, as described above, triamcinolone was injected IA at week 1. The same animals received a human equivalent dose of clinically effective anti-NGF antibody IV at weeks 5 and 9 after the triamcinolone effect had completely worn off. In addition, placebo IA injections were administered to this group at weeks 3, 5, 7, 9, and 11. Observer-independent non-contact capacitance device measurements were performed 6 hours after the first injection and then always before injection at bi-weekly intervals as in the above example. IV treatment with 1 mg / kg of anti-NGF antibody resulted in a maximum 56% effect on pain (p = 0.0195). This effect size is equivalent to the effects on pain of 47.1% (p = 0.0426), 57.8% (p = 0.0091), and 75.7% (p = 0.0011) achieved with 3 doses of R399E at the same time point (see Figure 7).

[0046] [Example 7] In human synovium + cartilage explant cultures, R399E reduces matrix loss (GAG release), thereby contributing to a significant normalization of joint homeostasis. In addition, R399E reduces the release of cytokines IL1 and PGE2, which cause pain and inflammation in OA and impair joint homeostasis (Figure 8). These cytokines not only directly induce pain and inflammation in OA patients, but also downregulate BMP receptor expression in chondrocytes. As a result, the responsiveness of chondrocytes to BMP is reduced, which may accelerate disease progression (Figure 9). The effects of R399E on matrix modulation (GAG release), PGE2, and pro-inflammatory cytokines were investigated in a human OA co-culture model consisting of cartilage explants + synovium, or synovium only. Tissues were co-cultured for 7 days and samples were taken after 1, 4, and 7 days. Co-culture of OA cartilage explants and OA synovium significantly induced GAG release into the supernatant. Treatment with R399E (100 and 300 ng / mL) inhibited GAG release, reaching statistical significance at 300 ng / mL (p = 0.016). Cultures of synovium alone did not induce GAG release. This indicates that OA cartilage is the main source of GAG in the co-culture system (Figure 8). Co-culturing OA cartilage and OA synovium together robustly induced the release of IL1β and PGE2 into the supernatant. R399E inhibited IL1β (p = 0.0245 at 100 ng / mL and p = 0.0159 at 300 ng / mL, see Figure 11) production and PGE2 (p = 0.9872 at 100 ng / mL and p = 0.0057 at 300 ng / mL) production in the co-culture system. Cultures of synovium alone yielded significantly more PGE2 in the supernatant than cultures of explants alone (p = 0.0001). This indicates that the synovium is the main source of PGE2 in this system. Both R399E doses tested inhibited unstimulated PGE2 release by the synovium (p = 0.007 at 100 ng / mL and p = 0.027 at 300 ng / mL). In summary, R399E inhibited matrix degradation in co-cultures of human OA cartilage and synovium. Additionally, R399E disrupted autocrine and / or paracrine signaling between OA cartilage and OA synovium, as represented by inhibition of inflammatory cytokines and pain-mediating PGE2.

[0047] [Example 8] In meniscus tissue cultures stimulated with TNF alpha + oncostatin, R399E reduced the release of cytokines that cause OA pain and inflammation and compromise joint homeostasis (TNFa, IL6) and prevented matrix loss (GAG, Figure 10). Porcine menisci were cultured for the purpose of investigating the effect of R399E on the release of prostaglandin E2 (PGE2) and cytokines IL1β, IL6, IL8, and TNFα. Complete slices of porcine menisci (meniscus explants) were stimulated with T+O (20 ng / mL TNFα + 10 ng / mL OSM (oncostatin A)). Additionally, meniscus explants were treated with different concentrations of R399E (300, 900, 1200 ng / mL). The total incubation time was 7 days, and samples were taken after 2, 5, and 7 days. As controls, meniscus explants were either stimulated but untreated (T+O) or unstimulated (explants only). Stimulation with T+O induced IL6 from porcine menisci. Treatment with R399E inhibited T+O-induced IL6 release (p = 0.0001 in the 900 ng / mL study batch, p < 0.015 in the 300 and 1200 ng / mL tox batches, p < 0.005 in the 300 and 900 ng / mL GMP batches). R399E inhibited T+O-induced PGE2 release by up to 44% in the GMP batch, 72% in the study batch, and 49% in the GLP batch, but did not reach statistical significance at p < 0.05. No significant differences were observed between batches. The effect of R399E on ILβ, Il-8, and TNF-alpha release was inconsistent and not dose-dependent in this experimental setting (see Figure 10). In summary, such data indicate that the meniscus contributes to the inflammatory environment of knee OA, and that treatment with R399E can reduce the concentrations of pro-inflammatory cytokines and PGE2 derived from the meniscus, thereby providing analgesia after IA injection in OA animal models and OA patients.

[0048] [Example 9] Also, in synovial cell line (SW982) and primary human osteoarthritis synovial cell cultures, R399E reduces the cytokine release of interleukin-6 (Figure 11A, C) and interleukin-1 (Figure 11B, D), thereby promoting the normalization of joint homeostasis and preventing pain, inflammation, and even disease progression (Figure 11).

[0049] [Example 10] In primary human meniscus cell cultures stimulated with nerve growth factor (NGF), R399E reduces the release of PGE2, which causes pain and inflammation in OA. Primary meniscus cells derived from total knee arthroplasty were freshly prepared within the framework of ethical approval one day after surgery. First, the skin and muscle were removed to isolate the meniscus. The meniscus was transferred to a 10 cm dish filled with HAM F12 + 1% P / S + 1% amphotericin B. The tissue was cut into approximately 3×3 mm pieces and transferred to a sterile beaker for digestion. Digestion was carried out for 16 hours at 37 °C and 7.5% CO2 with constant stirring in 50 ml of 0.4% collagenase in HAM F12 + 1% P / S + 1% amphotericin solution. After 16 hours, the solution was passed through a 100 μm filter and then a 40 μm filter with a pipette, and then centrifuged at 1400 g for 5 minutes. The remaining pellet containing cells was resuspended in 20 ml of HAM F12 + 1% P / S + 1% amphotericin + 10% FCS. The cell number was counted and the cell viability was determined. Finally, 10,000 cells per well were seeded into a 96-well plate. The cells were cultured for up to 1 week until they reached confluence. The medium was changed once during that time. Once the cells reached confluence, they were stimulated with 10 ng / ml rhNGF and / or treated with 0.1 μM dexamethasone, 0.1 μM triamcinolone, 375 ng / ml anti-beta NGF antibody, 300 ng / ml R399E, or left untreated (negative control). The effects of individual compounds were compared with cells stimulated with rhNGF only. After 2 days of incubation, the supernatant was removed to determine prostaglandin E2 (PGE2) in the medium. Treatment of primary meniscus cells with rhNGF induced PGE2, which was significantly inhibited by all test compounds. The effect of R399E was compared with the effects of clinically effective dexamethasone, triamcinolone, and anti-NGF antibody treatments (Figure 12).

[0050] [Example 11] R399E reduces ADAMTS5 (a disintegrin and metalloproteinase with thrombospondin motif 5) expression and matrix metalloproteinase (MMP) release in porcine healthy chondrocytes (Figure 13) and human OA chondrocytes (Figure 14). ADAMTS5 is a catabolic protease that causes pathological cleavage of the cartilage matrix during OA progression. Thereby, R399E prevents further cartilage destruction and reduces the production of damage-associated molecular pattern molecules (DAMPs) such as endogenous DNA and other cartilage matrix degradation products. Such molecules are associated with the acceleration of OA pathology and are the cause of OA-related inflammation and pain as well as neuronal sensitization.

[0051] Porcine chondrocytes were isolated from the femoral heads of approximately 1-year-old pigs obtained from a local abattoir (Arras, Reichelsheim-Beerfurth). To remove cells from the soft tissue, cartilage was digested with 0.25% mass / volume collagenase (Serva GmbH, catalog number 17465) in HAM F12 (Gibco®, Life Technologies, catalog number 21765) for 45 minutes at room temperature and then with 0.1% mass / volume collagenase in HAM F12 with 1% penicillin / streptomycin (Gibco®, Life Technologies) overnight at 37 °C. The resulting cell suspension was filtered through 100 μm and then 40 μm cell strainers (Becton Dickinson GmbH), washed several times by centrifugation, and resuspended in culture medium. Freshly isolated porcine chondrocytes were first cultured in monolayer for 7 days in DMEM HG, 10% fetal calf serum (FCS, Promocell GmbH), 50 μg / mL ascorbic acid-2-phosphate, and 0.4 mM proline (Prolin), and then in the same medium with 10 ng / ml of IL-1β, either at 15,000 cells / well for qPCR analysis or at 200,000 cells / well for MMP1 measurement, and treated with 30, 300, and 900 ng / mL of R399E or left untreated in 24-well plates for 3 days (MMP1) or 7 days (qPCR).

[0052] For gene expression, RNA was isolated using Qiagen's RNeasy Mini Kit. The concentration and quality of mRNA were analyzed with an Agilent Bioanalyser using an Agilent RNA 6000 Nano Chip from Agilent Technologies Inc. Reverse transcription was achieved with Invitrogen Corp's SuperScript III First-Strand Synthesis SuperMix, followed by RNAseH treatment. qPCR was performed using primers for porcine ADAMTS5 ('TCACACTGCTCATGACGAAA; GCAAGTGTGTGGACAAAACC) with Sigma's SYBR Green JumpStart Taq Ready Mix. 60S ribosomal protein L13a (RPL13A) was used as a housekeeping gene.

[0053] For MMP1 measurement, the supernatant was collected and MMP1 was measured using a human MMP3-Plex ultrasensitive kit (MSD).

[0054] Human chondrocytes were isolated from cartilage taken from three OA patients who had undergone total knee or hip replacement. All patients signed an informed consent. Cell isolation consisted of digesting with 0.25% collagenase (collagenase NBG4 diluted 1 / 10 with 2.5% Serva in HAM F12) for 45 minutes. Dissociated cells were discarded and the cartilage was further digested overnight with 0.1% collagenase (collagenase NBG4 diluted 1 / 25 with 2.5% in HAM F12 with 1% penicillin / streptomycin) to extract chondrocytes.

[0055] Freshly isolated human OA chondrocytes were first cultured in monolayer for 5 days in DMEM high glucose with 10% FBS, 0.4 mM proline, and 50 μg / mL ascorbic acid-2-phosphate, 1% penicillin / streptomycin, then cultured at 200,000 cells / well in the same medium in 24-well plates and treated with 30, 300, 1000 ng / mL of R399E for 7 days or left untreated. For gene expression, RNA was isolated using Qiagen's RNeasy Mini Kit. The concentration and quality of mRNA were analyzed with an Agilent Bioanalyser using an Agilent RNA 6000 nanochip from Agilent Technologies Inc. Reverse transcription was achieved with Invitrogen Corp's SuperScript III First-Strand Synthesis SuperMix, followed by RNAseH treatment. qPCR was performed using Life Technologies' Taqman Universal PCR Mastermix with the corresponding TaqMan gene expression assay from Applied Biosystems. EF1 alpha was used as the housekeeping gene.

[0056] [Example 12] In a surgically induced rabbit unstable OA model (ACLT + pMx, KK-rabbit-16-01), 0.6 (p = 0.205) and 6 μg (p = 0.0404) showed a >30% beneficial effect on cartilage morphology in gross morphological analysis (Figure 15A). Micro-CT-based quantification of cartilage volume in the 6 μg group (with the best gross morphology results) revealed that the cartilage volume and thickness were significantly higher compared to the placebo group (Figures 15B and 15C). As described in Example 2, the anterior cruciate ligament of female rabbits was transected (ACLT), and approximately half of the medial meniscus was resected (pMx). The animals were injected intra-articularly (IA) with placebo (R399E vehicle) 0.6, 6, or 60 μg of R399E starting 1 week after surgery and then every 14 days for a total of 6 times. Two weeks after the last injection, the animals were euthanized at 13 weeks.

[0057] For micro-CT analysis, the knee joint was separated from the femur and tibia during the autopsy process. Subsequently, it was fixed in 4% paraformaldehyde (PFA, Merck, Darmstadt, Germany) in 1× phosphate-buffered saline (PBS) pH 7.4 (Gibco, Thermo Fisher Scientific, Waltham, USA) for at least 5 days to be completely fixed. Before obtaining the micro-CT images, the joint was rinsed with 1× PBS to wash away PFA residues and individually filled into small plastic shot glasses (2 cl, EDEKA GUT&GUENSTIG, Germany) filled with Moltofill™ elastic (Akzo Nobel Deco GmbH, Cologne, Germany) without air bubbles. A micro-CT device (SkyScan1176; Bruker, Kontich, Belgium) with an X-ray source of 65 kV / 384 μA, a pixel size of 17.60 μm, and an aluminum filter of 1 mm was used to scan the specimens. After scanning, cross-sectional slices were generated using NRecon software (Bruker). Each scan was reconstructed using a defined threshold to distinguish bone&Moltofill™ (the same bone-like contrast agent) from the negative contrast of cartilage to which beam hardening and ring artifact correction were applied. To ensure uniform analysis, DataViewer software (Bruker) was similarly used to align all datasets to anatomical markers. 3D analysis was performed using CTAn software (Bruker). The volume of interest (VOI) was applied to the weight-bearing area of the medial femoral condyle with a diameter of 3502.8 μm (199 pixels). The cartilage volume and cartilage thickness of the left and right (contralateral) medial femoral condyles within this VOI were calculated and expressed as % values of the corresponding contralateral joint (Figures 15B, 15C).

[0058] For morphological investigation by naked eye, the articular surfaces of the tibia and femur were stained with toluidine blue (0.05%) for 30 seconds at room temperature, then immersed in deionized water and air-dried for 15 - 20 minutes. To increase the contrast between the smooth and fibrous tissues, the stained surfaces were immersed in black ink (Higgins black India ink (Chartpak Inc, Lees, Massachusetts, USA)) for 1 second, then waited for 3 seconds and rinsed with tap water for 3 seconds. After an additional 15-minute air-drying period, the surfaces were imaged using a Discovery V12 microscope (Carl Zeiss Microscopy GmbH, Jena, Germany) and photographed with an Axiocam HRC camera and appropriate software AxioVision 4.8.2 (Carl Zeiss Microscopy, Jena, Germany). The magnification was selected such that the entire articular surface filled the image format. An electro-optical system was used for the reconstruction of 3D images from the acquired Z-stacks. The height of the Z-stack was determined manually by scrolling through the region of interest of each joint. 10 - 20 single images of the Z-stack were acquired and combined into a final image for Cavaleri analysis.

[0059] The total articular surface area was measured using image analysis software, and morphological changes were quantified using a score. The total articular surface area increased surgically. This finding was expected and is consistent with this model as well as other surgical models and other studies using different species. R399E showed no effect on this parameter. Considering that a 100% improvement in the gross morphological total score would correspond to the contralateral mean level and 0% to the vehicle mean level, the mean of all three treatment groups improved by approximately 30% regardless of dosing. The area with only mild changes scored 1 and had more regions in the R399E-treated group than in the vehicle-treated animals. Again, all three doses reached a significant effect of 30% improvement compared to the mean of the vehicle group. In the area of score 2, which represents the amount of moderately damaged cartilage, the mean of the 0.6 μg group showed a 30% benefit compared to the mean of the vehicle group. The most distinct structural effect was seen when looking at the amount of severely damaged cartilage with cracks (score 3). 0.6 μg of R399E resulted in approximately 40% less area of score 3, 6 μg reduced the area with cracks with an effect size of 50% and reached statistical significance (p = 0.0404), and 60 μg resulted in a mean value that was 30% improved compared to the mean of the vehicle group but did not reach statistical significance (Figure 15A).

[0060] [Example 13] In a pilot study using only 7 animals per group in a surgically induced sheep OA model, intra-articular injection of R399E 3 times every 4 weeks had already tended to result in a significant improvement in histological score (Figure 16) and a better MRI score (Figure 17) compared to placebo. In this experiment, an inner meniscus transection model (Cake, Osteoarthritis and Cartilage 2013; 21: 226-236) was used to induce osteoarthritis (OA)-like changes during a 12-week "survival" period. The test article, R399E, was administered intra-articularly (IA) starting on day 7 after surgery in a once-monthly regimen at three different doses (12, 120, and 1200 μg / joint). The primary endpoint of this study was the structural improvement of the medial and lateral femoral condylar cartilage, determined by quantitative scoring of histological sections. R399E significantly improved this outcome. Here, the middle dose of 120 μg / joint of R399E was the most effective.

[0061] Osteochondral samples (6×6 mm) were collected from the load-bearing cartilage regions of the lateral and medial femoral condyles and the lateral and medial proximal tibial condyles. Each sample was obtained from the central portion of the joint determined using measurements of each joint. The midpoint of the condyle was marked using a ruler and used as the center of the osteochondral sample. Samples were fixed in 10% buffered saline and decalcified with 10% EDTA solution for 4 weeks, followed by 5% formic acid for 1 week. Paraffin-embedded sections (5 μm thick) were prepared. Sections were stained with toluidine blue and safranin O-fast green to highlight the structure and cartilage (Schmitz et al., Osteoarthrtis and Cartilage 2010; 18 Suppl 3: S113-116). Modified Mankin scores were used to quantify histological changes in the cartilage.

[0062] Sections were obtained from four compartments of the operated joint and scored using the modified Mankin score. Summing the histological scores, there was a statistically significant reduction in damage in animals receiving 12 and 120 μg / joint of R399E compared to the vehicle control (see Figure 16). Sub-analyzing the various components of the Mankin score, it was shown that the reduction in damage was not due to any one measured parameter, and the reduction spread across all parameters. Magnetic resonance images (MRI) were obtained from each operated limb postmortem using low-field MRI (Esoate). MR images were blindly scored by European Imaging Specialists using a modified sMOAKS score (Moya-Angeler, March 2016; 23(2):214-20. doi:10.1016 / j.knee.2015.11.017. Epub January 27, 2016). For MRI, the joint was considered to have three units - the medial and lateral femorotibial joints and the femoropatellar joint. For each region of the joint, the following were scored: cartilage loss, osteophytes, joint effusion, and bone marrow lesions (subchondral bone hyperintensity). MRI was obtained from all operated limbs postmortem using a low-field magnet. MR images were blindly scored by European Imaging Specialists using a modified sMOAKS score. Analysis of the scores of all three compartments of the complete joint or of the medial femur-tibia compartment only showed a trend in the sMOAK scores of animals treated with 120 μg and 1200 μg of R399E / joint compared to controls (see Figure 17).

[0063] [Example 14] In porcine healthy chondrocyte cell culture experiments, R399E significantly increased chondrocyte extracellular matrix production and cell proliferation (Figure 18). Porcine chondrocytes were isolated and cultured in a scaffold-free 3D culture system (cartilage tissue analog, CTA) as described elsewhere (Gigout et al., Osteoarthritis and cartilage 2017, 25:1858-1867). 1 million cells / 3D construct were seeded in DMEM high glucose supplemented with 10% FCS, 0.4 mM proline, and 50 μg / mL ascorbic acid-2-phosphate and treated with 300 ng / mL of R399E or left untreated for 4 weeks with N = 3.

[0064] At the end of the culture, 3D cell constructs were collected and their DNA, GAG, and hydroxyproline content or gene expression was evaluated by qPCR. Samples were also fixed for each condition and embedded in paraffin for histology (N = 3). Before measuring GAG, hydroxyproline, and DNA, the 3D cell constructs were digested with papain (overnight at 60 °C with 0.125 mg / mL papain in papain buffer, 5 mM L-cysteine). DNA was measured using Invitrogen's QuantiT PicoGreen ds DNA kit according to the manufacturer's recommendations. GAG was quantified by dimethylmethylene blue (DMMB) assay (Farndale et al., Biochem Biophys Acta 883:173 - 177, 1986) and by HPLC for HPro as described by Gigout et al., 2007.

[0065] For gene expression, RNA was isolated using Qiagen's RNeasy Mini Kit. The concentration and quality of mRNA were analyzed with an Agilent Bioanalyser using an Agilent RNA 6000 nanochip from Agilent Technologies Inc. Reverse transcription was achieved with Invitrogen Corp's SuperScript III First-Strand Synthesis SuperMix, followed by RNAseH treatment. qPCR was performed with 200 nM reverse and forward primers using Sybr-Green Jumpstart Taq Ready Mix (Sigma-Aldrich). EF1 alpha was used as the housekeeping gene. For histological evaluation, 3D cell constructs were fixed with 4% paraformaldehyde for 30 minutes at room temperature, washed three times with PBS, and the extracellular matrix was stained with safranin-O or for type 2 collagen.

[0066] [Example 15] In human OA chondrocyte cell culture experiments, permanent exposure to R399E significantly and dose-dependently increased the production of glycosaminoglycan (GAG), hydroxyproline (HPro), and type II procollagen (proC2) (Figure 19). Human chondrocytes were isolated from cartilage taken from three OA patients who had undergone total knee or hip replacement. All patients signed an informed consent. Cell isolation consisted of digestion with 0.25% collagenase (collagenase NBG4 diluted 1 / 10 with 2.5% Serva in HAM F12) for 45 minutes. Dissociated cells were discarded, and the cartilage was further digested overnight with 0.1% collagenase (collagenase NBG4 diluted 1 / 25 with 2.5% in HAM F12 with 1% penicillin / streptomycin) to extract chondrocytes. Each condition was performed with N = 4.

[0067] The newly isolated human OA chondrocytes were first cultured in monolayer for 5 days in DMEM high glucose supplemented with 10% FBS, 0.4 mM proline, and 50 μg / mL ascorbic acid-2-phosphate, 1% penicillin / streptomycin, and adjusted to 380 mOsm (osmotic pressure was confirmed with an osmometer). The cells were then harvested, and 2×106 cells were resuspended in an alginate solution (1.25% alginate from Fluka in 0.2 M HEPES from AppliChem and 1.5 M NaCl from Merck, adjusted to pH 7.4), and the cell suspension was pipetted dropwise into 120 mM CaCl2 (from Merck) containing 10 mM HEPES (from AppliChem). The cell droplets were polymerized for 15 minutes with stirring to form alginate beads, which were washed three times with 150 mM NaCl solution. The alginate beads were first cultured for 7 days without treatment in culture medium adjusted to 380 mOsm. Subsequently, the beads were transferred at 5 beads / well to 24-well ultra-low binding plates (from VWR) in 1 mL of 380 mOsm culture medium supplemented with 300 ng / mL R399E or 12.5 μM HCL (control). After 14 days, the alginate beads were dissolved for 1 hour in 460 μL of 55 mM sodium citrate (from Merck) with 150 mM NaCl at pH 8 and 40 μL of 2.5% collagenase. Next, 500 μL of DMEM high glucose or PBS was added, and the solution was centrifuged. GAG, HPro, and ProC2 in the dissolved alginate supernatant were measured. GAG and HPro were analyzed as described above. ProC2 was measured as described by Gudmann et al., Int J Mol Sci 2014, 15:18789-18803.

[0068] [Example 16] In the human OA chondrocyte cell culture experiment, chronic exposure to R399E significantly and dose-dependently increased the aggrecan protein level with an EC50 of 108 ng / mL (Figure 20). Cartilage biopsies were isolated from three human donors during total knee arthroplasty, minced, and digested. The cells were cultured and frozen in liquid nitrogen (LN) at P1. The cells were thawed from LN and seeded at 10,000 cells / cm 2Cells were cultured at the cell density of and grown until they reached confluence. After 8 days, the confluent cells at P2 were trypsinized and counted, and beads were fabricated (-5 days). After 5 days of culture (day 0), the beads were stimulated 3 times over 7 days (days 0, 2, and 4). One week later, the beads were collected and the aggrecan content was analyzed. The controls included were beads at day 0 in normal culture medium and beads at day 7 with vehicle control medium (1:50 dilution of 10 mM HCl pH 0.2 with normal growth medium). The aggrecan content of the samples was determined using a commercially available PG-ELISA from Diasource (catalog number KAP1461). The blank control was subtracted from the experimental OD values. The absolute amount of aggrecan was calculated based on the calibration curve formula. The ratio compared to beads at day 7 (unstimulated - vehicle control medium only) was calculated and compared. The EC50 value was calculated using 4PL fitting of the average ratio of 3 donors.

[0069] [Example 17] In the human OA chondrocyte cell culture experiment, permanent exposure to R399E significantly increased the production of hyaline cartilage matrix over time (Figure 21). Human OA chondrocytes were isolated, cultured, embedded in alginate, and treated with 300 ng / mL of R399E or left untreated as described above. After bead lysis, the cell content was analyzed by cell analysis using ViCell from Beckman Coulter. GAG, HPro, and ProC2 in the lysed alginate were measured as described above. Gene expression analysis was performed on the cells as described above.

[0070] [Example 18] Intermittent treatment with R399E is sufficient to reach a significant anabolic effect over time. Human OA chondrocytes were cultured in alginate as described above and treated with 300 ng / mL of R399E for 1 week, 2 weeks, 3 weeks, or 4 weeks per month or left untreated. After 8 weeks (2 months), the cell content, GAG content, HPro content, and ProC2 content were significantly increased (Figure 22).

[0071] [Example 18] In the human OA chondrocyte cell culture experiment, continuous exposure to R399E significantly increased the production of anabolic biomarkers of proC2, proC6, and CILP-2 (Figure 23). Human OA chondrocytes were cultured in alginate as described above and treated with 300 ng / mL of R399E for 4 weeks or left untreated. ProC2, Proc6, and CILP2 in the culture medium were measured at various time points. ProC2 was measured as mentioned above, Proc6 was measured by Nordic Bioscience, and CILP2 was measured using the Abbexa ELISA kit abx151073.

Table 1

Table 2

Claims

1. Use of a growth / differentiation factor 5 (GDF-5) mutant protein having an amino acid exchange of arginine at amino acid residue 399 with glutamic acid (R399E) for the manufacture of a medicament for treating cartilage defects and pain.

2. The use of the protein according to claim 1, wherein the cartilage defect is a cartilage defect caused by osteoarthritis, rheumatoid arthritis, meniscus injury or ligament rupture, chondrodystrophy, growth disorder and subsequent chondro-ossification, achondroplasia, costochondritis, intervertebral disc herniation, relapsing polychondritis, or chondroma or chondrosarcoma.

3. The use of the protein according to claim 1 for the manufacture of a medicament for preventing cartilage degradation or meniscus degradation by reducing inflammation and pain.

4. A medicament for treating cartilage defects and pain, comprising the protein according to claim 1, which is administered by intra-articular injection into the affected joint.

5. A pharmacological composition for treating cartilage defects and pain, comprising the protein according to claim 1 and at least one other pharmacologically active ingredient.

6. A pharmacological composition for treating cartilage defects and pain, comprising the protein according to claim 1 and sprifermin.

7. The pharmacological composition according to claim 5 or 6, further comprising an acceptable additive or carrier.

Citation Information

Patent Citations

  • GDF-5 mutants for inducing chondrogenesis

    JP2015504649A