Composition

A composition of TNF-α and IL-7R binding polypeptides addresses the limitations of existing treatments for inflammatory bowel diseases by providing simultaneous targeting and enhanced stability, improving efficacy in Crohn's disease and ulcerative colitis through oral administration.

JP7702363B2Active Publication Date: 2025-07-03ソリッソ ファーマシューティカルズインク
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2021576307
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-06-21
Filing Date
2020-06-19
Publication Date
2025-07-03
Estimated Expiration
2040-06-19

AI Technical Summary

Technical Problem

Current treatments for inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis, have high rates of primary non-response and secondary loss of response, with existing anti-TNF-α agents ineffective for a significant portion of patients, and IL-7R blocking antibodies lacking efficacy trials in these conditions, necessitating a new therapeutic approach.

Method used

A composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide, which can be administered orally, providing an additive or synergistic effect in reducing inflammation by targeting both pathways simultaneously, enhancing stability and binding affinity to intestinal tissues.

Benefits of technology

The combined polypeptides effectively reduce inflammation in inflammatory bowel diseases, demonstrating improved efficacy in cultured intestinal mucosal tissues and potential for broader patient benefit, including Crohn's disease and ulcerative colitis, with enhanced stability and reduced immunogenicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007702363000011
    Figure 0007702363000011
  • Figure 0007702363000012
    Figure 0007702363000012
  • Figure 0007702363000013
    Figure 0007702363000013
Patent Text Reader

Abstract

Among other things, compositions are provided that include a TNF-α binding polypeptide and an IL-7R binding polypeptide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a composition and a construct comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide. The present invention also relates to a nucleic acid encoding such a construct, a method for preparing such a composition and construct, a cDNA and a vector comprising a nucleic acid encoding such a construct, a host cell capable of expressing or expressing such a construct, and the use of such a composition and construct.

Background Art

[0002] Tumor necrosis factor α is a homotrimeric pro-inflammatory cytokine involved in systemic inflammation that exists in both soluble and membrane-bound forms. TNF-α is mainly secreted by monocytes and macrophages, but also by tumor cell lines, as well as CD4+ and CD8+ peripheral blood T lymphocytes, and some cultured T and B cell lines. TNF-α is involved in inflammatory diseases, autoimmune diseases, viral infections, bacterial infections, parasitic infections, malignancies, and / or neurodegenerative diseases, and is a target for specific biological therapies for autoimmune / auto-inflammatory diseases such as rheumatoid arthritis and Crohn's disease (CD).

[0003] Interleukin-7 (IL-7) is constitutively produced by non-hematopoietic stromal and epithelial cells and is essential for T lymphocyte development in the thymus and the regulation of peripheral T cell survival and homeostasis. In the intestinal mucosa, IL-7 further regulates phenotypically and functionally distinct populations of CD4+ lymphoid tissue inducer (LTi) cells, which are important for the initial priming of the immune response to pathogenic microbial challenges, as well as promoting lymphoid tissue organogenesis and some dendritic cell populations. Because the effects of IL-7 on T cells are functional, IL-7 is an important enhancer of not only defensive immunity but also autoimmunity and inflammation. The effects of IL-7 on different target cells are mediated through the IL-7R, a heterodimeric complex containing the IL-7Rα subunit (CD127), and the common cytokine receptor γ chain (γc) (CD132). IL-7Rα is available not only in a cell membrane-bound format but also in a soluble form (sIL-7Rα). Preclinical studies have demonstrated the involvement of the IL-7 / IL-7Rα pathway in animal models of different autoimmune and inflammatory diseases, in addition to the role played by IL-7 / IL-7Rα in human T cell development and homeostasis.

[0004] TSLP is a cytokine thought to be involved in the regulation of inflammatory processes at the mucosal surfaces of the body. TSLP stimulates dendritic cells (DCs) and innate lymphoid cells (ILCs) to induce the secretion of Th2 cytokines (IL-4, IL-5, and IL-13), promoting the progression of Th2-type inflammation. TSLP is currently thought to underlie the development of some allergic disorders, including atopic dermatitis and rhinitis, and to promote intestinal disorders, including eosinophilic esophagitis (EoE) and ulcerative colitis (UC). Paradoxically, TSLP has also been reported to be important for maintaining immune homeostasis and mucosal protection in the gastrointestinal tract. In recent years, the discovery that TSLP may be expressed as two different isoforms has provided a biological explanation for the apparently contrasting activities of this cytokine. Molecular studies have shown that the TSLP gene can give rise to two coding RNAs regulated by two different promoter regions. One of the transcripts encodes the long isoform of TSLP (L-TSLP) of 159aa (UNIPROT entry Q969D9, SEQ ID NO: 22), and the second transcript encodes the short form of TSLP (S-TSLP) that encompasses the C-terminal 63aa of L-TSLP (UNIPROT entry Q969D9-2, SEQ ID NO: 23). L-TSLP acts on target cells via a receptor complex that includes the TSLP-specific receptor chain (TSLPR) and the IL-7Rα chain. Recent structural studies have shown that the interaction of IL-7 and L-TSLP with the IL-7Rα chain of the TSLP receptor complex targets a common IL-7Rα binding site (Verstraete et al 2017). S-TSLP does not bind to the TSLPR and cannot inhibit the binding of L-TSLP to this receptor. To the author's knowledge, a receptor specific for S-TSLP has not been identified to date. Importantly, S-TSLP has been found to be expressed mainly by healthy skin and by epithelial and basement membrane cells in healthy intestinal mucosal tissue. S-TSLP has anti-inflammatory activity.In vitro, S-TSLP inhibits the production of pro-inflammatory cytokines by monocyte-derived DCs and contributes to the regulation of CD103+ DCs towards an immunotolerogenic phenotype.

[0005] Therefore, TNFα, IL-7, and L-TSLP are all cytokines that regulate the cell types and pathways involved in the onset and maintenance of intestinal inflammation in IBD. Anti-TNF-α antibodies have changed the treatment of Crohn's disease and ulcerative colitis. However, approximately one-third of patients prescribed anti-TNF-α agents are primary non-responders. In primary responders, the subsequent loss of response may vary from 10% to 50% per year (secondary non-response). Patients who have shown primary non-response are unlikely to benefit even if switched to a second anti-TNF-α agent. As a result, new effective treatments are needed to better address the unmet clinical needs in such patients. Currently, efficacy trials of IL-7R blocking antibodies have not been conducted in patients with inflammatory bowel diseases. However, preclinical studies have demonstrated that short-term systemic administration of IL-7R blocking antibodies can be an effective treatment in gastrointestinal inflammation models. In a mouse IBD model, the primary mechanism regarding the efficacy after administration of an IL-7R antagonist involves the local depletion or functional inhibition of pathogenic T cells (IL-7R+ effector / memory T cells) that express moderate to high levels of IL-7Rα and are activated due to increased production of IL-7 in inflamed intestinal tissue. Inhibition of the IL-7 / IL-7R pathway represents a novel strategy for addressing pro-inflammatory T cells through a mechanism different from that involved in the action of TNF-α neutralizing antibodies. Therefore, a composition or construct that achieves a combination of the effects of anti-TNF-α and anti-IL-7R antibodies has the potential to improve efficacy in a broader group of IBD patients.

[0006] WO2004041862, WO2006122786, and Coppieters et al 2006 (which are hereby incorporated by reference in their entirety) disclose single domain antibodies directed to TNF-α and related aspects. WO2013056984, WO2015189302, WO2011094259, and WO2011104687 (which are hereby incorporated by reference in their entirety) disclose antibodies directed to IL-7R and related aspects.

[0007] In at least some embodiments, the compositions or constructs of the present invention may have one or more of the following advantages compared to prior art substances. These advantages can be achieved by each of the polypeptides that are components of the compositions of the present invention on their own, or a combination of the polypeptides in the compositions of the present invention may result in an additive or even synergistic effect with respect to one or more of the following advantages. (a) Increased affinity and / or binding activity for TNF-α and / or IL-7R, (b) Increased neutralizing ability against TNF-α and / or IL-7R, (c) Increased inhibition of phosphorylation of signaling proteins, (d) Increased inhibition of cytokine production, (e) Reduced immunogenicity when administered, for example, to mice, cynomolgus monkeys, or humans, (f) Increased stability in the presence of proteases, for example, (a) proteases found in the small intestine and / or large intestine, and / or IBD inflammatory proteases such as trypsin, chymotrypsin, enterokinase, MMP3, MMP10, MMP12, other MMPs, and cathepsin, and / or (b) cell membrane-attached proteases, secreted proteases, and proteases released from cell lysis of intestinal commensal microflora and / or pathogenic bacteria found in the small intestine and / or large intestine, (g) Increased safety against proteolytic degradation during production (for example, resistance to yeast proteases), (h) Increased suitability for oral administration, (i) Increased appropriateness of local delivery to the intestine and basement membrane after oral administration, (j) Increased appropriateness of expression in heterologous hosts such as bacteria (e.g., Escherichia coli) or yeast (e.g., Saccharomyces cerevisiae or Pichia pastoris), (k) Appropriateness of use in pharmaceuticals and improvement of properties, (l) Appropriateness of use in functional foods and improvement of properties, (m) Improvement of tissue penetration such as penetration of inflamed colonic mucosal epithelium and submucosal tissue to access the submucosal basement membrane, (n) Reduction of human immunogenicity due to increased sequence similarity to, for example, human immunoglobulins, (o) More effective prevention or treatment of autoimmune and / or inflammatory diseases, including inflammatory bowel disease and / or mucositis, improvement of their symptoms, especially when administered orally, and (p) Binding to novel epitopes. SUMMARY OF THE INVENTION

[0008] The present inventors provide surprisingly effective compositions and constructs comprising a TNF-α binding polypeptide and an IL7R binding polypeptide. Specifically, it has been recognized that providing the TNF-α binding polypeptide and the IL-7R binding polypeptide in a single composition may be more effective than providing each binding polypeptide individually. In some embodiments, the combination of these polypeptides in the compositions of the present invention has an additive effect, and in further embodiments, the combination of these polypeptides in the compositions of the present invention may have a synergistic effect.

[0009] Based on the discoveries disclosed herein, it can be expected that these compositions are particularly effective in the prevention or treatment of autoimmune and / or inflammatory diseases when using intestinal mucosal tissues cultured ex vivo from patients with inflammatory bowel disease (Examples 4 and 5). More specifically, the discoveries disclosed herein indicate that these compositions are particularly effective in the prevention or treatment of inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis, or checkpoint inhibitor-induced colitis), or the prevention or treatment of mucositis or esophagitis, particularly when administered orally.

[0010] It can be expected that the same benefits may be derived by using a TNF-α binding polypeptide together with an IL-7R binding polypeptide in the treatment of diseases, in which case the polypeptides are not combined in the same composition. Similarly, it can be expected that the same benefits may be derived by using an IL-7R binding polypeptide together with a TNF-α binding polypeptide in the treatment of diseases, in which case the polypeptides are not combined in the same composition.

[0011] The present invention provides a composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide.

[0012] Also provided are a TNF-α binding polypeptide and an IL-7R binding polypeptide, and a polynucleotide encoding this construct.

[0013] Furthermore, provided are a TNF-α binding polypeptide used together with an IL-7R binding polypeptide in the treatment or prevention of autoimmune and / or inflammatory diseases, and an IL-7R binding polypeptide used together with a TNF-α binding polypeptide in the treatment or prevention of autoimmune and / or inflammatory diseases.

[0014] A specific TNF-α binding polypeptide, and some of the data disclosed herein are also disclosed in PCT International Publication WO / 2016 / 156465 (specifically incorporated herein by reference in its entirety insofar as this application is related to TNF-α binding polypeptide ID-38F).

Brief Description of the Drawings

[0015]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

[0016] Sequence description Polypeptide sequence of CDR1 of ID-38F, SEQ ID NO: 1 Polypeptide sequence of CDR2 of ID-38F, SEQ ID NO: 2 Polypeptide sequence of CDR3 of ID-38F, SEQ ID NO: 3 Polypeptide sequence of FR1 of ID-38F, SEQ ID NO: 4 Polypeptide sequence of FR2 of ID-38F, SEQ ID NO: 5 Polypeptide sequence of FR3 of ID-38F, SEQ ID NO: 6 Polypeptide sequence of FR4 of ID-38F, SEQ ID NO: 7 Polypeptide sequence of ID-38F, SEQ ID NO: 8 Polypeptide sequence of CDR1 of ID-A62U, SEQ ID NO: 9 Polypeptide sequence of CDR2 of ID-A62U, SEQ ID NO: 10 Polypeptide sequence of CDR3 of ID-A62U, SEQ ID NO: 11 Polypeptide sequence of FR1 of ID-A62U, SEQ ID NO: 12 Polypeptide sequence of FR2 of ID-A62U, SEQ ID NO: 13 Polypeptide sequence of FR3 of ID-A62U, SEQ ID NO: 14 Polypeptide sequence of FR4 of ID-A62U, SEQ ID NO: 15 Polypeptide sequence of ID-A62U, SEQ ID NO: 16 Polynucleotide sequence encoding SEQ ID NO: 17 ID-38F (including two stop codons) Polynucleotide sequence encoding SEQ ID NO: 18 ID-A62U (including two stop codons) Polypeptide sequence of SEQ ID NO: 19 enterokinase cleavage site Polypeptide sequence including the enterokinase cleavage site of SEQ ID NO: 20 Polypeptide sequence of a specific labile linker used in FU3K of SEQ ID NO: 21 Polypeptide sequence of SEQ ID NO: 22 L-TSLP Polypeptide sequence of SEQ ID NO: 23 S-TSLP Polypeptide sequence of SEQ ID NO: 24 ID-A40U Polypeptide sequence of SEQ ID NO: 25 V7R-2E9 Polypeptide sequence of both ends of FU3K of SEQ ID NO: 26 Polynucleotide sequence encoding both ends of FU3K of SEQ ID NO: 27 Polypeptide sequence of CDR1 with optional conservative substitution at residue 1 of SEQ ID NO: 9 Polypeptide sequence of CDR2 with optional conservative substitutions at residues 2, 3, 7, 12, and 16 of SEQ ID NO: 10 Polypeptide sequence of CDR3 with optional conservative substitutions at residues 3 and 9 of SEQ ID NO: 11 Polypeptide sequence of a non-protease-labile peptide linker format of SEQ ID NO: 31 Polypeptide sequence of a trypsin protease-labile peptide linker format of SEQ ID NO: 32 Polypeptide sequence of a trypsin protease-labile peptide linker format of SEQ ID NO: 33 Polypeptide sequence of a second trypsin protease-labile peptide linker format of SEQ ID NO: 34 Polypeptide sequence of an exemplary trypsin protease-labile peptide linker of SEQ ID NO: 35 Polypeptide sequence of an exemplary trypsin protease-labile peptide linker of SEQ ID NO: 36 Polypeptide sequence of a trypsin protease-labile peptide linker for example SEQ ID NO: 37 Polypeptide sequence of a trypsin protease-labile peptide linker for example SEQ ID NO: 38 Polypeptide sequence of a trypsin protease-labile peptide linker for example SEQ ID NO: 39 Polypeptide sequence of a trypsin protease-labile peptide linker for example SEQ ID NO: 40 Polypeptide sequence of a trypsin protease-labile peptide linker for example SEQ ID NO: 41 Polypeptide sequence of a third trypsin protease-labile peptide linker format SEQ ID NO: 42 Polypeptide sequence of a chymotrypsin protease-labile peptide linker format SEQ ID NO: 43

Mode for Carrying Out the Invention

[0017] Polypeptides such as antibodies and antibody fragments containing immunoglobulin chain variable domains (ICVDs) such as VH and VHH

[0018] A polypeptide is an organic macromolecule composed of a large number of amino acid residues covalently bonded in a chain. As used herein, "polypeptide" is used interchangeably with "protein" and "peptide". A polypeptide contains one or more stretches of amino acid residues that form binding sites and have a certain affinity (appropriately, Kd values, Ka values, k on rates, and / or k off rates) and is said to be a binding polypeptide when it can bind to an epitope on a target.

[0019] Binding polypeptides include polypeptides such as DARPins (Binz et al. 2003), Affimers™ (Johnson et al 2012), Fynomers™ (Grabulovski et al 2007), Centyrins (Goldberg et al 2016), Affitins (e.g., Nanofitins®, Krehenbrink et al 2008), cyclic peptides, antibodies, and antibody fragments. Binding polypeptides further include polypeptides such as Affibodies (Nygren 2008), Affilins (Ebersbach et al. 2007), Alphabodies (Desmet et al 2014), Anticalins (Skerra et al 2008), Avimers (Silverman et al 2005), Kunitz domain peptides (Nixon and Wood 2006), Monobodies (Koide and Koide 2007), nanoCLAMPs (Suderman et al 2017), Adnectins (Lipovsek 2011), and bicyclic peptides.

[0020] Conventional antibodies or immunoglobulins (Igs) are proteins that include two heavy (H) chains and two light (L) chains as four polypeptide chains. Each chain is divided into a constant region and a variable domain. The heavy chain variable domain is abbreviated as VHC herein, and the light (L) chain variable domain is abbreviated as VLC herein. These domains, domains related thereto, and domains derived therefrom are referred to herein as immunoglobulin chain variable domains (“ICVD”).

[0021] The VHC and VLC domains are further subdivided into hypervariable regions, referred to as "complementary determining regions" ("CDRs"), which may be interspersed with more conserved domains, which are referred to as "framework regions" ("FRs"). The framework and complementary determining regions are precisely defined (Kabat et al 1991 Sequences of Proteins of Immunological Interest, Fifth Edition U.S. Department of Health and Human Services, NIH Publication Number 91-3242, which is hereby incorporated by reference in its entirety). In conventional antibodies, VHC and VLC each consist of three CDRs and four FRs arranged from the amino terminus to the carboxy terminus, in the order FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. A conventional antibody tetramer consisting of two heavy immunoglobulin chains and two light immunoglobulin chains is formed with the heavy and light immunoglobulin chains interconnected to each other, for example by disulfide bonds, and the heavy chains similarly connected. The heavy chain constant region includes CH1, CH2, and CH3 as three domains. The light chain constant region consists of CL as one domain.

[0022] The heavy chain variable domain and the light chain variable domain are the binding domains that interact with the antigen. The constant region of the antibody generally mediates the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first element (C1q) of the classical complement system. The term antibody includes immunoglobulins of the IgA, IgG, IgE, IgD, IgM types (as well as subtypes thereof), where the light chain of the immunoglobulin may be of the kappa or lambda type. The overall structure of an immunoglobulin γ (IgG) antibody assembled from two identical heavy (H) chains and two identical light (L) chain polypeptides is well established and highly conserved in mammals (Padlan 1994 Mol Immunol 31:169-217).

[0023] Exceptions to the conventional antibody structure have been found in camel sera. These sera possess, in addition to conventional antibodies, special IgG antibodies. These IgG antibodies are known as heavy chain antibodies (HCAbs), lack the L-chain polypeptide, and lack the first constant domain (CH1). In their N-terminal region, the heavy chains of the homodimeric protein contain a dedicated immunoglobulin chain variable domain, called VHH, which serves to associate with its cognate antigen (Muyldermans et al 2013, Hamers-Casterman et al 1993, Muyldermans et al 1994, which are hereby incorporated by reference in their entirety).

[0024] An antibody fragment, as used herein, refers to a portion of an antibody that specifically binds to a target (e.g., a molecule in which one or more immunoglobulin chains are not full length but specifically bind to the target). Examples of binding fragments encompassed by the term antibody fragment (or “antigen-binding fragment”) are (i) Fab fragment (a monovalent fragment consisting of the VLC, VHC, CL, and CH1 domains), (ii) F(ab’)2 fragment (a bivalent fragment containing two Fab fragments joined by a disulfide bridge in the hinge region), (iii) Fd fragment (consisting of the VHC and CH1 domains), (iv) Fv fragment (consisting of a single group of VLC and VHC domains of an antibody), (v) scFv fragment (consisting of VLC and VHC domains joined by a synthetic linker using recombinant methods such that the VLC and VHC regions pair to form a monovalent molecule), (vi) VH (an immunoglobulin chain variable domain consisting of the VHC domain of a conventional four-chain immunoglobulin (Ward et al 1989)), (vii) VL (an immunoglobulin chain variable domain consisting of the VLC domain, (viii) V-NAR (immunoglobulin chain variable domain consisting of the VHC domain derived from IgNAR of Chondrichthyes) (Roux et al 1998 and Griffiths et al 2013, which are hereby incorporated by reference in their entirety), (ix) VHH is included.

[0025] The total number of amino acid residues of VHH or VH may be in the range of 110 - 140, more suitably in the range of 110 - 120.

[0026] The examples provided herein relate to compositions comprising an immunoglobulin chain variable domain that binds to TNF-α and an immunoglobulin chain variable domain that binds to IL-7R. However, the principles of the invention disclosed herein are equally applicable to any composition comprising a polypeptide that binds to TNF-α and a polypeptide that binds to IL-7R, such as antibodies and antibody fragments. For example, an immunoglobulin chain variable domain can be incorporated into a polypeptide such as a full-length antibody. Such a technique has been demonstrated by McCoy et al., 2014, which engineered an anti-HIV VHH as a fusion with the human Fc region (including the hinge, CH2, and CH3 domains) and expressed it as a dimer construct.

[0027] Suitably, the polypeptide of the present invention comprises an immunoglobulin chain variable domain. More suitably, the polypeptide of the present invention consists of an immunoglobulin chain variable domain. Suitably, the polypeptide of the present invention is an antibody or an antibody fragment. More suitably, the polypeptide of the present invention is an antibody fragment. Suitably, the antibody fragment is a VHH, VH, VL, V-NAR, scFv, Fab fragment, or F(ab’)2 fragment. Suitably, the antibody fragment is an immunoglobulin chain variable domain (such as VHH, VH, VL, etc.). Suitably, the antibody fragment is an immunoglobulin heavy chain variable domain. More suitably, the antibody fragment is a VHH or VH, and most suitably a VHH.

[0028] Specificity, affinity, binding activity, potency, inhibition, and neutralization Specificity refers to the number of various targets (such as antigens or antigenic determinants) to which a specific binding polypeptide can bind. The specificity of a binding polypeptide is the ability of the binding polypeptide to recognize a specific target as a unique molecular entity and distinguish it from others.

[0029] Affinity is represented by the equilibrium constant for the dissociation of the target from the binding polypeptide (Kd), and is a measure of the binding strength between the target and the binding site on the binding polypeptide. The lower the Kd value, the higher the binding strength between the target and the binding polypeptide (alternatively, affinity can also be expressed as the binding constant (Ka), which is 1 / Kd). Affinity can be determined by known methods according to the specific antigen of interest. Appropriately, affinity is determined using a dynamically switchable biosurface (see, for example, "switchSENSER", Knezevic et al 2012) or by surface plasmon resonance.

[0030] Binding activity is a measure of the binding strength between a binding polypeptide and its associated target. Binding activity is related to both the affinity between the target and its binding site on the binding polypeptide and the number of associated binding sites present on the binding polypeptide.

[0031] 10 -6 A Kd value of less than 10 μM is considered to indicate binding. Specific binding of a binding polypeptide to a target (such as an antigen or antigenic determinant) can be determined in appropriate known formats, including, for example, Scatchard analysis and / or competitive binding assays such as radioimmunoassay (RIA), enzyme immunoassay (EIA), and sandwich competition assays, as well as various modifications of these known in the art.

[0032] Efficacy is a measure of the activity of an expressed therapeutic agent (such as a binding polypeptide) in terms of the amount required to produce an effect of a given intensity. A highly potent agent elicits a high response even at low concentrations, as compared to an agent with low efficacy that elicits a small response at low concentrations. Efficacy is influenced by affinity and effect. Effect refers to the ability of a therapeutic agent to produce a biological response upon binding to a target, and the quantitative magnitude of this response. The term half maximal effective concentration (EC50) refers to the concentration of a therapeutic agent that produces a response halfway between the lower and upper limits after a specified exposure time. A therapeutic agent may cause inhibition (specifically, sometimes referred to as the half inhibitory concentration “IC50”) or stimulation. EC50 and IC50 are well - used and are used herein as measures of efficacy. EC50 and IC50 are used interchangeably herein with respect to the TNF - α binding polypeptide and the IL - 7R binding polypeptide due to both binding polypeptides causing inhibition of the target.

[0033] Specific assays suitable for confirming the efficacy of the TNF - α binding polypeptide and the IL - 7R binding polypeptide are detailed below under the headings “TNFα binding polypeptide” and “IL - 7R binding polypeptide”, respectively.

[0034] Polypeptide and Polynucleotide Sequences To compare two closely related polypeptide sequences, the “% sequence identity” between a first polypeptide sequence and a second polypeptide sequence can be calculated using NCBI BLAST v2.0 (BLASTP) with standard settings for polypeptide sequences. To compare two closely related nucleotide sequences, the “% sequence identity” between a first nucleotide sequence and a second nucleotide sequence can be calculated using NCBI BLAST v2.0 (BLASTN) with standard settings for nucleotide sequences.

[0035] The sequences of polypeptides or polynucleotides are said to be the same or identical to the sequences of other polypeptides or polynucleotides if they share 100% sequence identity over their entire lengths. Residues in a sequence are numbered from left to right, i.e., from the N-terminus to the C-terminus for polypeptides and from the 5'-terminus to the 3'-terminus for polynucleotides.

[0036] The "difference" between sequences refers to the insertion, deletion, or substitution of a single amino acid in a part of the second sequence when compared to the first sequence. Two polypeptide sequences may have such amino acid differences of 1, 2, or more. Insertions, deletions, or substitutions in the second sequence that are identical (100% sequence identity) to the first sequence in other respects result in a decrease in the % sequence identity. For example, if the identical sequence is 9 amino acid residues long, one substitution in the second sequence results in 88.9% sequence identity. If the identical sequence is 17 amino acid residues long, two substitutions in the second sequence result in 88.2% sequence identity. If the identical sequence is 7 amino acid residues long, three substitutions in the second sequence result in 57.1% sequence identity. If the first and second polypeptide sequences are 9 amino acid residues long and share 6 identical residues, the first and second polypeptide sequences share more than 66% identity (the first and second polypeptide sequences share 66.7% identity). If the first and second polypeptide sequences are 17 amino acid residues long and share 16 identical residues, the first and second polypeptide sequences share more than 94% identity (the first and second polypeptide sequences share 94.1% identity). If the first and second polypeptide sequences are 7 amino acid residues long and share 3 identical residues, the first and second polypeptide sequences share more than 42% identity (the first and second polypeptide sequences share 42.9% identity).

[0037] Alternatively, the number of additions, substitutions, and / or deletions made to the first array to produce the second array may be determined in order to compare the first reference polypeptide sequence to the second comparison polypeptide sequence. An addition is the addition of one amino acid residue to the first polypeptide sequence (including an addition at either end of the first polypeptide). A substitution is the substitution of one amino acid residue in the first polypeptide sequence with one different amino acid residue. A deletion is the deletion of one amino acid residue from the sequence of the first polypeptide (including a deletion at either terminus of the first polypeptide).

[0038] A "conservative" amino acid substitution is an amino acid substitution in which an amino acid residue is replaced with another amino acid residue having a similar chemical structure and is predicted to have little effect on the function, activity, or other biological properties of the polypeptide. Such conservative substitutions are substitutions in which one amino acid in the following groups is replaced by another amino acid residue in the same group.

[0039] [Table 1]

[0040] Suitably, a hydrophobic amino acid residue is a nonpolar amino acid. More suitably, a hydrophobic amino acid residue is selected from V, I, L, M, F, W, or C.

[0041] As used herein, numbering of CDR and FR polypeptide sequences is as defined according to the Kabat system (Kabat et al 1991 Sequences of Proteins of Immunological Interest, Fifth Edition U.S. Department of Health and Human Services, NIH Publication Number 91-3242, which is hereby incorporated by reference in its entirety). "Corresponding" amino acid residues between a first polypeptide sequence and a second polypeptide sequence are the amino acid residues of the first sequence that share the same position with the second sequence according to the Kabat system, although the identity of the amino acid residues of the second sequence may differ from the first sequence. Appropriately, corresponding residues will share the same number (and letter) when the framework and CDR are of the same length according to the Kabat definition. Alignment can be achieved manually or by using known computer algorithms for sequence alignment such as NCBI BLAST v2.0 (BLASTP or BLASTN) using standard settings, for example.

[0042] The Kabat numbering system is applied to the specific TNF-α and IL-7R binding polypeptides used in the examples provided herein as follows.

[0043] [Table 2]

[0044] Residue numbering from the N-terminus to the C-terminus is provided in the column below. Kabat numbering includes the prefix "H" and is provided in the second column. CDR1, CDR2, and CDR3 are labeled "CDR-H1", "CDR-H2", and "CDR-H3", respectively. Residues of each CDR or FR can also be numbered from the N-terminus to the C-terminus of that CDR or FR.

[0045]

Table 3-1

[0046]

Table 3-2

[0047] The numbering of the ID-38F figure above by the prefix "H" is Kabat numbering, while the numbering above the amino acid sequence is the numbering of consecutive amino acids from the N-terminus to the C-terminus. The residues of each CDR or FR can also be numbered from the N-terminus to the C-terminus of that CDR or FR.

[0048] ID-38F is encoded by the polynucleotide sequence of SEQ ID NO: 17. ID-A62U is encoded by the polynucleotide sequence of SEQ ID NO: 18. Appropriately, the polynucleotides used in the present invention are isolated. An "isolated" polynucleotide is a polynucleotide removed from its original environment. For example, a naturally occurring polynucleotide is isolated when it is separated from some or all of the substances coexisting in the natural system. A polynucleotide is considered to be isolated, for example, when it is cloned into a vector that is not part of its natural environment, or when it is contained within cDNA.

[0049] TNFα-binding polypeptide Functional characteristics All anti-TNF-α polypeptides, polypeptides that interact with TNF-α, or polypeptides against TNF-α are effective TNF-α-binding polypeptides. A TNF-α-binding polypeptide may bind to a linear or conformational epitope on TNF-α. Appropriately, a TNF-α-binding polypeptide binds to human TNF-α.

[0050] Appropriately, the TNF-α-binding polypeptide is 10 -6 M or less, more appropriately 10 -7 M or less, even more appropriately 10 -8Less than 10 nM, and more preferably less than 1 nM -9 Binds to TNF-α with an equilibrium dissociation constant (Kd) of less than 1 nM.

[0051] Preferably, the affinity of the TNF-α binding polypeptide is determined using a dynamically switchable biosurface (see, e.g., “switchSENSER”, Knezevic et al 2012).

[0052] In one embodiment, the affinity of the TNF-α binding polypeptide is established at 25° C. by fusing the TNF-α binding polypeptide to single-stranded DNA at its C-terminus, attaching the DNA-polypeptide fusion to a gold electrode coated with a fluorescently labeled complementary strand of the single-stranded DNA, and then exposing the chip-bound TNF-α binding polypeptide to a 10 kHz current and five different concentrations of human TNF-α ranging from 50 pM to 4.5 nM for 600 seconds, and observing dissociation by time-resolved fluorescence over 8 hours.

[0053] Preferably, the TNF-α binding polypeptide neutralizes TNF-α. A polypeptide that neutralizes TNF-α is, for example, a polypeptide that protects cells from the effects of TNF-α by inhibiting the biological effects of TNF-α. Conventionally, anti-TNF-α therapeutic antibody products have used the L929 mouse cell line with a cell death endpoint as a neutralization assay (Humphreys and Wilson 1999). The L929 assay may be performed to analyze the ability of a TNF-α binding polypeptide to neutralize the effects of TNF-α cytotoxicity by determining the half-maximal effective concentration (EC50) of the TNF-α binding polypeptide. A detailed protocol for the L929 assay is provided below.

[0054] L929 Assay L929 cells (10,000 cells / well) are cultured for 24 hours in the presence of soluble TNFα (500 pg / ml) and actinomycin (0.75 μg / mL) together with dilutions of the purified polypeptide. At the end of the experiment, cell toxicity is determined using resazurin. A test for the inhibition of soluble human TNF-induced cytotoxicity of mouse L929 cells is performed to determine the TNF-α neutralizing activity of each polypeptide that binds to human TNF-α.

[0055] Materials - L929 cells (10,000 cells / well) - Sterile polypropylene 96-well plates - DMEM - Human TNFα concentration: 500 pg / ml - Actinomycin D concentration: 0.75 μg / ml - Purified test polypeptide - Dilution range of the purified polypeptide (e.g.): 300 nM to 5 pM (1:3 dilution) - Dose-response curve of human TNF-α: 10 ng / mL to 0.5 pg / mL - Incubation time: 22 hours - Resazurin cell viability reagent

[0056] Methods On day 0, 10,000 cells / well in 100 μl were seeded into DMEM complete medium in a 96-well microplate and stored at 37°C overnight in 5% CO2. On day 1, a 1:3 serial dilution (in DMEM + Act.D + TNF) for each purified variable domain was set (in sufficient amounts in triplicate at each time point), starting with the top concentration of 300 nM.

[0057] The following controls are added to the plate. 1. DMEM complete + 0.75 μg / mL actinomycin D 2. DMEM complete + 0.75 μg / mL actinomycin D + 0.5 ng / mL of h-TNF-α 3. DMEM complete + 0.01% Triton (only in plates containing TNF-α dose response) 4. DMEM complete (only for plates containing TNF-α dose response).

[0058] Remove the medium from each well of the microplate and incubate the cells with 100 ul of each polypeptide dilution or 100 ul of different controls. After 22 hours of incubation at 37 °C and 5% CO2, add 10 ul of resazurin to each well and incubate the cells at 37 °C for 2 hours. Subsequently, add 50 ul of 3% SDS to each well. Then, read the plate using a fluorescence plate reader at Ex544 nm / Em590 nm.

[0059] Preferably, the TNF-α binding polypeptide neutralizes human TNF-α cytotoxicity in the L929 assay with an EC50 of 100 nM or less, 50 nM or less, 10 nM or less, 5 mM or less, 1 nM or less, 0.9 nM or less, 0.8 nM or less, 0.7 nM or less, 0.6 nM or less, 0.5 nM or less, 0.4 nM or less, 0.3 nM or less, 0.2 nM or less, 0.15 nM or less, etc.

[0060] The neutralizing ability of the TNF-α binding polypeptide can also be confirmed by ELISA. Preferably, the TNF-α binding polypeptide inhibits the binding of human TNF-α to TNFR1 in ELISA analysis with an EC50 of 30 nM or less, preferably 10 nM or less, more preferably 3 nM or less, even more preferably 1 nM or less, also preferably 0.6 nM or less, still more preferably 0.5 nM or less, even more preferably 0.4 nM or less.

[0061] Alternatively, or additionally, the TNF-α binding polypeptide inhibits the binding of human TNF-α to TNFR2 in ELISA analysis with an EC50 of 2 nM or less, preferably 1 nM or less, more preferably 0.9 nM or less, even more preferably 0.8 nM or less, also preferably 0.7 nM or less, still more preferably 0.6 nM or less, even more preferably 0.5 nM or less, more preferably 0.4 nM or less.

[0062] Suitably, ELISA is performed as described in Example 2 of WO2018 / 060453.

[0063] In one embodiment, the affinity of the TNF-α binding polypeptide is established by directly coating a Biacore (or equivalent) sensor chip, where the polypeptide flows over the chip to detect binding. Suitably, the Biacore T200 chip is used at 25 °C in HBS-EP+ (GE Healthcare) running buffer at 30 μl / min.

[0064] Structural characteristics Suitably, the TNF-α binding polypeptide is a polypeptide comprising an antibody fragment. The polypeptide can be an antibody. Suitably, the antibody fragment is selected from the group consisting of V-NAR, scFvs, Fab fragments, F(ab’)2 fragments, or immunoglobulin chain variable domains such as VL, VHH, and VH. More suitably, the antibody fragment is an immunoglobulin chain variable domain, more suitably VHH or VH, and most suitably VHH.

[0065] Suitably, the TNF-α binding polypeptide comprises three CDRs (CDR1, CDR2, CDR3).

[0066] Suitably, CDR1 of the TNF-α binding polypeptide comprises a sequence having at least 20%, suitably at least 40%, more suitably at least 60%, even more suitably at least 80% sequence identity with SEQ ID NO:1, and more suitably consists of this sequence.

[0067] Alternatively, CDR1 of the TNF-α binding polypeptide comprises a sequence having 3 or fewer, suitably 2 or fewer, more suitably 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO:1, and more suitably consists of this sequence.

[0068] Preferably, any residue of CDR1 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 1 is a conservative substitution with respect to its corresponding residue. Preferably, CDR1 includes SEQ ID NO: 1, and more preferably consists of this sequence.

[0069] Preferably, CDR2 of the TNF-α binding polypeptide includes a sequence having at least 20%, preferably at least 30%, more preferably 40%, still more preferably at least 50%, preferably at least 55%, more preferably at least 60%, preferably at least 70%, more preferably at least 75%, preferably at least 80%, more preferably at least 85%, and even more preferably at least 90% sequence identity with SEQ ID NO: 2, and more preferably consists of this sequence.

[0070] Alternatively, CDR2 of the TNF-α binding polypeptide includes a sequence having 8 or fewer, preferably 7 or fewer, more preferably 6 or fewer, still more preferably 5 or fewer, preferably 4 or fewer, more preferably 3 or fewer, preferably 2 or fewer, and even more preferably 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO: 2, and more preferably consists of this sequence.

[0071] Preferably, any residue of CDR2 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 2 is a conservative substitution with respect to its corresponding residue. Preferably, the residue of CDR2 of the TNF-α binding polypeptide corresponding to residue number 10 of SEQ ID NO: 2 is R, H, D, E, N, Q, S, T, Y, G, A, V, L, W, P, M, C, F, or I (most preferably H). Preferably, CDR2 of the TNF-α binding polypeptide includes SEQ ID NO: 2, and more preferably consists of this sequence.

[0072] Preferably, CDR3 of the TNF-α binding polypeptide includes a sequence having at least 30%, preferably 50%, more preferably at least 60%, and still more preferably at least 80% sequence identity with SEQ ID NO: 3, and more preferably consists of this sequence.

[0073] Alternatively, the CDR3 of the TNF-α binding polypeptide comprises a sequence having 3 or fewer, suitably 2 or fewer, more suitably 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO:1, and more suitably consists of this sequence.

[0074] Suitably, any residue of the CDR3 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO:3 is a conservative substitution with respect to its corresponding residue. Suitably, the residue of the CDR3 of the TNF-α binding polypeptide corresponding to residue number 3 of SEQ ID NO:3 is R, H, D, E, N, Q, S, T, Y, G, A, V, L, W, P, M, C, F, or I, or suitably, R, H, D, E, N, Q, S, T, Y, G, V, L, W, P, M, C, F, or I (most suitably H). Suitably, the residue of the CDR3 of the TNF-α binding polypeptide corresponding to residue number 3 of SEQ ID NO:3 is H, and the other residues of the CDR3 of the TNF-α binding polypeptide that are different from the corresponding residues of SEQ ID NO:3 are conservative substitutions with respect to their corresponding residues. Suitably, the CDR3 of the TNF-α binding polypeptide comprises SEQ ID NO:3, and more suitably consists of this sequence.

[0075] Alternatively, the CDR3 of the TNF-α binding polypeptide comprises a sequence sharing 30%, 50%, 60%, 80% etc. sequence identity with SEQ ID NO:3, and more suitably consists of this sequence, and residue number 3 of the CDR3 is R, D, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, or V (suitably H or a conservative substitution of H, more suitably H). Alternatively, residue number 3 of the CDR3 is H or a conservative substitution of H (most suitably H), and the other residues of the CDR3 that are different from the corresponding residues of SEQ ID NO:3 are conservative substitutions.

[0076] Preferably, residue 1 of CDR1 of the TNF-α binding polypeptide is S, V, or N, residues 2-4 are HWM, and residue 5 is Y or C. Preferably, residues 1-9 of CDR2 of the TNF-α binding polypeptide are EINTNGLIT, residue 10 is H, K, S, or N, residue 11 is Y, residue 12 is G, V, I, or A, residue 13 is D, residue 14 is S or F, residue 15 is V or T, residue 16 is H, K, R, or G, and residue 17 is G. Preferably, residue 1 of CDR3 of the TNF-α binding polypeptide is N, residue 2 is Q or E, residue 3 is H, K, M, or R, and residues 4-6 are GLN.

[0077] Preferably, the TNF-α binding polypeptide comprises three CDRs (CDR1, CDR2, CDR3) and four framework regions (FR1-FR4).

[0078] Preferably, FR1 of the TNF-α binding polypeptide comprises a sequence that shares 5%, 12%, 18%, 26%, 32%, 38%, 46%, 52%, 58%, 62%, 66%, 68%, 72%, 75%, 78%, 82%, 85%, 90%, or 95%, or more sequence identity with SEQ ID NO: 4, and more preferably consists of this sequence.

[0079] Preferably, any residue of FR1 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 4 is a conservative substitution with respect to its corresponding residue. Preferably, the residue of FR1 of the TNF-α binding polypeptide corresponding to residue number 1 of SEQ ID NO: 4 is G, A, V, L, I, F, P, S, T, Y, C, M, K, R, H, W, D, E, or N (more preferably D or E, most preferably D). Preferably, the residue of FR1 of the TNF-α binding polypeptide corresponding to residue number 5 of SEQ ID NO: 4 is G, A, V, L, I, F, P, S, T, Y, C, M, K, R, H, W, D, E, or N (preferably V). Preferably, the residues of FR1 of the TNF-α binding polypeptide corresponding to residues 1 to 5 of SEQ ID NO: 4 are DVQLV. Preferably, the residues of FR1 of the TNF-α binding polypeptide corresponding to residue number 20 and / or 24 of SEQ ID NO: 4 are amino acids that are hydrophobic (most preferably L or A respectively). Preferably, the residue of FR1 of the TNF-α binding polypeptide corresponding to residue number 29 of SEQ ID NO: 4 is F. Preferably, FR1 of the TNF-α binding polypeptide comprises SEQ ID NO: 4, and more preferably consists of this sequence.

[0080] Preferably, FR2 of the TNF-α binding polypeptide comprises a sequence that shares 10%, 15%, 25%, 30%, 40%, 45%, 55%, 60%, 70%, 75%, 85%, or 90%, or more sequence identity with SEQ ID NO: 5, and more preferably consists of this sequence.

[0081] Preferably, any residue of FR2 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 5 is a conservative substitution with respect to its corresponding residue. Preferably, the residues of FR2 of the TNF-α binding polypeptide corresponding to residues 8 to 11 of SEQ ID NO: 5 are KEXE, where X is R or L. Alternatively, the residues of FR2 of the TNF-α binding polypeptide corresponding to residues 9 to 12 of SEQ ID NO: 5 are GLEW. Preferably, FR2 of the TNF-α binding polypeptide comprises SEQ ID NO: 5, and more preferably consists of this sequence.

[0082] Suitably, the FR3 of the TNF-α binding polypeptide comprises a sequence sharing 8%, 15%, 20%, 26%, 32%, 40%, 45%, 52%, 58%, 65%, 70%, 76%, 80%, 82%, 85%, 90%, 92%, or 95%, or more sequence identity with SEQ ID NO: 6, and more suitably consists of this sequence.

[0083] Suitably, the residue of the FR3 of the TNF-α binding polypeptide corresponding to residue number 26 of SEQ ID NO: 6 is an amino acid that is hydrophobic (suitably, A). Suitably, any residue of the FR3 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 6 is a conservative substitution with respect to its corresponding residue. Suitably, the FR3 of the TNF-α binding polypeptide comprises SEQ ID NO: 6, and more suitably consists of this sequence.

[0084] Suitably, the FR4 of the TNF-α binding polypeptide comprises a sequence sharing 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or more sequence identity with SEQ ID NO: 7, and more suitably consists of this sequence.

[0085] Suitably, any residue of the FR4 of the TNF-α binding polypeptide that is different from the corresponding residue of SEQ ID NO: 7 is a conservative substitution with respect to its corresponding residue. Suitably, the FR4 of the TNF-α binding polypeptide comprises SEQ ID NO: 7, and more suitably consists of this sequence.

[0086] Suitably, the TNF-α binding polypeptide comprises a sequence sharing 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or more sequence identity with SEQ ID NO: 8, and more suitably consists of this sequence. Suitably, the N-terminus of the TNF-α binding polypeptide is D. Suitably, the TNF-α binding polypeptide comprises SEQ ID NO: 8, and more suitably consists of this sequence.

[0087] According to certain embodiments, the TNF-α binding polypeptide has an amino acid sequence that is not exactly the same as (does not share exactly 100% sequence identity with) the amino acid sequence of a naturally occurring polypeptide.

[0088] IL-7R binding polypeptide Functional characteristics An anti-IL-7R polypeptide, a polypeptide that interacts with IL-7R, or a polypeptide against IL-7R are all effective IL-7R binding polypeptides. The IL-7R binding polypeptide may bind to a linear or conformational epitope on IL-7R. Preferably, the IL-7R binding polypeptide binds to IL-7Rα.

[0089] Suitably, the IL-7R binding polypeptide binds to human IL-7R. Suitably, the IL-7R binding polypeptide binds to both soluble and membrane-bound IL-7R.

[0090] Suitably, the polypeptide of the present invention neutralizes IL-7 and / or L-TSLP that binds to human IL-7R.

[0091] Suitably, the polypeptide of the present invention neutralizes human IL-7 and / or human L-TSLP that binds to human IL-7R. More suitably, the polypeptide of the present invention neutralizes human IL-7 and / or human L-TSLP that binds to human IL-7R and at least one additional primate IL-7R selected from the group consisting of cynomolgus IL-7R, marmoset IL-7R, rhesus IL-7R, and squirrel monkey IL-7R. Most suitably, the polypeptide of the present invention neutralizes human IL-7 and human L-TSLP that binds to human IL-7R.

[0092] Suitably, the IL-7R binding polypeptide targets an epitope on IL-7R that is at and / or forms part of the IL-7 binding site of IL-7R, whereby the polypeptide results in inhibition or reduction of IL-7R-mediated signal transduction upon binding to IL-7R.

[0093] An IL-7R-binding polypeptide is a neutralizing polypeptide for the purposes of the present invention if the polypeptide binds to IL-7R (suitably IL-7Rα) as measured by ELISA and inhibits the binding of IL-7R to IL-7 and / or L-TSLP. A specific ELISA method suitable for determining the level of inhibition in this context is detailed in Example 1 below.

[0094] Suitably, the IL-7R-binding polypeptide neutralizes IL-7R that binds to IL-7 with an EC50 of 2.00 nM or less, 1.50 nM or less, 1.00 nM or less, 0.90 nM or less, 0.80 nM or less, 0.70 nM or less, 0.65 nM or less, 0.60 nM or less, 0.55 nM or less, 0.50 nM or less, 0.45 nM or less, 0.4 nM or less, 0.35 nM or less, 0.30 nM or less, etc. Suitably, the EC50 is established using the IL-7 / IL-7R neutralization ELISA detailed in Example 1 below.

[0095] Suitably, the polypeptide that binds to IL-7R neutralizes IL-7R-dependent, IL-7-induced STAT5 phosphorylation in human lymphocytes with an EC50 of 100 nM or less, 50 nM or less, 25 nM or less, 10 nM or less, 8 nM or less, 6 nM or less, 5 nM or less, 4 nM or less, 3 nM or less, 2 nM or less, 1.5 nM or less, 1 nM or less, etc. Suitably, the EC50 is established using the IL-7-induced STAT5 phosphorylation assay detailed in Example 1 below.

[0096] Suitably, the affinity of the IL-7R-binding polypeptide is determined by surface plasmon resonance.

[0097] Suitably, the IL-7R-binding polypeptide binds to IL-7R with an equilibrium dissociation constant (Kd) of 10 -7 M or less, more suitably 10 -8 M or less, even more suitably 10 -9 M or less, and still even more suitably 10 -10 M or less.

[0098] In one embodiment, the affinity of the IL-7R binding polypeptide is established by directly coating a sensor plate of Biacore (or equivalent), where the polypeptide flows over the plate to detect binding. Appropriately, the Biacore T200 plate is used at 25°C in a running buffer of HBS-EP+ (GE Healthcare) at 30 ul / min.

[0099] Structural characteristics Appropriately, the IL-7R binding polypeptide is a polypeptide comprising an antibody fragment. The polypeptide can be an antibody. Appropriately, the antibody fragment is selected from the group consisting of V-NAR, scFvs, Fab fragments, F(ab’)2 fragments, or immunoglobulin chain variable domains such as VL, VHH, and VH. More appropriately, the antibody fragment is an immunoglobulin chain variable domain, more appropriately VHH or VH, and most appropriately VHH.

[0100] Appropriately, the IL-7R binding polypeptide comprises three CDRs (CDR1, CDR2, CDR3).

[0101] Appropriately, CDR1 of the IL-7R binding polypeptide comprises a sequence sharing 20%, 40%, 60%, 80%, or more sequence identity with SEQ ID NO: 9.

[0102] Alternatively, CDR1 of the polypeptide of the IL-7R binding polypeptide comprises a sequence having 4 or fewer, appropriately 3 or fewer, more appropriately 2 or fewer, and even more appropriately 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO: 9, and even more appropriately consists of this sequence.

[0103] Appropriately, any residue of CDR1 of the IL-7R binding polypeptide that is different from the corresponding residue of SEQ ID NO: 9 is a conservative substitution with respect to its corresponding residue. Appropriately, FR2 of the IL-7R binding polypeptide comprises SEQ ID NO: 9, and even more appropriately consists of this sequence.

[0104] Preferably, the residues of CDR1 have the following identity (SEQ ID NO: 28).

[0105] [Table 4]

[0106] More preferably, CDR1 contains SEQ ID NO: 9 and even more preferably consists of this sequence.

[0107] Preferably, CDR2 of the IL-7R binding polypeptide contains a sequence having at least 20%, preferably at least 30%, more preferably at least 40%, even more preferably at least 50%, also preferably at least 55%, even more preferably at least 60%, also preferably at least 65%, even more preferably at least 70%, also preferably at least 75%, even more preferably at least 80%, also preferably at least 85%, and even more preferably at least 90% sequence identity with SEQ ID NO: 10, and even more preferably consists of this sequence.

[0108] Alternatively, CDR2 of the IL-7R binding polypeptide contains a sequence having 8 or fewer, preferably 7 or fewer, more preferably 6 or fewer, even more preferably 5 or fewer, also preferably 4 or fewer, even more preferably 3 or fewer, also preferably 2 or fewer, and even more preferably 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO: 10, and even more preferably consists of this sequence.

[0109] Preferably, any residue of CDR2 of the IL-7R binding polypeptide that is different from the corresponding residue of SEQ ID NO: 10 is a conservative substitution with respect to that corresponding residue. Preferably, CDR2 of the IL-7R binding polypeptide contains SEQ ID NO: 10 and even more preferably consists of this sequence.

[0110] Preferably, the residues of CDR2 have the following identity (SEQ ID NO: 29).

[0111] [Table 5]

[0112] Preferably, the residue of CDR2 corresponding to residue number 16 of SEQ ID NO: 10 is Q or K, most preferably K. Preferably, CDR2 comprises or consists of SEQ ID NO: 10. More preferably, CDR2 comprises SEQ ID NO: 10, and even more preferably consists of this sequence.

[0113] Preferably, the CDR3 of the IL-7R binding polypeptide comprises, and even more preferably consists of, a sequence having at least 20%, preferably at least 30%, more preferably 40%, even more preferably at least 50%, preferably at least 55%, even more preferably at least 60%, preferably at least 65%, even more preferably at least 70%, preferably at least 75%, even more preferably at least 80%, preferably at least 85%, and even more preferably at least 90% sequence identity with SEQ ID NO: 11.

[0114] Alternatively, the CDR3 of the IL-7R binding polypeptide comprises, and even more preferably consists of, a sequence having 6 or fewer, preferably 5 or fewer, more preferably 4 or fewer, even more preferably 3, preferably 2 or fewer, and even more preferably 1 or fewer additions, substitutions, and / or deletions compared to SEQ ID NO: 11.

[0115] Preferably, any residue of the CDR3 of the IL-7R binding polypeptide that is different from the corresponding residue of SEQ ID NO: 11 is a conservative substitution with respect to its corresponding residue.

[0116] Preferably, the residues of CDR3 have the following identity (SEQ ID NO: 30).

[0117] [Table 6]

[0118] Preferably, the CDR3 of the IL-7R binding polypeptide comprises, and even more preferably consists of, SEQ ID NO: 11.

[0119] Suitably, the IL-7R binding polypeptide comprises three CDRs (CDR1, CDR2, CDR3) and four framework regions (FR1 to FR4).

[0120] Suitably, FR1 of the IL-7R binding polypeptide comprises a sequence that shares 5%, 12%, 18%, 26%, 32%, 38%, 46%, 52%, 58%, 62%, 66%, 68%, 72%, 75%, 78%, 82%, 85%, 90%, or 95%, or more sequence identity with SEQ ID NO: 12, and more suitably consists of this sequence.

[0121] Suitably, any residue of FR1 that is different from the corresponding residue of SEQ ID NO: 12 is a conservative substitution with respect to its corresponding residue. Suitably, the residue of FR1 corresponding to residue number 1 of SEQ ID NO: 12 is D or E, most suitably D. Suitably, the residues of FR1 corresponding to residues numbers 1 to 5 of SEQ ID NO: 12 are DVQLV. Suitably, FR1 comprises SEQ ID NO: 12, and more suitably consists of this sequence. Suitably, the residue of FR1 corresponding to residue number 24 of SEQ ID NO: 12 is S.

[0122] Suitably, FR2 of the IL-7R binding polypeptide comprises a sequence that shares 10%, 15%, 25%, 30%, 40%, 45%, 55%, 60%, 70%, 75%, 85%, or 90%, or more sequence identity with SEQ ID NO: 13, and more suitably consists of this sequence.

[0123] Preferably, any residue of FR2 that is different from the corresponding residue of SEQ ID NO: 13 is a conservative substitution with respect to its corresponding residue. Preferably, the residue of FR2 corresponding to residue number 10 of SEQ ID NO: 13 is R or L, most preferably L. Preferably, the residues of FR2 corresponding to residue numbers 8-11 of SEQ ID NO: 13 are KEXE, where X is R or L, most preferably L. Alternatively, the residues of FR2 corresponding to residue numbers 9-12 of SEQ ID NO: 13 are GLEW. Preferably, FR2 comprises SEQ ID NO: 13, and more preferably consists of this sequence. Preferably, the residue of FR2 corresponding to residue number 2 of SEQ ID NO: 13 is F, and in addition, more preferably, the residue of FR2 corresponding to residue number 14 of SEQ ID NO: 13 is A. Preferably, the residues of FR2 corresponding to residues 9-14 of SEQ ID NO: 13 are ELEFLA (SEQ ID NO: 79). Preferably, the residues of FR2 corresponding to residues 9-14 of SEQ ID NO: 13 are not GLEWVS (SEQ ID NO: 80). Preferably, the residue of FR2 corresponding to residue number 9 of SEQ ID NO: 13 is not G. More preferably, the residue of FR2 corresponding to residue number 9 of SEQ ID NO: 13 is E.

[0124] Preferably, the FR3 of the IL-7R binding polypeptide comprises a sequence that shares 8%, 15%, 20%, 26%, 32%, 40%, 45%, 52%, 58%, 65%, 70%, 76%, 80%, 82%, 85%, 90%, 92%, or 95%, or more sequence identity with SEQ ID NO: 14, and more preferably consists of this sequence.

[0125] Preferably, any residue of FR3 that is different from the corresponding residue of SEQ ID NO: 14 is a conservative substitution with respect to its corresponding residue. Preferably, FR3 comprises SEQ ID NO: 14, and more preferably consists of this sequence. Preferably, the residues of FR3 corresponding to residue numbers 18, 19, and 20 of SEQ ID NO: 14 are NSL. Preferably, the residue of FR3 corresponding to residue number 21 of SEQ ID NO: 14 is R. Preferably, the residue of FR3 corresponding to residue number 22 of SEQ ID NO: 14 is A.

[0126] Suitably, the FR4 of the IL-7R binding polypeptide comprises a sequence sharing 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more sequence identity with SEQ ID NO: 15, and more suitably consists of this sequence.

[0127] Suitably, any residue of the FR4 of the IL-7R binding polypeptide that is different from the corresponding residue of SEQ ID NO: 15 is a conservative substitution with respect to that corresponding residue. Suitably, the FR4 of the IL-7R binding polypeptide comprises SEQ ID NO: 15, and more suitably consists of this sequence.

[0128] Suitably, the IL-7R binding polypeptide comprises a sequence sharing 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with SEQ ID NO: 16, and more suitably consists of this sequence.

[0129] Suitably, the CDR3 of the IL-7R binding polypeptide comprises SEQ ID NO: 16, and more suitably consists of this sequence.

[0130] In certain embodiments, the IL-7R binding polypeptide has an amino acid sequence that is not exactly the same as the amino acid sequence of a naturally occurring polypeptide (does not share exactly 100% sequence identity).

[0131] A specific combination of the structural and functional properties of both the TNF-α binding polypeptide and the IL-7R binding polypeptide Suitably, both the TNF-α binding polypeptide and the IL-7R binding polypeptide are immunoglobulin chain variable domains, where (a) The CDR1 of the TNF-α binding polypeptide comprises a sequence sharing 40% or more sequence identity with SEQ ID NO: 1, (b) The CDR2 of the TNF-α binding polypeptide comprises a sequence sharing 40% or more sequence identity with SEQ ID NO: 2, (c) The CDR3 of the TNF-α binding polypeptide contains a sequence that shares 50% or more sequence identity with SEQ ID NO: 3, (d) The CDR1 of the IL-7R binding polypeptide contains a sequence that shares 40% or more sequence identity with SEQ ID NO: 9, (e) The CDR2 of the IL-7R binding polypeptide contains a sequence that shares 40% or more sequence identity with SEQ ID NO: 10, (f) The CDR3 of the IL-7R binding polypeptide contains a sequence that shares 50% or more sequence identity with SEQ ID NO: 11, More preferably, (a) The CDR1 of the TNF-α binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 1, (b) The CDR2 of the TNF-α binding polypeptide contains a sequence that shares 50% or more sequence identity with SEQ ID NO: 2, (c) The CDR3 of the TNF-α binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 3, (d) The CDR1 of the IL-7R binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 9, (e) The CDR2 of the IL-7R binding polypeptide contains a sequence that shares 50% or more sequence identity with SEQ ID NO: 10, (f) The CDR3 of the IL-7R binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 11, More preferably, (a) The CDR1 of the TNF-α binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 1, (b) The CDR2 of the TNF-α binding polypeptide contains a sequence that shares 70% or more sequence identity with SEQ ID NO: 2, (c) The CDR3 of the TNF-α binding polypeptide contains a sequence that shares 65% or more sequence identity with SEQ ID NO: 3, (d) The CDR1 of the IL-7R binding polypeptide contains a sequence that shares 60% or more sequence identity with SEQ ID NO: 9, (e) The CDR2 of the IL-7R binding polypeptide contains a sequence that shares 70% or more sequence identity with SEQ ID NO: 10, (f) The CDR3 of the IL-7R binding polypeptide comprises a sequence sharing at least 65% sequence identity with SEQ ID NO: 11, more preferably, (a) The CDR1 of the TNF-α binding polypeptide comprises a sequence sharing at least 80% sequence identity with SEQ ID NO: 1, (b) The CDR2 of the TNF-α binding polypeptide comprises a sequence sharing at least 85% sequence identity with SEQ ID NO: 2, (c) The CDR3 of the TNF-α binding polypeptide comprises a sequence sharing at least 80% sequence identity with SEQ ID NO: 3, (d) The CDR1 of the IL-7R binding polypeptide comprises a sequence sharing at least 80% sequence identity with SEQ ID NO: 9, (e) The CDR2 of the IL-7R binding polypeptide comprises a sequence sharing at least 85% sequence identity with SEQ ID NO: 10, (f) The CDR3 of the IL-7R binding polypeptide comprises a sequence sharing at least 80% sequence identity with SEQ ID NO: 11, In each case, most preferably, the TNF-α binding polypeptide neutralizes human TNF-α cytotoxicity in the L929 assay with an EC50 of 100 nM or less, and the IL-7R binding polypeptide neutralizes IL-7R-dependent, IL7-induced STAT5 phosphorylation in human lymphocytes with an EC50 of 100 nM or less, and / or the TNF-α binding polypeptide binds to TNF-α with a Kd of 10 -7 M or less, and the IL-7R binding polypeptide binds to IL7R with a Kd of 10 -7 M or less. Most preferably, the above polypeptides are provided in a diabody construct for oral administration in the treatment of Crohn's disease or ulcerative colitis.

[0132] Preferably, both the TNF-α binding polypeptide and the IL-7R binding polypeptide are of the same class of immunoglobulin light chain variable domain, such as VH, VHH, or VL, more preferably VH or VHH.

[0133] Format of TNF-α and IL-7R binding polypeptides The TNF-α binding polypeptide and the IL-7R binding polypeptide may or may not be bound to each other.

[0134] In one embodiment, the TNF-α binding polypeptide and the IL-7R binding polypeptide may be present independently of each other in the composition of the present invention (the TNF-α and IL-7R binding polypeptides are not bound to each other). In certain embodiments, the composition comprises (a) a polypeptide having ID-38F (SEQ ID NO: 8) or at least 75%, more suitably at least 85% identity thereto, and (b) a polypeptide having ID-A62U (SEQ ID NO: 16) or at least 75%, more suitably at least 85% identity thereto.

[0135] In a further embodiment, the TNF-α binding polypeptide and the IL-7R binding polypeptide comprised in the composition of the present invention are bound to each other (thereby forming a single construct). Such a format may be convenient for recombinant expression. Thus, such constructs of the present invention are multimeric and multivalent. When no more polypeptides are comprised in the construct, such a construct can be referred to as a "heterobihead". Since the multivalent construct comprises two or more binding polypeptides, it provides two or more sites to which attachment to an antigen can occur (suitably, before or after cleavage of the labile peptide linker if such a linker is present in the construct; see "linker" below).

[0136] Suitably, the molecular weight of each polypeptide in the construct is 300 kDa or less, 250 kDa, 200 kDa, 180 kDa, 160 kDa, 140 kDa, 120 kDa, 100 kDa, 80 kDa, 60 kDa, 40 kDa, 30 kDa, 20 kDa, 15 kDa, etc.

[0137] Linker When bound, the TNF-α and IL-7R binding polypeptides can be bound to each other directly (without using a linker) or via a linker. Appropriately, a linker is used. This linker can be a protease-labile or non-protease-labile linker. The linker is appropriately a peptide selected to enable the binding of the polypeptide to its epitope. Appropriately, the linker is flexible, for example, flexible enough to allow both binding polypeptides to bind simultaneously to their target. When used for therapeutic purposes, the linker is appropriately non-immunogenic in the subject to whom the polypeptide is administered. Appropriately, the polypeptide and the linker are expressed as a single contiguous polypeptide construct.

[0138] Appropriately, the length of the peptide linker is at least 5, at least 7, at least 10, at least 13, at least 16, at least 19, at least 20, at least 21, etc. Appropriately, the length of the peptide linker is 40 residues or less, 35 residues or less, 30 residues or less, 25 residues or less, etc.

[0139] Appropriately, the peptide linker consists of any amino acid selected from the group consisting of arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, proline, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Proline may be a suboptimal amino acid for inclusion in the linker, and thus, more appropriately, the peptide linker consists of any amino acid selected from the group consisting of arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan.

[0140] When the TNF-α and IL-7R binding polypeptides bind, they may be in the orientation of anti-TNF-α linker - anti-IL-7R (from N-terminus to C-terminus) or in the orientation of anti-IL-7R linker - anti-TNF-α. Most appropriately, they are in the orientation of anti-TNF-α linker - anti-IL-7R.

[0141] The composition of the present invention containing TNF-α and IL-7R binding polypeptides linked by a peptide linker can be obtained, for example, by preparing a nucleic acid encoding the two binding polypeptides and a peptide linker using techniques for nucleic acid synthesis and then expressing the thus obtained nucleic acid (as detailed below under the heading of "Preparation Method").

[0142] Non-protease labile linker Suitably, the non-protease labile linker is a peptide and does not contain a cleavage site for proteases.

[0143] Suitably, the non-protease labile linker has the format -(G a S b ) x -, where a is from 1 to 10, b is from 1 to 5, and x is from 1 to 15 (SEQ ID NO: 31). Suitably, a is from 1 to 5, b is from 1 to 2, and x is from 1 to 10. Suitably, a is 4, b is 1, and x is from 1 to 8 (SEQ ID NO: 32).

[0144] Protease labile linker The protease labile linker is more suitable than the non-protease labile linker because the constituent monomers are released and can freely bind to their targets upon cleavage. The protease labile linker (or "labile peptide linker") is a peptide and contains at least one cleavage site for proteases. By including the protease labile linker in the construct of the present invention, for example, it becomes possible to conveniently produce the construct in a heterodimeric form that is cleaved after administration of the individual binding polypeptides later.

[0145] In one embodiment of the present invention, the labile peptide linker can be engineered to withstand cleavage by proteases to a desired extent and / or to be cleaved only upon exposure to a specific intestinal region. For example, when the construct is recombinantly produced in a host such as yeast, the trypsin-like protease produced by the yeast may cleave the recombinant construct product. This can make purification difficult and may result in regulatory, clinical, and commercial complications.

[0146] This can be achieved by incorporating a shielding residue into the labile peptide linker adjacent to the labile site. The shielding residue is adjacent to the labile site of the labile peptide linker and reduces its lability. By positioning the labile site near or on the outer periphery of the labile peptide linker, the cleavage resistance can also be increased. This concept is referred to as the "shielded labile site" and regulates the lability.

[0147] Alternatively, the labile peptide linker can be engineered to be highly labile to cleavage by intestinal proteases and thus rapidly release the constituent polypeptides of the construct after oral administration. This is achieved by incorporating one or more labile sites into the labile peptide linker, such that the labile sites are exposed for proteolysis, for example, by positioning the labile site near the center of the labile peptide linker and / or by having a labile site that is not substantially shielded by adjacent residues. This concept is referred to as the "unprotected labile site".

[0148] Incorporating a P residue immediately after an R or K residue into the labile peptide linker of the construct of the present invention is presumed to substantially prevent cleavage of the labile peptide linker. Suitably, the labile peptide linker does not contain a P residue.

[0149] Trypsin labile site Suitably, the labile peptide linker comprises a cleavage site for trypsin or a trypsin-like protease. Suitably, the labile peptide linker comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, etc. K residues. Suitably, the labile peptide linker comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, etc. R residues. Preferably, the cleavage site is one or more K residues.

[0150] Suitably, the protease-labile linker has the format [-(G a S b ) v -(G c S d ) w -B t -(G e S f ) x -(G g S h ) y z and more preferably consists of this format, where B is lysine or arginine, t is from 1 to 5, a, c, e, and g are each independently from 0 to 10, b, d, f, and h are each independently from 0 to 5, v, w, x, and y are each independently from 0 to 10, and z is from 1 to 5 (SEQ ID NO: 33). More preferably, B is lysine or arginine, t is 1 or 2, a, c, e, and g are each independently from 1 to 5, b, d, f, and h are each independently from 1 to 3, v, w, x, and y are each independently from 1 to 3, and z is from 1 to 3, and even more preferably, B is lysine or arginine, t is from 1 to 3, a, c, e, and g are each independently from 2 to 4, b, d, f, and h are each independently from 1 to 2, v, w, x, and y are each independently from 1 to 2, and z is 1.

[0151] ​Particularly preferred linkers of this format are -(G4S) x -K-(G4S) y - selected from, where x and y are each independently 1 to 5 (SEQ ID NO: 34), more preferably selected from -(G4S)2-K-(G4S)2- (i.e., -GGGGSGGGGSKGGGGSGGGGS- (SEQ ID NO: 21)).

[0152] Preferably, the labile peptide linker comprises or more preferably consists of a polypeptide sequence of the following format -B-(G a S) x -B’- wherein a is 1 to 10 x is 1 to 10 B is K or R, and B’ is K or R (SEQ ID NO: 35).

[0153] In one embodiment, a is 2 to 5, more preferably 4. In a further embodiment, x is 1 to 5. More preferably, x is 2. B may or may not be present. B’ may or may not be present. Preferably, B is K. Preferably, B’ is K.

[0154] Particularly preferred linkers of this format are selected from the group consisting of -K-(G4S)2-K- (SEQ ID NO: 36), -(G4S)2-K- (SEQ ID NO: 37), -K-(G4S)2- (SEQ ID NO: 38), -R-(G4S)2-R- (SEQ ID NO: 39), -(G4S)2-R- (SEQ ID NO: 40), and -R-(G4S)2- (SEQ ID NO: 41).

[0155] Preferably, the labile peptide linker comprises or more preferably consists of a polypeptide sequence of the following format -B-(G a S) x -B’-(G b S) y -B”- wherein a is from 1 to 10, b is from 1 to 10, x is from 1 to 10, y is from 1 to 10, B is K or R, B’ is K or R, and B” is K or R (SEQ ID NO: 42).

[0156] In one embodiment, a is from 2 to 5, more preferably 4. In one embodiment, b is from 2 to 5, more preferably 4. In a further embodiment, x is from 1 to 5. More preferably, x is 2. In a further embodiment, y is from 1 to 5. More preferably, y is 2. Preferably, B is K. Preferably, B’ is K. Preferably, B” is K.

[0157] Chymotrypsin labile site Alternatively, or in addition to the trypsin labile site, the labile peptide linker of the construct may include a cleavage site for chymotrypsin or a chymotrypsin-like protease. Preferably, the labile peptide linker comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 residues selected from the group consisting of W, F, Y, L, and M, more preferably W, F, and Y. Preferably, the labile peptide linker consists of residues selected from the group consisting of S, G, W, F, Y, L, and M, such as S, G, W, F, and Y.

[0158] Preferably, the protease labile linker has the format [-(G a S b ) v -(G c S d ) w -J t -(G e S f ) x -(G g S h ) y z ​comprises or more preferably consists of this format, where J is W, F, Y, L, or M, t is from 1 to 5, a, c, e, and g are each independently from 0 to 10, b, d, f, and h are each independently from 0 to 5, v, w, x, and y are each independently from 0 to 10, and z is from 1 to 5 (SEQ ID NO: 43). More preferably, J is W, F, Y, L, or M, t is 1 or 2, a, c, e, and g are each independently from 1 to 5, b, d, f, and h are each independently from 1 to 3, v, w, x, and y are each independently from 1 to 3, and z is from 1 to 3. Even more preferably, J is W, F, Y, L, or M, t is from 1 to 3, a, c, e, and g are each independently from 2 to 4, b, d, f, and h are each independently from 1 to 2, v, w, x, and y are each independently from 1 to 2, and z is 1.

[0159] Enterokinase labile site Alternatively, or in addition to the trypsin and / or chymotrypsin labile sites, the labile peptide linker of the construct may comprise a cleavage site for enterokinase. Preferably, the labile peptide linker comprises or consists of a sequence such as -G4S-DDDDK-G4S- (SEQ ID NO: 20), including the sequence DDDDK (SEQ ID NO: 19).

[0160] MMP labile site In one embodiment, the labile peptide linker of the construct may comprise a cleavage site for MMP3, MMP10, or MMP12.

[0161] Other labile sites In one embodiment, the labile peptide linker of the construct may comprise a cleavage site for other inflammatory or microbial proteases where the cleavage site is known.

[0162] Stability of the polypeptide within the construct In embodiments where the construct comprises a non-protease labile linker, suitably, the construct as a whole (the binding polypeptide (which may be an immunoglobulin chain variable domain) and the non-protease labile linker) is substantially resistant to proteases such as trypsin and chymotrypsin. In embodiments where the construct comprises a protease labile linker, suitably, the polypeptide (the binding polypeptide which may be an immunoglobulin chain variable domain) is substantially resistant to proteases such as trypsin and chymotrypsin, but the protease labile linker is labile to proteases such as trypsin or chymotrypsin.

[0163] Stability of labile peptide linkers to expression hosts A variety of organisms may be used to express recombinant polypeptides. Commonly used expression organisms include yeast, mold, and mammalian cells. However, many of these expression organisms produce proteases such as trypsin-like proteases, which may cleave the expressed recombinant polypeptide. When the expressed polypeptide incorporates one or more protease labile peptide linkers present in the intestinal tract, this peptide linker may be unduly labile to proteases produced by the expression organism, thus preventing efficient expression of the intact polypeptide.

[0164] It is convenient for the labile peptide linker to be substantially non-labile to the enzymes produced by the recombinant host used for the production of the construct. Suitably, the labile peptide linker is substantially resistant to proteases produced by recombinant hosts such as bacteria like Escherichia coli, or yeasts or molds such as Saccharomyces cerevisiae or Pichia pastoris belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula, or Pichia.

[0165] Suitably, the recombinant host is a yeast or a mold. Suitably, the yeast belongs to the genus Saccharomyces, Kluyveromyces, Hansenula, Pichia, Candida, or Torulopsis. Suitably, the mold belongs to the genus Aspergillus, Acremonium, Alternaria, Chrysosporium, Cladosporium, Dictyostelium, Fusarium, Mucor, Penicillium, Rhizopus, Stachybotrys, Trichoderma, and Trichophyton.

[0166] Gastrointestinal tract and digestive enzymes The gastrointestinal tract (GIT) is an organ system responsible for food consumption and digestion, nutrient absorption, and excretion of excreta. In humans and other mammals, the GIT consists of the esophagus, stomach, small intestine (duodenum, jejunum, and ileum), and large intestine (cecum, colon, rectum, and anal canal). Various pathogens can colonize in various regions of the GIT, and various diseases may occur. The intestinal tract (in contrast to the gastrointestinal tract) consists of the small intestine and the large intestine.

[0167] Each of the various parts of the gastrointestinal tract contains a complex mixture of digestive enzymes. Proteases are involved in digesting polypeptide chains into shorter fragments by splitting the peptide bonds that link amino acid residues (proteolysis). Some release terminal amino acids from the protein chain (exopeptidases), while others attack internal peptide bonds of the protein (endopeptidases). Proteolysis can be quite random so that a wide range of protein substrates are hydrolyzed. This is an example of a protease that cleaves the diverse polypeptides ingested in the intestinal tract into smaller polypeptide fragments.

[0168] Most proteases generally have specificity only for the residue to which they bind a single amino acid (labile site) on the substrate. Examples of proteases present in the intestinal tract include trypsin, trypsin-like proteases, chymotrypsin, chymotrypsin-like proteases, carboxypeptidase, elastase, aminopeptidase, carboxypeptidase, and enteropeptidase. Trypsin-like proteases cleave peptide bonds after lysine or arginine residues. Chymotrypsin-like proteases cleave peptide bonds after hydrophobic residues such as tyrosine, phenylalanine, tryptophan, leucine, and methionine. In particular, tyrosine, phenylalanine, and tryptophan.

[0169] In particular, in the context of oral agents, the binding polypeptide desirably exhibits substantial resistance to one or more proteases (such as all) of the intestinal tract, while the labile peptide linker (if used) desirably is labile to one or more proteases (such as all) of the intestinal tract.

[0170] Suitably, the polypeptide in the construct exhibits substantial resistance to one or more proteases, and suitably, the labile peptide linker (if present) is labile to one or more proteases that are present in the small intestine or large intestine, more suitably the jejunum, ileum, and / or cecum. A polypeptide that exhibits substantial resistance substantially retains its neutralizing ability and / or efficacy when exposed to one or more proteases.

[0171] Such proteases include proteases supplied by the microflora or pathogenic bacteria that colonize the gastrointestinal tract. For example, such proteases are proteases attached to the cell membrane, secreted proteases, and proteases released onto the cell lysate. Such proteases may further include IBD inflammatory proteases such as MMP3, MMP10, and MMP12. Suitably, one or more proteases are serine proteases. Suitably, one or more proteases are selected from the group consisting of enteropeptidase, trypsin, trypsin-like proteases, chymotrypsin, and chymotrypsin-like proteases.

[0172] Suitably, the polypeptide substantially retains its neutralizing ability and / or efficacy upon oral delivery and after exposure to the intestinal tract (e.g., after exposure to proteases in the small intestine and / or large intestine, and / or IBD inflammatory proteases). Proteases in the small intestine and / or large intestine, or proteases produced in the small intestine and / or large intestine, include proteases supplied by the microflora and / or pathogenic bacteria that colonize the intestine. For example, such proteases are proteases attached to the cell membrane, secreted proteases, and proteases released onto the cell lysate. Most suitably, the proteases are trypsin and chymotrypsin.

[0173] Suitably, the intestinal tract is the intestinal tract of a dog, pig, rat, guinea pig, hamster, rabbit, human, cynomolgus monkey, or mouse. The small intestine suitably consists of the duodenum, jejunum, and ileum. The large intestine suitably consists of the cecum, colon, rectum, and anal canal.

[0174] A polypeptide substantially retains its neutralizing ability if at least 10%, suitably at least 20%, more suitably at least 30%, also suitably at least 40%, further suitably at least 50%, also suitably at least 60%, further suitably at least 70%, also suitably at least 80%, further suitably at least 90%, also suitably at least 95%, further suitably 100% of the polypeptide's or construct's native neutralizing ability is retained after a given exposure period at a given temperature following exposure to proteases present in the small intestine and / or large intestine and / or IBD inflammatory proteases. This concept is referred to herein as "survival rate".

[0175] Suitably, the polypeptide substantially retains its neutralizing ability after being exposed to proteases present in the small intestine and / or large intestine and / or IBD inflammatory proteases at 37 °C for, for example, at least up to 2 hours, suitably at least up to 3 hours, more suitably at least up to 4 hours, further suitably at least up to 5 hours, also suitably at least up to 5.5 hours, further suitably at least up to 6 hours, also suitably at least up to 12 hours, further suitably at least up to 14 hours, also suitably at least up to 16 hours.

[0176] A polypeptide substantially retains its neutralizing ability if at least 10%, suitably at least 20%, more suitably at least 30%, also suitably at least 40%, further suitably at least 50%, also suitably at least 60%, further suitably at least 70%, also suitably at least 80%, further suitably at least 90%, also suitably at least 95%, further suitably 100% of the polypeptide's or construct's native neutralizing ability is retained after a given exposure period at a given temperature following exposure to human fecal supernatant or mouse small intestine fluid. This concept is referred to herein as "survival rate".

[0177] Suitably, the polypeptide substantially retains its neutralizing ability after being exposed to human fecal supernatant or mouse intestinal fluid at 37°C for, for example, at least a maximum of 2 hours, suitably at least a maximum of 3 hours, more suitably at least a maximum of 4 hours, even more suitably at least a maximum of 5 hours, also suitably at least a maximum of 5.5 hours, even more suitably at least a maximum of 6 hours, also suitably at least a maximum of 12 hours, even more suitably at least a maximum of 14 hours, and also suitably at least a maximum of 16 hours.

[0178] Autoimmune and / or inflammatory diseases The compositions and constructs provided by the present invention may find particular utility in the prevention or treatment of autoimmune and / or inflammatory diseases. Suitably, the autoimmune and / or inflammatory diseases are inflammatory bowel diseases and / or mucositis, most suitably inflammatory bowel diseases (Crohn's disease, ulcerative colitis, or checkpoint inhibitor-induced colitis, most suitably ulcerative colitis or Crohn's disease).

[0179] Autoimmune diseases occur when the immune system reacts detrimentally to normal body tissues. Autoimmune diseases can lead to damage to body tissues, abnormal organ growth, and / or changes in organ function. This disorder can affect either a single organ or tissue type or multiple organs and tissues. Organs and tissues commonly affected by autoimmune diseases include blood components such as red blood cells, blood vessels, connective tissue, endocrine glands such as the thyroid and pancreas, muscles, joints, and skin. Inflammatory diseases are diseases characterized by inflammation. Many inflammatory diseases are autoimmune diseases, and vice versa.

[0180] Autoimmune and / or inflammatory diseases of the GIT Chronic inflammatory bowel diseases (IBD), Crohn's disease, and ulcerative colitis afflict both children and adults and are examples of autoimmune and inflammatory diseases of the gastrointestinal tract (GIT) (Hendrickson et al 2002, which is hereby incorporated by reference in its entirety). Ulcerative colitis is defined as a disease in which the inflammatory response and morphological changes persist in the colon. The rectum is involved in 95% of patients. Most of the inflammation is limited to the mucosa and consists of a continuous involvement of varying severity with ulceration, edema, and bleeding along the length of the colon (Hendrickson et al 2002, which is hereby incorporated by reference in its entirety). Ulcerative colitis is usually manifested by the presence of stools mixed with blood and mucus, in addition to lower abdominal cramps that are most severe during the passage of stools. Clinically, the presence of diarrhea with blood and mucus differentiates ulcerative colitis from irritable bowel syndrome without blood. Unlike ulcerative colitis, the symptoms of Crohn's disease are usually subtle and are diagnosed later. Factors such as the location, extent, and severity of involvement determine the degree of gastrointestinal symptoms. Patients with ileocolonic involvement usually experience right lower quadrant tenderness and postprandial abdominal pain sometimes accompanied by inflammatory masses. Symptoms associated with Crohn's disease of the gastroduodenum include early satiety, nausea, vomiting, epigastric pain, or dysphagia. Perianal diseases are generally anal polyps, in addition to deep anal fissures, and fistulas (Hendrickson et al 2002, which is hereby incorporated by reference in its entirety).

[0181] Other GIT diseases include, for example, mucositis, an inflammatory disease in which the inflammatory lesion is present in the mucosa that interferes with the tight junctions of the epithelium (appropriately, drug- and radiation-induced mucositis). In mucositis, the lesions can occur anywhere from the mouth to the anus, and for lesions in the oral cavity and esophagus, a mouthwash or cream preparation containing the composition can be used. For lesions in the anus and rectum, a suppository, cream, or foam for topical administration containing the composition is appropriate. The composition is removed from the basement membrane or other inflammatory sites via absorption into the bloodstream at the site of inflammation or removal of lymphatic fluid and subsequent entry into the bloodstream. Therefore, the composition reaches the liver via the bloodstream and is removed in the kidneys via glomerular filtration. Thus, there is excellent theoretical basis for the composition of the present invention to function against diseases such as autoimmune hepatitis, type II diabetes, and glomerulonephritis.

[0182] Appropriately, the composition of the present invention is used for the treatment or prevention of autoimmune and / or inflammatory diseases of the GIT.

[0183] Appropriately, the composition of the present invention is used for the treatment of autoimmune and / or inflammatory diseases of the GIT selected from the group consisting of Crohn's disease, ulcerative colitis, irritable bowel disease, type II diabetes, glomerulonephritis, autoimmune hepatitis, Sjögren's syndrome, celiac disease, drug- or radiation-induced mucositis, esophagitis, and checkpoint inhibitor-induced colitis (more appropriately, Crohn's disease, ulcerative colitis, or checkpoint inhibitor-induced colitis, most appropriately ulcerative colitis or Crohn's disease).

[0184] Oral delivery of the composition ideally treats the inflammatory disease. In this case, TNF-α (or TNF-α receptor) and / or IL-7R (or IL-7 or L-TSLP) contribute to at least a part of the disease state, and more appropriately, the immunoglobulin chain variable domain is accessible to the tissues where these cytokines are biologically active.

[0185] Skin autoimmune and / or inflammatory diseases Psoriasis is a debilitating autoimmune skin disease. The most common form of this disease is plaque psoriasis, which is characterized by red skin covered with silver scales. Histologically, the picture is one of disordered differentiation and hyperproliferation in keratinocytes within psoriatic plaques with inflammatory cell infiltration (Ortonne, 1999). Psoriatic skin lesions are well-demarcated, red, inflammatory plaques of various shapes with characteristic shiny silver scales. The term psoriasis includes psoriasis, as well as psoriatic symptoms including erythema, skin thickening / elevation, and scaling.

[0186] Biological agents used in the treatment of psoriasis include anti-TNF-α therapeutic agents (monoclonal antibodies against TNF, such as adalimumab or infliximab, or TNF-α receptor fusion proteins such as etanercept), humanized antibodies against CD11a (efalizumab), or agents such as alefacept that bind to CD2 (thereby blocking the CD2-LFA3 interaction). It should be noted that not all of the biological agents listed herein are approved for use in the treatment of psoriasis.

[0187] The compositions of the present invention may be incorporated into creams / ointments or other topical carriers for administration to inflammatory skin lesions in which TNF-α (or TNF-α receptor) and / or IL-7R (or IL-7 or L-TSLP) contribute to the pathogenesis of such lesions.

[0188] Suitably, the compositions of the present invention are for use in the treatment of skin autoimmune and / or inflammatory diseases selected from the group consisting of pemphigus, psoriasis, eczema, and scleroderma.

[0189] In one embodiment, the polypeptide or construct of the present invention is for use, suitably by topical delivery and / or, suitably in the form of a cream, nanoparticle, ointment, or hydrogel, in the treatment or prevention of atopic dermatitis through the skin.

[0190] Therapeutic uses and delivery Suitably, the compositions of the present invention are used as agents that are suitably administered by oral administration, and are suitably used for the treatment and / or prevention of GIT diseases and / or for the treatment or prevention of diseases such as autoimmune diseases and / or inflammatory diseases such as inflammatory bowel disease. Suitably, the constructs of the present invention are those used as agents that are suitably administered by oral administration. The compositions of the present invention may also be used for the treatment or prevention by oral administration for other health conditions such as metabolic disorders such as obesity. In one embodiment, the compositions of the present invention are intended to have a local effect on the intestinal tract. In one embodiment, the compositions of the present invention are not used for the treatment or prevention of diseases by delivering a therapeutically effective amount into the circulation.

[0191] In one aspect of the present invention, there is provided a method of treating an autoimmune disease and / or an inflammatory disease, the method comprising the step of administering to a person in need thereof a therapeutically effective amount of the composition of the present invention. Suitably, the autoimmune disease and / or inflammatory disease is inflammatory bowel disease and / or mucositis.

[0192] The anti-TNF-α binding polypeptide and the anti-IL-7R binding polypeptide may be formulated together in the composition of the present invention or separately formulated and administered separately, sequentially, or simultaneously.

[0193] The TNF-α binding polypeptide and the IL-7R binding polypeptide may be administered by the same route or different routes. For example, the TNF-α binding polypeptide may be administered orally while the IL-7R binding polypeptide may be administered rectally.

[0194] In one aspect of the present invention, there is provided a TNF-α binding polypeptide for use in the treatment or prevention of autoimmune and / or inflammatory diseases, together with an IL-7R binding polypeptide. In a further aspect, there is provided an IL-7R binding polypeptide for use in the treatment or prevention of autoimmune and / or inflammatory diseases, together with a TNF-α binding polypeptide.

[0195] In a further aspect of the present invention, there is provided a method of treating an autoimmune and / or inflammatory disease, the method comprising administering to a person in need thereof a TNF-α binding polypeptide together with an IL-7R binding polypeptide. Also provided is a method of treating an autoimmune and / or inflammatory disease, the method comprising administering to a person in need thereof an IL-7R binding polypeptide together with a TNF-α binding polypeptide.

[0196] In a further aspect of the present invention, there is provided a composition for use in the treatment or prevention of inflammatory bowel disease and / or mucositis, comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide.

[0197] In a further aspect of the present invention, there is provided a composition for use in the treatment or prevention of inflammatory bowel disease and / or mucositis, comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide, the composition being administered orally.

[0198] In a further aspect of the present invention, there is provided the use of a composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide in the manufacture of a medicament for the treatment or prevention of an autoimmune and / or inflammatory disease, suitably inflammatory bowel disease and / or mucositis.

[0199] In a further aspect of the present invention, there is provided the use of a composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide in the manufacture of a medicament for the treatment or prevention of an autoimmune and / or inflammatory disease, suitably inflammatory bowel disease and / or mucositis, by oral administration.

[0200] In a further aspect of the invention, there is provided a method of treating and / or preventing an inflammatory bowel disease and / or mucositis, the method comprising administering to a person in need thereof a composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide.

[0201] In a further aspect of the invention, there is provided a method of treating and / or preventing an inflammatory bowel disease and / or mucositis, the method comprising orally administering to a person in need thereof a composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide.

[0202] In the above embodiments, the inflammatory disease is suitably mucositis or esophagitis, and the inflammatory bowel disease is suitably Crohn's disease, ulcerative colitis, or checkpoint inhibitor-induced colitis, most suitably ulcerative colitis or Crohn's disease. Further, in the above embodiments, the TNF-α binding polypeptide is suitably a polypeptide comprising an antibody fragment, and / or the IL-7R binding polypeptide is suitably a polypeptide comprising an antibody fragment. More suitably, the TNF-α binding polypeptide and the IL-7R binding polypeptide are both polypeptides comprising antibody fragments. More suitably, both polypeptides are ICVD.

[0203] Administering one binding polypeptide "together with" another binding polypeptide means that the therapeutic concentration ranges of each binding polypeptide overlap with each other. This means, for example, that a therapeutically effective amount of each binding polypeptide is present in the subject's body simultaneously. In certain embodiments, a therapeutically effective amount of each binding polypeptide is present simultaneously at the site where treatment is needed.

[0204] A therapeutically effective amount of the composition of the present invention is an amount effective to significantly neutralize the biological effect of the selected target in a subject after single or multiple administrations to the subject. The therapeutically effective amount may vary depending on factors such as the disease state, age, gender, and weight of the individual, as well as the ability of the construct to induce the desired response in the individual. The therapeutically effective amount is also an amount where the therapeutically beneficial effect exceeds the toxic or harmful effects of the construct. The composition of the present invention can be incorporated into a pharmaceutical composition suitable for oral administration to a subject.

[0205] The composition of the present invention can be formulated for oral delivery. The composition of the present invention may assume various forms. For example, liquid, liquid solution, dispersion, or suspension, and semi-solid and solid dosage forms such as tablets, pills, and powders can be mentioned. Solid dosage forms are preferred. Appropriately, the composition of the present invention is provided in tablets, more appropriately in small tablets. Appropriately, the construct of the present invention is provided in tablets, more appropriately in small tablets, for the treatment of ulcerative colitis or Crohn's disease. More appropriately, the construct of the present invention is provided in enteric-coated small tablets for oral administration.

[0206] In the treatment of eosinophilic esophagitis, delivery in the form of lozenges is particularly preferred. In the treatment of atopic dermatitis, delivery in the form of cream is particularly preferred.

[0207] The composition contains pharmaceutically acceptable excipients and can be used appropriately in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.

[0208] Generally, the composition comprises a pharmaceutically acceptable excipient such as a carrier that forms a pharmaceutical composition. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and combinations thereof. The pharmaceutically acceptable carrier may contain minor amounts of auxiliary substances such as wetting agents, emulsifying agents, preservatives, or buffers, thereby enhancing the shelf life or effectiveness of the polypeptide or construct of the present invention. The pharmaceutical composition may contain antiadherents, binders, coatings, disintegrants, flavorings, colors, lubricants, adsorbents, preservatives, sweeteners, lyophilization excipients (including cryoprotectants), or compression aids. Suitably, the polypeptide in the composition of the present invention is lyophilized and then incorporated into the pharmaceutical composition.

[0209] The composition of the present invention may also be provided with an enteric coating. An enteric coating is a polymeric barrier applied to oral medications that protects the polypeptide from the low pH of the stomach. Materials used for enteric coatings include fatty acids, waxes, shellac, plastics, and vegetable fibers. Suitable enteric coating components include methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate (hypromellose acetate succinate), polyvinyl acetate phthalate (PVAP), methyl methacrylate-methacrylic acid copolymer, sodium alginate, and stearic acid. Suitable enteric coatings contain pH-dependent release polymers. These are polymers that do not dissolve at the highly acidic pH found in the stomach but dissolve rapidly at a low acidic pH. Thus, suitably, the enteric coating will not dissolve in acidic gastric juice (pH up to 3) but will dissolve in the high pH environment in the small intestine (pH above 6) or colon (pH above 7.0). The pH-dependent release polymer is selected such that the composition of the present invention is released at approximately the time it reaches the target region of the intestinal tract.

[0210] The pharmaceutical composition of the present invention may be formulated in a buffer solution at a concentration of 5 to 50, more suitably 15 to 40, or even more suitably 25 to 30 g / liter in order to stabilize the pH of the composition. Examples of suitable buffer components include physiological salts such as sodium citrate and / or citric acid. Suitably, the buffer solution contains a physiological salt such as sodium chloride at 100 to 200, more suitably 125 to 175 mM. Suitably, the buffer solution is selected to have a pKa close to the pH of the composition or the physiological pH of the patient.

[0211] The polypeptide concentration in a typical pharmaceutical composition may range from about 1 mg / mL to about 200 mg / ml, from about 50 mg / mL to about 200 mg / mL, or from about 150 mg / mL to about 200 mg / mL.

[0212] The aqueous formulation of the pharmaceutical composition of the present invention may be formulated in a pH buffer solution, for example, in a pH range of about 4.0 to about 7.0, about 5.0 to about 6.0, or about 5.5. Examples of suitable buffer solutions include phosphate buffer, histidine buffer, citrate buffer, succinate buffer, acetate buffer, and other organic acid buffers. The buffer concentration may be, for example, about 1 mM to about 100 mM, about 5 mM to about 50 mM, depending on the buffer and the desired tonicity of the formulation.

[0213] The tonicity of a pharmaceutical composition can be modified by including a tonicity modifier. Such tonicity modifiers may be charged or uncharged chemical species. Typical uncharged tonicity modifiers include saccharides, sugar alcohols, or other polyols, preferably trehalose, sucrose, mannitol, glycerol, 1,2-propanediol, raffinose, sorbitol, or lactitol (especially trehalose, mannitol, glycerol, or 1,2-propanediol). Typical charged tonicity modifiers include salts such as combinations of sodium, potassium, or calcium ions with chloride, sulfate, carbonate, sulfite, nitrate, lactate, succinate, acetate, or maleate ions (especially sodium chloride or sodium sulfate), or amino acids such as arginine or histidine. Appropriately, aqueous formulations are isotonic, although hypertonic or hypotonic solutions may also be appropriate. The term "isotonic" refers to a solution that has the same tonicity as some other solution being compared, such as physiological saline or serum. Tonicity modifiers can be used in amounts of about 5 mM to about 350 mM, for example 1 mM to 500 nM. Appropriately, at least one tonicity modifier is included in the composition.

[0214] Surfactants may also be added to pharmaceutical compositions to reduce aggregation of formulated constructs, minimize particle formation in the formulation, and / or reduce absorption. Typical surfactants include polyoxyethylene sorbitan fatty acid esters (Tween), polyoxyethylene alkyl ethers (Brij), alkylphenyl polyoxyethylene ethers (Triton-X), polyoxyethylene-polyoxypropylene copolymers (poloxamers, Pluronic®), and sodium dodecyl sulfate (SDS). Examples of suitable polyoxyethylene sorbitan fatty acid esters are polysorbate 20 and polysorbate 80. Typical surfactant concentrations can range from about 0.001% to about 10% w / v.

[0215] In order to protect the polypeptide from unstable conditions during the lyophilization process, a lipoprotectant may also be added. For example, known lipoprotectants include saccharides (including glucose, sucrose, mannose, and trehalose), polyols (including mannitol, sorbitol, and glycerol), and amino acids (including alanine, glycine, and glutamic acid). The lipoprotectant can be included in an amount of about 10 mM to 500 mM.

[0216] The dosage range of the pharmaceutical composition of the present invention is the range for producing the desired therapeutic effect. The required dosage range depends on the exact nature of the pharmaceutical composition or construct, the target area of the intestinal tract, the nature of the formulation, the age of the patient, the nature, degree, or severity of the patient's disease, contraindications if any, and the judgment of the attending physician. Variations in these dosage levels can be adjusted using standard empirical routines for optimization.

[0217] The daily dose of the appropriate pharmaceutical composition of the present invention is in the range of 50 μg to 40 mg / kg, such as 5 to 30 mg / kg, 50 ng to 50 mg / kg. The unit dose can vary up to less than 100 mg, but generally is in the range of 250 to 2000 mg per single administration, and this amount may be administered frequently over more than one day, for example, twice, three times, or four times a day, or at intervals of one day, or once a week.

[0218] The TNF-α binding polypeptide and the IL-7R binding polypeptide are present in the composition of the present invention, and when not bound to each other, the molar ratio of the TNF-α binding polypeptide to the IL-7R binding polypeptide may be in the state of 20:1 to 1:20, for example 15:1 to 1:15, suitably 10:1 to 1:10, more suitably 5:1 to 1:5, still more suitably 3:1 to 1:3, also suitably 2:1 to 1:2, still more suitably 1.5:1 to 1:1.5.

[0219] The treatment of the disease further includes the treatment of the exacerbation of the disease, the improvement of symptoms, and the treatment of the patient in remission from the symptoms to prevent the recurrence of the symptoms.

[0220] Combination therapy The pharmaceutical composition of the present invention may also contain one or more active agents (e.g., active agents suitable for treating diseases such as those described herein). It is within the scope of the present invention to use the pharmaceutical composition of the present invention in a method of treatment for treating autoimmune and / or inflammatory diseases, as an adjuvant to other established therapeutic agents commonly used for treating bacterial, autoimmune, and / or inflammatory diseases, or in combination with such therapeutic agents.

[0221] In the treatment of inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), possible combinations include, for example, 5-aminosalicylic acid or its prodrugs (such as sulfasalazine, olsalazine, or bisalazide), corticosteroids (such as prednisone, methylprednisolone, or budesonide), immunosuppressive drugs (such as cyclosporine, tacrolimus, methotrexate, azathioprine, or 6-mercaptopurine), anti-TNF-α antibodies (such as infliximab, adalimumab, certolizumab pegol, or golimumab), anti-IL12 / IL23 antibodies (such as ustekinumab), anti-IL-23p19 specific antibodies (such as brazikumab, risankizumab, or mirikizumab), anti-IL6R antibodies, or small molecule IL12 / IL23 inhibitors (such as apilimod), anti-oncostatin M antibodies (anti-α-4-β-7 antibodies (such as vedolizumab)), MAdCAM-1 blockers (such as PF-00547659), antibodies against the cell adhesion molecule α-4-integrin (such as natalizumab), antibodies against the IL2 receptor α subunit (such as daclizumab or basiliximab), JAK1 inhibitors (such as filgotinib or upadacitinib), JAK3 inhibitors (such as tofacitinib or R348), Syk inhibitors and their prodrugs (such as fostamatinib and R-406), phosphodiesterase-4 inhibitors (such as tetomilast), HMPL-004, probiotics, delsalazine, semapimod / CPSI-2364, and protein kinase C inhibitors (such as AEB-071). The most appropriate combination drugs are JAK1 inhibitors (such as filgotinib or upadacitinib), JAK3 inhibitors (such as tofacitinib or R348), anti-IL12 / IL23 antibodies (such as ustekinumab), anti-IL-23p19 specific antibodies (such as brazikumab, risankizumab, or mirikizumab), or anti-α-4-β-7 antibodies (such as vedolizumab).

[0222] Accordingly, another aspect of the present invention provides a pharmaceutical composition of the present invention in combination with one or more additional active agents, such as one or more of the additional active agents described above. In a further aspect of the present invention, the pharmaceutical composition or construct is administered continuously, simultaneously, or separately with at least one active agent selected from the above group.

[0223] Similarly, another aspect of the present invention provides a combined pharmaceutical product, which (A) the pharmaceutical composition of the present invention, and (B) one or more other active agents and components (A) and (B) are each formulated by mixing with a pharmaceutically acceptable adjuvant, diluent, or carrier. In this aspect of the present invention, the combined pharmaceutical product may be a single (combination) formulation or part of a kit. For this reason, this aspect of the present invention encompasses a combined formulation comprising the pharmaceutical composition or construct of the present invention and another therapeutic agent, mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier.

[0224] The present invention also encompasses part of a kit, and this part of the kit (i) the pharmaceutical composition of the present invention mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier, and (ii) a formulation containing one or more other active agents mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier and components (i) and (ii) are each administered in a form suitable for administration in combination with the other.

[0225] For this reason, some of the components (i) of the kit are those obtained by mixing the above component (A) with a pharmaceutically acceptable adjuvant, diluent, or carrier. Similarly, component (ii) is those obtained by mixing the above component (B) with a pharmaceutically acceptable adjuvant, diluent, or carrier. One or more other active agents (i.e., the above component (B)) may be any of the agents described above in connection with the treatment of, for example, bacterial infections such as Clostridium difficile infection, autoimmune and / or inflammatory diseases such as IBD (e.g., Crohn's disease and / or ulcerative colitis). When component (B) is two or more additional active agents, these active agents may be formulated together with each other, formulated together with component (A), or formulated separately. In one embodiment, component (B) is one other therapeutic agent. In another embodiment, component (B) is two other therapeutic agents. The combination pharmaceutical (either the combined component formulation or a part of the kit) of this aspect of the present invention may be used for the treatment or prevention of autoimmune diseases (e.g., autoimmune diseases described herein).

[0226] Vectors and Hosts As used herein, the term "vector" is intended to refer to a nucleic acid molecule capable of carrying another nucleic acid to which it is ligated. One type of vector is a plasmid, which refers to a circular double-stranded DNA loop to which additional DNA segments can be ligated. Other types of vectors are viral vectors, where additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication, as well as episomal mammalian and yeast vectors). Other vectors (e.g., non-episomal mammalian vectors) integrate into the host cell genome upon introduction into the host cell and are thereby replicated along with the host genome. Furthermore, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). In general, expression vectors useful in recombinant DNA techniques often take the form of plasmids. As used herein, the terms "plasmid" and "vector" may be used interchangeably since the plasmid is the most commonly used form of vector. However, the present invention is intended to include expression viruses such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses) that perform an equivalent role, as well as other forms such as bacteriophages and phagemids. The present invention also relates to nucleotide sequences encoding polypeptides in the compositions of the present invention. The term "recombinant host cell" (or simply "host cell") as used herein is intended to refer to a cell into which a recombinant expression vector has been introduced. Such term is intended to refer to the progeny of this cell in addition to the particular subject cell.

[0227] In one aspect of the present invention, there is provided a polynucleotide encoding a construct of the present invention, and a vector containing cDNA containing the polynucleotide. In a further aspect of the present invention, there is provided a host cell transformed with the vector, which is capable of expressing the construct of the present invention. Suitably, the host cell is a yeast cell belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula or Pichia such as Saccharomyces cerevisiae, Escherichia coli or Pichia pastoris.

[0228] Preparation method Polypeptides, and constructs containing polypeptides, can be obtained and manipulated using, for example, the techniques disclosed in Green and Sambrook 2012.

[0229] Monoclonal antibodies can be produced using hybridoma technology by fusing B cells that produce specific antibodies with myeloma (B cell cancer) cells selected for their growth ability in tissue culture and lack of antibody chain synthesis (Kohler et al., 1975 and Nelson et al., 2000, which are hereby incorporated by reference in their entirety).

[0230] Monoclonal antibodies directed against a determined antigen can be obtained, for example, a) immortalizing lymphocytes obtained from the peripheral blood of an animal pre-immunized with the determined antigen, immortal cells, preferably myeloma cells, to form hybridomas, b) culturing the formed immortalized cells (hybridomas) and recovering cells that produce antibodies with the desired specificity by.

[0231] Alternatively, the use of hybridoma cells is not necessary. Thus, monoclonal antibodies a) cloning into a vector, specifically a phage, more specifically a filamentous bacteriophage, DNA, or cDNA sequence obtained from lymphocytes, particularly peripheral blood lymphocytes of an animal (appropriately pre-immunized with a determined antigen); b) transforming a prokaryotic cell with the above vector under conditions enabling antibody production; c) selecting the antibody by subjecting it to antigen affinity selection; d) recovering an antibody having the desired specificity can be obtained by a process comprising.

[0232] Methods are known for immunizing camels and cloning the VHH repertoire of circulating B cells (Chomezynnski et al., 1987), as well as for immunizing (Arbabi-Ghahroudi et al., 1997) and isolating antigen-specific VHH from immune and non-immune (Tanha et al 2002) libraries using phage, yeast, or ribosome display (WO92 / 01047, Nguyen et al., 2001, and Harmsen et al., 2007). These references are hereby incorporated by reference in their entirety.

[0233] Antibody fragments such as scFv and Fv fragments can be isolated and expressed in E. coli (Miethe et al., 2013, Skerra et al., 1988, and Ward et al., 1989, which are hereby incorporated by reference in their entirety).

[0234] A mutation may be made to DNA or cDNA encoding a polypeptide that, while unchanged with respect to the amino acid sequence of the polypeptide, provides codons preferred for translation in a particular host. For example, codons preferred for translation of nucleic acids in E. coli, P. pastoris, and S. cerevisiae are known. Mutations of a polypeptide can be achieved, for example, by substitution, addition, or deletion of a nucleic acid encoding the polypeptide. Substitution, addition, or deletion of a nucleic acid encoding a polypeptide can be introduced by many methods, such as error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-directed mutagenesis (Ling et al 1997, which is hereby incorporated by reference in its entirety), gene reconstruction, gene site saturation mutagenesis (GSSM), synthetic ligation reconstruction (SLR), or combinations of these methods. Modification, addition, or deletion of a nucleic acid can also be introduced by methods including recombination, recursive sequence recombination, phosphorothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiation mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, ensemble mutagenesis, chimeric nucleic acid multimer generation, or combinations thereof.

[0235] In particular, artificial gene synthesis may be used (Nambiar et al 1984, Sakamar et al., 1988, Wells et al., 1985, and Grundstrom et al., 1985, which are hereby incorporated by reference in their entirety). Genes encoding polypeptides can be synthetically produced, for example, by solid-phase DNA synthesis. The entire gene can be synthesized de novo without the need for a precursor template DNA. To obtain the desired oligonucleotide, the building blocks are sequentially joined to the growing oligonucleotide chain in the order required for the sequence of the product. When the assembly of the chain is complete, the product is released from the solid phase into solution, deprotected, and collected. The product can be isolated by high-performance liquid chromatography (HPLC) (Verma et al., 1998) to obtain the desired oligonucleotide with high purity.

[0236] Expression of immunoglobulin chain variable domains such as VH and VHH can be achieved using an appropriate expression vector such as a prokaryotic cell, such as Escherichia coli, (e.g., according to the protocol disclosed in WO94 / 04678, which is hereby incorporated by reference and detailed below). Expression of immunoglobulin chain variable domains such as VH and VHH can also be achieved using eukaryotic cells, such as insect cells, CHO cells, Vero cells, or yeast, such as yeast belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula, or Pichia. Appropriately, S. cerevisiae is used (e.g., according to the protocol disclosed in WO94 / 025591, which is hereby incorporated by reference and detailed below).

[0237] Specifically, VHH can be prepared using Escherichia coli cells according to the method disclosed in WO94 / 04678 by a process comprising the following steps: a) In a Bluescript vector (Agilent Technologies), cloning the DNA or cDNA sequence encoding a VHH, optionally containing a His tag (e.g., obtained from camel lymphocytes or produced synthetically); b) Recovering the cloned fragment after amplification using a 5' primer specific for the VHH containing an XhoI site and a 3' primer containing a SpeI site having the sequence TCTTAACTAGTGAGGAGACGGTGACCTG (SEQ ID NO: 13); c) In an Immuno PBS vector (Huse et al., 1989, incorporated herein by reference in its entirety), cloning the recovered fragment in-phase after digestion of the vector with XhoI and SpeI restriction enzymes; d) Transforming a host cell, particularly Escherichia coli, by transfection with the recombinant Immuno PBS vector of step c; e) Recovering the expression product of the VHH coding sequence by affinity purification, such as column chromatography using Protein A, cation exchange, or nickel affinity resin if the VHH contains a His tag.

[0238] Alternatively, immunoglobulin chain variable domains such as VH and VHH a) Obtaining the DNA or cDNA sequence encoding a VHH having a determined specific antigen-binding site; b) Amplifying the obtained DNA or cDNA using a 5' primer containing a start codon and a HindIII site, and a 3' primer containing a stop codon having an XhoI site; c) Recombining the amplified DNA or cDNA back into the HindIII (position 2650) and XhoI (position 4067) sites of plasmid pMM984 (Merchlinsky et al., 1983, incorporated herein by reference in its entirety); d) a step of transfecting permissive cells, particularly NB-E cells (Faisst et al., 1995, incorporated herein by reference), e) a step of recovering the obtained product can be obtained by a process comprising:

[0239] Furthermore, immunoglobulin heavy chain variable domains such as VHH or VH can be produced using Escherichia coli or S. cerevisiae according to the methods disclosed in Frenken et al., 2000 and WO99 / 23221 (incorporated herein by reference in its entirety).

[0240] A blood sample is taken from an immunized llama, and the lymphocyte population is enriched via discontinuous gradient centrifugation with Ficoll (a neutral, highly branched, high-mass, hydrophilic polysaccharide that is soluble in aqueous solution - Pharmacia). Total RNA is isolated by discontinuous gradient centrifugation and acid guanidinium thiocyanate extraction (Chomezynnski et al., 1987). After performing first-strand cDNA synthesis (using a cDNA kit such as RPN 1266 (Amersham)), DNA fragments encoding VHH and VH fragments, as well as part of a short or long hinge region, are amplified by PCR using specific primers detailed on pages 22 and 23 of WO99 / 23221. Upon digestion of the PCR fragments with PstI and HindIII or BstEII, DNA fragments of approximately 300 - 450 bp in length are purified via agarose gel electrophoresis and ligated into the Escherichia coli phagemid vector pUR4536 or the episomal S. cerevisiae expression vector pUR4548, respectively. pUR4536 is derived from pHEN (Hoogenboom et al., 1991, incorporated herein by reference in its entirety) and enables the cloning of llama VHH and VH genes due to lacI qIt contains a gene and unique restriction sites. pUR4548 is derived from pSY1 (Harmsen et al., 1993, which is incorporated herein by reference in its entirety). The BstEII site in the leu2 gene was removed from this plasmid via PCR, and the cloning site between the SUC2 signal sequence and the terminator was replaced to facilitate the cloning of VH / VHH gene fragments. VH / VHH has a c-myc tag at the C-terminus to be detected. Individual E. coli JM109 colonies are transferred to 96-well microtiter plates containing 150 ml of 2TY medium supplemented with 1% glucose and L -1 ampicillin and transferred to 96-well microtiter plates containing 150 ml of 2TY medium. After growth overnight (37 °C), the plates are L -1 replicated into 2TY medium containing 100 mg of ampicillin and 0.1 mM IPTG. After further incubation overnight and optionally freeze-thawing, the cells are centrifuged to form pellets, and the supernatants are available for ELISA. Individual S. cerevisiae colonies are transferred to test tubes containing selective minimal medium (0.7% yeast nitrogen base without amino acids, containing 2% glucose and supplemented with essential amino acids and bases) and grown at 30 °C for 48 hours. Subsequently, the cultures are diluted 10-fold in YPGal medium (containing 1% yeast extract, 2% bacto peptone, and 5% galactose). After 24 and 48 hours of growth, the cells are pelleted, and the culture supernatants are analyzable by ELISA. The absorbance at 600 nm (OD600) is optionally measured.

[0241] Furthermore, immunoglobulin heavy chain variable domains such as VH / VHH can be produced by S. cerevisiae or P. pastoris using the following procedure.

[0242] Isolate a naturally occurring DNA sequence encoding VH / VHH, or produce by synthesis a DNA sequence encoding VH / VHH that includes a 5'-UTR, signal sequence, stop codon, and that is flanked by SacI and HindIII sites (such synthetic sequences can be produced as outlined above or may be ordered from commercial suppliers such as Geneart (Life Technologies)).

[0243] Next, use restriction sites to transfer the VH / VHH gene into the multi-copy integration (MCI) vector pUR8569 or pUR8542. Use 25 ul of VHH DNA (Geneart plasmid or MCI vector), 1 ul of SacI, 1 ul of HindIII, and 3 ul of buffer suitable for double digestion such as NEB buffer 1 (New England Biolabs) to cut the DNA sequence encoding VHH, optionally included within a shuttle vector, cassette, or other synthetic gene construct, and the MCI vector with SacI and HindIII at 37 °C overnight. Perform 25 ul of digested DNA encoding VHH and 25 ul of digested MCI vector on a 1.5% agarose gel with 1xTAE buffer, and then perform gel extraction using, for example, the QIAquick Gel Extraction Kit (Qiagen). Next, set up the ligation of the digested MCI vector and digested DNA encoding VH / VHH as follows: 100 ng of vector, 30 ng of VHH gene, 1.5 ul of 10x ligase buffer, 1 ul of T4 DNA ligase, and ddH2O. Then perform the ligation at 16 °C overnight.

[0244] Next, transform the E. coli cells. For chemically competent XL-1 Blue cells, thaw 200 μl of heat-competent XL-1 Blue cells, add 5 μl of the ligation mixture dropwise onto ice over approximately 30 minutes, and then add a heat shock at 42 °C for 90 seconds. Then, add 800 μl of Luria-Bertani low-salt medium supplemented with 2% glucose and allow the cells to recover at 37 °C for 2 hours. Spread the cells onto Luria-Bertani agar and ampicillin (100 μg / ml) and maintain the temperature at 37 °C overnight. For electrocompetent TG1 E. coli cells, use an electroporation cuvette. In the electroporation cuvette, thaw 50 μl of electrocompetent TG1 cells and 1 μl of the ligation mixture on ice over approximately 15 minutes. Place the cuvette in the holder and give a pulse. Add 500 μl of 2TY medium and allow the cells to recover at 37 °C for 30 minutes. Spread 100 μl of the cells onto Luria-Bertani, agar, ampicillin (100 μg / ml), and 2% glucose. Maintain the temperature of the plate at 37 °C overnight.

[0245] After cloning the VH / VHH gene into E. coli as detailed above, S. cerevisiae or P. pastoris can be transformed with the linearized MCI vector. Before performing the transformation, several steps are carried out. (i) The DNA needs to be changed from circular to linear by digestion and cannot integrate into the yeast genome, and (ii) the digested DNA needs to have impurities removed by ethanol precipitation. Also, during the transformation process, the yeast cells are made semi-permeable so that the DNA can pass through the membrane.

[0246] Preparation for yeast transformation: As follows, perform an HpaI digestion of a midi-prep prepared from a selected E. coli colony expressing the VH / VHH gene. Prepare a 100 μl solution containing 20 ng of the midi-prep, 5 μl of HpaI, 10 μl of an appropriate buffer such as NEB4 buffer (BioLabs), and ddH2O.

[0247] Digest the DNA with HpaI overnight at room temperature. Next, perform ethanol precipitation (and add 5 μl of the sample from the HpaI digestion to one side). Add 300 μl of 100% ethanol to 95 μl of the HpaI digested midiprep, vortex, and spin at full speed for 5 minutes. Carefully decant if a pellet is present, add 100 μl of 70% ethanol, and then spin at full speed for 5 minutes. Decant the sample again and keep at 50 - 60 °C until the pellet is dry. Resuspend the pellet in 50 μl of ddH2O. Run 5 μl on a gel next to the 5 μl of the HpaI digested sample.

[0248] Transformation of Yeast: Prepare YNBglu plates. Use 10 g of agar + 425 ml of water (sterilized), 25 ml of filtered 20×YNB (3.35 g of YNB (Yeast Nitrogen Base Minimal Medium) in 25 ml of sterilized H2O), and 50 ml of sterilized 20% glucose, and pour into Petri dishes. Pick one yeast colony from the master plate and grow it overnight at 30 °C in 3 ml of YPD (Yeast Extract Peptone Dextrose). The next day, prepare approximately 600 ml of YPD and use it to fill three flasks with 275 ml, 225 ml, and 100 ml of YPD. Add 27.5 μl of the yeast YPD culture to the first flask and mix gently. Take 75 ml from the first flask and put it into the second flask and mix gently. Take 100 ml from the second flask and put it into the third flask and mix gently. Grow until an OD660 of 1 - 2 is reached. Divide the flask that reaches this OD into four Falcon tubes, each with ±45 ml. Spin at 4200 rpm for 2 minutes. Discard the supernatant. Dissolve the pellet in two Falcon tubes in 45 ml of H2O (the number of tubes decreases from 4 to 2). Spin at 4200 rpm for 2 minutes. Dissolve the pellet in 45 ml of H2O (the number of tubes decreases from 2 to 1). Spin at 4200 rpm for 2 minutes. Gently dissolve the pellet in 5 ml of lithium acetate (LiAc) (100 mM) and spin for a few seconds. Carefully discard some of the LiAc and keep more than half of the LiAc in the tube. Vortex the cells, boil the carrier DNA for 5 minutes, and quench in ice water. Add to a 15 ml tube containing 240 μl of PEG, 50 μl of cells, 36 μl of LiAc (1 M), 25 μl of carrier DNA, 45 μl of ethanol-precipitated VH / VHH. Mix gently after each step (process the same blank sample but do not use only ethanol-precipitated VH / VHH). Incubate at 30 °C for 30 minutes, gently invert the tube 3 - 4 times, then give a heat shock at 42 °C for 20 - 25 minutes. Spin briefly at a maximum of 6000 rpm. Gently remove the supernatant, add 250 μl of ddH2O, and mix. Streak all on YNBglu plates until the plates are dry and grow at 30 °C for 4 - 5 days.Finally, prepare YNBglu plates by dividing the plates into six equal parts, label them with numbers 1 to 6, inoculate the largest colonies, and streak out number 1. Repeat for the other colonies from the largest to the smallest among 1 to 6. Grow the larger ones for 3 to 4 days at 30 °C until colonies are produced. Grow VH / VHH clones using glucose as the carbon source, and induction of VH / VHH expression is performed by opening the galactose-7-promoter by adding 0.5% galactose. Perform a 3 mL small-scale culture, test the colonies, and select which ones show the best expression of VH or VHH. Then, this colony is used for purification.

[0249] Purification: VH / VHH is purified by cation exchange chromatography on a strong anion resin (such as Capto S). On the first day, select yeast colonies expressing VH / VHH are inoculated into 5 ml of YPD medium (YP medium + 2% glucose), and the cells are grown overnight at 30 °C (shaken at 180 rpm) in a 25 mL sterile sealed tube. On the second day, 5 ml of the culture is diluted overnight into 50 mL of freshly prepared YP medium + 2% glucose + 0.5% galactose, and the cells are grown for two nights at 30 °C (shaken at 180 rpm) in an aerated 250 ml baffled flask. On the fourth day, the cells are sedimented in a centrifuge at 4200 rpm for 20 minutes. Cation exchange purification process using a strong anion resin: Adjust the pH of the supernatant containing the ligand to 3.5. For 50 mL of the supernatant, add 0.75 ml of the resin (+ / - 0.5 mL of slurry), wash it with 50 mL of ddH2O, and then wash it three times with the binding buffer. Add the washed resin to the supernatant, and incubate the suspension in a shaker at 4 °C for 1.5 hours. Pellet the VH / VHH bound to the resin by centrifugation at 500 g for 2 minutes, and wash this with the wash buffer. Decant the supernatant, and resuspend the resin in 10 mL of the binding buffer. Place a filter into a PD-10 column, pour the resin into the column, let it stand for a while, and then add a filter on top of the resin. Wait until all of the binding buffer has flowed through. Elute VH / VHH with 6 × 0.5 ml of the elution buffer. Collect the elution fractions in Eppendorf tubes. Measure the protein concentration of the six elution fractions with a Nanodrop. Pool the fraction that contains VHH and transfer the solution to a dialysis membrane with a 3,500 Da cut-off. Dialyze the purified protein solution against 3 L of PBS overnight at 4 °C. On the fifth day, dialyze the purified protein solution against 2 L of fresh PBS for an additional 3 hours at 4 °C. Finally, calculate the final concentration by BCA.

[0250] Although discussed in the context of VH / VHH, the techniques described above are also applicable to scFv, Fab, Fv, and other antibody fragments when necessary.

[0251] Multiple antigen-binding fragments (suitably VH / VHH) can be fused by chemical cross-linking by reacting amino acid residues with an organic derivatizing agent such as those described in Blattler et al., 1985 (incorporated herein by reference in its entirety). Alternatively, the antigen-binding fragments can be genetically fused at the DNA level, i.e., a polynucleotide construct encoding a complete polypeptide construct containing one or more antigen-binding fragments is formed. One way to join multiple antigen-binding fragments via the genetic route is by joining the antigen-binding fragment coding sequences directly or via a peptide linker. For example, the carboxy terminus of the first antigen-binding fragment may be joined to the amino terminus of the next antigen-binding fragment. This form of linkage may be extended to join antigen-binding fragments for the construction of functional constructs such as tri-, tetra-, etc. Methods for producing multivalent (e.g., bivalent) VHH polypeptide constructs are disclosed in WO96 / 34103 (incorporated herein by reference in its entirety).

[0252] Suitably, the polypeptide can be produced in a fungus such as a yeast (e.g., S. cerevisiae or P. pastoris) including fungal growth on a medium containing a carbon source, according to the method disclosed in WO02 / 48382, wherein 50 to 100 wt% of the carbon source is ethanol. Large-scale production of VHH fragments in S. cerevisiae is described in Thomassen et al., 2002 (incorporated herein by reference in its entirety).

[0253] In one aspect of the invention, a method for making a composition of the invention is provided, the method comprising expressing a polynucleotide encoding TNF-α using a suitable host, expressing a polynucleotide encoding IL-7R using a suitable host, and comparing the two polynucleotides. In a further aspect of the invention, a method for making a construct of the invention is provided, the method comprising expressing a polynucleotide encoding the construct of the invention using a suitable host.

[0254] Further embodiments of the present invention are described in the following sections.

[0255] Section 1. A composition comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide. 2. (a) The TNF-α binding polypeptide comprises three complementarity-determining regions (CDR1 - CDR3), CDR1 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 1, CDR2 comprises a sequence sharing 50% or more sequence identity with SEQ ID NO: 2, CDR3 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 3, and (b) The TNF-α binding polypeptide comprises three complementarity-determining regions (CDR1 - CDR3), CDR1 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 9, CDR2 comprises a sequence sharing 50% or more sequence identity with SEQ ID NO: 10, CDR3 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 11, the composition according to section 1. 3. The polypeptide comprising an antibody fragment is an immunoglobulin chain variable domain, the composition according to section 1 or 2. 4. The TNF-α binding polypeptide binds to TNF-α with a Kd of 10 -7 M or less, and the IL-7R binding polypeptide binds to IL-7R with a Kd of 10 -7 M or less, the composition according to any one of sections 1 to 3. 5. The TNF-α binding polypeptide neutralizes human TNF-α cytotoxicity in the L929 assay with an EC50 of 100 nM or less, and the IL-7R binding polypeptide neutralizes IL-7R-dependent, IL-7-induced STAT5 phosphorylation in human lymphocytes with an EC50 of 100 nM or less, the composition according to any one of sections 1 to 4. 6. The TNF-α binding polypeptide and the IL-7R binding polypeptide are conjugated, the composition according to any one of sections 1 to 5. 7. The composition according to paragraph 6, wherein the TNF-α binding polypeptide and the IL-7R binding polypeptide are linked by a protease-labile peptide linker. 8. The composition according to paragraph 7, wherein the protease-labile peptide linker contains K and / or R residues. 9. The composition according to any one of paragraphs 1 to 8, wherein the polypeptide is substantially resistant to one or more proteases present in the small intestine or large intestine. 10. A pharmaceutical composition comprising the composition according to any one of paragraphs 1 to 9 and a pharmaceutically acceptable excipient. 11. The composition according to any one of paragraphs 1 to 10, comprising an enteric coating. 12. The composition according to any one of paragraphs 1 to 11, which is suitable for oral administration. 13. The composition according to any one of paragraphs 1 to 12, which is for use in the treatment or prevention of autoimmune diseases and / or inflammatory diseases. 14. A TNF-α binding polypeptide for use in the treatment or prevention of autoimmune diseases and / or inflammatory diseases, together with an IL-7R binding polypeptide. 15. An IL-7R binding polypeptide for use in the treatment or prevention of autoimmune diseases and / or inflammatory diseases, together with a TNF-α binding polypeptide.

[0256] The present invention is further described by the following non-limiting examples.

Examples

[0257] Examples 1 to 3 provide information on the properties of specific IL-7R binding polypeptides. Examples 4 and 5 provide information on experiments targeting the combined use of an IL-7R binding polypeptide and a TNF-α binding polypeptide. Example 6 details the production of constructs containing an IL-7R binding polypeptide and a TNF-α binding polypeptide.

Examples

[0258] Potency of IL-7R-binding polypeptides ID-A40U, V7R-2E9, and ID-A62U compared to prior art IL-7R-binding polypeptides The inhibitory potency and efficacy (maximal inhibition) of both IL-7R-binding polypeptides ID-A40U (SEQ ID NO: 24) and V7R-2E9 (SEQ ID NO: 25), both produced in E. coli, were analyzed in vitro in an L-7 / IL-7R neutralizing ELISA and compared to mAb829, a clinical anti-IL-7R antibody (also known as "GSK2618960", an anti-IL-7Rα monoclonal antibody disclosed in Ellis et al 2019).

[0259] Starting from 300 nM and using a dilution factor of 3.2, a 7-point dilution series of ICVD was prepared in 1% BSA (2x assay concentration). The mAb829 control antibody was used as a positive control in the ELISA in the concentration range of 10 nM to 0.088 nM (2x assay concentration). Sufficient volume was prepared for each ICVD dilution in triplicate, while sufficient volume was prepared for mAb829 in two triplicates (two plates). 85 μL (or 170 μL) of each ICVD (or mAb829) dilution was mixed with 85 μL (or 170 μL) of 10 ng / mL IL-7 (2x assay concentration). 85 μL of IL-7 was mixed with 85 μL of block buffer to include the IL-7 (1x) full binding signal in each plate. The block buffer was also added to each plate as a blank. Subsequently, biotinylated anti-hIL-7 followed by Extravidin-HRP was used to measure the bound IL-7. The TMB reaction was stopped after 30 minutes.

[0260] A corrected for ELISA signal blank 450 Using the data and "Log (inhibitor) vs. Response - Variable slope (4 parameters)", EC 50 values were generated in Graphpad Prism and fitted to the curve to generate EC 50 values.

[0261] In addition, the ability of ID-A40U and V7R-2E9 to inhibit IL-7 binding to IL-7Rα and prevent STAT5 phosphorylation was tested in vitro using human lymphocytes. Human peripheral blood mononuclear cells (PBMCs) respond to exogenous IL-7 by stimulation of intracellular STAT5 phosphorylation via IL-7R signaling, and this response can be abrogated by an IL-7Rα-specific ICVD that interferes with IL-7 / IL-7R binding.

[0262] A lymphocyte-rich population was isolated from human buffy coats and stored in 90% FBS 10% DMSO in liquid nitrogen. For recovery, cells were thawed in complete RPMI-1640 and allowed to rest. After recovery, 100 μl of 2.5 x 10 in round-bottom 96-well plates 5Cells were seeded into the wells and starved for 1 hour in complete RPMI without FBS. After starvation, the desired ICVD concentration was added to each well (50 μL / well), and the plate was incubated at room temperature for 15 minutes. Then, 50 μL / well of IL-7 was added to each well, and the plate was incubated at 37 °C with 5% CO2 for 15 minutes. The plate was quenched on ice to stop the reaction, followed by centrifugation to remove the supernatant. Subsequently, the cells were processed for fixation, permeabilization, and intracellular staining of pSTAT5. The cells were incubated with 100 μL / well of Cytofix / Cytoperm solution (BD Bioscience #554722) for 20 minutes on ice, washed twice with 150 μl / well of 1x Perm / Wash buffer (BD Bioscience #554723), incubated with 200 μL / well of Perm buffer III (BD Bioscience #558050) for 30 minutes on ice, and washed twice with 150 μL / well of 1x PBS 2% BSA (FACS buffer). Subsequently, the cells were stained with 25 μL / well of pSTAT5 antibody ([47 / Stat5(pY694)](A488) (BD Bioscience #612598)) or isotype control mouse IgG1 ([B11 / 6](FITC) (Abcam #ab91356)) for 1 hour at room temperature. The reaction was stopped by adding 150 μL / well of FACS buffer. After one wash / centrifugation step, the cells were finally resuspended in 200 μL / well of FACS buffer, and the data were acquired in a CytoFlex flow cytometer (Beckman Coulter). Data analysis was performed using FlowJo software.

[0263] The results of these experiments are shown in Table 1a along with the control drug.

[0264]

Table 7

[0265] In a separate experiment, this same IL-7 / IL-7R neutralizing ELISA was performed on ID-A62U (SEQ ID NO: 16) (produced in S. cerevisiae) together with a control drug. The results are shown in Table 1b. ID-A62U contains the E1D and R45L mutations relative to ID-A40U.

[0266]

Table 8

[0267] The ability of V7R-2E9 to neutralize the L-TSLP / TSLP-R complex that binds to IL-7Rα was tested. 96-well plates were coated with 0.25 μg / mL of recombinant human IL-7Rα-His6-Fc + 5 μg / mL of BSA and then blocked. V7R-2E9 was serially diluted and mixed 1:1:1 with recombinant human L-TSLP (final concentration 15 ng / mL) and human TSLP-R (final concentration 20 ng / mL). The mixture was then incubated for 30 minutes to allow binding and then added to the plates coated with IL-7Rα. After a 2-hour incubation, the bound L-TSLP was detected with 50 μL / well of 0.3 μg / mL biotinylated rabbit anti-hTSLP antibody and then 50 μL / well of 1 / 2000 Extravidin-HRP, and the neutralization level of the L-TSLP / TSLP-R complex that binds to IL-7Rα was determined using GraphPad Prism. The results are shown in Table 1c below.

[0268]

Table 9

[0269] In summary, it was found that ID-A62U and ID-A40U have potencies higher than that of the clinical anti-IL-7R antibody mAb829, which is a control drug. It should be noted that both ID-A40U and ID-A62U belong to the same ICVD family, do not have the same sequence (ID-A62U contains mutations E1D and R45L relative to ID-A40U), and maintain high potency even when produced using different organisms.

Example

[0270] Biocore Estimation of ICVD-IL-7R Binding Affinity The binding kinetics of ID-A40U was compared with that of the mAb829 clinical antibody in a Biacore assay. IL-7Rα-His6-Fc was either directly coated onto a Biacore sensor chip (for mAb829 analysis) or captured with anti-human IgG Fc (for ICVD analysis), and ICVD / Ab was flowed over the chip to detect binding. The affinity (KD) of ID-A40U was 7.8x10 -11 M, and the affinity (KD) of mAb829 was slightly lower at 5.67x10 -10 M. From this result, it is recognized that ID-A40U exhibits strong binding to the antigen. ID-A62U contains mutations E1D and R45L relative to ID-A40U.

Example

[0271] Resistance to Gastrointestinal Extracts Ex vivo incubation in intestinal supernatants can predict the stability of ICVD in the intestinal tracts of cynomolgus monkeys and humans. The activities of the major small intestinal proteases, trypsin, and chymotrypsin, are conserved across mammalian species, while the proteases present in the large intestine are likely produced by host-specific intestinal microflora. To generate test matrices reflecting these two environments, pooled mouse small intestinal supernatants and pooled fecal supernatants were prepared. Both of these matrices are highly digestive towards unselected and unmanipulated ICVD.

[0272] Previously, the stability of anti-TNF-α ICVD ID-38F was found to be high in these matrices (see WO2016 / 156465), and it has been recognized that this property predicts high stability during intestinal passage of ID-38F.

[0273] V7R-2E9 and ID-A40U were tested for survival in gastrointestinal extracts from mouse and human sources. The ICVDs were incubated with mouse small intestine supernatant at 37 °C for 6 hours and then with human fecal supernatant for 16 hours. Survival was measured by the IL-7 / IL-7R neutralizing ELISA described above in Example 1. Both constructs demonstrated good survival in the tested digestive matrices (Figure 1. "SI" = mouse intestinal fluid, "HF" = human fecal supernatant).

[0274] In a separate experiment, ID-A62U was tested for survival in the same human fecal supernatant assay along with ID-A41U (an unstable control ICVD). ID-A62U showed approximately 100% survival compared to approximately 40% survival with ID-A41U (Figure 2. "A62U" labeled for ID-A62U and "A41U" labeled for ID-A41U).

[0275] These were rigorous tests involving extended incubation times. Therefore, any of these ICVDs are expected to survive very well in the gastrointestinal environment.

Example

[0276] Investigation of the inhibitory effects of separately and combinatorially administered TNF-α binding polypeptide and IL-7R binding polypeptide on the phosphorylation of signaling proteins in cultured IBD tissue Tests were conducted to examine the inhibitory effects of TNF-α-binding polypeptide and IL-7R-binding polypeptide on the levels of lin proteins biomarkers and the spontaneous production of inflammatory cytokines in ex vivo cultures of inflamed colonic mucosal tissues obtained from UC patients. The polypeptides tested were both ICVDs. The ICVDs were ID-A62U (the IL-7R-binding ICVD discussed in Examples 1-3 above) and ID-38F (the TNF-α-binding ICVD disclosed in WO2016 / 156465). The effects of the individual ICVDs were compared with a mixture of the two ICVDs and a negative control ICVD ("ID-2A", an irrelevant ICVD that does not bind to either target) to evaluate the combined effects of various anti-cytokine mechanisms.

[0277] Biopsies from each of four different UC patients were incubated for 24 hours with various ICVDs (control ID-2A 50 nM, ID-38F 50 nM, ID-A62U 50 nM, or ID-38F + ID-A62U (50 nM each)), and after treatment, the tissue lysates were analyzed by a lin protein antibody array. The resulting histograms (Figures 3-4) provide a visual representation of the combination of phospho-intensity data obtained for each biopsy (4 per treatment). The inhibitory effects of the various ICVD treatments were demonstrated by the shift from predominantly high phospho-intensity values in biopsies treated with the control ICVD ID-2A to relatively low phospho-intensity values in biopsies treated with anti-TNF-α or anti-IL-7R ICVDs or combinations thereof. These average results showed a consistent overall inhibitory effect of ID-A62U and ID-38F on tissue phosphorylation levels, with the effect being even higher when the two ICVDs were combined. It is not known whether either of the lin proteins may be more important in this analysis, and the overall effect of the treatment on protein phosphorylation in each biopsy was evaluated.

[0278] The results shown in Figure 5 indicate the total phospho-intensity measured for four biopsies from each patient. For each biopsy, the total phosphorylation level was calculated by summing the intensity values measured for all 45 proteins on the array. For each patient, the total phosphorylation levels measured for each treatment are shown. Marked inhibition was observed in 3 cases (UC2748, UC2749, and UC2750) (about 50% in combination), and marked inhibition was also observed in the fourth UC2747, but generally the reactivity was low.

[0279] The inhibitory effect in the treatment combining ID-38F and ID-A62U exceeded the effect achieved with one ICVD, and as a result, almost maximal inhibition was achieved for most phosphoproteins. Due to the unexpectedly high inhibition levels observed in this experiment, definitive evidence regarding the synergistic effect of the co-administered drugs in UC tissue requires further investigation. However, the evidence regarding the marked inhibition of inflammatory biomarkers in UC tissue by the IL-7R and TNF-α binding polypeptides is promising and suggests that a synergistic effect may occur when lower concentrations of the polypeptides are combined.

[0280] Overall, these results demonstrate at least an additive and possibly a synergistic effect in the co-administered anti-TNF-α and anti-IL-7R polypeptides.

Example

[0281] Investigation of the inhibitory effects of separately and co-administered TNF-α binding polypeptide and IL-7R binding polypeptide on cytokine production in ex vivo cultures of IBD tissue The effects of various treatments on the average spontaneous cytokine production during biopsy discussed in Example 4 above are shown in FIGS. 6-8. Treatment with ID-38F or ID-A62U alone inhibited the production of IL-8, TNFα, and IL-17F, but had little effect on other cytokines. However, when ID-38F and ID-A62U were combined, the inhibitory effects on IL-1β, IL-6, IL-8, IL-17A, and IL-33 were significantly higher than those observed with individual ICVDs. The combined inhibitory effect on TNFα and IL-17F production was below the effect of the individual ICVDs described above.

[0282] In conclusion, the results obtained from three patients in this study showed that treatment with either ID-38F or ID-A62U alone inhibited the production of some pro-inflammatory cytokines (IL-8, TNFα, IL-17F). The inhibitory effects on other cytokines were small / partial, which probably reflected the concentrations below the maximum of the ICVDs selected in this study. Importantly, when the two ICVDs were combined, the inhibitory effect on the production of most cytokines, including IL-1β, IL-6, IL-8, IL-17A, and IL-33, increased.

[0283] Overall, these results demonstrate at least an additive and possibly a synergistic effect in the co-administered anti-TNF-α and anti-IL-7R polypeptides.

Example

[0284] Production, cleavage, and testing of a heterobihead comprising a TNF-α binding polypeptide and an IL-7R binding polypeptide linked by a labile linker A bihead construct called "FU3K" combining ID-38F and ID-A62U was produced and separated by a flexible (G4S)2 linker having a central lysine (K) residue (SEQ ID NO: 21) to create a trypsin cleavage site.

[0285] FU3K was cloned onto the SacI / HindIII fragment into the vector pUR9013, facilitating stable multi-copy integration into the chromosome of the S. cerevisiae expression strain. This was achieved following standard cloning procedures. Using this integration and expression system, FU3K was placed under the control of a galactose-inducible promoter and bispecific secretion was achieved via the yeast mating factor α signal sequence. Expression of FU3K from the yeast chromosome was evaluated in 50 mL of induced culture. Full-length FU3K was sufficiently expressed in small-scale yeast cultures.

[0286] As a result of incubation of FU3K at 37 °C with trypsin, the ID-38F and ID-A62U monomer arms were rapidly separated. Analysis was performed by SDS-PAGE (Figure 9. The lanes are time (minutes), St = standard (without addition of trypsin), L = molecular weight marker, equal volumes loaded per lane). Bands corresponding to uncut FU3K bispecific (≈27 kDa) and cleaved monomers (≈13.5 kDa) are clearly visible. This confirms that FU3K is sufficiently formatted against rapid release of both monomer arms upon exposure to trypsin in the human small intestine or microbial trypsin-like proteases in the colon.

[0287] IL-7 / IL-7R ELISA was performed using the method described in Example 1 above. The potency of FU3K against IL-7R before digestion was comparable to that of ID-A62U and after digestion, and FU3K retained high (sub-nanomolar) potency against IL-7R (Figure 10. ID-A62U is labeled "A62U").

[0288] A biotinylated Humira competitive ELISA was performed to measure the competition for overlapping epitopes of ID-38F and Humira on TNFα. ELISA plates were coated with 100 ng / mL human TNFα in 250 μg / mL bovine serum albumin (BSA) in phosphate buffered saline (1xPBS) and blocked with 1% BSA in 1xPBS. Biotinylated adalimumab was mixed 1:1 with all standards and samples to obtain a final concentration of 2 nM biotinylated adalimumab, and then the mixture was added to the plates. Bound biotinylated adalimumab was detected using ExtrAvidin-horseradish peroxidase, visualized using TMB Micowell Substrate, stopped with 0.5 M H2SO4, and read at 450 nm.

[0289] It was confirmed that the potencies of FU3K before and after digestion were comparable to those of ID-38F in this competitive ELISA (Figure 11).

[0290] Both monomeric arms of FU3K were found to retain the favorable stability characteristics of the parent monomers ID-38F and ID-A62U after a 4-hour incubation with human fecal supernatant as performed as described in Example 2 above.

[0291] These data demonstrate that FU3K is an appropriate format for delivering each of these monomers at high concentrations as a dual therapy targeting the human colon.

[0292] Others All references, including patents and patent applications, mentioned in this application are incorporated by reference to the fullest extent possible.

[0293] Throughout this specification and the following claims, unless the context requires otherwise, the term "comprise" and variations such as "comprises" or "comprising" are to be interpreted as including the stated integer, step, group of integers, or group of steps but not as excluding any other integer, step, group of integers, or group of steps.

[0294] The application of which this specification and the claims form part may be used as a basis for priority in respect of any later application. The claims of such later application may be directed to the features described herein or combinations thereof. These may take the form of claims for products, compositions, processes, or uses, and may include, by way of example only and without limitation, the following claims.

[0295] References Arbabi-Ghahroudi et al FEBS Lett 1997 414:521-526 Blattler et al Biochemistry 1985 24:1517-1524 Binz et al.Journal of Molecular Biology 2003 332(2):489-503 Coppieters et al 2006 Arthritis & Rheumatism 54(6):1856-1866 Chomezynnski et al Anal Biochem 1987 162:156-159 Desmet et al 2014 Nature Communications 5:5237 Ebersbach et al.J.Mol.Biol.372(1):172-185 Ellis et al Br J Clin Pharmacol.2019 85(2):304-315 Faisst et al J Virol 1995 69:4538-4543 Fornasa et al J Allergy Clin Immunol.2015 136(2):413-422 Frenken et al J Biotech 2000 78:11-21 Goldberg et al 2016 Protein Eng Des Sel.29(12):563-572 Green and Sambrook Molecular Cloning:A Laboratory Manual 2012 4 th Edition Cold Spring Harbour Laboratory Press Grabulovski 2007 J Biol Chem.282(5):3196-3204 Griffiths et al Antibodies 2013 2:66-81 Grundstrom et al 1985 Nucl.Acids Res 13:3305-3316 Hamers-Casterman et al Nature 1993 363(6428):446-448 Harmsen et al Gene 1993 125:115-123 Harmsen et al Appl Microbiol Biotechnol 2007 77(1):13-22) Hendrickson et al Clin Microbiol Rev 2002 15(1):79-94 Hoogenboom et al Nucl Acid Res 1991 19:4133-4137 Humphreys and Wilson 1999 Cytokine 11(10):773-782 Huse et al Science 1989 246(4935):1275-1281 Johnson et al 2012 Anal.Chem.84(15):6553-6560 Kabat et al Sequences of Proteins of Immunological Interest, Fifth Edition U.S.Department of Health and Human Services, 1991 NIH Publication Number 91-3242 Knezevic et al J.Am.Chem.Soc.2012, 134(37):15225-15228 Koehler et al Nature 1975 256:495-497 Koide and Koide 2007 Methods Mol.Biol.352:95-109 Krehenbrink et al 2008 J.Mol.Biol.383(5):1058-1068. Ling et al Anal Biochem 1997 254(2):157-178 Lipovsek 2011 Protein Eng Des Sel.24(1-2):3-9 McCoy et al Retrovirology 2014 11:83 Merchlinsky et al J.Virol.1983 47:227-232 Miethe et al J Biotech 2013 163(2):105-111 Muyldermans et al Protein Eng 1994 7(9):1129-1135 Muyldermans Annu Rev Biochem 2013 82:775-797 Nambiar et al Science 1984 223:1299-1301 Nelson et al Molecular Pathology 2000 53(3):111-117 Nguyen et al Adv Immunol 2001 79:261-296 Nixon and Wood 2006 Curr Opin Drug Discov Devel.9(2):261-268 Nygren FEBS J.2008 275(11):2668-76 Ortonne, Brit J Dermatol 1999 140(suppl 54):1-7 Padlan Mol Immunol 1994 31:169-217 Rose-John Int J Biol Sci.2012;8(9):1237-47 Roux et al Proc Natl Acad Sci USA 1998 95:11804-11809 Sakamar et al Nucl.Acids Res 1988 14:6361-6372 Silverman et al 2005 Nat.Biotechnol.23(12):1556-1561 Skerra et al Science 1988 240(4855):1038-1041 Skerra et al 2008 FEBS J.275(11):2677-83 Suderman 2017 Protein Expression and Purification 134:114-124 Tanha et al J Immunol Methods 2002 263:97-109 Thomassen et al Enzyme and Micro Tech 2002 30:273-278 Tsilingiri et al Cell Mol Gastroenterol Hepatol.2017 3(2):174-182 Verma et al Annu Rev Biochem 1998 67:99-134 Verstraete et al Nat Commun.2017 8:14937.doi:10.1038 / ncomms14937 Ward et al Nature 1989 341:544-546

Claims

**Claim 1** A composition comprising a polypeptide comprising a TNF-α binding VHH and an IL-7R binding VHH, wherein the IL-7R binding VHH comprises three complementarity determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), CDR1 comprises SEQ ID NO: 9, CDR2 comprises SEQ ID NO: 10, and CDR3 comprises SEQ ID NO:

11. **Claim 2** The composition according to claim 1, wherein the TNF-α binding VHH comprises three complementarity determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), CDR1 comprises SEQ ID NO: 1, CDR2 comprises SEQ ID NO: 2, and CDR3 comprises SEQ ID NO:

3. **Claim 3** (a) The TNF-α binding VHH comprises three complementarity determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), CDR1 consists of SEQ ID NO: 1, CDR2 consists of SEQ ID NO: 2, and CDR3 consists of SEQ ID NO: 3, and (b) The IL-7R binding VHH comprises three complementarity determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), CDR1 consists of SEQ ID NO: 9, CDR2 consists of SEQ ID NO: 10, and CDR3 consists of SEQ ID NO: 11, the composition according to claim 1 or 2. **Claim 4** The TNF-α-binding VHH binds to TNF-α with a Kd of 10 -7 M or less, and the IL-7R-binding VHH binds to IL-7R with a Kd of 10 -7 M or less. The composition according to any one of claims 1 to 3 **Claim 5** The TNF-α binding VHH neutralizes human TNF-α cytotoxicity in the L929 assay with an EC50 of 100 nM or less, and the IL-7R binding VHH neutralizes IL-7R-dependent, IL-7-induced STAT5 phosphorylation in human lymphocytes with an EC50 of 100 nM or less, the composition according to any one of claims 1 to 4. **Claim 6** (a) The TNF-α binding VHH comprises or consists of a sequence sharing at least 90% identity with SEQ ID NO: 8, (b) The IL-7R binding VHH comprises or consists of a sequence sharing at least 90% identity with SEQ ID NO: 16, the composition according to any one of claims 1 to 5. **Claim 7** (a) The TNF-α binding VHH comprises or consists of SEQ ID NO: 8, (b) The IL-7R binding VHH comprises or consists of SEQ ID NO: 16, the composition according to claim 6. **Claim 8** The composition according to any one of claims 1 to 7, wherein the TNF-α binding VHH and the IL-7R binding VHH are bound.

9. The composition according to claim 8, wherein the TNF-α binding VHH and the IL-7R binding VHH are bound by a protease-labile peptide linker.

10. The composition according to claim 9, wherein the protease-labile peptide linker contains K and / or R residues.

11. wherein the protease-labile linker is of the format -(G 4 S) x -K-(G 4 S) y -, where x and y are each independently from 1 to 5, the composition according to claim 10, comprising or consisting of the sequence (SEQ ID NO: 34).

12. The protease-labile linker is of the format -(G 4 S) 2 -K-(G 4 S) 2 - and comprises or consists of the sequence (SEQ ID NO: 21), the composition according to claim 11.

13. The composition according to any one of claims 1 to 12, wherein the VHH is substantially resistant to one or more proteases present in the small intestine or large intestine.

14. The composition according to claim 13, wherein the protease is trypsin and chymotrypsin.

15. A pharmaceutical composition comprising the composition according to any one of claims 1 to 14 and a pharmaceutically acceptable excipient.

16. The pharmaceutical composition according to claim 15, for use as a medicament.

17. The pharmaceutical composition according to claim 16, for use in the treatment or prevention of autoimmune diseases and / or inflammatory diseases.

18. Use of the composition according to any one of claims 1 to 14 in the manufacture of a medicament for the treatment or prevention of autoimmune diseases and / or inflammatory diseases.

19. The pharmaceutical composition according to claim 17, wherein the autoimmune disease and / or inflammatory disease is inflammatory bowel disease and / or mucositis.

20. The pharmaceutical composition according to claim 17, wherein the autoimmune disease and / or inflammatory disease is atopic dermatitis.

21. The pharmaceutical composition according to any one of claims 16 to 17 or 19 to 20, wherein the pharmaceutical composition is for oral administration.

22. The pharmaceutical composition according to any one of claims 16 to 17 or 19 to 20, wherein the pharmaceutical composition is for topical administration.

23. A first composition comprising a first polypeptide comprising a TNF-α binding VHH, used for the treatment or prevention of autoimmune diseases and / or inflammatory diseases, together with a second composition comprising a second polypeptide comprising an IL-7R binding VHH, wherein the IL-7R binding VHH comprises three complementarity-determining regions (CDR1 to CDR3) and four framework regions (FR1 to FR4), CDR1 comprises SEQ ID NO: 9, CDR2 comprises SEQ ID NO: 10, and CDR3 comprises SEQ ID NO:

11.

24. A first composition comprising a first polypeptide comprising an IL-7R binding VHH, used for the treatment or prevention of autoimmune diseases and / or inflammatory diseases, together with a second composition comprising a second polypeptide comprising a TNF-α binding VHH, wherein the IL-7R binding VHH comprises three complementarity-determining regions (CDR1 to CDR3) and four framework regions (FR1 to FR4), CDR1 comprises SEQ ID NO: 9, CDR2 comprises SEQ ID NO: 10, and CDR3 comprises SEQ ID NO:

11.

25. The composition according to any one of claims 1 to 14, wherein the polypeptide comprises an amino acid sequence having at least 90% identity with SEQ ID NO:

26.

26. The composition according to any one of claims 1 to 6 or 8 to 14, wherein the polypeptide comprises the amino acid sequence set forth in SEQ ID NO:

26.

27. A polynucleotide encoding a polypeptide according to any one of claims 1 to 14, 25 or 26.

28. The polynucleotide according to claim 27, wherein the polynucleotide comprises a nucleic acid sequence according to SEQ ID NO: 27.

Citation Information

Patent Citations

  • polypeptide

    JP2018514226A

  • Peptide Constructs with Protease Cleavable Linkers

    JP2018515596A

  • Polypeptides

    JP2022537780A

  • compositions

    WO2018060453A1