Antisense oligonucleotide sequences for silencing human L1-MET transcripts in tumors

Abstract

The present invention relates to the use of antisense oligonucleotides to induce death of several types of human cancer cells by silencing human L1-MET, a non-coding transcript that is specifically transcribed in tumor cells.

Description

Technical Field

[0001] The present invention relates to an antisense oligonucleotide sequence for silencing human L1-MET transcripts in tumors.

[0002] In particular, the present invention relates to the use of antisense oligonucleotides for inducing the death of several types of human cancer cells by silencing human L1-MET, a non-coding transcript specifically transcribed in tumor cells.

Background Art

[0003] Currently, finding new therapies for cancer treatment, especially new therapies that are selective for cancer cells, has become the focus of research.

[0004] In fact, it is well known that anti-cancer therapies such as chemotherapy can cause the death of both cancer cells and normal cells. The death of normal cells can cause several unpleasant side effects.

[0005] To solve this problem, new treatment strategies targeting specific molecules that are more highly expressed in cancer cells have been developed over the past 20 years. The molecular background of each patient corresponds to the physics of a specific drug and reduces off-targets. However, the molecules targeted by this drug are present not only on the cancer cell membrane but also in some normal cells. Furthermore, the presence of mutations in other genes can lead to a loss of efficacy, that is, in colorectal cancer, if there are mutations in the KRAS gene, the use of drugs that bind to EGFR and block the pathway becomes ineffective. In lung cancer, if there are mutations in EGFR, the response to EGFR inhibitors may improve, but if resistance mutations occur, the drug becomes ineffective.

[0006] Therefore, in view of the above, it is clear that there is a need to provide a new anti-cancer therapy that can overcome the drawbacks of known anti-cancer therapies.

[0007] Long interspersed nuclear element-1 (LINE-1) is a retrotransposon known to occupy approximately 20% of the human genome. When activated by hypomethylation of CpG islands located in the promoter region, LINE-1 maintains the ability to self-transfer to new chromosomal regions [1]. Only a very small fraction of these sequences, which are usually located in non-coding regions, are capable of retrotransposition, but generally remain inactive for most of a lifetime [2]. The LINE-1 promoter, when demethylated, can act as a sense promoter that drives the transcription of two open reading frames (ORF-1 and ORF-2), or as an antisense promoter [3]. The activity of the antisense promoter can drive transcription of the strand opposite to the LINE-1 direction and cause the initiation of transcription including neighboring sequences [4]. In this regard, in recent years, a new primate-specific open reading frame (ORF-0) discovered within the 5’UTR of the LINE-1 sequence has been shown to be the origin of adjacent exon fusion transcripts using two splicing donor sites [5]. The LINE-1 sequence located in intron 2 of the human MET gene (Figure 1), known as L1-MET, belongs to the primate subfamily and is unable to retrotranspose. However, since the promoter region is completely maintained, activation of the antisense promoter by hypomethylation is possible, leading to the generation of alternative transcripts derived from the ORF-0 region and including neighboring MET sequences. The L1-MET transcript was first described in 2002 [6], but its full-length characterization was only achieved in 2018 as described by Miglio et al., 2018 (Figure 1) [7]. In the latter study, transcription starts from ORF-0 and ends at the MET 3’UTR, and six different splicing variants are included, which are derived from combinations of two splicing donor sites and three different acceptor sites, two of which are shown to be located in intron 2 of the MET gene. The length of the L1-MET transcript and the lack of a coding open reading frame suggest a function as a long non-coding RNA.In addition, although L1-MET does not encode a functional protein, it was also shown that the presence of the 3’UTR and polyA region enables the transport of the transcript from the nucleus to the cytoplasm. This property, along with its length, indicates the potential role as a long non-coding RNA. To date, only two studies have attempted to investigate the biological function of L1-MET. In one study, Weber et al. induced the expression of L1-MET by knocking down the DNA methyltransferase protein, promoted transcription by hypomethylation, and then observed a decrease in MET protein levels [8]. In the other study, Wolff et al. reported the presence of a truncated MET isoform after transfecting L1-MET into cell lines [9]. However, Miglio et al., in 2018 [7], showed that there is no basis for the truncated MET protein by both Western blot and informatics prediction tools.

[0008] Activation of the L1-MET antisense promoter has been shown to be a tumor-specific mechanism because experimental studies and in silico analysis have clearly shown that there is no basis for the expression of L1-MET in normal tissues [7].

Summary of the Invention

[0009] According to the present invention, it has now been shown that silencing of the L1-MET transcript significantly kills tumor cells but not normal cells, indicating that L1-MET is a promising target for cancer treatment.

[0010] Among the available therapeutic strategies targeting this sequence, antisense oligonucleotides, which are mainly used for diseases other than cancer, are considered to be more appropriate

[10] .

[0011] In particular, according to the present invention, silencing of L1-MET transcripts by antisense oligonucleotides targeting specific regulatory sequences of L1-MET has been shown to induce selective death of different types of cancer cells while leaving non-transformed cells unaffected. These results support the use of these oligonucleotide sequences to induce tumor cell death.

[0012] In particular, according to the present invention, a specific sequence covering 76 bp of MET intron 2 and forming part of the L1-MET transcript has been identified. This sequence can be conveniently targeted to cause premature degradation of the human L1-MET transcript.

[0013] In particular, according to the present invention, 11 antisense oligonucleotides capable of selectively silencing L1-MET transcripts have been identified by in silico analysis. Furthermore, three of them have been tested in in vitro experiments.

[0014] The antisense oligonucleotides of the present invention can be used as pharmacological compounds both alone and in combination.

[0015] Therefore, the antisense oligonucleotides of the present invention can be conveniently used to induce massive selective death of human tumor cells that are positive for the expression of L1-MET transcripts. The high selectivity of the antisense oligonucleotides of the present invention for tumor cells is due to the lack of expression of L1-MET in normal tissues and specific tumor transcriptional activation by hypomethylation.

[0016] Antisense oligonucleotides may be chemically modified for administration to patients without a vector or conjugated to a vector to increase the transfection efficiency of tumor cells. Examples of vectors that can be used for administering ASO are liposomes or nanoparticles that allow for more rapid internalization but may exhibit some limitations such as degradation by the retinal endothelial system.

[0017] In the past, antisense oligonucleotides have shown several limitations mainly due to their short blood half-life and rapid clearance. However, in recent years, the introduction of chemical modifications (i.e., locked nucleic acid - LNA, phosphorothioate backbone, 2'-ribose modification) has led to promising results enabling direct administration of the compounds

[11] . These chemical changes increase the binding to serum proteins, decrease clearance in the liver, and increase the time available for uptake by target cells. In the past few years, several antisense oligonucleotides have been approved by the FDA for the treatment of different diseases (i.e., spinal muscular atrophy, homozygous familial hypercholesterolemia).

[0018] Accordingly, a specific object of the present invention is an antisense oligonucleotide that targets the region of the L1-MET transcript encoded by GCAGAAAATGTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTAGGCTTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO: 1).

[0019] According to the present invention, the antisense oligonucleotide can target the region of the L1-MET transcript encoded by GCAGAAAATGTGCTAGATTGGAGGTGAAGAC (SEQ ID NO: 2) or TTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO: 3).

[0020] Furthermore, according to the present invention, the antisense oligonucleotide can comprise a sequence of 7 to 50 nucleotides, preferably 12 to 30 nucleotides, more preferably 15 to 23 nucleotides. For example, when the antisense oligonucleotide comprises both deoxyribonucleotides and ribonucleotides, the antisense oligonucleotide can comprise 16 nucleotides.

[0021] According to the present invention, the antisense oligonucleotide is complementary to the target region of the L1-MET transcript, and is GUCUUCACCUCCAAUC (SEQ ID NO: 4), GCAGGGCUAGGACUAA (SEQ ID NO: 5), GCCUAGGCUCUCUGGC (SEQ ID NO: 6), CUAGCACAUUUUCUGC (SEQ ID NO: 7), CUCCAAUCUAGCACAU (SEQ ID NO: 8), ACCUCCAAUCUAGCAC (SEQ ID NO: 9), CUAGGCUCUCUGGCUC (SEQ ID NO: 10), CUAAGCCUAAGGCUCUC (SEQ ID NO: 11), GUGCAGGGCUAGGACU (SEQ ID NO: 12), AGUGCAGGGCUAGGAC (SEQ ID NO: 13) or CUUCAGUGCAGGGCUA (SEQ ID NO: 14), preferably SEQ ID NO: 4 or SEQ ID NO: 5, more preferably SEQ ID NO: 5, or comprises or consists of these.

[0022] According to the present invention, one, a plurality or all of the nucleotides of the above-mentioned antisense oligonucleotide may be modified, provided that the antisense oligonucleotide does not contain only deoxyribonucleotides or does not contain only nucleotides having a modified deoxyribose. In particular, the nucleotide can be a ribonucleotide, a deoxyribonucleotide, a modified ribose or a nucleotide having a deoxyribose. Further, the ribonucleotide, deoxyribonucleotide, or nucleotide having a modified ribose and / or deoxyribose can optionally have a modified phosphate group. Accordingly, each of the antisense oligonucleotides can contain ribonucleotides, a combination of ribonucleotides and deoxyribonucleotides, and / or nucleotides having a modified ribose and / or deoxyribose, with the phosphate group optionally being modified.

[0023] In particular, the modified oligonucleotides may include nucleotides having sugar modifications such as 2'-O-MOE, 2'-O-Me, LNA, (S)-cEt, 2'-F RNA, morpholino (PMO), etc., and / or nucleotides having modifications on the phosphate group such as phosphodiester (PO), phosphorothioate (PS), phosphorodithioate, thiophosphoramidate, etc. The modifications on the phosphate group are applicable to any nucleotide, such as DNA, RNA, or nucleotides having modifications on the sugar.

[0024] According to an embodiment of the present invention, the antisense oligonucleotide may include a modified nucleotide having both LNA modification and phosphorothioate (PS) modification.

[0025] According to a specific embodiment, the oligonucleotide according to the present invention may include a flanking modified nucleotide having both LNA and PS modifications at both ends of the molecule and DNA nucleotides in the central part of the molecule. This type of structure advantageously amplifies the RNase-related target degradation of the ASO.

[0026] The LNA modification advantageously increases the binding specificity to the RNA target and confers resistance to nucleases.

[0027] The PS modification advantageously increases the binding to serum proteins (albumin), which is favorable for maintenance in the bloodstream. Also, the PS modification reduces renal clearance and decreases the removal rate by the kidneys when the ASO is in the bloodstream.

[0028] Furthermore, the combination of the above modifications (LNA and PS) provides improved transfection efficiency and enables transfection without a vector (such as lipofectamine, liposome, or nanoparticle).

[0029] A further object of the present invention is a pharmaceutical composition comprising, as an active ingredient, one or more of the antisense nucleotides as defined above, together with one or more excipients and / or adjuvants.

[0030] According to the present invention, the pharmaceutical composition can further contain one or more anticancer agents.

[0031] The present invention also relates to an antisense oligonucleotide as defined above or a pharmaceutical composition as defined above for use in the treatment of L1-MET expressing tumors, such as triple negative breast cancer, lung adenocarcinoma or colorectal cancer.

[0032] A further object of the present invention is a combination of one or more antisense oligonucleotides as defined above and one or more anticancer agents for separate or sequential use in the treatment of L1-MET expressing tumors, such as triple negative breast cancer.

[0033] According to the present invention, "separate use" is understood to mean administering the two compounds of the combination according to the present invention simultaneously in separate pharmaceutical forms.

[0034] "Sequential use" is understood to mean administering the two compounds of the combination according to the present invention successively in separate pharmaceutical forms.

[0035] Specific examples of antisense compounds useful in the present invention include oligonucleotides containing a modified backbone or non-natural internucleoside linkages. Oligonucleotides having a modified backbone include those that maintain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Also, modified oligonucleotides having no phosphorus atom in the internucleoside backbone can also be considered oligonucleosides.

[0036] In other oligonucleotide mimics, both the sugar of the nucleotide unit and the internucleoside linkage, i.e., the backbone, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an oligonucleotide mimic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of the oligonucleotide is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are maintained and are attached directly or indirectly to the azanitrogen atoms of the amide portions of the backbone.

[0037] As a further modification, locked nucleic acid (LNA) is included, where the 2'-hydroxyl group is attached to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. This linkage may be a methylene (-CH2-)n group that bridges the 2'-oxygen atom and the 4'-carbon atom, where n is 1 or 2.

[0038] Other modifications include 2'-methoxy (2'-O-CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH-CH2), 2'-O-allyl (2'-O-CH2-CH-CH2), and 2'-fluoro (2'-F).

[0039] Modified nucleobases can also include purine or pyrimidine bases substituted with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Some modified nucleobases are particularly useful for increasing the binding affinity of the oligonucleotides of the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, such as 2-aminopropyl-adenine, 5-propynyluracil, and 5-propynylcytosine.

[0040] The oligonucleotides of the present invention can be formed as a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics. Such oligonucleotides are also referred to in the art as hybrids or gapmers.

[0041] Here, the present invention will be illustratively described, but not limited thereto, according to its preferred embodiments, with particular reference to the accompanying drawings:

Brief Description of the Drawings

[0042]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Example

[0043] Example 1 : In silico identification and characterization of L1-MET-targeting oligonucleotides according to the present invention, and in vitro silencing of L1-MET.

[0044] Materials and Methods The human biological samples used in this study were from healthy donors who were internal collaborators of the laboratory and had given consent for the collection of blood samples and their use in the experiments.

[0045] No genetically modified organisms (GMOs) were used in the experiments described in this specification. Cancer cell lines The MDA-MB231 and MCF-7 cell lines were obtained from the NCI-60 panel, EBC1 (catalog JCRB0820) was obtained from the Health Science Research Resources Bank (HSRRB), and A549 (catalog CCL-185) and MRC5 (catalog CCL-171) were obtained from the American Type Culture Collection (ATCC). EBC1 and A549 were grown in RPMI supplemented with 10% FBS, MDA-MB231 was grown in high-glucose DMEM supplemented with 10% FBS, MCF7 was grown in high-glucose DMEM supplemented with 10% FBS and 10 μg / mL insulin, while MRC5 was grown in MEM supplemented with 10% FBS. Their genetic identities were confirmed by short tandem repeat profiling (PowerPlex® 16 HS System, Promega, Madison, WI) and were repeated last in June 2019. Cells were regularly tested for mycoplasma contamination using the Venor® GM kit (Minerva Biolabs, Berlin, Germany). Normal lymphocytes from healthy donors were obtained from peripheral blood by centrifugation using lymphocyte separation medium (Cedarlane) and were grown in RPMI supplemented with 10% FBS.

[0046] Selection of antisense oligonucleotides To identify the optimal antisense oligonucleotide (ASO), a specific 76-bp sequence of the L1-MET transcript was selected and examined by in silico analysis according to previously reported selection criteria

[12] . Five different ASO design tools were used to identify the most accessible sequences for the ASO.

[0047] Herein below, the complete DNA sequence of the L1-MET transcript (SEQ ID NO: 15) is shown, where the specific 76-bp fragment target of the antisense oligonucleotide is highlighted (bold and underlined).

[0048]

Chemical formula

[0049] We inquired with five antisense oligonucleotide design tools and identified 11 ASOs that can target specific L1-MET regions, as shown in Table 1 reported below.

[0050]

Table 1

[0051] Transient transfection After culturing all cells in complete medium, they were transiently transfected with ASO using Lipofectamine RNAiMAX (Thermofisher Scientific) according to the manufacturer's protocol. As a control, scrambled LNA gapmers were transfected. On the day of transfection, cells were harvested and counted, and then seeded at 600,000 cells / dish in a 10 cm tissue culture dish with appropriate culture medium in the presence of a transfection mixture composed of Lipofectamine and antisense oligonucleotides at a final concentration of 25 nM. Twenty-four hours after transfection, RNA and protein were extracted from the cells.

[0052] RNA Extraction and qRT-PCR Analysis RNA was extracted from cell lines using the Maxwell RSC miRNA Tissue Kit (Promega) according to the manufacturer's instructions. Quantification of RNA was performed using a DeNovix spectrophotometer. After reverse transcription using a reverse transcription system (Promega), gene expression of L1-MET was examined using quantitative real-time PCR (qRT-PCR) with previously reported primers and PCR conditions [7]. Briefly, the reaction mixture was composed of 1X buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 0.2 μM each primer, 2× EvaGreen dye, 0.04 U / μL Taq Polymerase (Promega), and H2O to a final volume of 25 μL in the presence of a forward primer located in the 76 bp region of L1-MET and a reverse primer located in exon 3 of MET. Relative expression quantification (RQ) was calculated according to the following formula using GAPDH as an endogenous control: RQ = 2-(ΔCt), where ΔCt = (Ct L1-MET - Ct GAPDH).

[0053] RNAseq Analysis RNA-seq analysis for gene expression profiles was performed on A549, EBC1, MDAMB-231, and MCF7 cancer cell lines. Specifically, RNA purified from cells treated with L1-MET_AS1 or scrambled gapmer was analyzed for a total of 24 samples in three independent replicate experiments. All library preparations were performed starting from 1 μg of total RNA with RIN > 8 using the TruSeq stranded mRNA kit (Illumina). Briefly, polyA RNA (e.g., mRNA) was purified using polyT oligo-attached magnetic beads according to the low sample workflow, followed by cDNA synthesis, and then the 3’ end was end-repaired and adenylated to enable ligation of indexed adapters. The pooled libraries were then loaded at a final concentration of 1.1 pM onto an Illumina NextSeq 500 / 550 instrument for single-end 75bp sequencing. Reads that did not pass the filter were discarded according to the standard Illumina NextSeq 500 procedure. Reads that passed the filter were aligned to the GRCh38 primary assembly genome downloaded from GENCODE (version 29)

[15] using STAR (version 2.5.4a, custom parameters --outFilterMultimapNmax 10 --outFilterMultimapScoreRange 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.08)

[16] . For quantification of gene expression, subread featureCounts v1.6.3 was used to assign reads to exons, discarding multimapping reads and ambiguous reads, and summarized by gene name

[17] . The basic annotation of GENCODE (version 29) was used as the reference transcript annotation, complemented with a custom track of L1-MET transcripts described by Miglio et al., 2018 [7].The same complemented transcript annotations were used to construct the star index.

[0054] Protein extraction and Western blot analysis Twenty-four hours after transfection, proteins were extracted from the cell line using the hot lysis protocol. The cells were washed three times with PBS, and then a lysis solution composed of 1 M Tris-HCl pH 6.8, 10% SDS, and H2O was added to reach the final volume. The lysate was collected in 1.5 mL tubes and incubated at 95 °C for 15 minutes. After removing cell debris by sonication and centrifugation at 16,000 g for 5 minutes, proteins were quantified spectrophotometrically using the Pierce BCA Protein Assay Kit (Thermofisher scientific). 50 ng of protein was separated by SDS-polyacrylamide gel electrophoresis (Bolt 4-12% Bis-Tris Plus gel) (Thermofisher scientific) and blotted onto a Trans-Blot Turbo nitrocellulose membrane (Bio-Rad). The membrane was blocked with TBS-T containing 10% BSA or 5% non-fat dry milk for 45 minutes depending on the antibody used. Subsequently, the membrane was incubated overnight at 4 °C with the following antibodies: anti-AKT (2972), anti-p44 / 42 MAPK (9102), anti-phospho-AKT Ser473 (9271), anti-phospho-p44 / 42 MAPK Thr202 / Tyr204 (9101), anti-phospho-EGFR (3777), anti-phospho-MET (3077) (Cell Signaling Technology), anti-MET (DL21) homemade antibody, and anti-EGFR (1005 sc-03) (Santa Cruz). All primary antibodies were diluted 1:1000. An appropriate HRP-conjugated secondary antibody (1:10000 - Jackson ImmunoResearch Laboratories, INC.) was used for chemiluminescent detection using the Clarity Western ECL substrate (Bio-Rad).

[0055] Cell viability and apoptosis assay Cell viability was evaluated using the Cell Titer Glow kit (Promega). Transfection was performed six times at 25 nM for each gapmer in 96-well plates seeded with 3000 cells / well. Luminescence was acquired 24 hours after transfection using a Tecan Spark 10M instrument (TECAN).

[0056] The apoptosis assay was performed by flow cytometry using propidium iodide and Annexin V APC-conjugate (Thermofisher Scientific). Cells were transfected in 10 cm plates as described above. Twenty-four hours after transfection, the cells were detached with trypsin, washed three times with PBS, and incubated with Annexin V APC-conjugate and propidium iodide in binding buffer solution (0.5 M Hepes, 0.15 M NaCl, 0.005 M CaCl2) using the Annexin V apoptosis detection kit APC (Thermofisher Scientific). Acquisition was performed on a CyAn flow cytometer (Beckman Coulter), and Summit v4.3 software (Dako Colorado, INC.) was used for data analysis. The apoptosis index was expressed as the percentage ratio of apoptotic cells and calculated using the formula: (number of early apoptotic cells + number of late apoptotic cells) / total number of detected cells.

[0057] Silencing of L1-MET In-silico characterization of ASOs targeting L1-MET As described above, after identifying a specific 76 bp region of the L1-MET transcript encoded by the sequence GCAGAAAATGTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTAGGCTTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO: 1), a more accessible part thereof was detected. Considering all the trained algorithms, two "ASO hot target" regions were revealed, which were located at the ends of specific regions of L1-MET. After the numbering reported for SEQ ID NO: 15, 37% of the predicted antisense oligonucleotides were detected between nucleotides +236 and +266, which represents the first 31 bases of the specific region and 36% of the predicted ASOs at the end of the same sequence (between nucleotides +289 and +311). Thus, the detected "ASO hot target" regions are GCAGAAAATGTGCTAGATTGGAGGTGAAGAC (SEQ ID NO: 2) and TTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO: 3).

[0058] Out of the predicted ASOs, only three covered nucleotide positions composed between +267 and +288. To complete the evaluation of the ASOs, the sRNA tool of the web software sFOLD was applied to predict the secondary structure of the designed antisense oligos and determine the level of their thermal stability. According to the literature, a high proportion of self-folding ASOs is known to be associated with an increase in target binding due to a decrease in the probability of forming a secondary structure and a decrease in efficiency. Therefore, to determine the effectiveness of the ASOs, the Gibbs free energy (ΔG) was calculated. ΔG represented the energy released by folding a completely unfolded molecule. A low level of ΔG was a characteristic of a molecule that self-folded at a high rate, while on the other hand, the fewer hydrogen bonds formed by the nucleotides of a single ASO, the less likely the ASO was to form a secondary structure. In this context, it could be considered that more stable antisense oligonucleotides (for example, those with a positive ΔG value) were the most efficient. In the literature, a cut-off of ΔG ≦ -1.1 was defined. Furthermore, the heteroduplex formed by the ASO and the target mRNA also depended on the secondary folding of the transcript. Long-sized RNA molecules were always superfolded, and in contrast to small ASOs, regions with secondary structures were reported to be more accessible to hybridization, especially when located at the ends of the sequence. To examine the folding of the entire sequence of L1-MET, the sRNA algorithm on the sFOLD web page was queried. Table 2 reports 11 predicted ASOs targeting L1-MET along with their relevant ΔG values.

[0059]

Table 2

[0060] To evaluate the effect of L1-MET silencing, Exiqon commissioned the design of three different ASOs that cover two hot regions and also the nucleotides in the center of a 76 bp region predicted to have low accessibility. Specifically, L1-MET_AS1 (SEQ ID NO: 4) is complementary to the region between nucleotides +251 and +266, and L1-MET_AS2 (SEQ ID NO: 5) covers the sequence between +289 and +304. The third ASO (L1-MET_AS3 (SEQ ID NO: 6)) overlapped in the more central part of the sequence (between +273 and +288). Figure 3 shows the secondary structure of the ASOs of the present invention. To the side of the two low-folding molecules (L1-MET_AS1 / 2), L1-MET_AS3, which has a distinct hairpin structure, showed only 37.5% unpaired bases. Regarding ΔG, it was confirmed that L1-MET_AS3 had the most negative value (ΔG = -2.7), and the ΔG of L1-MET_AS2 was 0.6. In terms of this property, L1-MET_AS1 was evaluated as a better-designed ASO (ΔG = 2.5). Figure 4 summarizes the results of the examination of the secondary structure of L1-MET. The first panel A shows a pie chart for the secondary structure. Since L1-MET is composed of more than 5000 bp, this graph schematizes the secondary structure. The specific target sequence is included in the lower semicircular part of the table, which is enlarged in Figure 4B. More specifically, panel C reports an enlarged view of the secondary structure of the specific 76 bp sequence. The parts complementary to the three designed ASOs are circled. All target regions showed internal loops (L1-MET_AS1 and AS2) or hairpins (L1-MET_AS3), and the prediction results were confirmed. However, L1-MET_AS1 and AS2 targeted the most favorable regions, which are characterized by a secondary structure with free ends. In conclusion, integrating all the data so far, L1-MET_AS3, although included independently of ΔG, had low potential activity.

[0061] As reported in Table 2, ΔG was calculated for all other predicted ASOs, and although there were other ASOs with better ΔG, three designed by Exiqon were used in the experiments described herein because they were generated using proprietary design tools. However, the efficiency of other ASOs reported in the present invention is not excluded.

[0062] Gene expression analysis Silencing of L1-MET was performed by transfecting cell lines in which the expression of L1-MET and MET mRNA fluctuates. Experiments were performed in lung cancer (EBC1, A549: L1-MET+ / MET+), and breast cancer cells (MDA-MB231: L1-MET± / MET+, MCF7: L1-MET+ / MET-). Also, as normal controls, non-transformed fibroblasts, namely MRC5, and normal lymphocytes derived from healthy donors were used. The expression of L1-MET was found to be usually high in EBC1, A549, and MCF7, weak in MDA-MB231, but no transcription was detected in MRC5 and normal lymphocytes (Figure 5). By qRT-PCR 24 hours after transfection, the gene expression of L1-MET was decreased in all cancer cell lines, but not in normal cells (MRC5 and lymphocytes), confirming the effectiveness of silencing. As shown in Figure 6, a knockdown silencing effect was observed for the three gapmers, with L1-MET_AS2 being the most effective, followed by L1-MET_AS1. As predicted above, L1-MET_AS3 was less effective for silencing of L1-MET transcripts.

[0063] Cell viability and apoptosis assays To investigate the biological effects of L1-MET silencing, a cell viability assay was performed. When treated with L1-MET_AS2 (p<0.0001) and L1-MET_AS1 (EBC1 p<0.0001 and A549 p = 0.0001), a strong decrease in viability was observed in the EBC1 and A549 cell lines. On the other hand, only EBC1 treated with L1-MET_AS3 showed a lower viability compared to the control (p = 0.002) (Figure 8). L1-MET_AS2 significantly affected MDA-MB231 (p<0.0001) and MCF7 (p = 0.028). As expected, the viability of control cells was not affected by silencing with the three gapmers (Figure 7).

[0064] Finally, apoptosis assessment of cancer cells using flow cytometry revealed that EBC1 and A549 cells underwent significant cell death after L1-MET silencing with L1-MET_AS1 or L1-MET_AS2 oligonucleotides. Silencing with L1-MET_AS2 was stronger than that obtained with L1-MET_AS1 and was also detectable in MCF7 and MDA-MB231 cells. Silencing with L1-MET_AS3 did not show an effect on apoptosis (Figure 8).

[0065] RNAseq analysis NGS analysis was performed on cancer cells treated with L1-MET_AS1, and the other two ASOs were not considered because their effects on genotype and phenotype were opposite and extreme. The RNA-seq mRNA Illumina kit was applied, which, based on the evidence revealed in the paper by di Miglio et al., Int J Cancer, 2018, stating that L1-MET also maintains polyA, meant selecting the polyA-tailed RNA of the above cells treated with L1-MET_AS1. To a) clearly confirm the decrease in L1-MET after treatment, b) evaluate the gene expression regulation after treatment and identify more interesting genes affected after treatment, and c) perform off-target analysis on the RNA-seq data, it was determined to reach a read depth of 30 million reads. In qRT-PCR, it was confirmed that the expression of L1-MET was detected in all cells. In cells treated with ASO, a decrease in L1-MET was also detected, confirming the effectiveness of silencing. Regarding differential gene expression, at the 24-hour time point after treatment, distinct gene sets underwent specific regulation. Among them, the cancer genes EGFR and MET decreased in all treated cells except MCF7. In this context, it became essential to evaluate sequences that could be off-target sequences. In silico alignment using the BLASTN tool identified very few exact match sequences that could be off-targets, but an empirical exact match - 4-base mismatch alignment was set between L1-MET_AS1 and the reads obtained in all samples. This alignment procedure revealed genes considered to be off-targets and confirmed gene regulation. Interestingly, it was confirmed that none of the predicted off-targets had a decrease in the number of reads and there were no undesirable changes in gene expression. Indirectly, it was confirmed that the regulation of the EGFR and MET genes could be considered not to be side effects of silencing.

[0066] Western blot analysis To validate the data obtained from RNAseq, the expression of MET and EGFR proteins and the downstream effectors of the signaling pathway: AKT and ERK were evaluated. The results of Western blot analysis are shown in Figure 9. Briefly, after L1-MET silencing in EBC1 cells, a decrease in the protein expression of both MET and EGFR and the corresponding phosphorylated proteins was observed for all three ASOs with the same efficacy observed above, with L1-MET_AS2 being the most effective, followed by L1-MET_AS1 and L1-MET_AS3. Since the EBC1 cell line is dependent on MET phosphorylation, a decrease in the activation of AKT and ERK was also detected. Similar results were found in A549 as long as no change in ERK phosphorylation was observed. In MDA-MB231, a decrease in EGFR protein is induced by L1-MET silencing with both L1-MET_AS1 and L1-MET_AS2, but not with L1-MET_AS3. The decrease in MET expression was confirmed only when the cells were treated with L1-MET_AS2. MCF7 does not express either MET or EGFR as reported in the literature, and no change was induced by silencing. In normal cells, no difference in protein expression was observed.

[0067] Overall, these results clearly show that L1-MET silencing is effective in cells expressing L1-MET together with MET and / or EGFR. Furthermore, it was found that the three antisense oligonucleotides can each induce cell death differently. Specifically, the results obtained with L1-MET_AS2 were the most effective, followed by L1-MET_AS1 and L1-MET_AS3. These findings indicate the possibility of translating L1-MET silencing to in vivo models for the development of selective therapies against human cancers.

[0068] References 1. Beck, C.R., et al., LINE-1 retrotransposition activity in human genomes. Cell,2010. 141(7): p. 1159-70. 2. Brouha, B., et al., Hot L1s account for the bulk of retrotransposition in thehuman population. Proc Natl Acad Sci U S A, 2003. 100(9): p. 5280-5. 3. Swergold, G.D., Identification, characterization, and cell specificity of ahuman LINE-1 promoter. Mol Cell Biol, 1990. 10(12): p. 6718-29. 4. Speek,M., Antisense promoter of human L1 retrotransposon drives transcription ofadjacent cellular genes. Mol Cell Biol, 2001. 21(6): p. 1973-85. 5. Denli,A.M., et al., Primate-specific ORF0 contributes to retrotransposon-mediateddiversity. Cell, 2015. 163(3): p. 583-93. 6. Nigumann,P., K. Redik, K. Matlik, and M. Speek, Many human genes are transcribed fromthe antisense promoter of L1 retrotransposon. Genomics, 2002. 79(5): p. 628-34. 7. Miglio, U., et al., The expression of LINE1-MET chimeric transcript identifies a subgroup of aggressive breast cancers. Int J Cancer, 2018. 143(11): p. 2838-2848. 8. Weber, B., S. Kimhi, G. Howard, A. Eden, and F. Lyko, Demethylation of a LINE-1 antisense promoter in the cMet locus impairs Met signalling through induction of illegitimate transcription. Oncogene, 2010. 29(43): p. 5775-84. 9. Wolff, E.M., et al., Hypomethylation of a LINE-1 promoter activates an alternate transcript of the MET oncogene in bladders with cancer. PLoS Genet, 2010. 6(4): p. e1000917. 10. Crooke, S.T., Molecular Mechanisms of Antisense Oligonucleotides. Nucleic Acid Ther, 2017. 27(2): p. 70-77. 11. Shen, X. and D.R. Corey, Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs. Nucleic Acids Res, 2018. 46(4): p. 1584-1600. 12. DiFusco, D., et al., Antisense Oligonucleotide: Basic Concepts and Therapeutic Application in Inflammatory Bowel Disease. Front Pharmacol, 2019. 10: p. 305. 13. Bo, X., et al., Selection of antisense oligonucleotides based on multiple predicted target mRNA structures. BMC Bioinformatics, 2006. 7: p. 122. 14. Shao, Y., Y. Wu, C.Y. Chan, K. McDonough, and Y. Ding, Rational design and rapid screening of antisense oligonucleotides for prokaryotic gene modulation. Nucleic Acids Res, 2006. 34(19): p. 5660-9. 15. Frankish, A., et al., GENCODE reference annotation for the human and mouse genomes. Nucleic Acids Res, 2019. 47(D1): p. D766-D773. 16. Dobin, A., et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 2013. 29(1): p. 15-21. 17. Liao, Y., G.K. Smyth, and W. Shi, featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics, 2014. 30(7): p. 923-30.

Claims

**Claim 1** An antisense oligonucleotide targeting a region of the L1-MET transcript, comprising SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO:

6. **Claim 2** The antisense oligonucleotide according to claim 1, wherein each of said antisense oligonucleotides comprises ribonucleotides, a combination of ribonucleotides and deoxyribonucleotides, and / or nucleotides having modified ribose and / or deoxyribose. **Claim 3** A pharmaceutical composition comprising one or more of the antisense nucleotides according to any one of claims 1 to 2 as an active ingredient together with one or more excipients and / or adjuvants. **Claim 4** The pharmaceutical composition according to claim 3, further comprising one or more anticancer agents. **Claim 5** The pharmaceutical composition according to claim 3 or 4 for the treatment of L1-MET-expressing tumors. **Claim 6** The pharmaceutical composition according to claim 5, wherein the L1-MET-expressing tumor is selected from the group consisting of triple-negative breast cancer, lung adenocarcinoma, and colorectal cancer. **Claim 7** A combination of one or more antisense oligonucleotides according to any one of claims 1 to 2 and one or more anticancer agents for separate or sequential use in the treatment of L1-MET-expressing tumors. **Claim 8** The combination according to claim 7, wherein the L1-MET-expressing tumor consists of triple-negative breast cancer. **Claim 9** The antisense oligonucleotide according to claim 2, wherein the phosphate group is modified.

Images