Aptamers against dengue virus, and related methods and products

Abstract

Aptamers against dengue virus, optionally against the dengue virus NS1 protein, are provided. The aptamers contain at least one unnatural base, which may be 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds), pyrrole-2-carbaldehyde (Pa), or 2-nitro-4-propynylpyrrole (Px). The aptamers of the present invention may be used to confirm dengue infection in a subject. Also provided are mixtures and kits containing the aptamers.

Description

Technical Field

[0001] The present disclosure broadly relates to aptamers against dengue virus and related methods, mixtures, kits, and nucleic acid molecules.

Background Art

[0002] Background Dengue fever is a widespread viral disease transmitted by mosquitoes and has four classified serotypes. There is no available drug therapy, but early detection and treatment reduce morbidity and mortality. Secondary infections by different serotypes result in more severe diseases. Commercially available dengue fever vaccines have been developed but are not available for people who have not been previously infected.

[0003] Dengue fever is an arthropod-borne flavivirus and has four major serological types (DEN1-4). Global dengue virus (hereinafter NV) infections are estimated to be over 390 million people per year, and the recent dramatic and global increase in incidence suggests that approximately 40% of the world's population is currently at risk. Symptoms vary from mild to severe and sometimes fatal in most cases. Infection by one dengue virus serotype provides long-term protection from reinfection by the same serotype but can enhance disease from secondary heterotypic infections. Secondary DENV infections are the greatest risk factor for severe diseases such as dengue hemorrhagic fever and dengue shock syndrome. Antibody-dependent enhancement (ADE) is thought to be one of the mechanisms causing severe dengue fever. A person's immune history is important for understanding the subsequent risk, etiology, and defense of disease, and thus the ability to elucidate previously infected serotypes is very valuable for research. Diagnostic methods for identifying the serotypes of previously infected patients help to clarify whether the order of dengue fever serotype infections affects the severity of the disease.

[0004] Currently, there is no specific treatment for dengue fever, but early diagnosis promotes appropriate treatment and reduces the risk of death. Dengvaxia, a dengue vaccine, was developed by Sanofi Pasteur. However, as a result of analysis, it was revealed that vaccination of people who have never been infected with dengue fever increases the risk of more severe symptoms if they are infected after vaccination. As a result, the World Health Organization (WHO) recommended using the vaccine only for people who have previously been infected with dengue fever. The effectiveness of the vaccine may vary among people who have previously been infected with different serotypes of dengue fever, and further research is needed to understand the mechanism. Therefore, the development of methods to detect not only current infections but also past infections (including serotype identification) is an urgent global issue.

[0005] In the early stages of DENV infection (e.g., within one week after the onset of fever), viral RNA can be identified by RT-qPCR. Viral-related substances such as envelope protein and non-structural protein 1 (NS1) can also be detected by enzyme-linked immunosorbent assay (ELISA) or lateral flow assay (LFA) using antibodies against the antigen. RT-qPCR is useful for serotype identification in the early stages but not in later stages. For the detection of serotype-specific NS1 in the early stages, the generation of antibodies against each NS1 serotype has been described. However, these antibodies are not commercially available. In later stages, IgM and IgG antibodies of patients against viral-related antigens such as viral particles and NS1 protein can be detected by ELISA or LFA. However, the reliability of detection is still limited, and serotype identification remains difficult.

[0006] A DNA aptamer is a single-stranded DNA fragment that specifically binds to a target molecule and is regarded as an alternative to an antibody. DNA aptamers were initially developed by the SELEX method ( S systematic EEvolution of L ligands by EX the in vitro selection method (systematic evolution of ligands by exponential enrichment) called SELEX. Once appropriate aptamer sequences are determined, they can be chemically synthesized in large scale under good manufacturing practice (GMP). Although many DNA aptamers have been reported, their use has remained limited because their affinity for the target is not sufficient (KD value 10 -7 ~10 -9 M).

[0007] Therefore, there is a need to provide alternative aptamers for dengue virus, as well as related methods and kits. SUMMARY OF THE INVENTION

[0008] Abstract In one aspect, aptamers against dengue virus (DENV) containing at least one unnatural base are provided.

[0009] In one embodiment, the at least one unnatural base is present within the loop structure and / or bulge of the aptamer.

[0010] In one embodiment, the at least one unnatural base is selected from the group consisting of: 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds), 7-(2,2'-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss), pyrrole-2-carbaldehyde (Pa), 2-nitro-4-propynylpyrrole (Px), 7-(2,2',5',2''-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dsss), 2-amino-6-(2-thienyl)purin-9-yl group (s), 2-amino-6-(2,2'-bithien-5-yl)purin-9-yl group (ss), 2-amino-6-(2,2',5',2''-terthien-5-yl)purin-9-yl group (sss), 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDsa), 4-(2,2'-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl group (Dsas), 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dsav), 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDva), 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dvas), 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDia), derivatives thereof, and combinations thereof.

[0011] In one embodiment, the aptamer comprises a DNA-based aptamer.

[0012] In one embodiment, the dissociation constant of the aptamer for DENV is 200 pM or less.

[0013] In one embodiment, the aptamer is capable of binding to the NS1 protein of DENV.

[0014] In one embodiment, the aptamer is specifically bindable to a single serotype of DENV selected from the group consisting of serotype 1, serotype 2, serotype 3, and serotype 4.

[0015] In one embodiment, the aptamer comprises the sequences described in the following table:

[0016]

Table 1-1

[0017]

Table 1-2

[0018]

Table 1-3

[0019] Or a sequence that shares at least 75% sequence identity with these sequences, or a sequence that differs from these sequences by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases, or a part of these sequences.

[0020] In one aspect, a mixture of aptamers specific for different serotypes is provided, and the mixture comprises at least 2, at least 3, or at least 4 aptamers.

[0021] In one aspect, a method for identifying DENV infection in a subject is provided, comprising: contacting a sample of the subject with the aptamer or a mixture of aptamers, and detecting a binding event in the aptamer.

[0022] In one embodiment, the method is a method for identifying current DENV infection in a subject, and a binding event of any of the aptamers indicates current DENV infection in the subject, where the bound aptamer may be specific for a single DENV serotype, and the binding event may indicate current DENV infection of the serotype in the subject.

[0023] In one embodiment, the method is a method for a subject to identify a current DENV infection, and the method further comprises contacting the sample of the subject with the aptamer or a mixture of aptamers in the presence of a DENV protein, and a method for detecting a binding event of the aptamer, wherein the absence of a binding event in any of the aptamers comprises determining whether the current DENV infection is a secondary DENV infection or a further DENV infection, wherein the unbound aptamer may be specific for a serotype of DENV, and the absence of the binding event may indicate a past infection of DENV of the serotype in the subject.

[0024] In one embodiment, where the method is a method for identifying a past DENV infection in a subject, the contacting step is performed in the presence of a DENV protein, and the absence of a binding event in any of the aptamers indicates a past DENV infection in the subject, wherein the unbound aptamer may be specific for a serotype of DENV, and the absence of the binding event may indicate a past infection of DENV of the serotype in the subject.

[0025] In one embodiment, the method comprises a competitive binding assay.

[0026] In one embodiment, the method is performed within one week after the onset of fever in the subject.

[0027] In one embodiment, when the subject is shown to have a current DENV infection, the method further comprises implementing a treatment plan for DENV in the subject.

[0028] In one aspect, a method for evaluating the suitability of a subject for a DENV vaccine is provided, the method comprising: binding a sample of the subject to the aptamer; detecting a binding event in the aptamer; determining the immune history of the subject based on the binding event of the aptamer (the absence of a binding event for any aptamer indicates a past DENV infection in the subject); and concluding the suitability of the subject for the DENV vaccine based on the immune history.

[0029] In one aspect, a kit for confirming DENV infection in a subject is provided, the kit comprising the aptamer or a mixture of aptamers.

[0030] In one embodiment, the kit further comprises a DENV protein.

[0031] In one aspect, a nucleic acid molecule is provided that comprises the sequences set forth in the following table, or sequences that share at least 75% sequence identity with these sequences, or sequences that differ from these sequences by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases, or a portion of these sequences.

[0032]

Table 2-1

[0033]

Table 2-2

[0034]

Table 2-3

[0035] Definitions As used herein, the term "aptamer" broadly refers to a nucleic acid molecule having the ability to bind to a target molecule, particularly a dengue virus protein, with high affinity and specificity. "Aptamer" includes not only nucleic acid molecules composed of natural bases, but also nucleic acid molecules containing unnatural bases, or artificial bases, modified bases, and / or nucleic acid analogs. "Aptamer" may be modified. Non-limiting examples of such modifications include terminal modifications to enhance the stability of the molecule, functional group modifications (e.g., amino group, thiol group, ethyl group, diol group), conjugation modifications (e.g., biotinylation), and phosphorothioate bond modifications.

[0036] As used herein, the term "identify" when used in relation to an infection should be broadly construed to include ascertaining the presence or absence, amount, level of disease burden, phase, or nature of the infection. For example, ascertaining the phase of an infection may include determining whether the infection is in the febrile phase, critical phase, or convalescent phase. For example, ascertaining the nature of an infection may include determining the serotype of the infection, whether the infection is a first infection or a second or subsequent infection, and / or whether the infection is a current infection or a past infection.

[0037] As used herein, "treat", "therapy", and their synonyms refer to both therapeutic treatment and prophylactic or preventative measures, where the aim is to prevent or slow (mitigate) a medical condition including, but not limited to, diseases (such as dengue fever infection), symptoms, and disorders. Medical conditions can also include the body's response to a disease or disorder, such as inflammation. Such treatment is required not only for those who already have a medical condition, but also for those who are likely to develop such a condition, or for those who should prevent the medical condition.

[0038] As used herein, the term "subject" includes patients and non-patients. The term "patient" refers to an individual who has or is likely to have a medical condition such as flavivirus or dengue virus infection, while "non-patient" refers to an individual who does not have or is unlikely to have a medical condition. "Non-patients" include healthy individuals, individuals who have not developed the disease, and / or individuals without a medical condition. The term "subject" includes humans and animals. Examples of animals include mice. "Mouse" refers to any mammal in the family Muridae such as a mouse or a rat.

[0039] As used herein, the term "micro" should be broadly interpreted to include the range from about 1 micron to about 1000 microns. When used as a unit prefix, 1 micro (μ) represents a factor of 10 -6 of.

[0040] As used herein, the term "nano" should be broadly interpreted to include the range less than about 1000 nm. When used as a unit prefix, 1 nano (n) represents a factor of 10 -9 of.

[0041] As used herein, the term "particle" broadly refers to a discrete entity or a separated body. Particles described herein include organic particles, inorganic particles, or biological particles. The particles used herein may be macro-particles formed by aggregates of a plurality of sub-particles or fragments of small objects. The particles disclosed herein may be spherical, substantially spherical, or non-spherical such as particles with an irregular shape or elliptical particles. The term "size" when referring to a particle broadly refers to the maximum dimension of the particle. For example, when the particle is substantially spherical, the term "size" may refer to the diameter of the particle, and when the particle is substantially non-spherical, the term "size" may refer to the longest diameter of the particle.

[0042] As used herein, the terms "coupled" or "connected" are intended to include both those that are directly connected and those that are connected through one or more intermediate means, unless otherwise specified.

[0043] As used herein, the term "associated with" when referring to two components refers to a broad relationship between the components. The relationship includes, but is not limited to, physical, chemical, or biological relationships. For example, when component A is associated with component B, components A and B may be directly or indirectly coupled to each other, or component A may include component B, or vice versa.

[0044] As used herein, the term "adjacent" when referring to two components means that one component is close to the other component, and although they may be in contact with each other, it is not limited thereto, and they may be components separated by one or more additional elements disposed therebetween.

[0045] The term "and / or", e.g., "X and / or Y", is understood to mean either "X and Y" or "X or Y", and should be used to clearly support both meanings or either meaning.

[0046] Furthermore, whenever the word "substantially" is used in this specification, it is understood to include, but not be limited to, "entirely" or "completely", etc. Further, whenever terms such as "comprising" are used, it is intended to be a non-limiting usage that broadly includes the components / elements described after such terms, in addition to other components not explicitly described. For example, when "comprising" is used, a description of "one" feature is also intended to refer to "at least one" of that feature. Terms such as "consisting" may be considered part of terms such as "comprising" in an appropriate context. Accordingly, in the embodiments disclosed herein using terms such as "comprising", it is understood that these embodiments teach corresponding embodiments using terms such as "consisting". Further, whenever terms such as "about" are used, it means, at any time, a reasonable variation such as, generally, a variation of + / - 5% of the disclosed value, or a dispersion of 4% of the disclosed value, or a dispersion of 3% of the disclosed value, a dispersion of 2% of the disclosed value, or a dispersion of 1% of the disclosed value.

[0047] Furthermore, in this specification, a predetermined value may be disclosed within a certain range. The values indicating both ends of the range are intended to illustrate the preferred range. Whenever a range is described, it is intended to include and teach all possible sub-ranges within that range, just as the individual numerical values within the range. That is, the two ends of the range should not be construed as limitations without room for change. For example, the description of the range from 1% to 5% is intended to specifically disclose partial ranges such as 1% to 2%, 1% to 3%, 1% to 4%, 2% to 3%, etc., as well as the individual values within the range such as 1%, 2%, 3%, 4%, 5%, etc. What the above specific disclosure intends is applicable to any depth / width of the range.

[0048] In addition, when describing a certain embodiment, the description may be a process such as a specific order in the disclosed method and / or steps. However, it is understood that unless specifically required, the method or process should not be limited to the specific order of the disclosed steps. Other orders of the steps are possible. The specific order of the steps disclosed in this specification should not be construed as an unnecessary limitation. Unless specifically required, the methods and / or processes disclosed in this specification should not be limited to the steps performed in the described order. The order of the steps may change and may remain within the scope of the disclosure.

[0049] Furthermore, the present disclosure provides embodiments having one or more features / characteristics discussed herein, but one or more of these features / characteristics may be excluded in other alternative embodiments, and it is understood that the present disclosure provides support for such exclusions and these related alternative embodiments.

Brief Description of the Drawings

[0050]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19A

Figure 19B

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Mode for Carrying Out the Invention

[0051] Exemplary and non-limiting embodiments of nucleic acid molecules, optionally aptamers against dengue virus (DENV), and related methods and mixture kits are disclosed below.

[0052] In various embodiments, a nucleic acid molecule or a portion thereof that can recognize and / or bind to DENV is provided. The nucleic acid molecule may be a polynucleotide or an oligonucleotide. The nucleic acid molecule may be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The nucleic acid molecule may contain natural bases, unnatural bases, or artificial bases, modified bases, and / or nucleic acid analogs (e.g., base analogs, sugar analogs, those with unnatural backbones, etc.). The nucleic acid molecule may be modified, for example, at one or both of its ends. The nucleic acid molecule may be single-stranded. In various embodiments, the nucleic acid molecule can bind to DENV or a part thereof with high affinity and / or high specificity. The term "nucleic acid molecule" does not imply a specific size. In various embodiments, the nucleic acid molecule includes an aptamer.

[0053] Accordingly, in various embodiments, aptamers against DENV are provided. The aptamers may be RNA-based aptamers, aptamers containing ribonucleotide units, DNA-based aptamers, or aptamers containing deoxyribonucleotide units. In one embodiment, the aptamers include DNA-based aptamers. Advantageously, DNA-based aptamers can increase stability. DNA-based aptamers include modified ones.

[0054] In various embodiments, the aptamer may include natural bases and / or non-natural bases (or artificial bases). "Natural bases" refer to naturally occurring bases such as adenine (A), guanine (G), cytosine (C), thymine (T) (for DNA-based aptamers), and uracil (U) (for RNA-based aptamers). "Non-natural bases" (or "artificial bases") refer to bases that do not occur naturally. Non-limiting examples of "non-natural bases" (or "artificial bases") include isoguanine (iG), isocytosine (iC), 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one (P), 6-amino-5-nitro-2(1H)-pyridone (Z), 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds), pyrrole-2-carbaldehyde (Pa), 2-nitropyrrole (Pn), 2-nitro-4-propynylpyrrole (Px), 7-(2,2'-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl (Dss), 7-(2,2',5',2''-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl (Dsss), 2-amino-6-(2-thienyl)purin-9-yl (s), 2-amino-6-(2,2'-bithien-5-yl)purin-9-yl (ss), 2-amino-6-(2,2',5',2''-terthien-5-yl)purin-9-yl (sss), 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl (dDsa), 4-(2,2'-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl (Dsas), 4-[2-(2-thiazole)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl (Dsav), 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl (dDva), 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl (Dvas), 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl (dDia), 6-methylisoquinolin-1(2H)-thione (5SICS), or

[0055] [Chemical formula]

[0056] , 3-methoxynaphthalen-2-yl (NaM), 2-methoxy-4-methylphenyl (MMO2), and their derivatives. Examples of derivatives include dihydroxy derivatives such as diol-Px and diol-Pa. (For example, diol 1-Px and diol 1-Pa), etc.

[0057] Examples of derivatives of Px and Pa in some embodiments include

[0058] [Chemical Formula]

[0059] are included, where R represents any of the moieties represented by the following formula:

[0060] [Table 3-1]

[0061] [Table 3-2]

[0062] [Table 3-3]

[0063] Or a derivative of Pa or Px with an amino bond, an alkylamino bond, a diol bond, an aromatic group bond, a fluorophore bond, a fluorescent dye bond, or a phosphor bond, or (i) Okamoto I, Miyatake Y, Kimoto M, Hirao I. High Fidelity, Efficiency and Functionalization of Ds-Px Unnatural Base Pairs in PCR Amplification for a Genetic Alphabet Expansion System. Okamoto I, Miyatake Y, Kimoto M, Hirao I.. 2016 Nov 18;5(11):1220-1230. Epub 2016 Feb 5. PMID: 26814421; (ii) Someya T, Ando A, Kimoto M, Hirao I.Site-specific labeling of RNA by combining genetic alphabet expansion transcription and copper-free click chemistry. Nucleic Acids Res. 2015 Aug 18;43(14):6665-76. doi: 10.1093 / nar / gkv638. Epub 2015 Jun 29. PMID:26130718; (iii) Ishizuka T, Kimoto M, Sato A, Hirao I. Site-specific functionalization of RNA molecules by an unnatural base pair transcription system via click chemistry. Chem Commun (Camb). 2012 Nov 14;48(88):10835-7. doi: 10.1039 / c2cc36293g. Epub 2012 Oct 3. PMID: 23032097; (iv) Morohashi N, Kimoto M, Sato A, Kawai R, Hirao I.Site-specific incorporation of functional components into RNA by an unnatural base pair transcription system. Molecules.2012 Mar 7;17(3):2855-76. doi: 10.3390 / molecules17032855. PMID: 22399139; (v) Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I. Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Res. 2012 Mar;40(6):2793-806. doi: 10.1093 / nar / gkr1068. Epub 2011 Nov 24. PMID: 22121213; (vi) Yamashige R, Kimoto M, Mitsui T, Yokoyama S, Hirao I. Monitoring the site-specific incorporation of dual fluorophore-quencher base analogues for target DNA detection by an unnatural base pair system. Org Biomol Chem. 2011 Nov 7;9(21):7504-9. doi: 10.1039 / c1ob06118f. Epub 2011 Sep 20. PMID:21935564, which is a derivative of Pa or Px. The contents of references (i) to (vi) are also incorporated herein by reference in their entirety.

[0064] Examples of the Ds derivative include the following.

[0065]

Chemical formula

[0066] Here, R and R’ each independently represent a molecular moiety represented by the following formula:

[0067]

Chemical formula

[0068]

Chemical formula

[0069] Here, when n1 = 2 to 10; n2 = 1 or 3; n3 = 1, 6, or 9; n4 = 1 or 3; n5 = 3 or 6; R1 = Phe (phenylalanine), Tyr (tyrosine), Trp (tryptophan), His (histidine), Ser (serine), or Lys (lysine), and R2, R3, and R4 are each Leu (leucine), Leu, and Leu, or each Trp, Phe, and Pro (proline).

[0070] In various embodiments, the derivatives of the molecule or unnatural base are structurally related to the molecule or unnatural base. For example, the derivative may share a common structural feature, a basic structure, and / or a fundamental chemical basis with the molecule or unnatural base. The derivative may be generated or obtained from the molecule or unnatural base, but it is not limited to being generated or obtained from the molecule or unnatural base. In some embodiments, the derivative can be derived from the molecule or unnatural base by modification of the molecule or unnatural base, at least theoretically. In some embodiments, the derivative of the molecule or unnatural base shares or at least retains to some extent the chemical properties, biological properties, chemical activity, and / or biological activity associated with the molecule or unnatural base. Those skilled in the art can, on a case-by-case basis, determine what needs to be maintained in the derivative to retain the function, chemical properties, biological properties, chemical activity, and / or biological activity, based on the disclosed information of the molecule or unnatural base, general structural features, important features, and / or the chemical basis underlying it. Those skilled in the art can also identify assays that can demonstrate that its function, chemical properties, biological properties, chemical activity, and / or biological activity are retained. For example, binding assays such as ELISA, EMSA, SPR, and bio-layer interferometry (BLI) can be used to determine the binding properties of aptamers containing unnatural base derivatives.

[0071] In various embodiments, the unnatural base is compatible with a polymerase and, optionally, a DNA polymerase. In various embodiments, the unnatural base is compatible with amplification reactions such as polymerase chain reaction (PCR). In various embodiments, the unnatural base can form a base pair with another unnatural base. For example, Ds can base pair with Pn, Pa, or Px. In some embodiments, the unnatural bases form pairs with their complementary bases with high accuracy in PCR. In various embodiments, the unnatural base is selected from components of an unnatural base pair system. For example, the unnatural base may comprise one or more components selected from Ds-Px pairs, Ds-Pa pairs, Ds-Pn pairs, Dss-Px pairs, Dss-Pa pairs, Dss-Pn pairs, iG-iC pairs, P-Z pairs, 5SICS-NaM pairs, TPT3-NaM pairs, 5SICS-MMO2 pairs, and derivatives thereof.

[0072] In some embodiments, the unnatural base is hydrophobic. In some embodiments, the unnatural base is hydrophilic.

[0073] In various embodiments, the aptamer comprises from about 1 to about 10, or from about 1 to about 5 unnatural bases. In various embodiments, the aptamer comprises at least about 1, at least about 2, at least about 3, at least about 4, or at least about 5 unnatural bases. In various embodiments, the aptamer comprises about 1 or fewer, about 2 or fewer, about 3 or fewer, about 4 or fewer, or about 5 or fewer unnatural bases. In various embodiments, the aptamer comprises about 1, about 2, about 3, about 4, about 5 or more unnatural bases.

[0074] The aptamer may include a hairpin structure or a stem-loop structure. The aptamer may further include a bulge. In various embodiments, the aptamer includes at least one hairpin structure or stem-loop structure and / or at least one bulge. In various embodiments, the unnatural base is present in the loop structure of the aptamer. In various embodiments, the unnatural base is present within the bulge of the aptamer. The bulge may be within the loop structure or may not be within the loop structure. In various embodiments, the unnatural base is present within the loop structure and / or bulge of the aptamer. In some embodiments, about 1 to about 10, or about 1 to about 5 unnatural bases are present within the loop structure and / or bulge of the aptamer. In some embodiments, at least about 1, at least about 2, at least about 3, at least about 4, or at least about 5 unnatural bases are present within the loop structure and / or bulge of the aptamer. In some embodiments, about 1 or less, about 2 or less, about 3 or less, about 4 or less, or about 5 or less unnatural bases are present within the loop structure and / or bulge of the aptamer. In some embodiments, about 1, about 2, about 3, about 4, about 5 or more unnatural bases are present within the loop structure and / or bulge of the aptamer. In some embodiments, all of the unnatural bases are present within the loop structure and / or bulge of the aptamer. In some embodiments, the stem structure of the aptamer does not have unnatural bases. In some embodiments, the stem structure of the aptamer includes only natural bases. In some embodiments, the loop structure and / or bulge of the aptamer includes unnatural bases.

[0075] In some embodiments, the unnatural base in the aptamer has no binding partner. In some embodiments, the unnatural base in the aptamer does not form a base pair with a natural base. In some embodiments, the unnatural base forms a loop-out / bulge-out region within the aptamer. The bulge can thus be part of an unpaired nucleic acid or aptamer. Unpaired formation can occur by non-complementary / mismatched base pairing between natural bases, non-complementary / mismatched base pairing between unnatural bases, or complementary / mismatched base pairing between a natural base and an unnatural base. In some examples, unpaired formation results from the introduction of one or more unnatural bases (e.g., in a region of natural bases) that do not form a base pair with a natural base. In some examples, the bulge contains from about 1 base to about 20 bases, from about 1 base to about 15 bases, from about 1 base to about 10 bases, or from about 1 base to about 5 bases. In some examples, the bulge contains about 1 base, about 2 bases, about 3 bases, about 4 bases, about 5 bases, about 6 bases, about 7 bases, about 8 bases, about 9 bases, about 10 bases, about 11 bases, about 12 bases, about 13 bases, about 14 bases, about 15 bases, about 16 bases, about 17 bases, about 18 bases, about 19 bases or about 20 bases.

[0076] In various embodiments, the number of bases in the aptamer is from about 20 bases to about 200 bases, from about 20 bases to about 100 bases, from about 30 bases to about 100 bases, from about 40 bases to about 100 bases, from about 40 bases to about 90 bases, from about 40 bases to about 80 bases, from about 40 bases to about 70 bases or from about 50 bases to about 60 bases. Advantageously, embodiments of aptamers having a short length or small size can reduce unexpected interactions / toxicity, reduce the cost of raw materials / production, or improve the quality assurance of raw materials.

[0077] In various embodiments, the unnatural base is selected from the group consisting of 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds), 7-(2,2'-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss), pyrrole-2-carbaldehyde (Pa), diol-modified pyrrole-2-carbaldehyde (diol-Pa), 2-nitro-4-propynylpyrrole (Px), diol-modified 2-nitro-4-propynylpyrrole (diol-Px), 7-(2,2',5',2''-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dsss); 2-amino-6-(2-thienyl)purin-9-yl group (s); 2-amino-6-(2,2'-bithien-5-yl)purin-9-yl group (ss), 2-amino-6-(2,2',5',2''-terthien-5-yl)purin-9-yl group (sss), 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDsa); 4-(2,2'-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl group (Dsas), 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dsav), 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDva), 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dvas), 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDia), derivatives thereof and combinations thereof. In various embodiments, the unnatural base is selected from the group consisting of 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds), 7-(2,2'-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss), pyrrole-2-carbaldehyde (Pa), diol-modified pyrrole-2-carbaldehyde (diol-Pa), 2-nitro-4-propynylpyrrole (Px), diol-modified 2-nitro-4-propynylpyrrole (diol-Px), derivatives thereof and combinations thereof. In some embodiments, the aptamer comprises an unnatural base comprising Ds, diol-Pa, diol-Px and derivatives thereof. In some embodiments, the aptamer comprises an unnatural base comprising Ds.In some embodiments, the aptamer comprises more Ds (or derivatives thereof) than diol-Pa (or derivatives thereof) and / or diol-Px (or derivatives thereof).

[0078] In various embodiments, the aptamer comprising at least one unnatural base can recognize and / or bind to DENV with high affinity and / or high specificity, as needed, and can recognize and / or bind to DENV viral proteins, as needed. In some embodiments, the aptamer comprising at least one unnatural base can recognize and / or bind to non-structural proteins of DENV with high affinity and / or high specificity, as needed. In some embodiments, the aptamer comprising at least one unnatural base can recognize and / or bind to the non-structural protein (NS1) of DENV with high affinity and / or high specificity, as needed. In some embodiments, the aptamer comprising at least one unnatural base can recognize and / or bind to serotype-specific NS1 of DENV with high affinity and / or high specificity, as needed. In various embodiments, the aptamer comprising at least one unnatural base can form a complex with DENV, DENV viral proteins, non-structural proteins of DENV, NS1 of DENV, and / or serotype-specific NS1 of DENV. For example, the presence of the aptamer-DENV complex can be detected by a gel shift assay (EMSA). For example, high affinity and / or high specificity can be measured by analysis using surface plasmon resonance (SPR). For example, high affinity and / or high specificity can be measured by enzyme-linked immunosorbent assay (ELISA).In various embodiments, the aptamer comprising at least one unnatural base can recognize and / or bind to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV, and / or serotype-specific NS1 of DENV with higher affinity and / or higher specificity than those of their relative sequences lacking the unnatural base (e.g., sequences in which the unnatural base is substituted with a natural base at the same position or the same relative position).

[0079] In various embodiments, the aptamer can distinguish various serotypes of DENV. For example, the aptamer can distinguish dengue serotype 1 (DEN1) from dengue serotype 2 (DEN2), dengue serotype 3 (DEN3), and / or dengue serotype 4 (DEN4). For example, the aptamer can distinguish DEN3 from DEN1, DEN2, and / or DEN4. For example, the aptamer can distinguish DEN4 from DEN1, DEN2, and / or DEN3. For example, the aptamer can distinguish DEN4 from DEN1, DEN2, and / or DEN3. For example, the aptamer can recognize and / or bind to one serotype of DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV with a much higher affinity than that of the other serotype(s) thereof. In some examples, the aptamer cannot recognize and / or bind to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV of other serotypes and does not recognize and / or bind. In various embodiments, the aptamer can specifically bind to a single serotype of DENV selected from the group comprising serotype 1, serotype 2, serotype 3, and serotype 4.

[0080] Advantageously, embodiments of the aptamer have high affinity for DENV, viral proteins of DENV, non-structural proteins of DENV, NS1 of DENV, and / or serotype-specific NS1 of DENV. In various embodiments, the dissociation constant (K D ) of the aptamer is about 14 nM or less, about 13 nM or less, about 12 nM or less, about 11 nM or less, about 10 nM or less, about 9 nM or less, about 8 nM or less, about 7 nM or less, about 6 nM or less, about 5 nM or less, about 4 nM or less, about 3 nM or less, about 2 nM or less, or about 1 nM or less. In various embodiments, the aptamer has a K D of about 800 pM or less, about 600 pM or less, about 400 pM or less, about 300 pM or less, about 250 pM or less, about 200 pM or less, about 190 pM or less, about 180 pM or less, about 170 pM or less, about 160 pM or less, about 150 pM or less, about 140 pM or less, about 130 pM or less, about 120 pM or less, about 110 pM or less, about 100 pM or less, about 90 pM or less, about 80 pM or less, about 70 pM or less, about 60 pM or less, about 50 pM or less, about 40 pM or less, about 30 pM or less, about 20 pM or less, or about 10 pM or less. In one embodiment, the K D of the aptamer for DENV is 200 pM or less.

[0081] In various embodiments, the aptamer comprises the sequences set forth in Table 1 below or

[0082]

Table 4-1

[0083]

Table 4-2

[0084]

Table 4-3

[0085] or comprises the sequences set forth in Table 2 below:

[0086]

Table 5-1

[0087]

Table 5-2

[0088] or a sequence that shares at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with them, or with a portion thereof, optionally with the linear portions thereof, and that differs by about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 bases or nucleotides. In some embodiments, the aptamer comprises the sequence of Table 1, or a portion thereof, optionally with the linear portions thereof, and that differs by about 1 or fewer, about 2 or fewer, about 3 or fewer, about 4 or fewer, about 5 or fewer, about 6 or fewer, about 7 or fewer, about 8 or fewer, about 9 or fewer, about 10 or fewer, about 11 or fewer, about 12 or fewer, about 13 or fewer, about 14 or fewer, about 15 or fewer, about 16 or fewer, about 17 or fewer, about 18 or fewer, about 19 or fewer, about 20 or fewer, about 21 or fewer, about 22 or fewer, about 23 or fewer, about 24 or fewer, or about 25 or fewer bases or nucleotides.

[0089] In some embodiments, the aptamer includes one or more core sequences, stem regions, and hairpin sequences such as mini-hairpin sequences. For example, Table 3 below shows some of the core sequences, stem regions, and hairpin sequences of the aptamer, with the core sequences shown in bold, the stem regions shown by solid underlines, and the hairpin sequences shown by dotted underlines.

[0090]

Table 6-1

[0091]

Table 6-2

[0092] In various embodiments, the core sequence does not include a hairpin sequence. In various embodiments, the hairpin sequence includes the mini-hairpin sequence CGCGLAGCG. In various embodiments, the hairpin sequence enables aptamer stabilization and biotinylation without substantially affecting or adversely affecting the aptamer binding affinity. In some examples, the stem region at the 3' end and / or 5' end of the secondary structure can be substituted with other bases and / or base pairs without substantially affecting or adversely affecting the aptamer binding affinity.

[0093] In various embodiments, the aptamer specific for DEN1 includes the sequences described in Table 4 below.

[0094]

Table 7-1

[0095]

Table 7-2

[0096] In various embodiments, the aptamer specific to DEN2 comprises the sequences described in Table 5 below.

[0097]

Table 8-1

[0098]

Table 8-2

[0099] In various embodiments, the aptamer specific to DEN3 comprises the sequences described in Table 6 below.

[0100]

Table 9

[0101] In various embodiments, the aptamer specific to DEN4 comprises the sequences described in Table 7 below.

[0102]

Table 10

[0103] In various embodiments, the aptamer may be chemically modified. In some embodiments, the aptamer includes chemical modifications at one or both of its ends. In some embodiments, the aptamer includes a chemical modification at its 3' end. In some embodiments, the aptamer includes a chemical modification at its 5' end. In some embodiments, the chemical modification includes introducing a mini hairpin structure / sequence at the end, for example, at the 3' end. The mini hairpin structure / sequence may be CGCGTAGCG, or may be a sequence that differs therefrom by about 1 nucleotide or less, about 2 nucleotides or less, or about 3 nucleotides or less. The mini hairpin structure / sequence can improve the stability of the aptamer. For example, the mini hairpin structure / sequence can prevent rapid degradation by nucleases, especially in biological samples. Alternative or additional suitable chemical modifications may be made to the aptamer. For example, the aptamer may be capped at the 3' or 5' end with an inverted deoxythymidine (idT) and / or a locked nucleic acid (LNA) analog.

[0104] In some embodiments, the modification may be made to the nucleotide units of the aptamer. For example, the modification may be made to the ribose or sugar moiety. In some examples, the modification is made at the 2’ position, such as 2’-fluoro, 2’-methoxy, 2’-O-methyl, and / or 2’-amino modifications. In some examples, the 2’-methoxy modification including deoxyribose modification at 2’-H and the 2’-O-methyl modification including ribose modification at 2’-OH result in the same chemical structure. In some examples, the modification includes 4-thiose modification. In some examples, the aptamer may consist of or include one or more nucleotide analogs such as peptide nucleic acid (PNA), locked nucleic acid (LNA), morpholino nucleotide, threose nucleic acid (TNA), glycol nucleic acid (GNA), arabinose nucleic acid (ANA), 2’-deoxy-2’-fluoro-β-D-arabinonucleic acid (2’F-ANA), 2’-fluoroarabinose nucleic acid (FANA), 2’-deoxy-2’-fluororibonucleic acid (2’-FRNA or FRNA), cyclohexene nucleic acid (CeNA), anhydrohexitol nucleic acid (HNA), unlocked nucleic acid (UNA), (4’→6’) linked oligo-2’,3’-dideoxy-β-D-glucopyranose nucleic acid (homo-DNA or hDNA), xylose nucleic acid (XyNA), deoxy-xylose nucleic acid (dXyNA), aminoallyl uridine (aa-UTP), and derivatives thereof. In some examples, the aptamer may consist of or include nucleotides based on L-ribose.

[0105] In some embodiments, the modification includes modification to the phosphate linkage portion or phosphodiester bond. In some examples, the aptamer includes one or more of phosphorothioate bond, boranophosphate bond, methylphosphonate, phosphorothioate analog, substitution to triazole bond, etc.

[0106] In one example, the aptamer includes phosphoramidite nucleotides.

[0107] In various embodiments, the modification confers stability on the aptamer against nucleic acid cleavage enzymes / nucleic acid degrading enzymes such as nucleases and DNase. In various embodiments, the modification increases the half-life of the aptamer in biological samples such as human blood and serum, for example. In various embodiments, the modification confers desirable properties on the modified aptamer. In some embodiments, the modification confers desirable pharmacological and / or pharmacokinetic properties on the modified aptamer. In various embodiments, the modified aptamer is stable in the human body. The modified aptamer has desirable whole body clearance properties such as a low glomerular filtration rate. In various embodiments, the modification does not substantially decrease the affinity and / or specificity of the aptamer for DENV, DENV viral protein, DENV non-structural protein, DENV NS1 and / or serotype-specific DENV NS1. In various embodiments, the affinity and / or specificity of the modified aptamer for DENV, DENV viral protein, DENV non-structural protein, DENV NS1 and / or serotype-specific DENV NS1 is not substantially changed and does not substantially decrease as compared to that of the unmodified aptamer(s).

[0108] In various embodiments, the unnatural bases of the aptamer may be modified. For example, the unnatural bases may be modified to have functional groups such as diols, azides, ethynyls, biotin, etc. In one example, Px is modified to diol-Px. In one embodiment, diol-Px is modified to diol-Pa. In various embodiments, unnatural bases having a diol group have enhanced affinity and / or specificity for DENV, DENV viral protein, DENV non-structural protein, DENV NS1 and / or serotype-specific DENV NS1 as compared to unnatural bases lacking a diol group or variants of natural bases. Thus, in some embodiments, the unnatural bases include a diol group.

[0109] In various embodiments, the aptamer may be bound / linked / conjugated to one or more molecules. In some examples, functional group modifications (e.g., amino, thiol, ethyl, diol, etc.) facilitate chemical conjugation (e.g., labeling, staining, reporter, carrier, fluorescence, solid support, drug, polyethylene glycol (PEG), cholesterol, albumin, or other substances, etc.) to molecules via a linker. In one example, amino modification using NH2-C6-dT is performed to introduce an amino reactive group to the aptamer to facilitate chemical conjugation. In some embodiments, the aptamer may be conjugated to a carrier molecule or a reporter molecule. The carrier molecule can bind to the aptamer so that the aptamer can obtain desirable properties. The reporter molecule can bind to the aptamer so that the aptamer can be detected. An example of the carrier molecule or the reporter molecule is biotin. In one example, the position of biotin-T in the GAA loop is acceptable for any of the natural bases (A, G, C, and T), so the thymidine in the mini-hairpin sequence CGCGAAGCG is used as a biotinylation site to generate a biotin conjugate sequence, CGCG(biotin-T)AGCG, that binds to the aptamer terminus. In some examples, biotin-TEG-T (including a tetraethylene glycol spacer arm) is used. In addition to biotinylated T, biotinylation can also be performed at the 5' end or the 3' end. In some examples, biotinylation facilitates immobilization to streptavidin. Alternative or additional carrier molecules or reporter molecules may also be conjugated to the aptamer. In various embodiments, the conjugation does not substantially reduce the affinity and / or specificity of the aptamer for DENV, DENV viral proteins, DENV non-structural proteins, DENV NS1, and / or serotype-specific DENV NS1.

[0110] Non-limiting examples of modifications / modifying agents include amino modifiers (e.g., amino modifier C6, amino modifier C12, amino modifier C6dT, Uni-link amino modifier, etc.), biotinylation (e.g., biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin, desthiobiotin-TEG, etc.), thiol modification (e.g., thiol modifier C3 S-S, dithiol, thiol modifier C6 S-S, etc.), alkyne modifiers (e.g., 5’ hexynyl), (e.g., 5’ hexynyl), 5-octadiynyl dU, etc.), acridite, adenylation, azide, azide (NHS ester), cholesterol-TEG, digoxigenin, digoxigenin (NHS ester), I-linker, fluorophore, and dark quencher (e.g., fluorescein, Cy, rhodamine dye, Alexa Fluor dye, ATTO dye, IRDye, FAM, 6-FAM, 6-FAM (NHS ester), 6-FAM (fluorescein), fluorescein dT, Cy3, TAMRA, JOE, JOE (NHS ester), MAX, MAX (NHS ester), TET, Cy5.5, ROX, ROX (NHS ester), TYE 563, Yakima Yellow, HEX, TEX 615, TYE 665, TYE 705, Texas Red-X, Texas Red-X (NHS ester), Lightcycler 640, Lightcycler 640 (NHS ester), Dy 750, Dy 750 (NHS ester), dark quencher, Iowa Black dark quencher, Iowa Black FQ, Iowa Black RQ, Black Hole Quencher-1, Black Hole Quencher-2, dabsyl, etc.), modification of modified bases (e.g., locked nucleic acid, 2’-O-methoxy-ethyl base (2’-MOE), 2’-O-methyl RNA base, fluorinated base, 2-aminopurine, 5-bromodU, deoxyuridine, 2,6-diaminopurine (2-amino-dA), dideoxy-C, deoxyinosine, hydroxymethyldC, inverted dT, iso-dG, iso-dC, inverted dideoxy-T, 5-methyldC, 5-nitroindole, etc.), phosphorylation modification, spacer modification (e.g., C3 spacer, hexanediol, 1’,2’-dideoxyribose (dSpacer), PC spacer, spacer 9, spacer 18, etc.), modification by click chemistry (e.g., (i) azide at the 5’ end, internal, or 3’ end, (ii) azide (NHS ester) at the 5’ end, internal, or 3’ end, (iii) 5’-terminal hexynyl, (iv) 5’-terminal, internal, or 3’-terminal 5-octadiynyl dU, (v) biotin at the 5’ end or internal, (vi) biotin (azide) at the 5’ end or internal, (vii) 6-FAM at the 5’ end or internal, (viii) 6-FAM (azide) at the 5’ end or internal, (ix) 5-TAMRA at the 5’ end or internal, (x) 5-TAMRA (azide) at the 5’ end or internal, etc.), modification of phosphorothioate bonds (e.g., phosphorothioated DNA bases, phosphorothioated RNA bases, phosphorothioated 2’-O-methyl bases, phosphorothioated Affinity Plus (locked nucleic acid) bases, etc.), and the like. Embodiments of the aptamer may have some inhibitory effects on DENV. Embodiments of the aptamer may also exhibit desirable pharmacological and / or pharmacokinetic properties (e.g., stability and / or low systemic clearance, etc.).,

[0111] In various embodiments, the aptamer is developed and selected by the SELEX method (Systematic Evolution of Ligands by EXponential enrichment), and optionally by the ExSELEX method (genetic alphabet Expansion for SELEX). In various embodiments, the aptamer recognizes and / or binds to a DENV protein, optionally a DEN-NS1 protein, having at least about 95%, at least about 95.5%, at least about 96%, at least about 96.1%, at least about 96.2%, at least about 96.3%, at least about 96.4%, at least about 96.5%, at least about 96.6%, at least about 96.7%, at least about 96.8%, at least about 96.9%, at least about 97%, at least about 97.1%, at least about 97.2%, at least about 97.3%, at least about 97.4%, at least about 97.5%, at least about 97.6%, at least about 97.7%, at least about 97.8%, at least about 97.9%, at least about 98%, at least about 98.1%, at least about 98.2%, at least about 98.3%, at least about 98.4%, at least about 98.5%, at least about 98.6%, at least about 98.7%, at least about 98.8%, at least about 98.9%, or at least about 99% sequence identity / homology to the DENV protein, optionally the DEN-NS1 protein, used in the selection in the SELEX or ExSELEX method.In various embodiments, the aptamer recognizes and / or binds to a DENV protein, optionally a DEN-NS1 protein, that is used in the selection in the SELEX or ExSELEX method and has a sequence identity / homology of about 95% or more, about 95.5% or more, about 96% or more, about 96.1% or more, about 96.2% or more, about 96.3% or more, about 96.4% or more, about 96.5% or more, about 96.6% or more, about 96.7% or more, about 96.8% or more, about 96.9% or more, about 97% or more, about 97.1% or more, about 97.2% or more, about 97.3% or more, about 97.4% or more, about 97.5% or more, about 97.6% or more, about 97.7% or more, about 97.8% or more, about 97.9% or more, about 98% or more, about 98.1% or more, about 98.2% or more, about 98.3% or more, about 98.4% or more, about 98.5% or more, about 98.6% or more, about 98.7% or more, about 98.8% or more, about 98.9% or more, or about 99% or more with the DENV protein, optionally the DEN-NS1 protein, used in the selection in the SELEX or ExSELEX method. In various embodiments, the aptamer recognizes and / or binds to a DENV protein, optionally a DEN-NS1 protein, that is used in the selection in the SELEX or ExSELEX method and has a difference of about 15 amino acids or less, about 14 amino acids or less, about 13 amino acids or less, about 12 amino acids or less, about 11 amino acids or less, about 10 amino acids or less, about 9 amino acids or less, about 8 amino acids or less, about 7 amino acids or less, about 6 amino acids or less, about 5 amino acids or less, about 4 amino acids or less, about 3 amino acids or less, about 2 amino acids or less, or about 1 amino acid or less from the DENV protein, optionally the DEN-NS1 protein, used in the selection in the SELEX or ExSELEX method. In some embodiments, the DENV protein, optionally the DEN-NS1 protein, used in the selection in the SELEX or ExSELEX method is: SEQ ID NO: 1 DSGCVINWKGRELKCGSGIFVTNEVHTWTEQYKFQADSPKRLSAAIGKAWEEGVCGIRSATRLENIMWKQISNELNHILLENDMKFTVVVGDVSGILAQGKKMIRPQPMEHKYSWKSWGKAKIIGADVQNTTFIIDGPNTPECPDNQRAWNIWEVEDYGFGIFTTNIWLKLRDSYTQVCDHRLMSAAIKDSKAVHADMGYWIESEKNETWKLARASFIEVKTCIWPKSHTLWSNGVLESEMIIPKIYGGPISQHNYRPGYFTQTAGPWHLGKLELDFDLCEGTTVVVDEHCGNRGPSLRTTTVTGKTIHEWCCRSCTLPPLRFKGEDGCWYGMEIRPVKEKEENLVKSMVSA; Sequence number 2 DSGCVVSWKNKELKCGSGIFITDNVHTWTEQYKFQPESPSKLASAIQKAHEEGICGIRSVTRLENLMWKQITPELNHILSENEVKLTIMTGDIKGIMQAGKRSLRPQPTELKYSWKTWGKAKMLSTESHNQTFLIDGPETAECPNTNRAWNSLEVEDYGFGVFTTNIWLKLKEKQDVFCDSKLMSAAIKDNRAVHADMGYWIESALNDTWKIEKASFIEVKNCHWPKSHTLWSNGVLESEMIIPKNLAGPVSQHNYRPGYHTQITGPWHLGKLEMDFDFCDGTTVVVTEDCGNRGPSLRTTTASGKLITEWCCRSCTLPPLRYRGEDGCWYGMEIRPLKEKEENLVNSLVTA; Sequence number 3 DMGCVINWKGKELKCGSGIFVTNEVHTWTEQYKFQADSPKRLATAIAGAWENGVCGIRSTTRMENLLWKQIANELNYILWENNIKLTVVVGDTLGVLEQGKRTLTPQPMELKYSWKTWGKAKIVTAETQNSSFIIDGPNTPECPSASRAWNVWEVEDYGFGVFTTNIWLKLREVYTQLCDHRLMSAAVKDERAVHADMGYWIESQKNGSWKLEKASLIEVKTCTWPKSHTLWTNGVLESDMIIPKSLAGPISQHNYRPGYHTQTAGPWHLGKLELDFNYCEGTTVVITESCGTRGPSLRTTTVSGKLIHEWCCRSCTLPPLRYMGEDGCWYGMEIRPISEKEENMVKSLVSA; Sequence number 4 DMGCVASWSGKELKCGSGIFVVDNVHTWTEQYKFQPESPARLASAILNAHKDGVCGIRSTTRLENVMWKQITNELNYVLWEGGHDLTVVAGDVKGVLTKGKRALTPPVSDLKYSWKTWGKAKIFTPEARNSTFLIDGPDTSECPNERRAWNSLEVEDYGFGMFTTNIWMKFREGSSEVCDHRLMSAAIKDQKAVHADMGYWIESSKNQTWQIEKASLIEVKTCLWPKTHTLWSNGVLESQMLIPKSYAGPFSQHNYRQGYATQTVGPWHLGKLEIDFGECPGTTVTIQEDCDHRGPSLRTTTASGKLVTQWCCRSCTMPPLRFLGEDGCWYGMEIRPLSEKEENMVKSQVTA; Sequence number 5: DSGCVINWKGRELKCGSGIFVTNEVHTWTEQYKFQADSPKRLSAAIGKAWEEGVCGIRSATRLENIMWKQISNELNHILLENDMKFTVVVGDANGILTQGKKMIRPQPMEHKYSWKSWGKAKIIGADTQNTTFIIDGPDTPECPDDQRAWNIWEVEDYGFGVFTTNIWLKLRDSYTQMCDHRLMSAAIKDSKAVHADMGYWIESEKNETWKLARASFIEVKTCIWPRSHTLWSNGVLESEMIIPKIYGGPISQHNYRPGYFTQTAGPWHLGKLELDFNLCEGTTVVVDEHCGNRGPSLRTTTVTGKIIHEWCCRSCTLPPLRFRGEDGCWYGMEIRPVKEKEENLVRSMVSA; SEQ ID NO: 6: DSGCVINWKGRELKCGSGIFVTNEVHTWTEQYKFQADSPKRLSAAIGKAWEEGVCGIRSATRLENIMWKQISNELNHILLENDMKFTVVVGDVAGILAQGKKMIRPQPMEHKYSWKSWGKAKIIGADVQNTTFIIDGPNTPECPDDQRAWNIWEVEDYGFGIFTTNIWLKLRDSYTQVCDHRLMSAAIKDSKAVHADMGYWIESEKNETWKLARASFIEVKTCIWPKSHTLWSNGVLESEMIIPKIYGGPISQHNYRPGYFTQTAGPWHLGKLELDFDLCEGTTVVVDEHCGNRGPSLRTTTVTGKIIHEWCCRSCTLPPLRFRGEDGCWYGMEIRPVKEKEENLVKSMVSA; Sequences comprising a histidine tag (e.g., HHHHHH or HHHHHHHHHH) at their C-terminus, sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity thereto, portions thereof, and, These combinations, comprise an array selected from the group consisting of.

[0112] In some embodiments, the DENV protein used in the selection in the SELEX or ExSELEX method, and optionally the DEN-NS1 protein, comprise a combination of sequences selected from SEQ ID NOs: 1, 2, 3, 4, and 5.

[0113] In some embodiments, thus, the aptamer can distinguish between DENV variants, and optionally between DEN-NS1 variants, within a single serotype. In one example, the aptamer can recognize and / or bind to a DEN-NS1 protein having 96.3% or more sequence identity / homology with the DEN-NS1 protein used in the selection in the SELEX or ExSELEX method, but cannot recognize / bind to a DEN-NS1 variant of the same serotype that has lower sequence identity / homology. In one example, the aptamer can recognize and / or bind to a DEN-NS1 protein having 96.3% or more sequence identity / homology with SEQ ID NO: 1, but cannot recognize / bind to a DEN-NS1 variant that has lower sequence identity / homology. In one example, the aptamer can recognize and / or bind to a DEN-NS1 protein having 98.9% or more sequence identity / homology with SEQ ID NO: 1, or the DEN-NS1 protein of SEQ ID NO: 6.

[0114] In various embodiments, a mixture / combination of aptamers specific for different serotypes is provided, the mixture comprising at least two, at least three, or at least four aptamers. For example, the mixture / combination may comprise an aptamer specific for DEN1, an aptamer specific for DEN2, an aptamer specific for DEN3, and an aptamer specific for DEN4. For example, the mixture / combination may comprise any three of: an aptamer specific for DEN1, an aptamer specific for DEN2, an aptamer specific for DEN3, and an aptamer specific for DEN4. For example, the mixture / combination may comprise any two of: an aptamer specific for DEN1, an aptamer specific for DEN2, an aptamer specific for DEN3, and an aptamer specific for DEN4. In some embodiments, the mixture / combination of aptamers is: SEQ ID NO: 11 (CCCCAGACGGACTGGTGTxCTCGGxATGGCCGTCTGGGGCGCGLAGCG), SEQ ID NO: 12 (GGCTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGACAAGCGGACCAGCCCGCGLAGCG), SEQ ID NO: 13 (CCGCTTGTCATCTAxCCTGGCCxTGTGGTACTGTAACGGCTGACAAGCGGCGCGLAGCG), SEQ ID NO: 14 (CGGCGGAGACGTAACGCxTATCAAATCxAAACAGCTTAGGGTCCGCCGCGCGLAGCG), SEQ ID NO: 15 (ITTTCGCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxACGAAGACAGACAAGCGGAGTAGTTAGACCGTGAAA), and SEQ ID NO: 16 (GCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxACGAAGACAGACAAGCGGAGTGTCGCGLAGCG), may include one or more of.

[0115] In various embodiments, the mixture / combination of aptamers enables detection of minor amino acid sequence variations between dengue NS1 variants beyond serotype identification.

[0116] Embodiments of the aptamer or mixture may be used for detection of the presence of DENV, DENV viral proteins, DENV non-structural proteins, DENV NS1 and / or serotype-specific DENV NS1. Embodiments of the aptamer or mixture may be used for detection of the presence of DENV, DENV viral proteins, DENV non-structural proteins, NS1 of a specific serotype of DENV.

[0117] In various embodiments, a method for confirming DENV infection in a subject is provided, the method comprising contacting a subject sample with the aptamer or a mixture of aptamers. In some embodiments, the method further comprises detecting a binding event of the aptamer. In various embodiments, thus, a method for confirming DENV infection in a subject is provided, the method comprising: contacting a subject sample with the aptamer or a mixture of aptamers, and detecting a binding event of the aptamer. The method may be a method for confirming current DENV infection, a method for confirming past DENV infection, and / or a method for confirming characteristics / properties of DENV infection (e.g., whether it is a primary, secondary, or further infection, serotype identification, disease load, etc.).

[0118] In various embodiments, the method may be performed in the form of a binding assay. In various embodiments, the method may be in the form of a "sandwich" assay, where a first binder or capture agent (e.g., an aptamer) is utilized to capture a target analyte (e.g., a DENV protein), and a second binder or detection agent (e.g., an anti-DENV antibody) is used to detect the captured target analyte. Examples of such assays include enzyme immunoassay (EIA) / enzyme-linked immunosorbent assay (ELISA), enzyme-linked aptamer assay (ELAA) / enzyme-linked oligonucleotide assay (ELONA), radioimmunoassay (radioimmunoassay (RIA)), strip assay, lateral flow assay (LFA), biolayer interferometry (BLI), detection by surface plasmon resonance (SPR), colorimetric change using gold nanoparticle aggregates, voltammetry, and electrochemical techniques, among others. The suitability of the particular assay used is within the skill of the art. In some embodiments, the aptamer is immobilized on a solid support, along with an anti-DENV antibody that is used as a detection agent as needed. In some embodiments, the aptamer is used as a detection agent, along with an anti-DENV antibody that is immobilized on a solid support as needed. In some embodiments, therefore, the detection step comprises adding a detection agent to detect a binding event in the aptamer.

[0119] In various embodiments, the method includes an ELISA method, but is not limited to, for example, direct ELISA, indirect ELISA, competitive ELISA, sandwich ELISA, etc. In some embodiments, the method includes a sandwich ELISA method. The sandwich ELISA method may be competitive or non-competitive. In some examples, the aptamer may be labeled, for example, with biotin to capture any DENV protein and may be bound to a solid phase such as beads, the surface of a well or other receptacle, a chip or a strip, etc., and an antibody to the DENV protein is used to detect any captured DENV protein. In some examples, an antibody to a first DENV protein is used as a primary detection agent, and a second antibody to the first antibody is used as a secondary detection agent. The detection agent may be labeled, for example, with a stain, a radioisotope, or a reactive or catalytically active moiety. In one example, the detection agent is labeled with horseradish peroxidase (HRP), and a tetramethylbenzidine (TMB) substrate may be added for visualization. It is understood that other suitable labels and substrates may be used. In some embodiments, a plate coated with streptavidin (e.g., a microplate, a microtiter plate, etc.) is used to immobilize a biotin-labeled aptamer for capturing DENV protein, and a labeled detection agent (or a primary detection agent and a labeled secondary detection agent) is used for detection. The detection agent may be an anti-immunoglobulin antibody such as anti-IgG (e.g., IgG1, IgG2, IgG3 or IgG4), anti-IgM antibody, or anti-IgA antibody. In some examples, the anti-immunoglobulin antibody includes anti-human IgM, anti-goat IgG, anti-rabbit IgG, and / or anti-mouse IgG. When the primary detection agent is labeled with biotin, the secondary detection agent may be an anti-biotin antibody or streptavidin.

[0120] In some embodiments, any binding event of the aptamer indicates current DENV infection in a subject. In some examples, the binding event is indicated by a chemiluminescent or colorimetric signal / readout / output, for example, the discoloration result of TMB by HRP. When the aptamer is specific for or specifically binds to a single DENV serotype, in some embodiments, the binding event indicates current DENV infection of that serotype in the subject. For example, when the aptamer is specific for DEN1, detection of the binding event of the aptamer when the aptamer contacts a subject sample (e.g., observation of the colorimetric signal output in the HRP-TMB system) indicates that the subject sample contains DEN1-protein, and thus indicates that the subject is currently infected with DEN1. In this example, the DEN1-specific aptamer immobilized on the solid support captures the DEN1-protein in the subject sample when it contacts the subject sample. Subsequently, when a detection agent for the DEN1-protein is added, it binds to the captured DEN1-protein. The detection agent outputs a colorimetric signal, thereby indicating the presence of the captured DEN1-protein, and thus indicating that the subject is infected with DEN1. In some embodiments, therefore, when the method is a method for confirming current DENV infection in a subject, any binding event in the aptamer indicates current DENV infection in the subject, and optionally, here the bound aptamer is specific for a single DENV serotype and the binding event indicates current DENV infection of that serotype in the subject.

[0121] Although not bound by theory, viral - related substances such as envelope proteins and non - structural protein 1 (NS1) are thought to be detectable somewhere during the febrile period or the initial stage of dengue virus. Thus, in some embodiments, the binding event indicates a current DENV infection during the febrile period or the initial stage. In some embodiments, the method is performed within one week after fever in a subject or during the febrile period or the initial stage of DENV infection.

[0122] In one example, the method includes a non - competitive binding assay. In one example, the method includes a non - competitive ELISA assay. In one example, the method includes direct detection of DENV proteins, and optionally DENV - NS1 proteins, in a sample.

[0123] In some embodiments, when the subject is indicated to have a current DENV infection, the method further includes contacting a sample of the subject with an aptamer or a mixture of aptamers in the presence of DENV proteins and detecting a binding event in the aptamer. In some embodiments, the sample is before incubation with DENV proteins and then contacts the aptamer or the mixture of aptamers.

[0124] Although not bound by theory, DENV antigen-binding proteins, such as anti-DENV IgG, are thought to be produced in a subject's body in response to DENV infection. Serotype-specific DENV antigen-binding proteins may become detectable several days after onset, for example, one week after fever, and may remain detectable even after recovery. Thus, detection of serotype-specific DENV antigen-binding proteins in a subject's sample during the early stage or febrile period of current DENV infection (e.g., within one week of onset) may indicate that the subject has been previously infected with DENV. Although not bound by theory, it is further thought that some of the DENV antigen-binding proteins produced, such as the anti-DENV IgG produced, are serotype-specific. For example, the DENV antigen-binding proteins produced in response to DEN1 infection are thought to be different from the DENV antigen-binding proteins produced in response to DEN2, DEN3, or DEN4 infection. Also, the DENV antigen-binding proteins produced in response to DEN1 infection recognize and / or bind only to DEN1 proteins, such as the DEN1-NS1 protein, and do not recognize and / or bind, or hardly recognize and / or bind, other proteins belonging to different serotypes of DENV, such as the DEN2-NS1 protein, the DEN3-NS1 protein, and the DEN4-NS1 protein.

[0125] Although not bound by theory, IgG production continues throughout life after DENV infection, and thus detection of IgG can confirm past infection. Thus, in various embodiments, the method includes detecting the presence of anti-DENV IgG in a subject sample.

[0126] In the example of 1, if a subject shows a current DEN1 infection, a second sample that could be the same as the previous sample is taken from the subject and contacted with aptamers specific for DEN2, DEN3, and / or DEN4 in the presence of DEN2-NS1, DEN3-NS1, and DEN4-NS1 proteins to determine whether the subject has not been previously infected with DEN2, DEN3, and / or DEN4. The DEN2-NS1, DEN3-NS1, and DEN4-NS1 proteins typically bind to DEN2-specific aptamers, DEN3-specific aptamers, and DEN4-specific aptamers, respectively. However, anti-DEN2-NS1 IgG, anti-DEN3-NS1 IgG, and / or anti-DEN4-NS1 IgG present in the sample can each bind to the DEN2-NS1, DEN3-NS1, and / or DEN4-NS1 proteins, thus inhibiting the binding of the DEN2-NS1, DEN3-NS1, and / or DEN4-NS1 proteins to their respective DEN2-specific aptamers, DEN3-specific aptamers, and DEN4-specific aptamers. Therefore, the absence of a binding event in any of the DEN2-specific aptamer, DEN3-specific aptamer, and DEN4-specific aptamer may indicate that the subject has anti-DEN2-NS1 IgG, anti-DEN3-NS1 IgG, and / or anti-DEN4-NS1 IgG in his / her body, and thus indicates that the subject has been previously infected with DEN2, DEN3, and / or DEN4. In some examples, the binding event in the aptamer may be measured by a signal / output / readout, such as a colorimetric analysis signal / output / readout. In some examples, the difference in intensity in the signal / output / readout associated with different aptamers provides an indication of the expected serotype of previous infection in the sample.

[0127] In various embodiments, therefore, the absence of a binding event in any of the aptamers indicates that the subject has had a past / primary DENV infection. In various embodiments, the absence of a binding event in any of the aptamers in a sample in which a current infection has been confirmed by other means indicates that the current DENV infection is a secondary or greater DENV infection.

[0128] In various embodiments, therefore, when a subject is indicated as having a current DENV infection, the method further comprises contacting a sample of the subject with an aptamer or a mixture of aptamers in the presence of DENV protein and detecting a binding event in the aptamer, wherein the absence of a binding event with any of the aptamers indicates that the current DENV infection is a secondary or greater DENV infection, and wherein an unbound aptamer that is specific for a DENV serotype and the absence of a binding event may indicate a past DENV infection of that serotype in the subject.

[0129] In various embodiments, the contacting step comprises contacting a sample of the subject with a mixture of aptamers in the presence of a predetermined amount / volume / concentration of DENV protein. An output / readout indicating the binding activity between each amount / each volume / each concentration of the sample and the DENV protein, e.g., a colorimetric readout, may be measured. The output / readout (which can be converted to a numerical value) can be plotted against the amount / volume / concentration of the sample to obtain a graph. Points on the graph (e.g., the amount / volume / concentration of the sample required to output a certain output / readout) can also be used as a basis for comparison across the results for each aptamer of the mixture of aptamers to obtain the relative binding activity of the sample to each aptamer of the mixture of aptamers. In some embodiments, the relative binding activity includes the relative IgG activity of the sample.

[0130] As can be understood, secondary or subsequent DENV infections of a serotype different from that of the primary infection can be more severe. For example, secondary DENV infection is the greatest risk factor for severe diseases such as dengue hemorrhagic fever and dengue shock syndrome. Without being bound by theory, antibody-dependent enhancement (ADE) can contribute to severe dengue fever. Embodiments of methods that enable determination of whether a current DENV infection is secondary or subsequent can advantageously facilitate clinical and therapeutic decisions. For example, subjects shown to be suffering from secondary DENV infection can be more closely monitored for the onset of severe dengue fever. Early treatment can be provided to the subject if necessary, thereby reducing the risk of progression to severe disease or death.

[0131] In an example of 1, the method includes a competitive binding assay. In an example of 1, the method includes a competitive ELISA. In an example of 1, the method includes detection of a competitive DENV antigen-binding protein, optionally detection of competitive anti-DENV IgG, and further optionally detection of competitive anti-DENV-NS1 IgG.

[0132] In various embodiments, different serotype-specific aptamers may be disposed or immobilized on different supports or on the same support. For example, each serotype-specific aptamer may be separately immobilized (e.g., in different wells) on a support as a capture agent. For example, four different serotype-specific aptamers may be immobilized (e.g., in the same well) on the same solid support as a capture agent. In the latter example, different detection systems, e.g., different colorimetric detection systems, may be used to discriminate binding events in different serotype-specific aptamers. The four different serotype-specific aptamers can also be disposed in different / separate / non-overlapping spatial regions in a single solid support (e.g., in a lateral flow assay) to discriminate binding events in the different serotype-specific aptamers.

[0133] In various embodiments, the method further includes administering a dengue virus treatment plan to a subject when the subject is shown to have a current DENV infection.

[0134] In various embodiments, the method further comprises the step of creating a nucleic acid library, optionally a DNA library, a nucleic acid or DNA containing at least one unnatural base. In various embodiments, the method further comprises performing SELEX or ExSELEX on the nucleic acid to select candidate nucleic acids or candidate DNAs having high affinity for DENV protein and optionally DEN-NS1 protein, and then recovering / isolating any DENV-nucleic acid complex (or DENV-DNA complex), optionally DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex). In some examples, enrichment may be observed from the differences in the population of sequences before and after isolation of the DENV-nucleic acid complex (or DENV-DNA complex), optionally any DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex). In various embodiments, the recovering / isolating step comprises capturing the DENV-nucleic acid complex (or DENV-DNA complex), optionally DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex) with an anti-DENV antibody, optionally an anti-DEN-NS1 antibody, or by an affinity tag (e.g., His tag) in the protein. Any unbound nucleic acid or DNA is washed away. The candidate nucleic acid or candidate DNA may be isolated from the complex to obtain an aptamer, or more than one round of selection by SELEX or ExSELEX may be performed. An amplification step, e.g., PCR amplification, may be performed to amplify the candidate nucleic acid or candidate DNA before or at the end of more than one round of selection. In some examples, SELEX is performed at least about 1 time, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 11 times, at least about 12 times, at least about 13 times, at least about 14 times, or at least about 15 times.

[0135] Embodiments of the method based on the binding of DENV antigen-binding proteins in a subject sample may be performed alone, independent of the next step of detecting DENV proteins in the sample, and embodiments of a method that can determine whether a subject has had a past DENV infection, even if the subject is not currently suffering from and is not suspected of having a current DENV infection, may be useful. For example, the immune history may be useful for understanding subsequent disease risks and prevention, as well as the subject's suitability for DENV vaccines.

[0136] In various embodiments, thus, the method is a method for determining past DENV infection in a subject, the contacting step is performed in the presence of DENV protein, and the absence of a binding event in any of the aptamers indicates past DENV infection in the subject. Optionally, the unbound aptamer is specific for a certain DENV serotype, and the absence of a binding event indicates past DENV infection of that serotype in the subject.

[0137] In various embodiments, thus, a method for assessing a subject's suitability for a DENV vaccine is provided, the method comprising: contacting a subject sample with an aptamer or a mixture of aptamers in the presence of DENV protein, detecting a binding event in the aptamer, determining the subject's immune history based on the binding event of the aptamer, and determining the subject's suitability for a DENV vaccine based on the immune history. In various embodiments, the absence of a binding event in any of the aptamers indicates past DENV infection in the subject.

[0138] As can be appreciated, some dengue vaccines have been shown to pose a higher risk of more severe symptoms in vaccinated subjects subsequently infected with DENV. Thus, it is recommended that the vaccine be used only in subjects previously infected with DENV. Advantageously, therefore, embodiments of the method that can demonstrate the DENV immune history of a subject, such as whether the human has had past DENV infections, the number of past DENV infections, and the serotype of the past DENV infections, are useful for determining the suitability of the human for DENV vaccination. For example, if a subject is determined to have no past DENV infections, the subject cannot be a suitable candidate for a DENV vaccine that is only recommended for people previously infected with DENV.

[0139] In various embodiments, the sample comprises a biological sample. In various embodiments, the biological sample comprises a biological sample that is a fluid or a liquid biological sample. The biological sample that is a fluid or a liquid biological sample may be blood, serum, plasma, sputum, washings, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like. In some embodiments, the biological sample that is a fluid or a liquid biological sample comprises whole blood, serum, plasma, or processed fractions thereof. In some embodiments, the biological sample that is a fluid comprises serum or plasma. In some embodiments, the biological sample that is a fluid comprises an antigen-binding protein such as an antibody.

[0140] In various embodiments, the sample comprises a sample taken from a patient during the acute or febrile phase (from about 2 days to about 7 days post illness onset (pio)), early convalescent phase (from about 10 days to about 14 days post illness onset), late convalescent phase (about 1 month post illness onset), early recovery phase (about 3 months post illness onset), late recovery phase (from about 5 months to about 6 months post illness onset) or complete recovery phase (about 1 year post illness onset). In some embodiments, the sample is taken from a patient when in the early stage of DENV infection (within about 1 week post illness onset). In some embodiments, the sample is taken from a patient when in the early stage (within about 1 week post illness onset) of DENV infection. The sample is taken from a patient when in the late stage (after about 1 week post illness onset) of DENV infection. In some embodiments, the sample is taken from a patient showing symptoms associated with DENV infection, such as fever (typically high fever), headache, muscle, bone, and joint pain, nausea, vomiting, pain behind the eyes, gland swelling, rash, severe abdominal pain, persistent vomiting, bleeding from the gums or nose, blood in urine, feces or vomit, subcutaneous bleeding, difficulty breathing or rapid breathing, cold or clammy skin (shock), fatigue, and feelings of irritability or restlessness. In some embodiments, the sample is taken from a patient who is asymptomatic or has become asymptomatic with respect to DENV infection. In some embodiments, the sample is taken from a patient after recovering from DENV infection.

[0141] In various embodiments, the method includes a diagnostic method. For example, in a method of directly detecting a DENV protein, the binding event in the aptamer can be an indicator of DENV infection in a subject.

[0142] In various embodiments, the method includes a prediction method. In some examples (see, e.g., FIG. 13), evaluation of clinical samples showed that DENV proteins were detectable by embodiments of a direct DENV protein detection method in the early stages of infection (e.g., 3 - 6 days after onset), while IgG was not detectable by embodiments of a competitive anti-DENV IgG detection method. However, in later stages of infection (e.g., 20 days after onset), DENV proteins were no longer detectable by embodiments of a direct DENV protein detection method, while IgG could be detected by embodiments of a competitive anti-DENV IgG detection method. Thus, embodiments of the method may be used to measure the production / generation of IgG, and optionally specific IgG, in a subject and to confirm appropriate production / generation of IgG by the acquired immune system. Embodiments of the method are thus useful for prediction. In some examples, an aptamer binding amount in a sample that is decreased compared to the aptamer binding amount in an earlier sample (e.g., a sample taken from the same subject at an earlier time point) can be an indicator for predicting DENV infection in a subject.

[0143] In various embodiments, the method has high sensitivity and / or specificity. In various embodiments, the method has a sensitivity of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 100%.

[0144] In various embodiments, the method has a specificity of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 100%.

[0145] In various embodiments, the method includes an in vitro or ex vivo method.

[0146] In various embodiments, a kit for confirming DENV infection in a subject is provided, the kit including an aptamer or a mixture of aptamers. In some embodiments, the aptamer or mixture of aptamers is provided in the form of a plate coated with the aptamer or mixture of aptamers for capturing DENV protein. In some embodiments, the kit further includes DENV protein, and optionally DENV-NS1 protein. In some embodiments, the kit includes a detection agent and / or a capture agent.

[0147] The kit may be a diagnostic kit or a predictive kit. In various embodiments, the subject includes mammals. In various embodiments, the subject includes human patients.

[0148] In various embodiments, provided are nucleic acid molecules comprising the sequences set forth in Table 1, or sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity thereto, or sequences that differ from them by about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24 or about 25 bases or nucleotides, or portions thereof, optionally including linear portions thereof. In some embodiments, the aptamer has a sequence that differs from the sequences set forth in Table 1 by about 1 or more, about 2 or more, about 3 or more, about 4 or more, about 5 or more, about 6 or more, about 7 or more, about 8 or more, about 9 or more, about 10 or more, about 11 or more, about 12 or more, about 13 or more, about 14 or more, about 15 or more, about 16 or more, about 17 or more, about 18 or more, about 19 or more, about 20 or more, about 21 or more, about 22 or more, about 23 or more, about 24 or more, about 25 or more bases or nucleotides, or a portion of the sequences set forth in Table 1, optionally including the linear portion of the sequences set forth in Table 1.

[0149] In some embodiments, the nucleic acid molecule comprises the sequence set forth in Table 1 or a sequence having at least 75% sequence identity thereto, or a sequence that differs from the sequence set forth in Table 1 by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases, or a portion of the sequence set forth in Table 1.

[0150] In various embodiments, methods for producing the nucleic acid molecule or aptamer are provided. In various embodiments, the method includes a chemical synthesis method. In various embodiments, the method includes an oligonucleotide synthesis method. In various embodiments, the method includes a phosphoramidite method of oligonucleotide synthesis. The synthesis may be a liquid phase synthesis or a solid phase synthesis. In some embodiments, the synthesis includes a solid phase synthesis. Other suitable methods for synthesizing nucleic acid molecules or aptamers or oligonucleotides may be used. For example, the method may include an H-phosphonate method and / or a phosphotriester method of oligonucleotide synthesis.

[0151] In various embodiments, the method may include incorporating one or more modifications into the nucleic acid molecule or aptamer. The incorporation can be performed, for example, during and / or after the synthesis of the oligonucleotide.

[0152] In various embodiments, methods, kits, or nucleic acid molecules as described herein are provided.

[0153]

Table 11-1

[0154]

Table 11-2

[0155]

Table 11-3

[0156]

Table 11-4

Examples

[0157] The embodiments of the examples of the present disclosure will be better understood and will become readily apparent to those skilled in the art by the following discussion and, if necessary, in conjunction with the figures. It should be understood that other changes related to structural, electrical, and optical changes can be made without departing from the scope of the present invention. The embodiments in the examples are not necessarily mutually exclusive, as some can be combined with one or more embodiments to form new exemplary embodiments.

[0158] Generation of UB-DNA aptamers targeting each DEN-NS1 serotype The ExSELEX method was performed three times to generate Ds-containing DNA aptamers targeting each DEN-NS1 serotype (Table E1). 33-35,38 。

[0159]

Table 12

[0160] ExSELEX was performed as follows targeting each recombinant DEN-NS1 serotype protein: In the column of the PCR cycle, DEN1-NS1 (D1), DEN2-NS1 (D2), DEN3-NS1 (D3), and DEN4-NS1 (D4). To enhance the stringency of the selection conditions, human serum (HS) was added to the binding buffer (additive), and urea was added to the washing buffer in later rounds.

[0161] Four DEN-NS1 serotypes were purchased from The Native Antigen Company (Oxford, UK). In the ExSELEX method, K of 27 - 107 pM DA selection method using an anti-DEN-NS1 monoclonal antibody (Ab#D06) that binds to all four serotypes of DEN-NS1 with a value was used (Figure 1). The Ds-containing DNA library was mixed with each DEN-NS1 serotype, and then the NS1-DNA complex was captured with Ab#D06 immobilized on the plate. Unbound DNA molecular species were washed away from the plate, and the DNA molecular species bound on the plate were isolated and amplified by PCR for subsequent rounds of selection.

[0162] After 7 to 10 rounds of selection, a concentrated DNA library was obtained, and its high specificity for each DEN-NS1 serotype was confirmed by a gel shift assay (EMSA) (Figure 2). High Ds-dependence was also confirmed by EMSA using a library variant of Ds→natural base mutation 39 and no complex that could be clearly recognized with any DEN-NS1 protein was formed (Figure 2). The sequences in the concentrated DNA library (Figures 3 to 6) were determined by a sequencing method 34,39 and several candidate aptamers for each serotype were selected from this (Table E2).

[0163]

Table 13

[0164] In Table E2, the oligonucleotide sequences used for the binding analysis to each target DEN-NS1 are summarized together with the results of gel shift assay (EMSA) and surface plasmon resonance (SPR) analysis. Additional complementary sequences forming the stem are underlined. Oligonucleotides containing the mini-hairpin sequence CGCG-(biotin-T)-AGCG at the 3'-end have an additional "h" in the aptamer candidate name. In the SPR analysis with 20 nM of each dengue NS1 protein, "specific" means that the oligonucleotide binds only to the DEN-NS1 of the target serotype and does not bind to DEN-NS1 of other serotypes, and "low specificity" means that the oligonucleotide binds not only to the NS1 of the target serotype but also to a part of NS1 proteins of other serotypes. The chemical structures of the unnatural bases diol-Px (Px) and diol-Pa (Pa) referred to in the table are shown below.

[0165] [Chemical formula]

[0166] Most of the sequences contain complementary motifs in the 5'- and 3'-regions, and thus the complementary motifs were trimmed to form a distinct stem structure. To enhance the thermal and enzymatic stability of the aptamer candidates, a specific biotin-binding DNA sequence (mini-hairpin DNA) 40-42 , CGCG(biotin-T)AGCG, was added to their 3'-ends 38,43,44 (Figure 7a). The aptamer candidates and their variants were chemically synthesized for further experiments.

[0167] In a notable case, it was related to some candidates obtained by ExSELEX targeting DEN2-NS1. One of the sequence families (D2-1) that showed the highest affinity for DEN2-NS1 contained two Ds and one Px base (see Figure 8 and the sequencing method for the Px base). The additional Px in the aptamer was due to ExSELEX34 This is due to the mutation of natural bases to Px during PCR amplification in the method. Since Px nucleosides are decomposed in a basic synthetic environment, DNA fragments containing Px cannot be chemically synthesized. The instability of this Px nucleoside is due to the combination of a nitro group and the pyrrole ring of Px, and thus the nitro group is substituted with an aldehyde group (Pa, pyrrole-2-carbaldehyde) 45 (Figure 1 and Table E2). The amidite derivatives of Pa nucleosides conjugated with diols were newly synthesized in the chemical synthesis of DNA, and several D2-1 variants containing Ds and Pa were synthesized by the ordinary phosphoramidite method. The variants of the Px→Pa aptamer still retained high affinity and specificity for DEN2-NS1. This may be attributed to the similarity of these two unnatural bases. Another similarity is that both of these unnatural bases contain a diol group. Finally, AptD2 (D2-1d-72h), which contains two Ds and one Pa base, was developed as a binder for DEN2-NS1. When the Ds base at the 11th position (or the 2801st position as shown in Figure 28) was substituted with a natural alanine base, the aptamer was able to maintain high affinity and specificity for DEN2-NS1. However, when the Ds base at the 23rd position (or the 2803rd position as shown in Figure 28) was substituted with a natural alanine base, the high affinity and specificity of the aptamer for DEN2-NS1 were lost. Similarly, when the diol-Pa / diol-Px at the 35th position was substituted with a natural thymine base, a loss of binding ability was observed (Figure 28). In some cases, a loss of binding ability was also observed when the diol-Pa / diol-Px was substituted with a DS base (see, for example, Table E2). Therefore, the Ds base at the 23rd position and the diol-Pa / diol-Px at the 35th position contribute to the binding affinity of the aptamer for DEN2-NS1. This result also suggests that mutation of the base at the 11th position or substitution of the Ds base at the 11th position is acceptable. 46,47 (Figure 1 and Table E2). The amidite derivatives of Pa nucleosides conjugated with diols were newly synthesized in the chemical synthesis of DNA, and several D2-1 variants containing Ds and Pa were synthesized by the ordinary phosphoramidite method. The variants of the Px→Pa aptamer still retained high affinity and specificity for DEN2-NS1. This may be attributed to the similarity of these two unnatural bases. Another similarity is that both of these unnatural bases contain a diol group. Finally, AptD2 (D2-1d-72h), which contains two Ds and one Pa base, was developed as a binder for DEN2-NS1. When the Ds base at the 11th position (or the 2801st position as shown in Figure 28) was substituted with a natural alanine base, the aptamer was able to maintain high affinity and specificity for DEN2-NS1. However, when the Ds base at the 23rd position (or the 2803rd position as shown in Figure 28) was substituted with a natural alanine base, the high affinity and specificity of the aptamer for DEN2-NS1 were lost. Similarly, when the diol-Pa / diol-Px at the 35th position was substituted with a natural thymine base, a loss of binding ability was observed (Figure 28). In some cases, a loss of binding ability was also observed when the diol-Pa / diol-Px was substituted with a DS base (see, for example, Table E2). Therefore, the Ds base at the 23rd position and the diol-Pa / diol-Px at the 35th position contribute to the binding affinity of the aptamer for DEN2-NS1. This result also suggests that mutation of the base at the 11th position or substitution of the Ds base at the 11th position is acceptable.

[0168] The sequences of each aptamer were completed by adding a mini-hairpin sequence conjugated with biotin at their 3'-ends (AptD1 (D1-1-48h) for DEN1-NS1, AptD2 (D2-1d-72h) for DEN2-NS1, AptD3 (D3-2-59h) for DEN3-NS1, and AptD4 (D4-3-57h) for DEN4-NS1) (Figure 7a). The high specificity of each aptamer for its serotype-specific DEN-NS1 was confirmed by EMSA and surface plasmon resonance (SPR) analysis (Figures 9, 10). Variants of natural bases substituted by natural bases showed a significant decrease in affinity for their targets, indicating the necessity of these UBs for the binding ability of the aptamer. The K D values of AptD1, AptD2, AptD3, and AptD4 for their respective targets were 182, 104, 57, and 30 pM, respectively.

[0169] The detection of each DEN-NS1 serotype was confirmed by a sandwich ELISA method using Ab#D06 antibody as the primary detector and aptamer as the capturer (Figure 7b). The signal was detected as a colorimetric output using an HRP-conjugated anti-IgG secondary antibody. Each aptamer successfully detected its target DEN-NS1 serotype, and no cross-reaction with non-target DEN-NS1 serotypes or dengue NS1 protein was observed. The limit of detection (LOD) in the buffer was 1.19 - 2.36 ng / ml per DEN-NS1 (Figure 11).

[0170] Detection of serotype-specific DEN-NS1 in patient samples Using blood samples from 11 Singaporean patients infected with acute DENV (PD1-1 to PD4-1), the sensitivity and specificity of an ELISA assay for detecting each DEN-NS1 serotype were evaluated (Figures 12b and 13). The serotype of the current infection in each patient was also determined by RT-qPCR and sequencing (Figure 13). The ELISA assay detected each DEN-NS1 serotype in the serum samples of PD1-1, PD2-1, PD3-1, PD3-2, PD3-3, and PD4-1. However, the ELISA assay using the antibody-antibody sandwich pair (Ab#D06 and Ab#D25 (K D values of 1.6 - 138 pM against DEN-NS1.)), and the commercially available LFA system (SD BIOLINE), were unable to detect PD1-2, PD1-3, PD2-2, PD2-3 and PD3-4, despite detecting DEN-NS1 in all samples except PD3-4 (described below), which was not detected by the antibody-antibody pair.

[0171] The false-negative results in PD1-2, PD1-3, PD2-2, and PD2-3 were caused by slight amino acid differences between DEN-NS1 in the samples and the DEN-NS1 purchased from The Native Antigen Company, which was used as the target for aptamer generation. When the amino acid sequence of DEN-NS1 in patient samples was determined and compared with the target NS1 protein, many amino acid substitutions were found (Figure 14). The sequence data revealed that the aptamer could specifically bind to those with at least 96.9% amino acid sequence identity to the target DEN-NS1. The detection of DEN1-NS1 and DEN2-NS1 clearly demonstrated the relationship between homology and aptamer affinity. In the ELISA detection using AptD1, the DEN1-NS1 of PD1-1 had 98.9% homology with the DEN1-NS1 of The Native Antigen Company. Conversely, PD1-2 and PD1-3 had 96.3% homology with theirs from The Native Antigen Company and were not detected by AptD1. Similarly, the homologies of DEN2-NS1 in PD2-1, PD2-2, and PD2-3 were 98.0, 96.6, and 96.6%, respectively, and AptD2 detected only the PD2-1 sample. For DEN3-NS1 and DEN4-NS1, the homology was 96.9 - 98.9%, and AptD3 and AptD4 bound to DEN-NS1, respectively.

[0172] Serotype-specific detection of anti-DEN-NS1 IgG antibodies in patient samples The use of the ELISA method was found to be also applicable for the detection of serotype-specific anti-NS1 IgG antibodies in the patient's serum samples. When testing the specificity of the aptamer-antibody pair ELISA for DEN-NS1 detection in the presence of human sera purchased from Sigma-Aldrich, the detection was significantly inhibited (Figure 15B) compared to that in buffer (Figure 15a). One reasonable cause is the presence of anti-DEN-NS1 IgG antibodies in the serum that inhibit the binding of the aptamer to additional NS1 proteins. To prove this contamination theory, it was confirmed that the inhibition did not occur in the treated serum in which all IgG antibodies were removed from the serum by treatment with protein A immobilized resin (Figure 15c). To confirm whether the serum inhibits the detection, at that time, an ELISA was also performed using serum samples from Singaporeans who were not infected with dengue fever. Interestingly, the serum showed a certain degree of serotype-specific inhibition in the detection of DEN2-NS1, similar to DEN1-NS1 (Figure 15d), suggesting that the person may have been previously infected with dengue serotype 2 and / or serotype 1 virus. From this, two other serum samples were obtained in a country where dengue fever was not widespread and ELISA was performed. As expected, the two serum samples did not inhibit the detection of DEN-NS1 in the ELISA method (Figures 15e and 15f). These results suggested to the inventors a new method (Figure 12c) for the serotype-specific detection of anti-DEN-NS1 IgG antibodies in human serum samples, as well as for the direct detection of DEN-NS1 (Figure 12b).

[0173] For serotype-specific IgG detection, a simple quantification method for anti-DEN-NS1 IgG was developed (Figure 16). For this purpose, competitive inhibition ELISA was performed using a series of different volumes (0.05, 0.1, 0.2, 0.5, and 5 μl) of patient sera in the presence of a specific amount of DEN-NS1 of each serotype (The Native Antigen Company). After measurement of the absorbance at 450 nm (OD 450 ) in the ELISA method, OD450 The values were plotted against the serum volume, and the OD 450 value at which the serum volume becomes 1.0 was calculated. The relative IgG activity was then defined by the following formula: Activity = 5 / (the serum volume at which the OD 450 value becomes 1.0).

[0174] Using a competitive ELISA method and quantification method, longitudinal changes in IgG production and serotype specificity in patient samples were measured (Figure 13). Even one year after the patient recovered, IgG antibodies could be detected (PD2-3, PD3-1, and PD3-3). Furthermore, the method clearly identified primary and secondary infections. Samples can be classified into two groups by IgG detection: one group includes PD1-1, PD1-2, PD1-3, PD2-1, PD2-2, PD3-1, and PD3-2, in which IgG was not detected within one week after fever. The other group includes PD2-3, PD3-3, PD3-4, and PD4-1, in which IgG was detected within 3 to 5 days. This data suggested that the latter patients had been previously infected with dengue fever. There were some discrepancies between IgG detection in PD1-1, PD3-2, and PD3-3 and the conventional LFA method (Panbio) (Figure 13). Visual judgment using the LFA method was often ambiguous, and all of the longitudinal IgG detection data supported the higher accuracy of the method of the present invention than the LFA method. Therefore, it was concluded that the first group probably represented a primary infection and the second group was a secondary infection, or a higher-order infection. IgG detection can identify whether a patient has a primary or secondary infection within 3 to 5 days after fever. In addition, in each of the samples of patients with primary infection, the serotype of infection determined by RT-qPCR was the same as the serotype showing the highest activity among the IgG antibodies detected in the competitive ELISA system. The competitive ELISA method is specific for IgG. In samples of patients with primary infection, IgM was detected by LFA (Panbio) in D1-1, PD2-1, PD3-1, and PD3-2. However, in the competitive ELISA, inhibition of DEN-NS1 detection was not detected within one week after fever, and inhibition was detected at the 17-day time point or later (Figure 13). Therefore, the binding of the aptamer was not inhibited by IgM produced in the early stage of infection (Figure 12a).

[0175] Quantitative serotype analysis of PD2-3, PD3-3, and PD4-1 revealed that the initial IgG levels mainly reflected the serotypes of past infections. Even after one week, the production of IgG antibodies that mainly recognized the serotypes brought about by past infections increased sharply compared to the IgG produced by the current secondary infections. Despite the variation in the predominance of past infections among patients, patient samples of PD2-3 and PD3-3 were shown to produce antibodies against the serotypes of past infections to the maximum extent.

[0176] As described above, DEN3-NS1 of PD3-4 was not detected by ELISA using either the antibody-aptamer or the antibody-antibody (Ab#D06-Ab#D25) sandwich system. This is because the serum samples already contained anti-DEN3-NS1 IgG antibodies brought about by past infections, which inhibited the binding of the aptamer as well as the binding of Ab#D06 and / or Ab#D25 to DEN3NS1 this time.

[0177] The IgG detection method using this aptamer-antibody sandwich pair showed high sensitivity and serotype specificity compared to that using the antibody-antibody sandwich pair. To confirm whether the antibody-antibody pair could also be used for IgG detection, competitive inhibition in the ELISA method using the combination was compared with the antibody-antibody (Ab#D06-Ab#D25) pair against the sera of patients with PD2-3, PD3-3, PD3-4, and PD4-1 (Figs. 17 and 18). The DEN-NS1 ternary complex with the antibody-antibody sandwich pair was also inhibited by anti-DEN-NS1 IgG in the patient plasma. However, the IgG activity of the antibody-antibody pair could not be detected in the sample at the 5-day time point of PD2-3 and the sample at the 3-day time point of PD4-1. Overall, the serotype sensitivity and specificity of the aptamer-antibody pair were higher than those of the antibody-antibody pair.

[0178] Discussion A method for serotype-specific detection of DEN-NS1 and IgG in human serum using UB-DNA aptamers with high affinity and high specificity is presented herein. Among the generated UB-DNA aptamers, AptD2 that binds to DEN2-NS1 contains two Ds and one Px bases as the fifth and sixth bases. The high affinity of AptD2 for DEN2-NS1 indicates the importance of the diol group of Px / Pa for the binding. The combination of hydrophobic Ds and hydrophilic Px / Pa bases creates a new type of six-letter DNA aptamer with high affinity and specificity for their targets. The specificity of these UB aptamers is extremely high, and they recognize amino acid sequences that are at least 96.9% identical to the amino acid sequences of the initial targets (purchased from The Native Antigen Company). This degree of homology is significantly higher than the homology between different NS1 serotypes (69 - 80%). Due to their high specificity, AptD1 and AptD2 could not bind to DEN1-NS1 (PD1-2 / 1-3) and a part of DEN1-NS2 of Singaporean patients.

[0179] Surprisingly, there are 10 and 11 amino acid differences between PD1-1 and PD1-2 / 1-3 DEN1-NS1, and between PD2-1 and PD2-2 / 2-3 DEN2-NS1 (352 amino acids), respectively. The positions of these amino acid differences suggest that they may be related to the aptamer binding site (Figure 19). Substituting the non-polar amino acids of PD1-1 and PD2-1 with other amino acids of PD1-2 / 1-3 and PD2-2 / 2-3 may facilitate the interaction between the non-polar amino acids and the hydrophobic Ds base. The generation of a series of UB aptamers corresponding to each variant of DEN-NS1 may open the door to rapid and accurate diagnosis of DENV mutations, more than the identification of serotypes used for global prevalence surveys.

[0180] In contrast to the highly sensitive and direct DEN-NS1 detection, the method of the present invention for the detection of serotype-specific IgG antibodies can be widely used for DENV variants. Although direct IgG detection methods by ELISA using antibodies have been reported 36 , as far as is known, this is the first simple method that can identify the specificity of IgG serotypes using DNA aptamers. A similar concept of IgG detection using conventional DNA aptamers has been reported for detecting IgG antibodies against the P48 protein of M. bovis 48 . However, the affinity of the DNA aptamer for the target is relatively low (KD = 16 - 33 nM), so the background of IgG detection is high and quantitative analysis is difficult. IgG detection provides valuable information regarding the diagnosis of dengue fever and the use of dengue vaccines. Secondary infections can be identified by IgG detection within a few days after fever (during the febrile period). If anti-DEN-NS1 IgG antibodies are detected in patients within one week after fever, this indicates a secondary infection and may require close observation. Serotype-specific IgG detection also provides valuable information for the use and analysis of dengue vaccines, where a record of pre-infection is important before administration due to concerns about ADE. Tests using patient samples with secondary DENV infections have revealed that IgG antibodies produced in response to past infections were predominantly produced even in cases of secondary infections with different serotypes of dengue fever. This result correlates with other reports 11-14,16,17 and supports ADE, which is why secondary heterologous infections sometimes lead to severe symptoms and the risk of vaccination for people not infected with dengue fever is high. Patients with primary infections produced IgG antibodies mainly targeting the serotype they were infected with. In secondary infections, the initially produced IgG antibodies reacted more strongly with the NS1 serotype of the past infection and did not efficiently react with the target of the secondary infection. By utilizing this test in a larger cohort of dengue fever patients, the mechanism of the etiology of dengue fever can be understood through the serotype-specific sequences of DENV. The method of the present invention is used to test the effectiveness of vaccine development 36,37or may be extended to diagnose other diseases or allergies.

[0181] Highly specific unnatural base DNA aptamers that selectively distinguish variants of dengue NS1 protein with several amino acid mutations in addition to serotype specificity The above described a series of unnatural base-containing DNA (UB-DNA) aptamers that specifically bind to dengue NS1 protein variants in sera of Singaporean patients of each serotype, which have amino acid homology of 96.9% or more to the first target (purchased from Native Antigen Company, NA). For example, one of the UB-DNA aptamers targeting the commercially available dengue serotype 1 NS1 protein detected only variants of serotype 1 NS1 protein with homology of 98.9% or more in patient sera by the ELISA system (PD1-1 and PD1-5 in Fig. 20). Here, novel UB-DNA aptamers (PD1-2, 1-3, and 1-4) that specifically bind to other variants in patient sera and have 96.3% homology to the dengue serotype 1 NS1 protein were generated. The amino acid sequences of the dengue serotype 1 NS1 protein variants in patient sera are identical (13 out of 352 amino acid residues in the full-length protein are mutated) (PD1-2, 1-3, and 1-4: Figs. 1A and 21B). Therefore, the recombinant NS1 protein variant (SIN DEN1-NS1) was prepared in-house. The NS1 region of cDNA obtained from other patient samples, which also encodes the same amino acid sequence as PD1-2, 1-3, 1-4, was subcloned into an in-house expression vector commonly used for the expression of rabbit monoclonal antibodies. The SIN DEN1-NS1 protein with six histidine tags at the C-terminus was expressed in cultured CHO cells and purified by the histidine tag pull-down method. The purity of the obtained SIN DEN1-NS1 protein was analyzed by SDS-PAGE using silver staining detection, and the concentration of the obtained SIN-D1 was measured by comparing with the intensity of the band of the DEN1 NS1 protein purchased from Native Antigen Company as a standard (SIN in Fig. 21C). Using SIN-D1, seven rounds of ExSELEX (ExSELEX-4) were performed in a DNA library containing Ds using the selection conditions summarized in Table E3.

[0182]

Table 14

[0183] As targets, recombinant SIN DEN1-NS1E prepared in the 1st, 2nd, 3rd, and 6th rounds of circulation was used, and PD1-4 clinical serum was used in the 4th, 5th, and 7th rounds of circulation. After 7 rounds of ExSELEX, binding of the enriched library to SIN DEN1-NS1 was observed in the gel shift assay (Figure 22A). Next, when the sequence of the enriched library was analyzed, the library sequence (total number of extracted reads: 43,385) converged to a single family (Family 1, 40,282 reads) containing two Ds bases, which was 93% of the population in the enriched library (Figure 23A). When the sequence pattern in Family 1 was examined, the 19D1F1 sequence was the most common (57% of the total extracted reads), and thus 19D1F1 was selected for further characterization. A clone of 19D1F1 was isolated from the enriched library using a biotinylated hybridization probe (5'-biotin-CCACGGCGTATTTTAGCAGCATC).

[0184] The isolated 19D1F1 DNA was amplified by PCR in the presence or absence of dDsTP and dPxTP, which are unnatural base substrates. The amplified 19D1F1 containing two Ds bases specifically bound to the SINDEN1-NS1 protein. However, the Ds→NB (natural base) variant lost the binding ability (Figure 22B), indicating the importance of the Ds base for strong binding. In addition, it was confirmed that 19D1F1 binds only to the SIN DEN1-NS1 protein and does not bind to other serotype NS1 proteins purchased from DEN1-NS1 or Native Antigen Company (Figure 22B).

[0185] Five 19D1F1 derivatives, 19D1F1-1, 19D1F1-2, 19D1F1-3, 19D1F1-4, and 19D1F1-5 (Figure 23B) were chemically synthesized. Among these derivatives, only 19D1F1-3 showed strong binding affinity to the SIN DEN1-NS1 protein (Figure 24). The dissociation constants (K D ) of the 19D1F1 UB-DNA aptamer (19D1F1 (isolate)) isolated from the enriched library and the chemically synthesized 19D1F1 UB-DNA aptamer (19D1F1-3) were measured by SPR, and their K D values were 9.1 pM and 27 pM, respectively.

[0186] ELISA was performed using the sandwich system of 19D1F1-3 (AptD1b) and an antibody pair with clinical samples PD1-1, PD1-2, and PD1-3 (Figure 25). ELISA using the isolated 19D1F1 (AptD1b) efficiently and specifically detected PD1-2 and PD1-3, but did not detect PD1-1 and the NS1 protein (NA) among all serotypes. Therefore, the UB-DNA aptamer can recognize ~97% amino acid homology of the target protein, rather than identifying the serotype with the highest specificity as a ligand.

[0187] The sequence related to 19D1F1-3 is useful because the UB-DNA aptamer can be used for the detection of some serotypes of the dengue serotype 1 NS1 protein.

[0188] Biological experiments General information on biological experiments and materials The DNA fragments containing the DNA aptamer variants, DNA libraries, and primers used in this study were either chemically synthesized in-house using phosphoramidites with an H8 DNA / RNA synthesizer (K&A Laborgerate) or purchased from Integrated DNA Technologies. The phosphoramidites of natural bases were purchased from Glen Research, and the commercially available modified phosphoramidites were purchased from Glen Research, Link Technologies, and ChemGenes Corporation. The Ds and diol-Pa phosphoramidites were chemically synthesized in-house as previously described for Ds 38 , and the latter was chemically synthesized with diol-Pa. Chemically synthesized DNA was either purified by denaturing gel electrophoresis or used directly without further purification (in the case of some primers and probes purchased from IDT). The unnatural bases (dDsTP, diol-dPxTP, Cy5-dPxTP, and dPa’TP) were as previously described 38-41Chemically synthesized. Recombinant DEN-NS1 (DEN1-NS1, DEN2-NS1, DEN3-NS1, and DEN4-NS1 with polyhistidine tags) was purchased from The Native Antigen Company (DEN1-NS: Nauru / Western Pacific / 1974, DEN2-NS: Thailand / 16681 / 84, DEN3-NS1: Sri Lanka D3 / H / IMTSSA-SRI / 2000 / 1266, DEN4-NS1: Dominica / 814669 / 1981). Recombinant Zika virus NS1 proteins (MR 766 Uganda strain and Brazilian strain) were obtained from R&D Systems and ACROBiosystems. Anti-Dengue NS1 rabbit monoclonal antibodies were prepared in-house by conventional methods. Among the antibodies, Ab#D06 and Ab#D25, which had higher affinity than others, were selected. Streptavidin-HRP conjugate (1 mg / ml) was obtained from Jackson ImmunoResearch. Streptavidin, Tween 20, BSA, and anti-mouse IgG HRP conjugate (1 mg / ml) were obtained from Promega. General stock solutions and compounds were from Thermo Fisher Scientific, Nacalai Tesque, 1 stPurchased from BASE, Promega, Sigma-Aldrich, New England Biolabs, and Bio-Rad Laboratories. The TMB substrate solution (SureBlue Reserve™ TMB 1-Component Microwell Peroxidase Substrate, #5120-0083) was purchased from KPL. Standard human serum was purchased from Sigma-Aldrich (Sigma #H4522) or obtained from healthy volunteers recruited in a study approved by the National Healthcare Group Domain Specific Review Board (NHG DSRB) (Reference 2009 / 00432) at Tan Tock Seng Hospital (TTSH, Singapore). Whole blood samples were collected from dengue patients referred by the Communicable Disease Centre of TTSH into serum separation transport tubes or EDTA tubes (Becton Dickinson). Blood specimens were obtained from patients who consented to the study. All patients provided individual written informed consent. The study protocol was approved by the NHG DSRB (see 2015 / 00528 and 2016 / 00076). The patients recruited were tested and confirmed as NS1 positive by regular hospital diagnosis using the SD BIOLINE Dengue Duo Test, and they had fever less than 5 days from onset. RTqPCR analysis of the samples confirmed infection with the dengue virus. Dengue serotype was determined by the FTD Dengue Differentiation RT-qPCR test from Fast Track Diagnostics, using a Bio-Rad CFX96 instrument for the samples, or by Sanger sequencing of the RT-PCR products (described below). Samples from several patients followed longitudinally were tested, and samples from the acute phase (within 7 days after fever) and convalescent phase (up to 1 year after fever) of dengue infection were provided. In the ELISA shown below, serum samples were used for PD1-1, PD1-2, PD1-3, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34, and PD4-1, and plasma samples were used for PD2-1.

[0189] ExSELEX method. In the first round of ExSELEX, a single-stranded DNA library of 2 nmol or 4 nmol (88-mer, 5’-GCACTCCATGATATGGTCTACTG-N42-GACAAGCGGAGTAGTTAGACCGT-3’, which is a mixture of 74 sub-libraries) was used. Each sub-library contains two Ds bases at a predetermined position in the 42-nucleotide randomized sequence region. The conditions of ExSELEX are summarized in Table E1. Usually, the DNA library diluted in binding buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl2, and 2.7 mM KCl) was denatured by heating at 95 °C for 5 minutes, quickly cooled on ice for 10 minutes, and then held at room temperature (25 °C) for 10 minutes. Nonidet P-40 (Nacalai Tesque) or Tween 20 was added to the diluted DNA library solution at the indicated concentration. In the presence or absence of additives (BSA and human serum), the library was incubated with each target protein (DEN1-NS1, DEN2-NS1, DEN3-NS1, or DEN4-NS1) at 25 °C. As shown in Table E1, the DNA-NS1 complex was separated from unbound DNA molecular species using one of four different methods (Methods A - D). Method A is ultrafiltration using an Amicon Ultra centrifugal filter unit (MWCO: 100 kDa). Method B is to capture the complex with the anti-DEN-NS1 antibody Ab#D06 coated on a microtiter plate (MaxiSorp (trademark) 96-well plate from Thermo Fisher Scientific). Method C is a pull-down method using Dynabeads His-Tag Isolation and pull-down Magnetic Beads (Thermo Fisher Scientific). Method D is a gel shift assay 42In methods A, B, and C, the captured DNA-NS1 complex was washed several times, and the DNA bound to NS1 was recovered by treatment with 150 mM NaOH and then desalted using an illustra MicroSpin G-25 column (GE Healthcare). The recovered DNA was amplified by PCR using forward 5'-PCR and reverse 3'-PCR primers in the presence of the unnatural substrates dDsTP and diol-dPxTP. 42,43 The reverse 3'-PCR primer contains a linker and a spacer at the 5'-end to distinguish the length of the library and its complementary strand, allowing separation by denaturing polyacrylamide gel electrophoresis. 44 The single-stranded Ds-DNA library was separated and purified by performing 8% denaturing PAGE for the next round of selection. From the second round, pre-counter selection was performed by incubating the DNA library solution with only magnetic beads or in wells coated with antibodies on a plate before target binding to remove non-specifically bound DNA molecular species. In the ExSELEX-1 method (4 - 9 rounds) and ExSELEX-2 (4 - 9 rounds), post-counter selection was performed to remove DNA molecular species that bound to other serotype NS1 proteins. In post-counter selection, the DNA solution eluted from DNA-NS1 (before PCR) was incubated with non-target serotype NS1 protein at 25°C for 30 minutes, and then the unwanted DNA-NS1 complex was removed from the solution containing magnetic beads. The resulting DNA solution was subjected to PCR amplification.

[0190] Deep sequencing As previously described 42,43,45 The aptamer candidate sequences were determined by a sequencing method using the ION PGM system (Thermo Fisher Scientific) from the DNA library enriched in the final rounds of ExSELEX-1, ExSELEX-2, and ExSELEX-3. The DNA library was amplified by substitution PCR using diol-dPxTP or dPa’TP instead of dDsTP.45 After purification of the PCR products, samples for sequencing were prepared by using the Ion Plus Fragment Library Kit equipped with the Ion Express Barcode Adapters 1-16 Kit and the Ion PGM Hi-Q View OT2 Kit, and then deep sequencing (Thermo Fisher Scientific) was performed using the Ion PGM Hi-Q View Sequencing Kit and the Ion PGM 314 v2 chip. The obtained sequence data were processed, clustered into families, and the positions of unnatural bases in the randomized regions of each family were estimated by using an in-house perl script.

[0191] Identification of Px in the aptamer strand of 2D-1 To confirm the presence of diol-Px in the 2D-1 clone, in the final round of ExSELEX-3 targeting DEN2-NS1, the target family sequence was first captured from the enriched library by using a probe for specific hybridization (5'-biotin-CCGCCTCTTGTTCCCAGTCGGAC-3'). A DNA library (100 μl at 50 nM in probing buffer (20 mM Tris-HCl, pH 7.6, 0.5 M NaCl, 10 mM MgCl2)) was heated at 95 °C for 3 minutes, then cooled to 60 °C at -0.1 °C / second, and the solution was maintained at 60 °C for 15 minutes to anneal with the probe (1 μl at 5 μM in water). The mixture was incubated with Hydrophilic Streptavidin Magnetic Beads (New England Biolabs) at 60 °C for 5 minutes, and the target clone was hybridized with the probe on its surface. The magnetic beads were then recovered and washed 5 times with 150 μl of probing buffer (preheated at 60 °C). The hybridized clone was recovered by incubation with 120 μl of water at 75 °C for 5 minutes. The recovered DNA (100 μl) was subjected to 20 cycles of PCR (400 μl) in the presence of dDsTP and diol-dPxTP (each 50 μM), and the aptamer strand was purified by denaturing PAGE. The binding of the isolated aptamer strand to DEN2-NS1 was confirmed by gel shift assay (EMSA) (Figure 8B). Chemically synthesized D2-1 DNA, D2-1-96(3Ds), with three Ds bases added at each position, did not bind to DEN2-NS1 (Figure 8B), and thus one of the three UB positions could be Px. To label the 5'-end of the aptamer strand with FAM and the Px-containing strand with Cy5, the isolated aptamer strand (0.5 pmol) was subjected to 8 cycles of PCR (25 μl) in the presence of 10 μM Cy5-dPxTP, a 5'-PCR primer with 50 μM FAM-labeled dDsTP, and a 3'-primer conjugated with a linker 39The PCR products were analyzed by 15% denaturing PAGE, and the band patterns were detected with fluorescence of FAM and Cy5 using a bioimaging analyzer, ChemiDoc™ MP (Bio-Rad) (Figure 8C). By PCR using a 3'-PCR primer conjugated with a linker, the mobility of the complementary strand of the aptamer sequence became slower than that of the aptamer strand, and both strands were confirmed separately on the gel (Figure 8C). Both strands of the PCR products from the isolated D2-1 strand emitted Cy5 fluorescence (Figure 8C), indicating that the D2-1 aptamer strand contains at least one Px base. The FAM-labeled aptamer strand in the remaining PCR products was purified by denaturing 8% PAGE for further experiments. Since Px nucleoside is decomposed under basic conditions, the DNA fragment was decomposed at the position of Px by treatment with concentrated ammonia at 55 °C for 4 hours. After removing the ammonia solution, the residue was suspended in 20 μl of Hi-Di formamide (Thermo Fisher Scientific), and 10 μl aliquots were fractionated by denaturing 8% PAGE. Before and after staining with SYBR Gold, the DNA band patterns on the gel were analyzed with a bioimaging analyzer, LAS4000 (Fuji Film). From the digestion pattern on the gel, the position of Px in D2-1 was evaluated (Figure 8D). 5'-FAM fluorescence detection showed one band corresponding to the fragment digested at the 5'-end (~57mer), and detection by SYBR Gold staining showed two bands corresponding to the fragment digested at the 5'-end (~57mer) and the fragment digested at the 3'-end (~39-mer). These digestion patterns indicated that the DNA fragment contains one Px base at the position of the third unnatural base from the 5'-end (57th position) (Table E2: D2-1y-97).

[0192] Preparation of authentic D2-1, D2-1y-96 The authentic D2-1 aptamer, D2-1y-96, consists of two chemically synthesized fragments (5-half: 5'-ACTCCATGATATGGTCTACTGGTCCG-Ds-CTGGGAACAAG-Ds- GGCGGGAGGGA-3', 3-Half: 5'-GGTCTAACTACTCCGCTTGTCGCACCCACACCC-Ds- TCCCTCCCGCC -3', (the complementary sequences are underlined) were prepared through primer extension and PCR amplification. Primer (100 μl) extension was performed in the presence of 50 μM diol dPxTP using each of the 5-Half and 3-Half, and then purified using the QIAquick Gel Extraction Kit (QIAGEN). By using the primer extension product as a template, 8 cycles of PCR were performed in the presence of 50 μM each of dDsTP and diol-dPxTP, and the aptamer strand was purified by denaturing 8% PAGE. The binding of the prepared aptamer strand D2-1y-96 was analyzed by SPR and EMSA.

[0193] Electrophoretic gel mobility shift assay (EMSA) For DNA folding, the DNA fragment diluted in the binding buffer was heated at 95 °C for 5 minutes and then immediately cooled on ice for 10 minutes. The DNA solution (50 nM) was mixed with each NS1 protein (25 nM) or without it in the binding buffer supplemented with 0.05% Nonidet P-40 and incubated at 25 °C for 30 minutes. After incubation, the sample was mixed with glycerol (final concentration 5%), and the formation of the complex was analyzed by PAGE (4% polyacrylamide gel with or without urea, containing 44.5 mM Tris-Borate, 1 mM MgCl2, 2.7 mM KCl, 5% glycerol). Gel electrophoresis was performed at 26 - 28 °C for 50 minutes in a constant temperature mode (3W setting with a temperature probe set at 30 °C). After staining with SYBR Gold, the DNA band pattern on the gel was detected with a LAS4000 imager. The intensity of the band corresponding to the free DNA was quantified using Multi Gauge software to quantify the relative shift ratio for comparing the degree of complex formation.

[0194] Surface plasmon resonance (SPR) analysis The binding affinity profile was obtained using a Biacore T200 (GE Healthcare) at 25 °C with running buffer (binding buffer supplemented with 0.05% Tween 20). To immobilize each ligand (aptamer variant), a sensor chip coated with streptavidin was used, and the biotinylated aptamer variant was immobilized on the flow cell by injecting a 0.5 nM ligand solution in the running buffer at a flow rate of 0.5 μl / min for 960 s. For some of the Ds-DNA aptamers (D1 and D2 aptamer variants), immobilization in the presence of NS1 ensured a reproducible target binding profile for efficient binding to multimeric NS1 by immobilizing the aptamer at an appropriately separated distance. The binding rate profile was measured by injection of at least five different concentrations of analyte solution (0.625 nM to 20 nM) at a flow rate of 30 μl / min for 150 s (binding). Next, the dissociation pattern of the analyte (D1-1-48h, D21d-72h, D3-2-59h, and D4-3-57h) was recorded for 600 s or 1200 s. To regenerate the ligand on the surface of the flow cell, a denaturing solution (50 mM NaOH) was injected for 5 s, and then the ligand was equilibrated with the running buffer for 10 min. The kinetic parameters for target binding, the association rate (k on ), the dissociation rate (k off ), and the dissociation constant (K D = k off / k on ) were determined using the double-reference subtraction method and global curve fitting (more than twice at each concentration) to a 1:1 Langmuir model with BIAevaluation software version 3.0.

[0195] ELISA using aptamer and antibody pairs (Apt / Ab ELISA). All incubations were performed at room temperature. A microtiter plate (Maxisorp (trademark) 96-well plate from Thermo Fisher Scientific) was coated overnight with 10 μg / ml streptavidin in 0.1 M sodium carbonate buffer (pH 9.6) at 100 μl / well. The wells coated with streptavidin were blocked with 300 μl of 10 mg / ml BSA in 1× D-PBS (Nacalai Tesque) for 2 hours, and then the wells were washed three times with 200 μl of wash buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl2, 2.7 mM KCl, 0.05% Tween 20). Each UB-DNA aptamer was immobilized on the streptavidin-coated wells by incubation with 100 μl of 15 nM D1-1-48h, or 5 nM D2-1d-72h, D3-3-59h, or D4-3-57h in dilution buffer (wash buffer supplemented with 1 mg / ml BSA) for 2 hours, and then each well was washed three times with 200 μl of wash buffer. 100 μl of NS1-Ab#D06 mixture solution was added to the wells coated with the aptamer and incubated for 30 minutes. The solution was pre-prepared at a ratio of 1:9 (vol / vol) by incubating each NS1 protein in dilution buffer, or dilution buffer supplemented with 11.1 nM Ab#D06 in human serum with 2% Tween 20 added (dilution buffer 2) for 30 minutes. After washing the wells once, 100 μl of secondary detection solution (anti-rabbit IgG HRP conjugate, diluted 1:2500 with dilution buffer) was added to each well and incubated for 30 minutes. After adding 100 μl of 1 N HCl to the wells to stop the reaction, the absorbance of the wells at 450 nm (OD 450 ) was measured with a microplate reader Cytation 3 (BioTek). The assay under each condition was performed twice (n = 2), and the data of the average absorbance were shown in a graph with error bars representing one standard deviation. If at least one well in the two samples showed overflow (OD 450 > 4.000), the data in the graph were shown with a wavy line.

[0196] ELISA using antibody and antibody pairs (Ab / Ab ELISA) The Ab / Ab ELISA was performed in a similar manner to the Apt / Ab ELISA with some modifications. Instead of the plate coated with the aptamer, the plate coated with the antibody was prepared by incubation with 2 μg / ml Ab#D25 (100 μl / well) in 0.1 M sodium carbonate buffer (pH 9.6) for 2 hours followed by blocking with BSA. In the process of preparing the NS1-Ab#D06 solution with Dilution Buffer 2, biotinylated Ab#D6 was used. For biotinylation, the Ab#D25 solution (6.67 μM in 1×D-PBS) was mixed with Thermo Scientific™ EZ-Link™ Sulfo-NHS-LC-Biotin (final concentration 117 μM), and the mixture was incubated at room temperature for 30 minutes. Then the antibody was recovered using an Amicon Ultra-0.5 centrifugal filter unit (MWCO: 50 kDa) after desalting. The biotinylated Ab#D06 solution in 1×D-PBS was stored at 4°C until use. For secondary detection, instead of the anti-rabbit IgG HRP conjugate, streptavidin-HRP conjugate diluted 1:20,000 with Dilution Buffer was used.

[0197] Treatment of control human serum with protein A resin To remove IgG from human serum, Sigma human serum (500 μL, Lot# SLBT0310) was incubated with Amintra Protein A resin using Protein A resin. Sigma human serum (500 μL, Lot# SLBT0310) was incubated with Amintra Protein A Resin (Expedeon, 500 μl slurry, washed 3 times with 1 ml of Dilution Buffer) with rotation at room temperature for 2 hours. After incubation, the resin was removed by centrifugation, and the supernatant was recovered and stored at 4°C until use.

[0198] Serological tests and dengue NS1 detection To compare the controls, detection of anti-dengue IgG and IgM serology and detection of dengue NS1 were performed on acute-phase samples using commercially available lateral flow assays, the Panbio Dengue Duo cassette (Alere) and the SD BIOLINE Dengue NS1 Ag rapid test (Alere) (Figure 13). For NS1 detection, 100 μl of each sample (human serum) was added to the sample well. After 20 minutes, the test line and control line were visually checked with the naked eye. For high-titer IgG and IgM detection, 10 μl of each sample (human serum) was dropped into the sample well, and immediately 2 drops of the buffer included in the kit were added. After 15 minutes, the test lines for IgG and IgM, and the control line were visually checked with the naked eye. The presence of IgG indicates a secondary infection, and the absence of IgG indicates a primary infection.

[0199] Competitive IgG detection In the assay with Apt / Ab ELISA, wells coated with each UB-DNA aptamer were used as the capture agent. For the preparation of the loading sample, serum samples (5 μl, undiluted or diluted 10-, 25-, 50-, or 100-fold with dilution buffer) were first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 350 pg, DEN2-NS1: 350 pg, DEN3-NS1: 450 pg, DEN4-NS1 200 pg). Next, the solution was mixed with 45 μl of 11.1 nM Ab#D06 in dilution buffer 2, incubated for 30 minutes, then loaded into the aptamer-coated wells (50 μl) and incubated for 30 minutes. The subsequent procedure was performed as described above for Apt / Ab ELISA.

[0200] In the assay by Ab / Ab ELISA, wells coated (overnight) with Ab#D25 as a capture agent were used. For the preparation of loading samples, serum samples (5 μL or diluted 10, 25, 50, or 100-fold with dilution buffer) were first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 400 pg, DEN2-NS1: 250 pg, DEN3-NS1: 400 pg, DEN4-NS1: 300 pg). The solution was then mixed with 45 μl of 11.1 nM biotinylated Ab#D06 in dilution buffer 2. The subsequent procedure was performed as described above for Ab / Ab ELISA.

[0201] OD against the amount of human serum used in ELISA 450 From the plot of 450 the relative IgG activity was calculated by normalizing the amount of serum required to lower OD

[0202] DNA sequencing of the dengue NS1 region in RNA samples. To compare the amino acid sequence of NS1 in clinical samples with the amino acid sequence of the target NS1 in aptamer generation, sequencing analysis of RT-PCR products related to the DENV NS1 gene was performed using the Sanger capillary sequencing method (PD1-2, PD1-3, PD2-1, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34 and PD4-1), or a multiplex PCR method followed by a deep sequencing method (PD1-1), with some modifications to the published protocol 46 performed. RNA from clinical samples was reverse transcribed into cDNA using Superscript III RNase H(-) reverse transcriptase (Thermo Fisher Scientific) and specific primers or random hexamers.

[0203] The resulting cDNA was then used as a template for PCR amplification using Taq DNA polymerase (New England Biolabs), AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific), or Q5 HighFidelity DNA polymerase (New England Biolabs). After purifying the PCR products from agarose gels or directly using the QIAquick Gel Extraction Kit (Qiagen), the products were subjected to cycle sequencing reactions using the BigDy (trademark) Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) or deep sequencing using the Ion PGM system (Thermo Fisher Scientific) according to the manufacturer's instructions. Capillary sequencing was performed on a 3500 Genetic Analyzer (Thermo Fisher Scientific), and sequence reads were manually assembled. In the case of PD1-1, PD1-2 was used as a reference sequence, and the reads obtained with the IonPGM system were mapped and analyzed using CLC Genomics Workbench software (CLC bio).

[0204] Chemical analysis General information for chemical analysis All reagents and solvents were purchased from standard manufacturers (Tokyo Chemical Industry Co., Ltd., Sigma-Aldrich, Merck). Thin-layer chromatography was performed using TLC silica gel 60F254 (Merck). Compounds were visualized by UV shadowing or staining with sulfuric acid-methanol solution. Nucleoside derivatives were purified on a Gilson HPLC system equipped with a preparative C18 column (μBONDASPHERE, water, 19 mm × 150 mm). 1 1H NMR and 31 31P NMR spectra were recorded on a Bruker magnetic resonance spectrometer. CDCl3 and DMSO-d6 were used as solvents.

[0205]

Chem.

[0206] Scheme 1. Synthesis of benzoyl-protected diol linker, (S)-pent-4-yn-1,2-diyl dibenzoate (2).

[0207] Lithium acetylide ethylenediamine complex (8.31 g, 81.2 mmol) was dissolved in hexamethylphosphoric triamide (20 ml) and dry THF (80 ml), and the resulting mixture was cooled to 0 °C. Then, (R)-(+)-glycidol, compound 1 (1786 μl, 27 mmol) in dry THF (40 ml) was added dropwise with stirring at 0 °C. After the reaction mixture was stirred at room temperature for 15.5 h, saturated NH4Cl (200 ml) was added. The mixture was extracted with EtOAc (50 ml × 3). The combined organic phases were dried over MgSO4 and concentrated under reduced pressure. The residue was evaporated to dryness twice with dry pyridine (60 ml). Benzoyl chloride (12.5 ml, 108 mmol) was added to the residue in dry pyridine (60 ml). The resulting mixture was stirred at room temperature for 19 h. The reaction was quenched by the addition of methanol (10 ml) and stirred at room temperature for 30 min before concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) were poured into the resulting residue. The organic layer was separated and washed with water (150 ml), saturated aqueous NaHCO3 (150 ml), and brine (150 ml). The organic phase was dried over MgSO4 and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (150 g of silica gel, hexane / EtOAc = 100:0 to 95:5) to give compound 2 (2.86 g, 9.26 mmol, 34%). 1 1H NMR (400 MHz, CDCl3) δ 8.08 - 8.02 (m, 4H), 7.60 - 7.54 (m, 2H), 7.47 - 7.41 (m, 4H), 5.58 - 5.53 (m, 1H), 4.68 (dq, 2H, J = 3.9, 12.0 Hz), 2.80 (dd, 2H, J = 2.6, 6.2 Hz), 2.08 (t, 1H, J = 2.6 Hz).

[0208]

Chem.

[0209] Scheme 2. Synthesis of benzoyl-protected diol-dPa phosphoramidite, 1-(2-deoxy-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzyloxy-pentyn-1-yl)-1H-pyrrole-2-carbaldehyde (3).

[0210] A mixture of dPa iodide (1.94 g, 5.75 mmol), copper(I) iodide (175 mg, 0.92 mmol), tetrakis(triphenylphosphine)palladium(0) (332 mg, 0.288 mmol), triethylamine (1.6 ml, 11.5 mmol), and DMF (30 ml) was stirred and degassed under reduced pressure for 10 minutes and then sparged with argon. Compound 2 (2.22 g, 7.19 mmol) was added to this mixture, and the resulting mixture was further degassed under reduced pressure for 10 minutes, sparged with argon, and then stirred at room temperature for 4 hours. The reaction mixture was concentrated under reduced pressure. The resulting dark liquid mixture was purified by silica gel column chromatography (60 g of silica gel, DCM / methanol = 100:0 to 98:2) and C18 RP-HPLC (eluting with a gradient of CH3CN (40 - 80% in water)) to give compound 3 (2.35 g, 4.53 mmol, 79%). 11H NMR (400 MHz, DMSO-d6) δ 9.47 (d, 1H, J = 0.9 Hz), 8.00 - 7.95 (m, 4H), 7.87 (s, 1H), 7.70 - 7.64 (m, 2H), 7.56 - 7.50 (m, 4H), 7.08 (d, 1H, J = 1.8 Hz), 6.66 (t, 1H, J = 6.3 Hz), 5.57 - 5.52 (m, 1H), 5.27 (d, 1H, J = 4.1 Hz), 5.03 (t, 1H, J = 5.3 Hz), 4.74 - 4.70 (dd, 1H, J = 3.3, 11.9 Hz), 4.64 - 4.59 (dd, 1H, J = 6.7, 12.0 Hz), 4.24 (m, 1H), 3.81 (dt, 1H, J = 3.6, 4.0 Hz), 3.62 - 3.50 (m, 2H), 3.03 (d, 2H, J = 6.4 Hz), 2.32 - 2.08 (m, 2H).

[0211] 1-(5-O-DMTr-2-deoxy-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzyloxy-pentyn-1-yl)-1H-pyrrole-2-carbaldehyde (4). Compound 3 (2.35 g, 4.53 mmol) was evaporated to dryness three times with dry pyridine. The residue in dry pyridine (40 ml) was mixed with 4,4'-dimethoxytrityl chloride (DMTrCl, 1.84 g, 5.44 mmol). The resulting mixture was stirred at room temperature for 2 h before concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) were poured into the obtained residue. The organic layer was separated and washed with saturated aqueous NaHCO3 solution (150 ml × 1) and brine (150 ml × 1). After drying over MgSO4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (silica gel 60 g, hexane / EtOAc = 100:0 - 70:30) to give compound 4 (2.98 g, 3.63 mmol, 80%). 11H NMR (400 MHz, DMSO-d6) δ 9.47 (d, 1H, J = 0.8 Hz), 7.98 - 7.94 (m, 4H), 7.68 - 7.63 (m, 3H), 7.57 - 7.47 (m, 4H), 7.39 - 7.37 (m, 2H), 7.31 - 7.19 (m 6H), 7.11 (d, 1H, J = 1.8 Hz), 6.89 - 6.87 (m, 4H), 6.67 (t, 1H, J = 5.9 Hz), 5.54 - 5.49 (m, 1H), 5.36 (d, 1H, J = 3.8 Hz), 4.71 - 4.67 (dd, 1H, J = 3.3, 11.9 Hz), 4.60 - 4.55 (dd, 1H, J = 6.7, 12.0 Hz), 4.26 (m, 1H), 3.97 - 3.93 (m, 1H), 3.73 (d, 6H, J = 1.0 Hz), 3.22 - 3.18 (dd, 1H, J = 5.8, 10.4 Hz), 3.14 - 3.11 (dd, 1H, J = 3.1, 10.4 Hz), 2.99 (d, 2H, J = 6.4 Hz), 2.36 - 2.18 (m, 2H).

[0212] 1-(5-O-DMTr-2-deoxy-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzyloxy-pentyn-1-yl)-1H-pyrrole-2-carboxaldehyde phosphoramidite (5). Compound 4 (2.98 g, 3.63 mmol) was evaporated to dryness three times with pyridine and then three times with dry THF. N,N-Diisopropylethylamine (950 μl, 5.45 mmol) and 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (893 μl, 4 mmol) were added to the residue in anhydrous THF (35 ml), and the resulting mixture was stirred at room temperature for 3 h. Dry methanol (500 μl) was added to the mixture to stop the reaction. The resulting residue was poured into EtOAc / triethylamine (150 ml, 99 / 1) and saturated aqueous NaHCO3 (150 ml). The organic layer was separated and washed with saturated aqueous NaHCO3 (150 ml) and brine (150 ml). After drying over MgSO4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (80 g, hexane / EtOAc = 100 / 0 to 80 / 20, containing 1% triethylamine) to give compound 5 (2.84 g, 2.78 mmol, 76%). 1 H NMR (400 MHz, DMSO-d6) δ 9.52-9.50 (m, 1H), 7.97-7.94 (m, 4H), 7.69-7.62 (m, 3H), 7.52-7.47 (m, 4H), 7.40-7.36 (m, 2H), 7.31-7.18 (m, 6H), 7.12 (m, 1H), 6.89-6.86 (m, 4H), 6.74-6.68 (m, 1H), 5.55-5.48 (m, 1H), 4.71-4.46 (m, 3H), 4.12-4.04 (m, 1H), 3.73-3.72 (m, 6H), 3.67-3.46 (m, 3H), 3.27-3.17 (m, 2H), 2.99 (t, 2H, J = 5.9 Hz), 2.76 (t, 1H, J = 5.9 Hz), 2.66 (t, 1H, J = 5.9 Hz), 2.49-2.32 (m, 2H), 1.14-0.99 (m, 12H) (Fig. 26). 31P NMR (162 MHz, DMSO-d6) δ 147.8 and 147.5 (diastereoisomers) (Fig. 27).

[0213] References 1. Bhatt, S. et al. The global distribution and burden of dengue. Nature 496, 504 - 507 (2013). 2. WHO. Dengue and severe dengue, <https: / / www.who.int / news-room / fact HYPERLINK "https: / / www.who.int / news-room / fact-sheets / detail / dengue-and-severe-dengue"https: / / www.who.int / news-room / fact-sheets / detail / dengue-and-severe-denguesheets / detail / dengue-and-severe-dengue> (2019). https: / / www.who.int / news-room / fact-sheets / detail / dengue-and-severe-dengue 3. Halstead, S. B. & O'Rourke, E. J. Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralizing antibody. J. Exp. Med. 146, 201 - 217 (1977). 4. Halstead, S. B. & O'Rourke, E. J. Antibody-enhanced dengue virus infection in primate leukocytes. Nature 265, 739 - 741 (1977). 5. Halstead, S. B. In vivo enhancement of dengue virus infection in rhesus monkeys by passively transferred antibody. J. Infect. Dis. 140, 527 - 533 (1979). 6. Halstead, S. B. Dengue. Lancet 370, 1644 - 1652 (2007). 7. Guzman, M. G. & Harris, E. Dengue. Lancet 385, 453 - 465 (2015). 8. Guzman, M. G., Gubler, D. J., Izquierdo, A., Martinez, E. & Halstead, S. B. Dengue infection. Nat. Rev. Dis. Primers 2, 16055 (2016). 9. Wilder - Smith, A., Ooi, E. E., Horstick, O. & Wills, B. Dengue. Lancet 393, 350 - 363 (2019). 10. Priyamvada, L. et al. Human antibody responses after dengue virus infection are highly cross - reactive to Zika virus. Proc. Natl. Acad. Sci. U S A 113, 7852 - 7857 (2016). 11. Mathew, A. et al. B - cell responses during primary and secondary dengue virus infections in humans. J. Infect. Dis. 204, 1514 - 1522 (2011). 12. Corbett, K. S. et al. Preexisting neutralizing antibody responses distinguish clinically inapparent and apparent dengue virus infections in a Sri Lankan pediatric cohort. J. Infect. Dis. 211, 590 - 599 (2015). 13. Priyamvada, L. et al. B Cell Responses during Secondary Dengue Virus Infection Are Dominated by Highly Cross - Reactive, Memory - Derived Plasmablasts. J. Virol. 90, 5574 - 5585 (2016). 14. Katzelnick, L. C. et al. Antibody - dependent enhancement of severe dengue disease in humans. Science 358, 929 - 932 (2017). 15. St John, A. L. & Rathore, A. P. S. Adaptive immune responses to primary and secondary dengue virus infections. Nat. Rev. Immunol. 19, 218 - 230 (2019). 16. Patel, B. et al. Dissecting the human serum antibody response to secondary dengue virus infections. PLoS Negl. Trop. Dis. 11, e0005554 (2017). 17. Reich, N. G. et al. Interactions between serotypes of dengue highlight epidemiological impact of cross-immunity. J. R. Soc. Interface 10, 20130414 (2013). 18. Villar, L. et al. Efficacy of a tetravalent dengue vaccine in children in Latin America. N. Engl. J. Med. 372, 113 - 123 (2015). 19. Capeding, M. R. et al. Clinical efficacy and safety of a novel tetravalent dengue vaccine in healthy children in Asia: a phase 3, randomised, observer - masked, placebo - controlled trial. Lancet 384, 1358 - 1365 (2014). 20. Ferguson, N. M. et al. Benefits and risks of the Sanofi - Pasteur dengue vaccine: Modeling optimal deployment. Science 353, 1033 - 1036 (2016). 21. Sridhar, S. et al. Effect of Dengue Serostatus on Dengue Vaccine Safety and Efficacy. N. Engl. J. Med. 379, 327 - 340 (2018). 22.Aguiar, M., Halstead, S. B. & Stollenwerk, N. Consider stopping dengvaxia administration without immunological screening. Expert. Rev. Vaccines 16, 301-302 (2017). 23.Halstead, S. B. Dengvaxia sensitizes seronegatives to vaccine enhanced disease regardless of age. Vaccine 35, 6355-6358 (2017). 24.Luo, R. et al. Rapid diagnostic tests for determining dengue serostatus: a systematic review and key informant interviews. Clin. Microbiol. Infect. (2019). 25.Bosch, I. et al. Rapid antigen tests for dengue virus serotypes and Zika virus in patient serum. Sci. Transl. Med. 9 (2017). 26.Lebani, K. et al. Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay. PLoS One 12, e0180669 (2017). 27.Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990). 28. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505 - 510 (1990). 29. Rothlisberger, P. & Hollenstein, M. Aptamer chemistry. Adv. Drug. Deliv. Rev. 134, 3 - 21 (2018). 30. Zhou, J. & Rossi, J. Aptamers as targeted therapeutics: current potential and challenges. Nat. Rev. Drug Discov. 16, 181 - 202 (2017). 31. Nimjee, S. M., White, R. R., Becker, R. C. & Sullenger, B. A. Aptamers as Therapeutics. Annu. Rev. Pharmacol. Toxicol. 57, 61 - 79 (2017). 32. McKeague, M. et al. Analysis of In Vitro Aptamer Selection Parameters. J. Mol. Evol. 81, 150 - 161 (2015). 33. Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S. & Hirao, I. Generation of high - affinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 453 - 457 (2013). 34. Matsunaga, K., Kimoto, M. & Hirao, I. High-Affinity DNA Aptamer Generation Targeting von Willebrand Factor A1-Domain by Genetic Alphabet Expansion for Systematic Evolution of Ligands by Exponential Enrichment Using Two Types of Libraries Composed of Five Different Bases. J. Am. Chem. Soc. 139, 324-334 (2017). 35. Futami, K., Kimoto, M., Lim, Y. W. S. & Hirao, I. Genetic Alphabet Expansion Provides Versatile Specificities and Activities of Unnatural-Base DNA Aptamers Targeting Cancer Cells. Mol. Ther. Nucleic Acids 14, 158-170 (2019). 36. Sharma, M. et al. Magnitude and Functionality of the NS1-Specific Antibody Response Elicited by a Live-Attenuated Tetravalent Dengue Vaccine Candidate. J. Infect. Dis. (2019). 37. Halstead, S. B., Russell, P. K. & Brandt, W. E. NS1, Dengue's Dagger. J. Infect. Dis. (2019). 38.Hirao, I. et al. An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA. Nat. Methods 3, 729-735 (2006). 39.Yamashige, R. et al. Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Res. 40, 2793-2806 (2012). 40. Yamashige, R., Kimoto, M., Mitsui, T., Yokoyama, S. & Hirao, I. Monitoring the site-specific incorporation of dual fluorophore-quencher base analogues for target DNA detection by an unnatural base pair system. Org. Biomol. Chem. 9, 7504-7509 (2011). 41.Mitsui, T., Kimoto, M., Sato, A., Yokoyama, S. & Hirao, I. An unnatural hydrophobic base, 4propynylpyrrole-2-carbaldehyde, as an efficient pairing partner of 9-methylimidazo[(4,5)-b]pyridine. Bioorg. Med. Chem. Lett. 13, 4515-4518 (2003). 42. Matsunaga, K., Kimoto, M. & Hirao, I. High-Affinity DNA Aptamer Generation Targeting von Willebrand Factor A1-Domain by Genetic Alphabet Expansion for Systematic Evolution of Ligands by Exponential Enrichment Using Two Types of Libraries Composed of Five Different Bases. J. Am. Chem. Soc. 139, 324334 (2017). 43. Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S. & Hirao, I. Generation of high-affinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 453-457 (2013). 44. Kimoto, M., Matsunaga, K. I. & Hirao, I. Evolving Aptamers with Unnatural BasePairs. Curr. Protoc. Chem. Biol. 9, 315-339 (2017). 45. Hamashima, K., Soong, Y. T., Matsunaga, K. I., Kimoto, M. & Hirao, I. DNA Sequencing Method Including Unnatural Bases for DNA Aptamer Generation by Genetic Alphabet Expansion. ACS Synth. Biol. (2019). 46.Quick, J. et al. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nat. Protoc. 12, 1261-1276 (2017). [Industrial Applicability]

[0214] Purpose Aptamer embodiments are high affinity and high specificity unnatural base (UB) DNA aptamers capable of binding to each serotype of the Dengue NS1 protein. In some examples, aptamer embodiments have an hK between 30 pM and 182 pM. D Aptamer embodiments can recognize target Dengue NS1 proteins with amino acid sequences that are 96.3% or more identical to the initial target. UB-DNA aptamer embodiments include Ds (7-(2-thienyl)imidazo[4,5-b]pyridine) and / or diol-modified Pa (pyrrole-2-carbaldehyde) as the fifth and sixth base moieties. Using these UB-DNA aptamer embodiments, a simple and highly specific method for detecting serotype-specific DENV infections has been developed. In this method embodiment, antigens of each serotype of DEN-NS1 can be detected by a sandwich-type ELISA format using a combination of aptamer and antibody, using UB-DNA aptamers that specifically bind to each DEN-NS1 serotype.

[0215] It was also found that anti-DEN-NS1 IgG in the patient's serum sample inhibited the binding of the aptamer to the NS1 protein. Furthermore, analysis of sera from primary or secondary infected patients in Singapore found that IgG production initially reflected the serotype of past infections rather than recent infections. Using these findings, a method for quantitatively identifying serotype-specific IgG antibodies against DEN-NS1 in serum was developed. In an embodiment of this method, detection of serotype-specific IgG antibodies against dengue NS1 protein was performed using a competitive ELISA format. In some instances, detection of anti-DEN-NS1 IgG antibodies in patients within one week of fever (e.g., during the febrile period) indicated secondary infection in the patient, which could be a legitimate reason for close observation.

[0216] Embodiments of the method identify serotype-specific dengue infections by using ELISA with high-affinity DNA aptamers to detect both viral NS1 proteins and their IgG antibodies in the early and late stages of dengue infection. Embodiments of the method enable the diagnosis of both past and current dengue infections, including serotype identification, thus facilitating early medical and vaccine use decisions and analysis. Embodiments of the method can potentially be extended for testing efficacy in vaccine development and for diagnosis of other diseases and allergies.

Claims

**Claim 1** A DNA aptamer against dengue virus (DENV) containing at least one unnatural base, the DNA aptamer consisting of the sequences described in the following table: 【Table 1-1】 【Table 1-2】 。 **Claim 2** The aptamer against DENV according to claim 1, wherein the aptamer consists of a sequence represented by SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 41, SEQ ID NO: 42 or SEQ ID NO:

27. **Claim 3** The aptamer according to claim 1 or 2, wherein the dissociation constant of the aptamer against DENV is 200 pM or less. **Claim 4** The aptamer according to any one of claims 1 to 3, which is capable of binding to the NS1 protein of DENV. **Claim 5** The aptamer according to any one of claims 1 to 4, which is specifically bindable to a single serotype of DENV selected from the group consisting of serotype 1, serotype 2, serotype 3, and serotype 4. **Claim 6** A mixture of aptamers specific for different serotypes, the mixture containing at least two, at least three, or at least four aptamers according to any one of claims 1 to 5. **Claim 7** A method for confirming DENV infection in a subject, comprising: contacting a sample of the subject with an aptamer according to any one of claims 1 to 5 or a mixture of aptamers according to claim 6, and detecting a binding event in the aptamer. The method comprising the above steps. **Claim 8** The method is a method for confirming current DENV infection in the subject, and a binding event of any of the aptamers indicates current DENV infection in the subject. The bound aptamer may be specific for a single DENV serotype. The binding event may indicate current DENV infection of the serotype in the subject. The method according to claim 7. **Claim 9** When the subject shows current DENV infection, further comprising: contacting the sample of the subject with an aptamer according to any one of claims 1 to 5 or a mixture of aptamers according to claim 6 in the presence of a DENV protein, and detecting a binding event of the aptamer. Here, the absence of a binding event for any of the aptamers indicates that the current DENV infection is a secondary DENV infection, The unbound aptamer may be specific to the serotype of DENV, and the absence of the binding event may indicate a past infection with DENV of that serotype in the subject. The method according to claim 8.

10. The method is a method for confirming a past DENV infection in a subject, the contacting step is performed in the presence of a DENV protein, and DENV-specific IgG in the subject forms a complex with the DENV protein, which inhibits the binding event with the aptamer, and as a result, the absence of a binding event for any of the aptamers indicates a past DENV infection in the subject. The unbound aptamer may be specific to the serotype of DENV, and the absence of the binding event may indicate a past infection with DENV of that serotype in the subject. The method according to claim 7.

11. The method according to claim 9 or claim 10, wherein the method includes a competitive binding assay method.

12. The method according to any one of claims 7 to 11, wherein the method is performed within one week after the onset of fever in the subject.

13. A method for evaluating the suitability of a subject for a DENV vaccine, contacting a sample of the subject with a DENV protein, contacting the sample contacted with the DENV protein with the aptamer according to any one of claims 1 to 5 or a mixture of the aptamers according to claim 6, detecting a binding event in the aptamer, wherein when no anti-DENV IgG antibody is present in the sample, a binding event occurs, whereby the DENV protein binds to the aptamer, determining the immune history of the subject based on the binding event in the aptamer (the absence of a binding event for any of the aptamers indicates a past DENV infection in the subject), wherein when the sample contains an anti-DENV IgG antibody that binds to the DENV protein, no binding event occurs, whereby the binding of the DENV protein to the aptamer is inhibited, concluding the suitability of the subject for the DENV vaccine based on the immune history, comprising a method.

14. A kit for confirming DENV infection in a subject, the kit comprising the aptamer according to any one of claims 1 to 5 or a mixture of the aptamers according to claim 6.

15. The kit according to claim 14, further comprising a DENV protein.

Images