Oligonucleic acid molecules and their application in the treatment of acute intermittent porphyria

Abstract

The present invention relates to a small molecule activator nucleic acid molecule for enhancing HMBS gene expression and its application. The small molecule activator nucleic acid molecule of the present invention may be a double-stranded or single-stranded RNA molecule targeting the HMBS gene promoter region, and comprises a first nucleic acid strand and a second nucleic acid strand. The first and second nucleic acid strands each contain complementary regions capable of forming a double-stranded nucleic acid structure that can promote cellular expression of the HMBS gene, for example, through an RNA activation mechanism. The first and second nucleic acid strands are each 16 to 35 nucleotides in length, one nucleotide strand of which has at least 75% identity or complementarity with a target selected from the target gene promoter region, and the other strand of which has at least 75% complementarity with the first strand. The 3' ends of the two oligonucleotide strands may have an overhang of 0 to 6 nucleotides. The use of a small molecule activator nucleic acid molecule targeting the HMBS gene can upregulate cellular expression of HMBS gene mRNA and protein and promote its enzymatic activity.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acids, and specifically relates to oligonucleic acid molecules related to gene activation, such as small molecule activating nucleic acid molecules, and the application of small molecule activating nucleic acid molecules in the activation / upregulation of hydroxymethylbilane synthase (HMBS) gene expression, as well as the application in the treatment of diseases caused by insufficient HMBS expression or reduced activity, such as acute intermittent porphyria.

Background Art

[0002] Hereditary porphyrias are a series of diseases caused by the lack of activity of specific enzymes in the hemoglobin biosynthesis pathway (also called the porphyrin pathway). The lack of enzymes in the porphyrin pathway results in insufficient production of hemoglobin, and porphyrin precursors and porphyrins accumulate. High concentrations of porphyrin precursors and porphyrins in tissues cause tissue toxicity.

[0003] Among the porphyrias, acute intermittent porphyria (AIP, e.g., autosomal dominant AIP), variegate porphyria (VP, e.g., autosomal dominant VP), hereditary coproporphyria (chromaffin cell or HCP, e.g., autosomal dominant HCP), and 5'-aminolevulinic acid (also called δ-aminolevulinic acid or ALA) dehydratase deficiency porphyria (ADP, e.g., autosomal recessive ADP) are classified as acute hepatic porphyrias. Acute neurological symptoms that can threaten life related to the autonomic, peripheral, and central nervous systems include severe abdominal pain, hypertension, tachycardia, constipation, muscle weakness, paralysis, and seizure attacks. If treatment is not appropriate, it can cause limb paralysis, respiratory impairment, and even death. Factors such as many drugs that can induce cytochrome P450, diet, and changes in hormone levels can induce acute attacks of porphyria by improving the activity of hepatic 5'-aminolevulinic acid synthase 1 (ALAS1) (Balwani and Desnick, Blood, 120:4496 - 4504, 2012).

[0004] AIP is also known as porphobilinogen deaminase (PBGD) deficiency or hydroxymethylbilane synthase (HMBS) deficiency. It is the most common acute hepatic porphyria, an autosomal dominant genetic disease caused by mutations in the HMBS gene, with an incidence of 5 - 10 per 100,000 people, and about 5 - 10% of patients showing symptoms. In AIP patients, a mutation occurs in one allele of the HMBS gene, resulting in a 50% decrease in the protein expression level of hydroxymethylbilane synthase (haploinsufficiency). As a result, its enzyme activity decreases, ALA and PBG (porphobilinogen) accumulate in the body, and hemoglobin synthesis becomes insufficient.

[0005] Intravenous injection of hemin is usually used for the treatment and prevention during the acute attack period of AIP patients. By providing exogenous hemoglobin, hemin suppresses the negative feedback of ALAS1 and reduces the production of ALA and PBG. Usually, the patient's response is good, but the effect is slow, and it usually takes 2 to 4 days or longer to normalize the urinary ALA and PBG concentrations. Since the intravenously injected hemin is rapidly metabolized, usually 3 to 4 injections are required to effectively treat or prevent acute attacks. Furthermore, repeated injections may cause iron overload and phlebitis. Currently, the only curative treatment is liver transplantation, but liver transplantation is accompanied by significant complications and mortality, and the supply of liver donors is limited.

[0006] In view of the deficiencies of current treatment methods, a more effective, longer-acting, faster-acting, and safer alternative treatment method is required.

[0007] The present invention provides a method for effectively treating AIP by specifically activating the expression level of the HMBS gene in the body using small molecule activating RNA, thereby promoting the production of endogenous porphobilinogen deaminase (also referred to as hydroxymethylbilane synthase) by cells in the long term, and restoring the normal level of the endogenous porphobilinogen deaminase (also referred to as hydroxymethylbilane synthase) in the cells.

Summary of the Invention

Problems to be Solved by the Invention

[0008] To solve the above problems, the present invention provides a small molecule activating nucleic acid molecule (saRNA) based on the RNA activation process, which activates / upregulates HMBS gene transcription, thereby improving the expression level of HMBS protein, and treating diseases caused by insufficient HMBS expression or reduced activity, such as acute intermittent porphyria.

[0009] In one aspect of the present invention, a small molecule activating nucleic acid molecule that activates or upregulates the expression of the HMBS gene in cells is provided. One strand of the small molecule activating nucleic acid molecule has at least 75% homology or complementarity with a nucleic acid sequence of 16 to 35 nucleotides in length in the promoter region of the HMBS gene, and the activation or upregulation of the gene expression is achieved. The promoter region includes a 400-nucleotide sequence upstream of the transcription start site of the HMBS gene. Specifically, one strand of the small molecule activating nucleic acid molecule of the present invention includes a nucleotide sequence having at least 75% or more homology or complementarity with any continuous 16 to 35 nucleotides in the promoter region of the HMBS gene, where the promoter region means including 400 nucleotides upstream of the transcription start site of the HMBS gene. In a specific embodiment, one strand of the small molecule activating nucleic acid molecule of the present invention has at least 75%, for example, at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100% homology or complementarity with a continuous 16 to 35 nucleotides in the region from -395bp to -351bp (region 1) (tagcctgggcaacatagtgaggccacctccccgctgtctctataa, SEQ ID NO:1) and the region from -179bp to -1bp (region 2) (tgctgcctatttcaaggttgtagcaaagctaagtttgaacagagcaaaggaagcgccatagaagctgcactacttgctcatgtcacagctggggaatggggtggtcgaatggggaggtccactgtcgcaatgttccaattcccgcccagagggagggacctccccttcgagggagggcg, SEQ ID NO:2) upstream of the promoter of the HMBS gene, or is selected from these. More specifically, in one embodiment, one strand of the small molecule activating nucleic acid molecule of the present invention has at least 75%, for example, at least about 79%, about 80%, about 85%, about 90%, about 95%, or about 99% homology or complementarity with any one continuous 16 to 35 nucleotide sequence selected from SEQ ID NO:1 and SEQ ID NO:2.In a specific embodiment, one strand of the small molecule activating nucleic acid molecule of the present invention comprises a nucleotide sequence having at least 75%, such as at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% homology or complementarity with any one continuous 16 - 35 nucleotide sequence selected from SEQ ID NO:1 and SEQ ID NO:2, or is selected therefrom. In another embodiment, one strand of the small molecule activating nucleic acid molecule of the present invention consists of a nucleotide sequence having at least 75%, such as at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% homology or complementarity with any one continuous 16 - 35 nucleotide sequence selected from SEQ ID NO:1 and SEQ ID NO:2.

[0010] In the present invention, the small molecule activating nucleic acid molecule of the present invention includes a double - stranded small molecule activating nucleic acid molecule targeted to the HMBS gene promoter region, comprising a first nucleic acid strand and a second nucleic acid strand. The first nucleic acid strand has at least 75% homology or complementarity with any one continuous 16 - 35 nucleotides in SEQ ID No.1 or SEQ ID No.2 in the HMBS gene promoter. The second nucleic acid strand has at least 75% complementarity with the first nucleic acid strand. The first nucleic acid strand and the second nucleic acid strand can form a double - stranded nucleic acid structure that activates the expression of the HMBS gene in cells by complementing each other.

[0011] The sense nucleic acid strand and the antisense nucleic acid strand of the small molecule activating nucleic acid molecule of the present invention may be present on two different nucleic acid strands or on the same nucleic acid strand. When the sense nucleic acid strand and the antisense nucleic acid strand are each on two strands, at least one strand of the small molecule activating nucleic acid molecule may have a protrusion or overhang at either the 5'-end or the 3'-end. For example, the 3'-end may have a protrusion of 0 to 6 nucleotides in length. Preferably, both strands of the small molecule activating nucleic acid molecule of the present invention have protrusions. More preferably, both 3'-ends of the two strands of the small molecule activating nucleic acid molecule have protrusions of 0 to 6 nucleotides, and most preferably, have protrusions of 2 or 3 nucleotides at the 3'-end. Preferably, the protruding nucleotides may be dT or U, or may be natural nucleotide protrusions. In the present invention, the natural nucleotide protrusion means that the nucleotides protruding from the end of the sense nucleic acid fragment or the antisense nucleic acid fragment are homologous or complementary to the nucleotides of the corresponding target sequence.

[0012] The small molecule activating nucleic acid molecule may include a single-stranded RNA molecule capable of forming a hairpin structure in the double-stranded region. In one embodiment, the small molecule activating nucleic acid molecule of the present invention is a single-stranded small molecule activating RNA molecule targeting the HMBS gene promoter region, and the single-stranded small molecule activating nucleic acid molecule can form a double-stranded region hairpin structure. When the sense nucleic acid strand and the antisense nucleic acid strand are present on the same nucleic acid strand, preferably, the small molecule activating nucleic acid molecule may be a hairpin-type single-stranded nucleic acid molecule, and the complementary region between the sense nucleic acid fragment and the antisense nucleic acid fragment forms a double-stranded nucleic acid structure that can promote the expression of the HMBS gene in cells, for example, through the RNA activation mechanism.

[0013] In the small molecule activating nucleic acid molecule, the lengths of the sense nucleic acid fragment and the antisense nucleic acid fragment may be 16 to 35 nucleotides, for example, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides.

[0014] In one embodiment, the sense strand of the small molecule activating nucleic acid molecule of the present invention has at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 30 to 48, and its antisense strand has at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 49 to 67. In one embodiment, the sense strand of the small molecule activating nucleic acid molecule of the present invention comprises or is selected from sequences having at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 30 to 48, and its antisense strand comprises or is selected from sequences having at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 49 to 67. In one embodiment, the sense strand of the small molecule activating nucleic acid molecule of the present invention consists of a sequence having at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 30 to 48, and its antisense strand consists of a sequence having at least 75%, for example at least about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% identity or homology with any one nucleotide sequence selected from SEQ ID NOs: 49 to 67. In a specific embodiment, the sense strand of the small molecule activating nucleic acid molecule of the present invention may be the sequence shown in any one nucleotide sequence selected from SEQ ID NOs: 30 to 48, and its antisense strand may be the sequence shown in any one nucleotide sequence selected from SEQ ID NOs: 49 to 67.

[0015] In one embodiment, the small molecule activating nucleic acid molecule described herein may be synthesized, transcribed in vitro, or expressed by a vector.

[0016] All nucleotides in the small molecule activating nucleic acid molecule described herein may be natural nucleotides without chemical modification, or may contain at least one modification. In one embodiment, the modification in the small molecule activating nucleic acid molecule herein may be a chemical modification, for example, there is a chemical modification on at least one nucleotide. The chemical modification used in the present invention includes one or more of the following modifications or any combination thereof, or is selected from these. (1) Modification to the phosphodiester bond of the nucleotide in the nucleotide sequence of the small molecule activating nucleic acid molecule, (2) Modification to the 2'-OH of ribose in the nucleotide sequence of the small molecule activating nucleic acid molecule, (3) Modification to the base in the nucleotide sequence of the small molecule activating nucleic acid molecule, (4) At least one nucleotide in the nucleotide sequence of the small molecule activating nucleic acid molecule is a strand nucleic acid.

[0017] The chemical modification is known to those skilled in the art. The phosphodiester bond modification refers to the modification to the oxygen in the phosphodiester bond, including but not limited to phosphorothioate modification and boranophosphate modification. Both modifications can stabilize the structure of the small molecule activating nucleic acid molecule and maintain the high specificity and high affinity of base pairing.

[0018] Ribose modification refers to the modification to the 2'-OH in the nucleotide pentose, that is, several substituents are introduced at the hydroxy position of ribose, including but not limited to 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylene methoxy modification, 2,4'-dinitrophenol modification, locked nucleic acid (LNA), 2'-amino modification, 2'-deoxy modification, etc.

[0019] Base modification refers to the modification of the base of a nucleotide, including, for example, 5′-bromouracil modification, 5′-iodouracil modification, N-methyluracil modification, 2,6-diaminopurine modification, etc., but not limited to these.

[0020] These modifications improve the bioavailability of small molecule-activated nucleic acid molecules, enhance the affinity with the target sequence, and improve the resistance to nuclease hydrolysis in cells.

[0021] In addition to the above modifications, in order to promote the entry of small molecule-activated nucleic acid molecules into cells, a lipidophilic group such as cholesterol can be introduced at the end of the sense strand or antisense strand of the small molecule-activated nucleic acid molecule so as to act on the promoter region of the gene in the cell nucleus through the cell membrane and nuclear membrane composed of lipid bilayers.

[0022] When the small molecule-activated nucleic acid molecule according to the present invention contacts cells, it can effectively activate or up-regulate the expression of the HMBS gene in the cells, preferably, at least up-regulate the expression by 10%.

[0023] Another aspect of the present invention relates to a nucleic acid encoding the small molecule-activated nucleic acid molecule described herein. In one embodiment, the nucleic acid may be a DNA molecule.

[0024] In another aspect of the present invention, a cell containing the small molecule-activated nucleic acid molecule described above or a nucleic acid encoding the small molecule-activated nucleic acid molecule described herein is provided. In one embodiment, the small molecule-activated nucleic acid molecule of the present invention may be a double-stranded small molecule-activated nucleic acid molecule targeting the HMBS gene promoter region, including a sense strand and an antisense strand. In another embodiment, the small molecule-activated nucleic acid molecule of the present invention may be a single-stranded small molecule-activated nucleic acid molecule targeting the HMBS gene promoter region.

[0025] In another aspect of the present invention, there is provided a kit comprising the small molecule-activated nucleic acid molecule described above or a nucleic acid encoding the small molecule-activated nucleic acid molecule described herein.

[0026] Another aspect of the present invention relates to the use of the small molecule-activated nucleic acid molecule, the nucleic acid encoding the small molecule-activated nucleic acid molecule herein, in the manufacture of a medicament for activating / upregulating HMBS gene expression in cells.

[0027] Another aspect of the present invention relates to the use of the small molecule-activated nucleic acid molecule, the nucleic acid encoding the small molecule-activated nucleic acid molecule herein, the cells of the present invention, in the manufacture of a medicament for treating a disease caused by insufficient HMBS expression or reduced activity in a subject. In one embodiment, the disease caused by insufficient HMBS expression or reduced activity may include hereditary porphyria. Hereditary porphyria may include, for example, acute intermittent porphyria.

[0028] Another aspect of the present invention relates to the use of the small molecule-activated nucleic acid molecule, the nucleic acid encoding the small molecule-activated nucleic acid molecule herein, the cells of the present invention, in the manufacture of a medicament for treating acute intermittent porphyria in a subject.

[0029] Another aspect of the present invention also relates to a method for treating a disease caused by insufficient HMBS expression or reduced activity in a subject, comprising administering the small molecule-activated nucleic acid molecule, the nucleic acid encoding the small molecule-activated nucleic acid molecule herein, or the cells of the present invention to the subject.

[0030] Another aspect of the present invention also relates to a method for treating acute intermittent porphyria in a subject, comprising administering the small molecule-activated nucleic acid molecule, the nucleic acid encoding the small molecule-activated nucleic acid molecule herein, or the cells of the present invention to the subject.

[0031] The present invention also relates to a method for activating / upregulating the expression of the HMBS gene in cells, comprising administering the small molecule-activated nucleic acid molecule or the nucleic acid encoding the small molecule-activated nucleic acid molecule herein to the cells.

[0032] The small molecule activating nucleic acid molecule of the present invention may be directly introduced into cells, or may be produced intracellularly by introducing a nucleic acid sequence encoding the small molecule activating nucleic acid molecule of the present invention into cells. The cells are preferably mammalian cells, more preferably human cells. The above cells may be isolates such as cell lines and cell strains, or may be isolated from mammalian bodies such as the human body. The human body may be a patient suffering from symptoms caused by a decrease in HMBS protein expression. The small molecule activating nucleic acid molecule herein can be dosed in an amount sufficient to treat symptoms caused by a decrease in HMBS protein expression. Specifically, the symptoms caused by the lack of the amount of the HMBS protein include, or are selected from, acute intermittent porphyria.

[0033] According to another aspect of the present invention, there is provided a site of action of a small molecule activating nucleic acid molecule of an isolated HMBS gene, which has any continuous 16-35 nucleotide sequence in the promoter region of the HMBS gene, preferably any continuous 16-35 nucleotide sequence in any one of the sequences selected from SEQ ID NO: 1-2. Specifically, the site of action is represented by any one of the nucleotide sequences selected from SEQ ID NO: 11-29.

Effects of the Invention

[0034] The small molecule activating nucleic acid molecule capable of activating / upregulating HMBS gene expression according to the present invention can activate the HMBS gene for a long period of time. Therefore, it can efficiently and specifically upregulate or restore the expression of the HMBS gene and protein and the activity of the enzyme, and has low toxicity and side effects. It is used in the manufacture of pharmaceuticals or preparations for activating / upregulating the expression of the HMBS gene and protein in cells.

Brief Description of the Drawings

[0035]

Figure 1

[0036]

Figure 2

[0037]

Figure 3

[0038]

Figure 4

[0039]

Figure 5

[0040]

Figure 6

[0041]

Figure 7

[0042]

Figure 8

[0043]

Figure 9

[0044]

Figure 10

Modes for Carrying Out the Invention

[0045] In the present invention, related terms are defined as follows.

[0046] As used herein, the term "complementary" means the ability of two oligonucleotide strands to form base pairs with each other. Base pairs are usually formed by hydrogen bonding between nucleotides in oligonucleotide strands that are parallel in the opposite direction. Complementary oligonucleotide strands can base pair in the Watson-Crick manner (e.g., A-T, A-U, C-G) or in any other manner that can form a double-stranded body (e.g., Hoogsteen-type or reverse Hoogsteen-type base pairing).

[0047] Complementation includes two types: perfect complementation and imperfect complementation. Perfect complementation, or 100% complementation, means that each nucleotide from the first oligonucleotide strand in the double-stranded region of a double-stranded oligonucleotide molecule can form a hydrogen bond with the nucleotide at the corresponding position of the second oligonucleotide strand without "mismatch". Imperfect complementation means that not all double-stranded nucleotide units can be joined to each other by hydrogen bonds. For example, for two oligonucleotide strands with a double-stranded region length of 20 nucleotides, if only two base pairs in each strand can be joined to each other by hydrogen bonds, the oligonucleotide strands have 10% complementarity. In the same example, if 18 base pairs in each strand can be joined to each other by hydrogen bonds, the oligonucleotide strands have 90% complementarity. Substantial complementation means complementing at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%.

[0048] As used herein, the term "oligonucleotide" or "small molecule nucleic acid molecule" means a polymer of nucleotides and includes single-stranded or double-stranded molecules of DNA, RNA, or DNA / RNA hybrids, but is not limited thereto, and includes oligonucleotide strands with regularly or irregularly alternating deoxyribosyl moieties and ribosyl moieties, as well as modified, naturally occurring, or non-naturally occurring backbones of these types of oligonucleotides. The oligonucleotide for activating target gene transcription described in the present invention is a small molecule activating nucleic acid molecule.

[0049] As used herein, the terms "oligonucleotide strand" and "oligonucleotide sequence" can be used interchangeably and are a general term for short-chain nucleotides having 35 or fewer bases (including nucleotides in deoxyribonucleic acid DNA or ribonucleic acid RNA). In the present invention, the length of the oligonucleotide strand can be any length from 16 to 35 nucleotides.

[0050] As used herein, the term "first nucleic acid strand" may be a sense strand or an antisense strand. The sense strand of a small molecule activating RNA refers to a nucleic acid strand that includes a nucleic acid strand having identity with the coding strand of the promoter DNA sequence of the target gene in the small molecule activating RNA duplex, and the antisense strand refers to a nucleic acid strand that is complementary to the sense strand in the small molecule activating RNA duplex.

[0051] As used herein, the term "second nucleic acid strand" may be a sense strand or an antisense strand. When the first oligonucleotide strand is a sense strand, the second oligonucleotide strand is an antisense strand. On the other hand, when the first oligonucleotide strand is an antisense strand, the second oligonucleotide strand is a sense strand.

[0052] As used herein, the term "gene" means all nucleotide sequences necessary for encoding one polypeptide chain or for transcription of one functional RNA. A "gene" may be endogenous to the host cell or a completely or partially recombinant gene (e.g., an exogenous oligonucleotide into which a coding promoter has been introduced and a coding sequence, or one in which a heterologous promoter adjacent to an endogenous coding sequence has been introduced into the host cell). For example, a "gene" includes a nucleic acid sequence composed of exons and introns. The sequence encoding a protein is, for example, a sequence included in an exon in the open reading frame between the start codon and the stop codon. In the present invention, a "gene" can include gene control sequences such as promoters, enhancers, etc. and all other sequences that control the transcription, expression, or activity of other genes known in the art, regardless of whether other genes include coding sequences or non-coding sequences. In one case, for example, a "gene" can be used to describe a functional nucleic acid that includes control sequences such as promoters and enhancers. The expression of a recombinant gene can be controlled by one or more heterologous control sequences.

[0053] As used herein, the "target gene" refers to a nucleic acid sequence that naturally exists in vivo, a recombinant gene, a viral or bacterial sequence, a chromosome or an extrachromosomal entity, and / or one that has been transiently or stably transfected or incorporated into cells and / or their chromatin. The target gene may be a protein-coding gene or a non-protein-coding gene (e.g., a microRNA gene, a long non-coding RNA gene). The target gene usually contains a promoter sequence. By designing a small molecule activating nucleic acid molecule that has identity (also referred to as homology) with the promoter sequence, positive regulation of the target gene can be achieved, which is manifested as up-regulation of the expression of the target gene. The "target gene promoter sequence" refers to the non-coding sequence of the target gene. In the present invention, the target gene promoter sequence that is "complementary to the target gene promoter sequence" refers to the coding strand (also referred to as the non-template strand) of the sequence, i.e., a nucleic acid sequence identical to the gene coding sequence. The "target sequence" refers to a sequence fragment that is homologous or complementary to the sense oligonucleotide strand or the antisense oligonucleotide of the promoter sequence of the target gene among the small molecule activating nucleic acid molecules.

[0054] As used herein, the terms "sense strand" and "sense oligonucleotide strand" are used interchangeably. The sense oligonucleotide strand of the small molecule activating nucleic acid molecule means that the double-stranded body of the small molecule activating nucleic acid molecule contains a first nucleic acid strand that has identity with the coding strand of the promoter sequence of the target gene.

[0055] As used herein, the terms "antisense strand" and "antisense oligonucleotide" are used interchangeably. The antisense oligonucleotide strand of the small molecule activating nucleic acid molecule refers to the second nucleic acid strand that is complementary to the sense oligonucleotide strand in the double-stranded body of the small molecule activating nucleic acid molecule.

[0056] As used herein, the "coding strand" refers to a single DNA strand that cannot be transcribed in the target gene, and the nucleotide sequence of this strand is identical to the sequence of the RNA generated by transcription (with U replacing T in DNA in RNA). The coding strand of the double-stranded DNA sequence of the target gene promoter described in the present invention means the promoter sequence present on the same DNA strand as the target gene DNA coding strand.

[0057] As used herein, the "template strand" refers to the other strand complementary to the coding strand among the double-stranded DNA of the target gene, which means a strand that can be transcribed into RNA as a template, and this strand is complementary to the transcribed RNA bases (A-U, G-C). During the transcription process, RNA polymerase binds to the template strand, moves along the 3'→5' direction of the template strand, and catalyzes the synthesis of RNA in the 5'→3' direction. The template strand of the double-stranded DNA sequence of the target gene promoter described in the present invention means the promoter sequence present on the same DNA strand as the target gene DNA template strand.

[0058] As used herein, a "promoter" is a sequence that exerts a regulatory effect on the transcription of protein-coding or RNA-coding nucleic acid sequences by being positionally associated with them. Usually, eukaryotic gene promoters contain 100 to 5,000 base pairs, but this length range is not intended to limit the "promoter" as used herein. The promoter sequence is generally located at the 5' end of the protein-coding or RNA-coding sequence, but it also exists in exon and intron sequences.

[0059] As used herein, the term "transcription start site" means the nucleotide for marking the start of transcription on the template strand of a gene. The transcription start site can appear on the template strand of the promoter region. A gene can have one or more transcription start sites.

[0060] As used herein, the term "homology" means that one oligonucleotide strand (sense strand or antisense strand) of a small molecule activating RNA has similarity to the coding strand or template strand of a region of the promoter sequence of a target gene. As used herein, said "homology" may be at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95%, about 99% or about 100%.

[0061] As used herein, the terms "protrusion", "overhang", and "オーバーハング" are used interchangeably and mean non-base paired nucleotides at the end (5' or 3') of an oligonucleotide strand, which are produced from the other strand extending from one strand within a double-stranded oligonucleotide. A single-stranded region protruding from the 3' and / or 5' ends of a double-stranded body is referred to as a "protrusion".

[0062] As used herein, the terms "gene activation", "activated gene", "upregulation of a gene", and "upregulated gene" are used interchangeably and mean measuring an increase in the transcription, translation, expression, or activity of a nucleic acid by measuring the transcriptional level, mRNA level, protein level, enzyme activity, methylation state, chromatin state or conformation, translation level, or this activity or state in a cell or biological system. These activities or states can be measured directly or indirectly. Also, "gene activation", "activated gene", "upregulation of a gene", "upregulated gene" mean an increase in the activity correlated with a nucleic acid sequence regardless of the mechanism of such activation, for example, exerting a regulatory effect as a regulatory sequence, being transcribed into RNA, or being translated into protein to increase protein expression. Preferably, the small molecule activating RNA molecule according to the present invention can upregulate gene or protein expression or increase the activity by at least 10%.

[0063] As used herein, the terms "small molecule activating RNA", "saRNA", and "small molecule activating nucleic acid molecule" are used interchangeably and refer to nucleic acid molecules that can promote gene expression, and include a first nucleic acid fragment (antisense strand; also referred to as an antisense oligonucleotide strand) containing a nucleotide sequence having sequence homology or identity with a non-coding nucleic acid sequence of a target gene (such as a promoter, enhancer, etc.), and a second nucleic acid fragment (sense strand; also referred to as a sense strand or sense oligonucleotide strand) containing a nucleotide sequence complementary to the first nucleic acid fragment, wherein the first nucleic acid fragment and the second nucleic acid fragment form a duplex. The small molecule activating nucleic acid molecule may be composed of single-stranded RNA molecules that can be synthesized or expressed by a vector and can form a hairpin structure in the double-stranded region. Among them, the first region contains a nucleotide sequence having sequence identity with the promoter target sequence of the gene, and the nucleotide sequence contained in the second region is complementary to the first region. The length of the double-stranded region of the small molecule activating nucleic acid molecule is usually about 10 to about 50 base pairs, about 12 to about 48 base pairs, about 14 to about 46 base pairs, about 16 to about 44 base pairs, about 18 to about 42 base pairs, about 20 to about 40 base pairs, about 22 to about 38 base pairs, about 24 to about 36 base pairs, about 26 to about 34 base pairs, about 28 to about 32 base pairs, and is usually about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50 base pairs. Also, "saRNA", "small molecule activating RNA", and "small molecule activating nucleic acid molecule" include nucleic acids other than ribonucleotide moieties, including modified nucleotides or analogs thereof, but are not limited thereto.

[0064] As used herein, the term "hot spot" means a gene promoter region having a length of at least 30 bp. In these regions, aggregation of functional small molecule activating nucleic acid molecule targets appears, that is, at least 30% of the small molecule activating nucleic acid molecules targeting these hot spot regions can induce the expression of the target gene mRNA to be 1.2 times or more.

[0065] As used herein, "synthesis" refers to the method of synthesizing oligonucleotides and includes any method capable of synthesizing RNA, such as chemical synthesis, in vitro transcription, vector expression, etc.

[0066] The present invention upregulates the expression of the HMBS gene by RNA activation and promotes the production of hemoglobin by increasing the expression level of the HMBS protein. In the present invention, the HMBS gene is also referred to as the target gene.

[0067] The method for producing the small molecule activating nucleic acid molecule provided by the present invention includes sequence design and sequence synthesis.

[0068] For the synthesis of the small molecule activating nucleic acid molecule sequence, a chemical synthesis method may be adopted, or a biotechnology company specializing in nucleic acid synthesis may be commissioned.

[0069] Generally, the chemical synthesis method includes the following four steps: (1) synthesis of oligoribonucleotides; (2) deprotection; (3) purification and separation; (4) desalting and annealing.

[0070] For example, the specific steps of the chemical synthesis of the oligonucleic acid molecule of the present invention are as follows.

[0071] (1) Synthesis of oligonucleic acid molecules

[0072] Set up the synthesis of 1 micromole of RNA with an automatic DNA / RNA synthesizer (for example, Applied Biosystems EXPEDITE8909), and set the coupling time for 1 cycle to 10 - 15 minutes. Use the solid-phase linked 5'-O-paradimethoxytrityl-thymidine support as the initiator, link the base to the solid-phase support in the first cycle, and link the base to the base linked in the (n - 1)th cycle in the nth cycle (19 ≥ n ≥ 2). In this way, repeat the cycle until the synthesis of all nucleic acid sequences is completed.

[0073] (2) Deprotection

[0074] Place the solid support linked to the oligo nucleic acid molecule into a test tube. Then, add 1 mL of an ethanol / ammonia aqueous solution (volume ratio 1:3) to this test tube. After that, stopper the test tube and place it in an incubator at 25 - 70 °C for 2 - 30 hours of incubation. Filter the solution containing the solid support of the oligo nucleic acid molecule to collect the filtrate, and elute the solid support twice with distilled water (1 mL each time) to collect the filtrate. Combine the collected eluates and dry them under vacuum conditions for 1 - 12 hours. Then, add 1 mL of a tetrahydrofuran solution (1 M) of tetrabutylammonium fluoride, let it stand at room temperature for 4 - 12 hours, and further add 2 mL of n-butanol. Collect the precipitate by high-speed centrifugation to obtain a crude product of single-stranded saRNA.

[0075] (3) Purification and separation

[0076] Dissolve the obtained crude product of saRNA in 2 mL of an ammonium acetate aqueous solution with a concentration of 1 mol / mL, and then separate it using a high-performance liquid chromatography reverse-phase C18 column to obtain a purified single-stranded product of the oligo nucleic acid molecule.

[0077] (4) Desalting and annealing

[0078] Remove the salt by size exclusion gel filtration method, and mix the single-stranded oligo ribonucleic acids of the sense strand and the antisense strand in the same molar ratio in 1 - 2 mL of buffer (10 mM Tris, pH = 7.5 - 8.0, 50 mM NaCl). Heat this solution to 95 °C and then slowly cool it to room temperature to obtain a solution containing the oligo nucleic acid molecule.

[0079] Hereinafter, the present invention will be further described with reference to specific examples and drawings. These examples are only for explaining the present invention and do not limit the scope of the present invention. In the following examples, for experimental methods where specific conditions are not specified, generally, common conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer, are used.

Example

[0080] Example 1 Design and Synthesis of Small Molecule Activating Nucleic Acid Molecules Targeting the HMBS Promoter

[0081] A sense promoter sequence of 395 bp in length from the transcription start site (TSS) of the HMBS gene to -395 bp upstream was obtained from the UCSC Genome Database (genome.ucsc.edu). Except for excluding some repetitive sequences (-350 to -180) from the target, the remaining two sequences (Region 1 of 45 bp: -395 to -351 and Region 2 of 179 bp: -179 to -1) were used as templates. From the most upstream to the downstream, a target of 19 bp in size was selected. A total of 27 targets were obtained in Region 1 and a total of 161 targets were obtained in Region 2 (Figure 1). Then, the target sequences were filtered, and the target sequences were retained based on the criteria that 1) the GC content was between 35% and 75%, 2) it did not contain 5 or more consecutive identical nucleotides, 3) it did not contain more than 3 dinucleotide repeat sequences, and 4) it did not contain more than 3 trinucleotide repeat sequences. After filtering, the remaining 180 target sequences entered the screening process as candidates. Based on these candidate sequences, the corresponding double-stranded oligo nucleic acid molecules were chemically synthesized. Among them, the lengths of both the sense strand and the antisense strand of the double-stranded oligo nucleic acid molecule used in this experiment were 21 nucleotides. The 19 nucleotides in the 5' region of the first ribonucleic acid strand (sense strand) of the double-stranded oligo nucleic acid molecule had 100% identity with the target sequence of the promoter, and its 3' end contained a TT sequence. The 19 nucleotides in the 5' region of the second ribonucleic acid strand were complementary to the sequence of the first ribonucleic acid strand, and its 3' end contained a TT sequence. The two strands of the aforementioned oligo nucleic acid molecule were mixed in an equal molar amount and annealed to form a double-stranded oligo nucleic acid molecule.

[0082] Example 2 Screening of saRNA Targeting the HMBS Promoter

[0083] (1) Cell Culture and Transfection Human hepatoma cell lines Huh7 and HepG2 were cultured in DMEM medium (Gibco). Human embryonic liver cells CCC-HEL-1 and human hepatoma cells Li-7 were cultured in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (Sigma-Aldrich) and 1% penicillin / streptomycin (Gibco). The cells were cultured under the conditions of 5% CO2 and 37 °C. According to the manufacturer's instructions, double-stranded oligonucleic acid molecules were transfected by reverse transfection at a concentration of 10 nM (unless otherwise specified) with RNAiMax (Invitrogen, Carlsbad, CA).

[0084] (2) One-step RT-qPCR

[0085] After transfection, the medium was discarded, 150 μl of PBS was added to each well for one wash, the PBS was discarded, 50 μl of cell lysate (the components or origin of the lysate?) was added to each well, and the mixture was incubated at room temperature for 5 minutes. 1 μl of cell lysate was taken from each well, and one-step TB Green TM PrimeScrip TM RT-PCR Kit II (Takara, RR086A) was used to perform qPCR analysis on the LightCyclerR 480 system (Roche). Three duplicate wells were amplified repeatedly for each sample, and the PCR reaction conditions are shown in Table 1 below. JPEG0007711944000001.jpg50170

[0086] The reaction conditions were as follows: Stage 1 reverse transcription reaction: 42 °C, 5 minutes; 95 °C for 10 seconds; Stage 2 PCR reaction: 95 °C for 5 seconds, 60 °C for 20 seconds, amplified for 45 cycles. HPRT1 and TBP were used as internal standard genes. The PCR primers for HMBS, HPRT1, and TBP are shown in Table 1 below. Among them, HMBS was amplified with the HMBS F1 / R1 primer pair. JPEG0007711944000002.jpg43170

[0087] To calculate the expression value (E rel ) of HMBS (target gene) in a certain saRNA transfection sample relative to the control treatment (Mock), the Ct values of the target gene and two internal reference genes were substituted into Equation 1 for calculation. JPEG0007711944000003.jpg12170

[0088] Among them, CtTm is the Ct value of the target gene derived from the Mock sample, CtTs is the Ct value of the target gene derived from the saRNA-treated sample, CtR1m is the Ct value of internal reference gene 1 derived from the Mock-treated sample, CtR1s is the Ct value of internal reference gene 1 derived from the saRNA-treated sample, CtR2m is the Ct value of internal reference gene 2 derived from the Mock-treated sample, and CtR2s is the Ct value of internal reference gene 2 derived from the saRNA-treated sample.

[0089] (3) Screening of functional saRNA

[0090] To obtain saRNAs transcribed by activated HMBS, each of the 180 double-stranded oligonucleic acid molecules was used to transfect Huh7 cells at a transfection concentration of 10 nM. After 72 hours, the cells were lysed and analyzed by one-step RT-qPCR in the same manner as described above to obtain the relative (compared to Mock) expression values of the HMBS gene in each saRNA-treated sample. As is clear from the results, activation was observed in 19 saRNAs. These double-stranded oligonucleic acid molecules with activated activities are called activating saRNAs.

[0091] Figures 2 and 3 further show the activity distribution of HMBS saRNA and the changes in HMBS mRNA expression mediated by saRNA. JPEG0007711944000004.jpg241170JPEG0007711944000005.jpg243170

[0092] Example 3 Promotion of HMBS gene expression in various cell lines by saRNA Using the saRNAs shown in Table 4 (n = 13, final concentration 20 nM), human hepatocellular carcinomas Huh7, HepG2, and human embryonic hepatocytes CCC-HEL-1 were each transfected by the method described in Example 2. After 72 hours of transfection, the cells were collected and RNA was extracted using the Qiagen RNeasy kit. After reverse transcription, qPCR amplification was performed on the HMBS gene using the 7500 FAST real-time PCR system. At the same time, the HPRT1 and TBP genes were amplified and used as internal standards. Mock, dsCon2, and siHMBS were blank transfection, double-stranded RNA transfection of an irrelevant sequence, and small interfering RNA control transfection, respectively. The PCR results were analyzed by the method described in Example 2. From the results shown in Figure 4, the candidate saRNAs were able to promote the mRNA expression level of the HMBS gene in various cell lines.

[0093] Example 4 Promotion of HMBS Protein Expression by saRNA Using the saRNA shown in Figure 5 (final concentration 20 nM), human hepatocellular carcinoma HepG2 was reverse transfected. After 72 hours, the cells were collected and lysed with an appropriate amount of cell lysis buffer containing protease inhibitors (1× RIPA buffer, Cell Signaling Technology). Proteins were quantified by the BCA method, then subjected to polyacrylamide gel electrophoresis separation and transferred to a 0.45 μm PVDF membrane. The primary antibody used was rabbit monoclonal anti-HMBS (Abcam, ab129092), the α / β-tubulin antibody (Cell Signaling Technology, 2148s) was used to detect the imprint, and the secondary antibody was anti-rabbit IgG, HRP-linked antibody (Cell Signaling Technology). Image Lab (BIO-RAD, Chemistry Doc tmThe detection signal was scanned using an MP Imaging System. As shown in Fig. 5, the candidate saRNA increased the HMBS protein expression level in HepG2 cells by about 2-fold, and the expression level of some proteins was improved to 2.5-fold. The activating saRNA had a significant activating effect on HMBS protein expression in liver cells.

[0094] Example 5 Promotion of HMBS Enzyme Activity by saRNA AIP is a disease caused by the deficiency or insufficient activity of the third hydroxymethylbilane synthase (HMBS) in the hemoglobin synthesis pathway, resulting in insufficient hemoglobin synthesis due to the accumulation of δ-aminolevulinic acid (ALA) and PBG (porphobilinogen) in the body. ALA is a simple endogenous 5-carbon chemical substance and is involved in the biosynthesis of hemoglobin in the body. ALA, as a precursor of hemoglobin, is converted into highly photosensitive protoporphyrin IX (Proto-porphyrin IX, abbreviated as PPIX) in mitochondria by the action of a series of enzymes such as ALA dehydratase, and PPIX binds to Fe ions to generate hemoglobin, which is an intermediate in the last step of hemoglobin biosynthesis. Under normal circumstances, the hemoglobin biosynthesis pathway is regulated by the negative feedback of the living body, that is, the synthesis of ALA is regulated by the intracellular hemoglobin content. Therefore, excessive ALA does not accumulate in the body. When exogenous ALA is added to cells, the hemoglobin synthesis pathway of the cells can convert ALA into PPIX. The content of PPIX can be detected by a fluorescence method. Therefore, by detecting the fluorescence intensity of PPIX, the strength of HMBS activity and the biosynthesis amount of hemoglobin can be indirectly reflected (Sassa et al., J Exp Med 1975;142:722-731, Divaris et al., Am J Pathol 1990;136:891-897, Kennedy et al., J Photochem Photobiol 1992;14:275-292). Such a detection method is called ALA conversion analysis.

[0095] Human embryonic liver cells CCC-HEL-1 (2×10 5Cells / well) were inoculated, and the saRNA shown in Fig. 6 was transfected into the cells by the reverse transfection method described in the manufacturer's instructions using RNAiMax (Invitrogen, Carlsbad, CA), with the final concentration set at 20 nM. 48 hours after transfection, the cells were treated with 1 mM ALA for 0 hours (baseline) and 24 hours. Three days after transfection, the cells were collected in 1.5 ml centrifuge tubes, a portion of the sample was taken out, the cells were lysed on ice for 10 minutes using 300 μl of 1N 1:1 MeOH-PCA, centrifuged at 10,000 g for 10 minutes at 4 °C, 100 μl of the supernatant was added to a black 96-well plate, and the fluorescence intensity was detected using a multifunctional microplate reader (TECAN Infintie M200PRO) with an excitation light of 400 nM and an emission light of 660 nM. For another portion of the sample, the cells were lysed using 1× RIPA lysis buffer (Cell Signaling Technology), and the protein concentration was detected by the BCA method. Finally, the data was normalized using the fluorescence intensity / protein concentration.

[0096] As shown in Fig. 6, compared with the Mock and dsCon2 control groups, in the cells transfected with the activating saRNA, the fluorescence intensity corresponding to the unit protein concentration was significantly increased, indicating that the activation of the HMBS gene by saRNA improved the activity of the HMBS enzyme and ultimately promoted the synthesis of hemoglobin.

[0097] Example 6 Dose-dependent promotion of saRNA on the expression of HMBS gene mRNA and protein, and dose-dependent increase of saRNA on HMBS enzyme activity Cells were cultured as in Example 2, and human hepatoma cells (Li-7) were seeded at 2×10 5Cells were inoculated into a 6-well plate at the cell / well level, and the saRNA (RAG5-386) shown in Fig. 7 was transfected into the cells by the reverse transfection method described in the manufacturer's instructions using RNAiMax (Invitrogen, Carlsbad, CA). The final concentrations of transfection were 1, 10, 20, 50, and 100 nM, respectively. Three groups of the same saRNA (RAG5-386) were transfected and used in different experiments. Among these, after one group of cells was transfected for 24 hours, 1 mM ALA was added and the cells were treated for 48 hours. Then the cells were collected, and the fluorescence intensity of PPIX was analyzed. At the same time, the cells were lysed to measure the protein concentration. The remaining two groups of cells were transfected and cultured for 72 hours, and then the cells were collected and used for the expression of HMBS gene mRNA and protein, respectively. The quantitative methods for cell mRNA extraction and protein lysis were as described in Example 3 and Example 4.

[0098] As shown in Fig. 7, with the increase in the dose of saRNA (RAG5-386), although to different extents, the expression of both HMBS gene mRNA and protein increased. (A) shows the mRNA expression after saRNA (RAG5-386) treatment. Compared with the control treatment, the mRNA expression in the siHMBS group decreased by more than 90%, indicating the effectiveness of the transfection system in the experiment. The saRNA (RAG5-386) group had an activation effect about twice as high, and especially reached a peak with the treatment of 20 nM saRNA (RAG5-386). (B) shows the protein expression level after saRNA (RAG5-386) treatment. Compared with the control treatment, the expression level of HMBS protein was upregulated with the increase in the dose of saRNA (RAG5-386), and all had an activation effect of more than 1.5 times, showing an obvious dose-dependent expression. (C) shows the change in PPIX fluorescence intensity after saRNA (RAG5-386) treatment. The saRNA (RAG5-386) group showed an increase to different extents. As is obvious from the above results, saRNA (RAG5-386) promoted HMBS gene activation, improved the activity of HMBS enzyme, and finally promoted hemoglobin synthesis.

[0099] Example 7 Promotion of the Expression of HMBS Gene mRNA and Protein by saRNA in Cells GM01623 of AIP Patients Cells GM01623, GM01624, and GM01625 (purchased from Coriell Institute, Camden, NJ, USA) were cultured in MEM medium (Gibco), and all media contained 15% fetal bovine serum (Sigma-Aldrich), 1% NEAA (non-essential amino acids, purchased from Thermo Fisher; product number: 11140050), and 1% penicillin / streptomycin (Gibco). The cells were cultured under the conditions of 5% CO2 and 37 °C. GM01623 cells (1×10 5 cells / well) were seeded in a 6-well plate and transfected using RNAiMax with a final transfection concentration of 20 nM. Cells were collected 72 hours after transfection. The methods for quantitative cell mRNA extraction and proteolysis were the same as those in Example 3 and Example 4.

[0100] As shown in Fig. 8, the candidate saRNA promoted the expression of HMBS gene mRNA and protein in the cells GM01623 of AIP patients. (A) shows the mRNA expression after the candidate saRNA treatment. Compared with the control treatment, siHMBS was knocked down by more than 90%, showing a significant effect as a small interfering RNA, indicating the effectiveness of the transfection system in the experiment. The relative expression levels of mRNA after the saRNA treatment were all higher than those in the control treatment group. The expression values of five groups, namely RAG5-126, RAG5-373, RAG5-179, RAG5-386, and RAG5-374, increased by 56%, 14%, 45%, 96%, and 25% respectively, indicating that all the candidate saRNAs according to the present invention can activate the expression of HMBS gene mRNA. (B) shows the protein expression after the candidate saRNA treatment. Compared with the control treatment, although the degree was different, the protein amounts in the RAG5-126, RAG5-373, RAG5-179, and RAG5-386 groups all increased after the saRNA treatment. Among them, the RAG5-126 group increased by 50%, showing an obvious activation effect, indicating that all the candidate saRNAs according to the present invention can activate the expression of HMBS protein.

[0101] Example 8 Promotion of the expression of HMBS gene mRNA and protein in the cells GM01624 of AIP patients by saRNA The culture and transfection conditions of GM01624 cells were as described in Example 7, and the quantitative methods for mRNA extraction and proteolysis of the cells were as described in Examples 3 and 4. As shown in Figure 9, the candidate saRNA was able to promote the expression of HMBS gene mRNA and protein in the cells GM01624 of AIP patients. (A) shows the mRNA expression after treatment with the candidate saRNA. Compared with the control treatment, siHMBS was knocked down by 90%, showing a significant effect as a small interfering RNA, which indicated the effectiveness of the transfection system in the experiment. The relative expression levels of mRNA after saRNA treatment were all higher than those in the control treatment group. The expression values of the three groups of RAG5-126, RAG5-179, and RAG5-386 increased by more than 50% respectively, showing a significant activation effect, which indicated that the candidate saRNA according to the present invention could activate the expression of HMBS gene mRNA. (B) shows the protein expression after treatment with the candidate saRNA. Although the degree was different compared with the control treatment, the protein amounts in the groups of RAG5-126, RAG5-373, RAG5-179, and RAG5-386 after saRNA treatment all showed an increase, which indicated that the candidate saRNA according to the present invention could activate the expression of HMBS protein to different degrees.

[0102] Example 9 Promotion of the expression of HMBS gene mRNA and protein in the cells GM01625 of AIP patients by saRNA The culture and transfection conditions of GM01625 cells were the same as those in Example 7, and the quantitative methods for mRNA extraction and proteolysis of the cells were the same as those in Example 3 and Example 4. As shown in Figure 10, the candidate saRNAs were able to promote the expression of HMBS gene mRNA and protein in the cells GM01625 of AIP patients. (A) shows the mRNA expression after candidate saRNA treatment. Compared with the control treatment, siHMBS knocked down more than 90% of HMBS mRNA expression, showing a significant effect as a small interfering RNA, which demonstrated the effectiveness of the transfection system in the experiment. The relative expression levels of mRNA after saRNA treatment were all higher than those of the control treatment group. The expression values of the RAG5-126, RAG5-373, RAG5-179, RAG5-386, and RAG5-374 groups increased by 4%, 26%, 60%, 123%, and 14% respectively. RAG5-386 had a very significant activation effect, indicating that the candidate saRNA according to the present invention can activate the expression of HMBS gene mRNA and has a very significant activation effect. (B) shows the protein expression after candidate saRNA treatment. Compared with the control treatment, the protein expression levels of the RAG5-126, RAG5-373, RAG5-179, and RAG5-374 groups after saRNA treatment all increased, indicating that the candidate saRNA according to the present invention can activate the expression of HMBS protein.

[0103] As can be seen from the above results, the applicant found a plurality of saRNAs that can significantly activate HMBS gene expression by high-throughput screening of saRNAs targeting the HMBS gene promoter. These saRNAs promoted hemoglobin production by up-regulating the expression of HMBS gene mRNA and protein. From the above results, it was clearly shown that the use of saRNAs targeting the HMBS gene promoter is promising as a means for the treatment of AIP.

Claims

**Claim 1** A small molecule activating RNA (saRNA) comprising a first nucleic acid strand and a second nucleic acid strand, wherein the first nucleic acid strand has 100% identity or 100% complementarity with a sequence selected from SEQ ID NOs: 11 to 29 (provided that thymine (T) in the sequences of SEQ ID NOs: 11 to 29 is replaced with uracil (U)), the second nucleic acid strand has complementarity with the first nucleic acid strand, and the first nucleic acid strand and the second nucleic acid strand can form a double-stranded nucleic acid structure that activates the expression of the HMBS gene in cells by complementing each other. **Claim 2** The saRNA according to claim 1, wherein the first nucleic acid strand and the second nucleic acid strand are present on two different nucleic acid strands. **Claim 3** The saRNA according to claim 1, wherein the first nucleic acid strand and the second nucleic acid strand are present on the same nucleic acid strand, the saRNA is a hairpin-type single-stranded nucleic acid molecule, and the complementary region of the first nucleic acid strand and the second nucleic acid strand forms a double-stranded nucleic acid structure. **Claim 4** The saRNA according to claim 2, wherein at least one strand of the saRNA has a protrusion of 0 to 6 nucleotides at the 3'-end. **Claim 5** The saRNA according to claim 4, wherein both strands of the saRNA have a protrusion of 0 to 6 nucleotides at the 3'-end. **Claim 6** The saRNA according to claim 4, wherein both strands of the saRNA have a protrusion of 2 or 3 nucleotides at the 3'-end. **Claim 7** The saRNA according to any one of claims 1 to 6, wherein the lengths of the first nucleic acid strand and the second nucleic acid strand are each 16 to 35 nucleotides. **Claim 8** The saRNA according to any one of claims 1 to 7, wherein the first nucleic acid strand has 100% identity with any nucleotide sequence selected from SEQ ID NOs: 30 to 48, and the second nucleic acid strand has 100% identity with any nucleotide sequence selected from SEQ ID NOs: 49 to 67. **Claim 9** The saRNA according to any one of claims 1 to 8, wherein the first nucleic acid strand contains or is selected from the sequences shown in any nucleotide sequence of SEQ ID NOs: 30 to 48, and the second nucleic acid strand contains or is selected from the sequences shown in any nucleotide sequence of SEQ ID NOs: 49 to 67. **Claim 10** The saRNA according to any one of claims 1 to 9, characterized in that the saRNA contains at least one modification, and the modification is a chemical modification.

11. The saRNA according to claim 10, characterized in that the chemical modification contains at least one or more of the following modifications, or is selected from these: (1) Modification to the phosphodiester bond connecting to the nucleotide in the nucleotide sequence of the saRNA; (2) Modification to the 2'-OH of ribose in the nucleotide sequence of the saRNA; (3) Modification to the base in the nucleotide sequence of the saRNA; (4) At least one nucleotide in the nucleotide sequence of the saRNA is a locked nucleic acid.

12. The saRNA according to claim 10, characterized in that the chemical modification contains one or more of 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylene methoxy modification, 2,4'-dinitrophenol modification, locked nucleic acid (LNA), 2'-amino modification, 2'-deoxy modification, 5'-bromouracil modification, 5'-iodouracil modification, N-methyluracil modification, 2,6-diaminopurine modification, phosphorothioate modification and boranophosphate modification, or is selected from these.

13. A cell containing the saRNA according to any one of claims 1 to 12.

14. A kit for activating / regulating the expression of the HMBS gene in a cell, containing the saRNA according to any one of claims 1 to 12, or the cell according to claim 13.

15. The saRNA according to any one of claims 1 to 12, characterized in that it activates / upregulates the expression of the HMBS gene by at least 10%.

16. Use in the manufacture of a formulation for activating / upregulating the expression of the HMBS gene in a cell of the saRNA according to any one of claims 1 to 12, or of the cell according to claim 13.

17. The use according to claim 16, characterized in that the saRNA is directly introduced into the cell.

18. The use according to claim 16 or 17, characterized in that the cell is a mammalian cell.

19. The use according to claim 18, characterized in that the cell is a human cell.

20. The use according to claim 19, characterized in that the cell exists in the human body.

21. The use according to claim 16, wherein the saRNA is administered to the cells at a final concentration of 1 to 150 nM.

22. Use of the saRNA according to any one of claims 1 to 12, or the cell according to claim 13, in the manufacture of a medicament for treating acute intermittent porphyria in a subject.

Images