Pseudorabies virus vaccine

An attenuated PRV vaccine with modified TK, gI, and gE genes addresses the limitations of current vaccines by providing effective protection against pseudorabies virus in swine, ensuring safety and reducing viral spread.

JP7715831B2Active Publication Date: 2025-07-30ZOETIS SERVICES LLC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023563191
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-04-16
Filing Date
2022-04-15
Publication Date
2025-07-30
Estimated Expiration
2042-04-15

AI Technical Summary

Technical Problem

Current PRV vaccines, including attenuated live and inactivated vaccines, fail to provide a safe and effective solution against pseudorabies virus, as they can lead to carrier animals that maintain and spread the virus, and there is a need for improved vaccines that protect swine without causing severe clinical symptoms.

Method used

Development of an attenuated porcine herpesvirus 1 (PRV) with modified TK, gI, and gE genes, and optionally US1, US2, and US9 genes, which are at least 85% identical to specific parental strains, ensuring the virus is safe and effective as a live vaccine for swine.

Benefits of technology

The modified PRV vaccine effectively protects swine from virulent PRV challenge while being safe, reducing the risk of carrier animals and viral spread, and inducing an immunological response to prevent or mitigate PRV infection.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides an attenuated porcine herpesvirus 1 (pseudorabies virus) whose TK, gI, and gE genes have been modified relative to the parent field strain, such that the resulting virus is safe and effective for use as a live vaccine to protect porcine animals from challenge with virulent pseudorabies virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention generally relates to the field of vaccines against pseudorabies virus.

Background Art

[0002] Pseudorabies virus (PRV) is a disease that infects many species of animals worldwide. PRV infection is variously called infectious bulbar paralysis, Aujeszky's disease, and mad itch. Clinical signs of PRV infection include abortion, high mortality in piglets, and cough, sneeze, fever, constipation, depression, seizures, ataxia, circling, and excessive salivation in piglets and mature pigs. The mortality rate of piglets less than 1 month old is nearly 100%, but less than 10% in pigs aged 1 to 6 months. Pregnant sows may resorb their fetuses or give birth to mummified, stillborn, or weak piglets. In cattle, symptoms include intense itching, followed by neurological signs and death. In dogs, symptoms include intense itching, paralysis of the jaw and pharynx, far barking, and death. Any infected secondary host generally lives only 2 to 3 days. Scratching or itching is considered a phantom limb sensation because the virus has never been found at the site of scratching.

[0003] Infections are known in important livestock such as pigs, cattle, dogs, cats, sheep, rats, and mink. The host range is very wide and includes most mammals and, experimentally, at least many species of birds (see D.P. Gustafson, “Pseudorabies”, Diseases of Swine, 5th ed., A.D. Leman et al., eds., (1981) for a detailed list of hosts). However, mature pigs and, in some cases, rats do not die from this disease and are therefore carriers. However, for other species, this disease is fatal.

[0004] Pig populations are particularly susceptible to infection with PRV. Mature pigs rarely show symptoms or die from the disease, but piglets become acutely ill when infected and usually die within 24 to 48 hours without specific clinical signs (T.C. Jones and R.D. Hunt, Veterinary Pathology, 5th ed., Lea & Febiger (1983)).

[0005] PRV is a herpesvirus. The PRV genome is characterized by two unique regions (UL and US), and the US region is flanked by internal and terminal repeat sequences (IRS and TRS, respectively). The sequence and gene organization of the entire PRV genome are known, and a map of the possible transcriptional mechanisms has been established, which is well supported by experimental data. Recombination between the inverted repeats can generate two possible isomers of the genome with the US region in the opposite orientation. The functions of 70 different genes have been identified. For the general biology of PRV and its mechanism of action, see Pomeranz et al, Microbiol. And Mol. Biol. Reviews 205, Sept., 462 - 500.

[0006] PRV vaccines are produced by various techniques, and vaccination has been practiced in the endemic areas of Europe for over 15 years. Although vaccination has reduced losses, the virus is maintained in the environment by vaccination. Vaccinated animals exposed to virulent virus may survive the infection and then excrete more virulent virus. Therefore, vaccinated animals may carry a potential infectious disease that can recur. (See D.P. Gustafson above).

[0007] Live attenuated and inactivated vaccines against PRV are commercially available in the United States and are approved by the USDA (see C.E. Aronson, ed., Veterinary Pharmaceuticals & Biologicals, (1983)).

[0008] Attenuated live vaccines and inactivated vaccines against PRV are commercially available in the United States and are approved by the USDA (see C.E. Aronson, ed., Veterinary Pharmaceuticals & Biologicals, (1983)). Nevertheless, there is still a need for novel PRV vaccines, and in particular, for attenuated live vaccines that are safe and effective.

SUMMARY OF THE INVENTION

[0009] In one aspect, the present invention provides an attenuated porcine herpesvirus 1 (pseudorabies virus) in which the TK, gI, and gE genes have been modified relative to the parental wild strain, and the resulting virus is safe and effective for use as a live vaccine that protects swine animals from challenge with virulent pseudorabies virus, wherein the parental strain is selected from the group consisting of strain FS18 (SEQ ID NO: 1), strain JS2012 (SEQ ID NO: 2), strain TJ (GenBank accession number KJ789182), strain HeN1 (GenBank accession number KP098534), strain HLJ8 (GenBank accession number KT824771), strain HN1201 (GenBank accession number KP722022), and any strain encoded by a nucleotide sequence that is at least 85% identical to SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the virus further comprises an attenuating modification of one or more of the US1, US2, and US9 genes, provided that at least one of the US2 and US9 genes is not modified.

[0010] In certain embodiments, the virus is encoded by SEQ ID NO: 3 or a sequence that is at least 85% identical thereto, wherein the sequence comprises a deletion in the UL23 gene of a) nucleotides 480 - 846 (isolate M1707), or b) nucleotides 526 - 607 (isolate M1705), or c) nucleotides 280 - 723 (isolate M1708), or d) nucleotides 364 - 615 (isolate M1710), or e) a deletion in the UL23 gene that includes any of the deletions of "a", "b", "c", or "d".

[0011] In another aspect, the present invention provides an attenuated porcine herpesvirus I (pseudorabies virus), wherein the virus is derived from strain FS18 (SEQ ID NO: 1), strain JS2012 (SEQ ID NO: 2), strain TJ (GenBank accession number KJ789182), strain HeN1 (GenBank accession number KP098534), strain HLJ8 (GenBank accession number KT824771), or strain HN1201 (GenBank accession number KP722022), or any strain encoded by a nucleotide sequence that is at least 85% identical to SEQ ID NO: 1 or SEQ ID NO: 2, and wherein the attenuated virus is encoded by a DNA sequence that comprises the following deletions: for the gE gene, all nucleotides of the ORF are deleted; for the gI gene, at least nucleotides 269 - 1101 of the 1101 nucleotide ORF are deleted; and for the TK gene, deletions are selected from the nucleotide sequences consisting of positions 526 - 607, 480 - 846, 280 - 723, and 364 - 615 from the 963 nucleotide ORF.

[0012] In certain embodiments, the virus further comprises a complete deletion of the US2 gene, a complete deletion of the US9 gene, and a deletion of at least nucleotides 909-1034 and / or at least nucleotides 301-315 of the 1260 nucleotide ORF of the US1 gene. In other embodiments, the US1, US2, and US9 genes are unmodified. In certain embodiments, the virus is encoded by SEQ ID NO: 3 (M1707) or a sequence that is at least 85% identical thereto.

[0013] In a third aspect, the invention provides an isolated DNA polynucleotide molecule encoding a virus according to any embodiment of the first and / or second aspects of the invention.

[0014] In a fourth aspect, the invention provides a plasmid capable of directly transfecting a host cell, the plasmid comprising a DNA polynucleotide molecule according to the third aspect of the invention and a promoter capable of enabling transcription of the coding sequence.

[0015] In a fifth aspect of the invention, there is provided a vaccine comprising a virus according to any embodiment of the first or second aspect of the invention.

[0016] In a sixth aspect, the invention provides a method of protecting a swine animal from pseudorabies infection, the method comprising administering to the swine animal a vaccine according to any embodiment of the fifth aspect of the invention. In certain embodiments, each dose of the vaccine comprises 10 4.5 and 10 9 TCID 50 , preferably about 10 7 TCID 50 . Preferably, the virus is the isolate M1707 encoded by SEQ ID NO: 3. In different embodiments, the swine animal is a boar, a sow, a gilt, or a piglet.

BEST MODE FOR CARRYING OUT THE INVENTION

[0017] The following definitions and introductory matters apply to this specification.

[0018] Unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include plural referents. Similarly, unless the context clearly indicates otherwise, the word “or” is intended to include “and.” The word “or” means any one member of a particular list and also includes any combination of members of that list.

[0019] The term “adjuvant” refers to a compound that enhances the effectiveness of a vaccine and can be added to a formulation containing an immunizing agent. An adjuvant provides an enhanced immune response even after administration of a vaccine in a single dose only. Examples of adjuvants include, for example, muramyl dipeptide, pyridine, aluminum hydroxide, dimethyldioctadecylammonium bromide (DDA), oil, oil-in-water emulsion, saponin, cytokine, and other substances known in the art. Examples of suitable adjuvants are described in U.S. Patent Application Publication No. 2004 / 0213817 A1. “Adjuvanted” refers to a composition that incorporates an adjuvant or is combined with an adjuvant.

[0020] “Antibody” refers to polyclonal and monoclonal antibodies, chimeric and single-chain antibodies, and Fab fragments, including products of Fab or other immunoglobulin expression libraries. With respect to an antibody, the term “immunologically specific” refers to an antibody that binds to one or more epitopes of the protein of interest but does not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biomolecules.

[0021] As used herein, "attenuated" PRV refers to a PRV that can infect and / or replicate in a susceptible host but is non-pathogenic or has lower pathogenicity to a host that is susceptible to infection. For example, an attenuated virus may not cause an observable / detectable clinical condition, or a less clinical condition, or a less severe clinical condition, or may show a decrease in virus replication efficiency and / or infectivity as compared to a related wild-isolated strain. Clinical conditions of PRV infection can include, but are not limited to, cough, sneeze, fever, constipation, depression, seizure, ataxia, circling, and excessive salivation in piglets and mature pigs.

[0022] An "epitope" is an antigenic determinant that is immunologically active in the sense that it can elicit a humoral (B-cell) and / or cellular (T-cell) immune response when administered to a host. These are specific chemical groups or peptide sequences on a molecule that are antigenic. Antibodies specifically bind to a particular antigenic epitope on a polypeptide. In animals, most antigens will present several or even many antigenic determinants simultaneously. Such polypeptides can also be recognized as immunogenic polypeptides, and epitopes can be specified as further described.

[0023] For the purposes of the present invention, the nucleotide sequence of a second polynucleotide molecule (either RNA or DNA) is "identical" to the nucleotide sequence of a first polynucleotide molecule when the nucleotide sequence of the second polynucleotide molecule encodes the same polyamino acid as the nucleotide sequence of the first polynucleotide molecule based on the degeneracy of the genetic code, or when the nucleotide sequence of the second polynucleotide molecule encodes a polyamino acid that is sufficiently similar to the polyamino acid encoded by the nucleotide sequence of the first polynucleotide molecule. Generally, the nucleotide sequence of the second polynucleotide molecule is identical to the nucleotide sequence of the first polynucleotide molecule when the nucleotide sequence of the second polynucleotide molecule has at least about 85% nucleotide sequence identity to the nucleotide sequence of the first polynucleotide molecule based on the BLASTN algorithm (National Center for Biotechnology Information of the United States National Institute of Health, known separately as NCBI (Bethesda, Md., USA)). In a specific example for calculations according to the practice of the present invention, BLASTP 2.2.6 [Tatusova TA and TL Madden, “BLAST 2 sequences--a new tool for comparing protein and nucleotide sequences.” (1999) FEMS Microbiol Lett. 174:247-250.] is referenced. Briefly, two amino acid sequences are aligned using a gap opening penalty of 10, a gap extension penalty of 0.1, and the Henikoff and Henikoff "blosum62" scoring matrix to optimize the alignment score (Proc. Nat. Acad. Sci. USA 325 89:10915-10919. 1992). The percent identity is then calculated as follows: total number of exact matches × 100 / length of the longer sequence used to align the two sequences + number of gaps introduced into the longer sequence.

[0024] The term "isolated" is used to indicate that a cell, peptide, or nucleic acid is separated from its native environment. Isolated peptides and nucleic acids can be substantially pure, i.e., essentially free of other substances to which they can naturally bind.

[0025] The phrase "lacking a functional protein" means that the amount and / or activity of the protein encoded by the modified gene is reduced by at least 95% compared to the protein encoded by the unmodified gene. In certain embodiments, the amount and / or activity of the protein encoded by the modified gene is reduced by at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 99.5%, or at least 99.9%. In certain embodiments, the amount and / or activity of the protein encoded by the modified gene is completely eliminated.

[0026] "Pharmaceutically acceptable carrier" means any conventional pharmaceutically acceptable carrier, vehicle, or excipient used in the art for the production and administration of a vaccine. A pharmaceutically acceptable carrier is typically a non-toxic, inert, solid, or liquid carrier.

[0027] The terms "porcine" and "swine" are used interchangeably herein and refer to any animal that is a member of the family Suidae, such as a pig.

[0028] As used herein, a "susceptible" host refers to a cell or animal that can be infected by PEDV. When introduced into a susceptible animal, the attenuated PEDV can also induce an immunological response against PEDV or its antigen, thereby conferring immunity to the animal against PEDV infection.

[0029] The term "vaccine" refers to an antigenic preparation used to generate immunity against a disease in order to prevent or mitigate the effects of infection. Vaccines are typically prepared using a combination of an immunologically effective amount of an immunogen, together with an adjuvant effective to enhance the immune response of the vaccinated subject to the immunogen.

[0030] A vaccine formulation will contain a "therapeutically effective amount" of an active ingredient, i.e., an amount capable of eliciting an immunoprotective response in the subject to whom the composition is administered. In the treatment and prevention of PEDV disease, for example, a "therapeutically effective amount" is preferably an amount that enhances the resistance of the vaccinated subject to new infection and / or reduces the clinical severity of the disease. Such protection will be evidenced by any of a reduction or disappearance of symptoms normally exhibited by a subject infected with PRV, a faster recovery time, and / or a reduced number of viral particles. The vaccine can be administered prior to infection as a prophylactic measure against PRV. Alternatively, the vaccine can be administered after the subject has already contracted the disease. A vaccine administered after exposure to PRV can mitigate the disease and elicit an immune response superior to that of the natural infection itself.

[0031] The present disclosure provides an attenuated strain of PRV that is safe and effective when used in a vaccine and protects pigs from challenge with a virulent PRV strain. In certain embodiments, the attenuated strain of PRV contains modifications in the thymidine kinase (TK), glycoprotein I (gI), and glycoprotein E (gE) genes relative to the parental field strain.

[0032] Suitable parental strains include, but are not limited to, FS18 (SEQ ID NO: 1), strain JS2012 (SEQ ID NO: 2), strain TJ (GenBank accession number KJ789182), strain HeN1 (GenBank accession number KP098534), strain HLJ8 (GenBank accession number KT824771), and strain HN1201 (GenBank accession number KP722022). Other suitable strains are those encoded by nucleotide sequences that are at least 85% identical (i.e., at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.2% identical, at least 99.4% identical, at least 99.6% identical, at least 99.8% identical, at least 99.9% identical) to the full-length SEQ ID NO: 1 or SEQ ID NO: 2.

[0033] In certain embodiments, the parent strain is at least 85% identical to SEQ ID NO: 1 or 2 as described in the previous paragraph, and at least half of the different bases (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) result in codons that encode similar amino acids, i.e., conservative amino acid substitutions. It is recognized that such certain conservative amino acid substitutions generally do not inactivate the overall protein function: for example, for positively charged amino acids (and vice versa), lysine, arginine, and histidine; for negatively charged amino acids (and vice versa), aspartic acid and glutamic acid, and for certain groups of neutrally charged amino acids (and in all cases, vice versa), (1) alanine and serine, (2) asparagine, glutamine, and histidine, (3) cysteine and serine, (4) glycine and proline, (5) isoleucine, leucine, and valine, (6) methionine, leucine, and isoleucine, (7) phenylalanine, methionine, leucine, and tyrosine, (8) serine and threonine, (9) tryptophan and tyrosine, (10) and for example, tyrosine, tryptophan, and phenylalanine. Amino acids can be classified according to their physical properties and their contribution to secondary and tertiary protein structure. Thus, conservative substitutions are recognized in the art as the substitution of one amino acid for another having similar properties, and exemplary conservative substitutions can be found in WO97 / 09433, published Mar. 13, 1997, page 10 (PCT / GB96 / 02197, filed Sep. 6, 1996). Alternatively, conservative amino acids can be grouped as described in Lehninger, (Biochemistry, Second Edition; Worth Publishers, Inc. NY: NY (1975), pp. 71-77). Protein sequences can be aligned using multiple sequence alignment of both Vector NTI Advance 11.5 and CLUSTAL 2.1.As used herein, the recitation of a particular amino acid or nucleotide sequence shall be deemed to include all silent mutations with respect to nucleic acid sequences, and any and all conservatively modified variants with respect to amino acid sequences.

[0034] The sequences and functions of the gI, gE, and TK proteins of pseudorabies virus are known. Thymidine kinase is encoded by the UL23 gene and is involved in nucleotide synthesis. Glycoproteins I and E are viral particle proteins encoded by the US7 and US8 genes, respectively. Pomeranz et al. have disclosed that gI and gE are complexed with each other. For the purposes of the present disclosure, the genes UL23, US7, and US8 may be referred to as the "TK gene", the "gI gene", and the "gE gene", respectively.

[0035] In certain embodiments, the attenuated strain of PRV further comprises a modification of one or more (i.e., one, two, or all three) of the US1, US2, and US9 genes. These genes encode the RSp40 / ICP22, 11K, and 28K proteins, respectively. In certain embodiments, at least one of the US2 and US9 genes is unmodified. Thus, for example, the virus may comprise unmodified US2, modified US9, and modified or unmodified US1. Alternatively, the virus may comprise unmodified US9, modified US2, and modified or unmodified US1.

[0036] In certain other embodiments, in the attenuated strain of PRV of the present invention, the US1, US2, and US9 genes are unmodified.

[0037] Pomeranz et al. disclose that US1 encodes the RSp40 / ICP22 protein, a protein of unknown function in PRV, although Pomeranz has disclosed that its HSV-1 homolog acts as a regulator of gene expression. US2 encodes a protein present in the tegument of the virus. US9 encodes an envelope protein involved in protein sorting in axons and functioning as a type II tail-anchor membrane protein.

[0038] Modifications in the genes encoding the TK, gI, gE proteins, as well as any modifications in the US1, US2, and US9 genes, result in viruses lacking the functional proteins expressed by these genes.

[0039] For example, in certain embodiments, the viruses of the invention lacking a functional gE protein can be prepared by a number of means. For example, a stop codon may be introduced into the proximal portion of the ORF encoding the gE protein. In different embodiments, the stop codon may be introduced after the N-terminal 10 amino acids or less, such as after 9, 8, 7, 6, 5, 4, 3, or 2 N-terminal amino acids. In other embodiments, the transcription start site may be altered so that transcription does not initiate. In yet other embodiments, all of the nucleotides in the ORF encoding the gE protein are deleted.

[0040] The viruses of the invention also lack a functional gI protein. In certain embodiments, at least nucleotides 269-1101 are deleted from the 1101-nucleotide-ORF encoding the gI protein. In certain embodiments, the deletion begins upstream of nucleotide 269, such as at nucleotide 250, 200, 150, 100, 50, or even further upstream. In certain embodiments, all 1101 nucleotides are deleted. In certain embodiments, a stop codon is introduced at position 269 or upstream thereof without introducing a frameshift mutation.

[0041] The virus of the present invention also has a modified US23 gene encoding the TK protein. The UL23 gene has a 963-nucleotide-long ORF. In certain embodiments, this 963-nucleotide-long ORF lacks at least one (or at least two, or at least three, or all four) sub-sequences selected from the sequences defined by nucleotides 526-607, 480-846, 280-723, and 364-615 of this 963-nucleotide-long ORF. Of course, longer deletions may also exist, such as deletions defined by positions 280-846 that incorporate all four sub-sequences, or deletions defined by positions 300-650 that include two sub-sequences. Alternatively, all 963 nucleotides of the ORF may be deleted. Alternatively, a stop codon may be introduced (without causing a frameshift) at a position upstream of 526, or upstream of 364, or upstream of 480, or upstream of 280, etc. Mutations at the transcription start site are also possible in certain embodiments.

[0042] Optional modifications to any one of the US1, US2, and US9 genes preferably render the resulting virus lacking the protein encoded by the modified gene. Suitable mutations include gene deletions, insertions, substitutions, etc. As described above, frameshift mutations can be introduced, thus generating a protein with minimal similarity to the protein encoded by the unmodified gene. In-frame mutations can include the introduction of a stop codon into the proximal portion of the gene (e.g., within the N-terminal 20, 15, 10, 5, 3 amino acids), or a mutation at the transcription start site such that the corresponding ORF is not transcribed.

[0043] In certain embodiments, the attenuated virus of the present invention is at least 85% identical to SEQ ID NO: 1 or 2 and has a genome with the following modifications: a) at least 90% (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) of the ORF encoding the gI protein; b) at least 90% (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) of the ORF encoding the gE protein; c) The ORF encoding the TK protein lacks at least one (i.e., at least two, at least three, or all four) of the sub - arrays defined by the nucleotides at positions 526 - 607, 480 - 846, 280 - 723, and 364 - 615 of this 963 - nucleotide - long ORF.

[0044] In certain other embodiments, the modified live virus is encoded by a sequence that is at least 85% identical to SEQ ID NO: 3, provided that the sequence encoding the virus includes modifications to the UL23 gene (encoding TK), the US7 gene (encoding gI), and the US8 gene (encoding gE). Some modified live viruses according to this embodiment of the invention may include unmodified US1, US2, and US9 genes. Some other modified live viruses according to this embodiment of the invention further include, as described above, optional modifications to the US1, US2, and US9 genes, such as modified US2, unmodified US9, and modified or unmodified US1, or modified US9, unmodified US2, and modified or unmodified US1. In other embodiments, all three of these genes (US1, US2, US9) are modified.

[0045] Methods for modifying genes such that the resulting virus is said to lack the functional proteins encoded by these genes are well - known. These methods include, but are not limited to, complete or partial deletions, frameshift mutations, nucleotide exchanges, or insertions. For example, one can modify the promoter that regulates the gene or the transcription start site. Alternatively (or additionally), one can insert mutations that introduce premature stop codons into the coding sequence. Other suitable methods are within the expertise of those skilled in the art.

[0046] The above modifications can be introduced into the viral genome by a number of methods including, but not limited to, targeted mutagenesis and homologous recombination.

[0047] The first step of this technique involves the construction of a recombinant DNA molecule for recombination with PrV genomic DNA. Such a recombinant DNA molecule can be derived from any suitable plasmid, cosmid, or phage, with a plasmid being most preferred, and includes a fragment of PrV DNA containing the DNA of a portion of the PrV genome as defined above. The DNA sequence of the portion of the PrV genome as defined above is preferably adjacent to a PrV nucleic acid sequence of an appropriate length, e.g., 50 - 3000 bp, such that in vivo homologous recombination with the viral PrV genome can occur.

[0048] The recombinant DNA molecule thus obtained is suitable for introducing mutations into the PrV genome.

[0049] Next, cells, e.g., porcine kidney cells or VERO cells, can be transfected with PrV DNA in the presence of a recombinant DNA molecule as described above or infected with wild-type PrV, whereby recombination occurs between the sequence within the recombinant DNA molecule and the corresponding sequence within the PrV genome.

[0050] Recombination can also be induced by co-transfecting cells with a nucleic acid sequence containing a mutant sequence flanked by appropriate adjacent PrV sequences that do not contain plasmid sequences. Thereafter, recombinant virus progeny are generated in cell culture and can be selected, e.g., genotypically or phenotypically. Another possibility is the detection of the absence of a polypeptide encoded by a nucleic acid sequence in which the mutation was localized. Similarly, the presence of a polypeptide encoded by the inserted heterologous nucleic acid sequence can be detected. Recombinant viruses can also be reliably selected based on resistance to compounds such as neomycin, gentamicin, or mycophenolic acid.

[0051] The selected recombinant PrV can be cultured on a large scale in cell culture, after which a recombinant PrV-containing substance or a heterologous polypeptide expressed by the PrV can be collected.

[0052] As an alternative or in addition to recombinant DNA techniques, cell culture passage combined with clone enrichment and clone selection may be used to prepare the virus of the present invention. For example, clones having a deletion in one of the genes, such as gI or gE, may be selected for further propagation, and it is known that TK natural gene deletion mutants can result in virus replication deficiency.

[0053] Suitable cell lines include, but are not limited to, porcine testicular cell line ST, porcine kidney cell line PK-15 or MRS-2, rabbit kidney cell line RK, African green monkey kidney cell line Vero, simian embryo kidney epithelial cell line Marc-145, bovine kidney cell line MDBK, bovine testicular cell line BT, chicken embryo fibroblast (CEF), and baby hamster kidney cell line BHK-21. In a preferred embodiment, the suitable cell line is Vero (ATCC CCL-81).

[0054] An immunologically effective amount of the vaccine of the present invention is administered to pigs in need of protection against viral infection. The immunologically effective amount or immunogenic amount for inoculating pigs can be readily determined or readily titrated by routine testing. The effective amount is the amount at which a sufficient immunological response to the vaccine is achieved to protect pigs exposed to the PRV virus. Preferably, the pigs are protected to the extent that one or all of the deleterious physiological symptoms or effects of the viral disease are significantly reduced, alleviated, or completely prevented.

[0055] The vaccine of the present invention can be formulated according to accepted practices so as to include an acceptable carrier for animals, such as a standard buffer, stabilizer, diluent, preservative, and / or solubilizing agent, and can also be formulated to promote sustained release. Examples of diluents include water, physiological saline, dextrose, ethanol, glycerol, and the like. Additives for isotonicity include, inter alia, sodium chloride, dextrose, mannitol, sorbitol, and lactose. Stabilizers include, inter alia, albumin. Other suitable vaccine vehicles and additives, including those particularly useful in formulating modified live vaccines, will be known to or apparent to those of ordinary skill in the art. See, for example, Remington’s Pharmaceutical Science, 18th ed., 1990, Mack Publishing, which is incorporated herein by reference.

[0056] The vaccine of the present invention can be non - adjuvanted. Alternatively, the vaccine of the present invention can further include one or more additional immunomodulatory components, such as, for example, an adjuvant or a cytokine. Non - limiting examples of adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), alum, mineral gels such as aluminum hydroxide gel, water - in - oil emulsions, oil - in - water emulsions such as Freund's complete and incomplete adjuvants, block copolymers (CytRx, Atlanta Ga.), QS - 21 (Cambridge Biotech Inc., Cambridge Mass.), SAF - M (Chiron, Emeryville Calif.), AMPHIGEN® adjuvant, saponin, Quil A or other saponin fractions, monophosphoryl lipid A, ionic polysaccharides, and Avridine lipid - amine adjuvant. Non - limiting examples of water - in - oil emulsions useful in the vaccine of the present invention include modified SEAM62 and SEAM1 / 2 formulations. Modified SEAM62 is a water - in - oil emulsion containing 5% (v / v) squalene (Sigma), 1% (v / v) SPAN® 85 detergent (ICI surfactant), 0.7% (v / v) TWEEN® 80 detergent (ICI surfactant), 2.5% (v / v) ethanol, 200 μg / ml of Quil A, 100 μg / ml of cholesterol, and 0.5% (v / v) lecithin. Modified SEAM1 / 2 is a water - in - oil emulsion containing 5% (v / v) squalene, 1% (v / v) SPAN® 85 detergent, 0.7% (v / v) Tween80 detergent, 2.5% (v / v) ethanol, 100 μg / ml of Quil A, and 50 μg / ml of cholesterol. Other immunomodulators that can be included in the vaccine include, for example, one or more interleukins, interferons, or other known cytokines.

[0057] Additional adjuvant systems enable the combination of both T helper and B cell epitopes, resulting in one or more types of covalently linked T-B epitope constructs that can be additionally lipidated, such as those described in WO2006 / 084319, WO2004 / 014957, and WO2004 / 014956.

[0058] In a preferred embodiment of the invention, the ORF1 PEDV protein, or other PEDV proteins or fragments thereof, are formulated with 5% AMPHIGEN® as discussed below.

[0059] Adjuvant component The vaccine composition of the present invention may or may not contain an adjuvant. Specifically, as based on an orally infectious virus, the modified live vaccine of the present invention can be used without an adjuvant together with a sterile carrier. Adjuvants that can be used for oral administration include those based on CT-like immunomodulators (rmLT, CT-B, i.e., recombinant mutant heat-labile toxin of E. coli, cholera toxin-B subunit), or those via encapsulation with polymers and mucoadhesives such as alginates or chitosan, or those via liposomes. The preferred adjuvanted or non-adjuvanted vaccine dose at the minimum protective dose through vaccine release is about 10 to about 10 6 log 10 TCID 50 of virus, or more can be provided. "TCID 50 " refers to "tissue culture infectious dose" and is defined as that dilution of the virus necessary to infect 50% of a given batch of inoculated cell cultures. The Spearman-Karber method, which is utilized throughout this specification, for TCID 50Various methods can be used to calculate . For a description of the Spearman-Karber method, see B.W. Mahy & H.O. Kangro, Virology Methods Manual, p. 25-46 (1996). If present, the adjuvant can more generally be provided as an emulsion when parenteral administration is selected, provided that the starting titer is not reduced by more than 0.7 log (80% reduction).

[0060] In one example, the adjuvant component is provided from a combination of lecithin in light mineral oil and also an aluminum hydroxide component. Details regarding the composition and formulation of AMPHIGEN® (as a representative lecithin / mineral oil component) are as follows.

[0061] Preferred adjuvant formulations can be provided as 2 mL doses in a buffer solution further containing about 5% (v / v) REHYDRAGEL® (aluminum hydroxide gel) and "20% AMPHIGEN®" to about 25% final volume (v / v). AMPHIGEN® is generally described in U.S. Patent No. 5,084,269 and provides deoiled lecithin (preferably soy) dissolved in light oil, which is then dispersed as an oil-in-water emulsion in an aqueous solution or suspension of the antigen. Amphigen is improved according to the protocol of U.S. Patent No. 6,814,971 (see columns 8-9 thereof) to provide a so-called "20% Amphigen" component for use in the final adjuvanted vaccine compositions of the present invention. Thus, a stock mixture of 10% lecithin and 90% carrier oil (DRAKEOL® from Penreco, Karns City, Pa.) is diluted 1:4 with 0.63% phosphate buffered saline aqueous solution, thereby reducing the lecithin and DRAKEOL® components to 2% and 18% (i.e., 20% of their original concentrations), respectively. Tween80 and Span80 surfactants are added to this composition, and representative and preferred final amounts are 5.6% (v / v) TWEEN® 80 and 2.4% (v / v) SPAN® 80, and the SPAN® is initially provided in the stock DRAKEOL® component and the TWEEN® is initially provided from the buffered saline component so that a mixture of saline and DRAKEOL® components ultimately provides the desired surfactant concentration. The mixture of DRAKEOL® / lecithin and aqueous saline solution can be achieved using an In-Line Slim Emulsifier device, model 405 (Charles Ross and Son, Hauppauge, N.Y., USA).

[0062] The vaccine composition also contains REHYDRAGEL® LV (containing about 2% aluminum hydroxide in the stock material) as an additional adjuvant component (available from Reheis, N.J., USA, and ChemTrade Logistics, USA). When further diluted using 0.63% PBS, the final vaccine composition contains the following composition amounts per 2ML dose: 5% (v / v) REHYDRAGEL® LV, 25% (v / v) of "20% Amphigen" (i.e., further diluted 4-fold), and 0.01% (w / v) of merthiolate.

[0063] As understood in the art, the order of addition of the components can be varied to provide an equivalent final vaccine composition. For example, an appropriate dilution of the virus in buffer can be prepared. Then, while blending, an appropriate amount of REHYDRAGEL® LV stock solution (containing about 2% aluminum hydroxide) can be added to enable the desired 5% (v / v) concentration of REHYDRAGEL® LV in the actual final product. After preparation, this intermediate stock material can be combined with an appropriate amount of "20% Amphigen" stock (already containing the required amounts of Tween 80 and Span 80 as generally described above) to again achieve the final product with 25% (v / v) of "20% Amphigen". Finally, an appropriate amount of 10% merthiolate can be added.

[0064] The vaccination composition of the present invention allows for variation in all of the formulation components such that the total dose of antigen can preferably vary by up to 100-fold (up or down), and most preferably by up to 10-fold (up or down) compared to the above antigen dose. Similarly, the surfactant concentration (regardless of TWEEN® or SPAN®) can independently vary up to 10-fold each, or they can be replaced by appropriate concentrations of similar materials or completely omitted, as is well understood in the art.

[0065] The concentration of REHYDRAGEL® in the final product can be varied first by using equivalent materials available from many other manufacturers (i.e., ALHYDROGEL®, Brenntag; Denmark), or by using additional variant forms in the REHYDRAGEL® product line such as CG, HPA, or HS. Using LV as an example, its ultimately useful concentration ranges from 0% to 20%, more preferably from 2% to 12%, and most preferably from 4% to 8%. Similarly, the final concentration of AMPHIGEN® (expressed as % of "20% Amphigen") is preferably 25%, but this amount can be varied from 5% to 50%, preferably from 20% to 30%, and most preferably can be about 24% to 26%.

[0066] In accordance with the practice of the present invention, the oil used in the adjuvant formulation of the present invention is preferably a mineral oil. As used herein, the term "mineral oil" refers to a mixture of liquid hydrocarbons obtained from petroleum via distillation techniques. This term is synonymous with "liquid paraffin", "liquid petrolatum", and "white mineral oil". This term is also intended to include "light mineral oil", i.e., an oil that is similarly obtained by distillation of petroleum but has a slightly lower specific gravity than white mineral oil. See, for example, Remington’s Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990, pages 788 and 1323). Mineral oil can be obtained from various commercial sources, such as J.T. Baker (Phillipsburg, Pa.), USB Corporation (Cleveland, Ohio). A preferred mineral oil is a light mineral oil marketed under the name DRAKEOL®.

[0067] The immunogenic and vaccine compositions of the present invention can further include a pharmaceutically acceptable carrier, excipient, and / or stabilizer in the form of a lyophilized formulation or an aqueous solution (see, e.g., Remington: The Science and practice of Pharmacy, 2005, Lippincott Williams). Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the dosage and concentration, and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (sodium mercury ((o-carboxyphenyl)thio)ethyl salt (THIOMERSAL (registered trademark)), octadecyl dimethyl benzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl, or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol, etc.); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterion metal complexes such as sodium (e.g., Zn-protein complexes); and / or nonionic surfactants such as polyethylene glycol (PEG), TWEEN (registered trademark), or PLURONICS (registered trademark).

[0068] The vaccine of the present invention can optionally be formulated for slow release of the virus, infectious DNA molecule, plasmid, or viral vector of the present invention. Examples of such slow release formulations include, for example, a virus, infectious DNA molecule, plasmid, or viral vector combined with a complex of biocompatible polymers such as poly(lactic acid), poly(lactic-co-glycolic acid), methylcellulose, hyaluronic acid, collagen, etc. The structure, selection, and use of degradable polymers in drug delivery vehicles have been reviewed in several publications, including A. Domb et al., 1992, Polymers for Advanced Technologies 3:279-292 (incorporated herein by reference). Additional guidance on the selection and use of polymers in pharmaceutical formulations can be found in texts known in the art, for example, M. Chasin and R. Langer (eds), 1990, “Biodegradable Polymers as Drug Delivery Systems”: Drugs and the Pharmaceutical Sciences, Vol. 45, M. Dekker, NY, which is also incorporated herein by reference. Alternatively, or in addition, the virus, plasmid, or viral vector can be microencapsulated to improve administration and efficacy. Methods for microencapsulating antigens are well known in the art and include, for example, the techniques described in U.S. Patent No. 3,137,631, U.S. Patent No. 3,959,457, U.S. Patent No. 4,205,060, U.S. Patent No. 4,606,940, U.S. Patent No. 4,744,933, U.S. Patent No. 5,132,117, and International Patent Publication No. 95 / 28227, all of which are incorporated herein by reference.

[0069] Liposomes can also be used to provide sustained release of viruses, plasmids, viral proteins, or viral vectors. Details regarding methods of making and using liposome formulations can be found, inter alia, in U.S. Patent No. 4,016,100, U.S. Patent No. 4,452,747, U.S. Patent No. 4,921,706, U.S. Patent No. 4,927,637, U.S. Patent No. 4,944,948, U.S. Patent No. 5,008,050, and U.S. Patent No. 5,009,956, all of which are incorporated herein by reference.

[0070] An effective amount of any of the vaccines described above can be determined by conventional means that start with a low dose of virus, viral protein plasmid, or viral vector and then increase the dosage while monitoring the effect. An effective amount can be obtained after a single administration of the vaccine or after multiple administrations of the vaccine. Known factors can be considered when determining the optimal dosage per animal. These include the species, size, age, and general condition of the animal, the presence of other drugs in the animal, etc. The actual dosage is preferably selected after considering the results from other animal studies.

[0071] One way to detect whether an appropriate immune response has been achieved is to determine seroconversion and antibody titers in the animal after vaccination. If so, the timing of vaccination and the number of boosters are preferably determined by a physician or veterinarian based on an analysis of all relevant factors, some of which are described above.

[0072] In a preferred example of the invention related to pig vaccination, the optimal age target for the animal is about 1 - 21 days, which can also accommodate other scheduled vaccinations such as against Mycoplasma hyopneumoniae or porcine reproductive and respiratory syndrome virus. Additionally, the preferred vaccination schedule for breeding sows includes similar dosages and an annual revaccination schedule.

[0073] Dosage Preferred clinical applications are for the treatment, control, and prevention prior to parturition in both breeding sows and gilts, followed by vaccination of piglets. In a representative example (applicable to both sows and gilts), a single-dose vaccine is used, although of course a two-dose vaccination regimen is also envisioned as necessary.

[0074] The actual volume of the dose is a function of how the vaccine is formulated, and the amount actually administered ranges from 0.05 to 5 mL, taking into account the size of the animal. Single-dose vaccination is also appropriate. The amount of pseudorabies virus in the vaccine is 10 4.5 TCID 50 ~10 8 TCID 50 , preferably 10 5 ~10 7 TCID 50 , more preferably 10 5.5 ~10 5.5 TCID 50 per dose.

[0075] Preferably, a single administration is sufficient to confer protection. However, if a two-dose regimen is required, the booster dose can be given 2 to 4 weeks prior to any subsequent parturition. Intramuscular vaccination (for all doses) is preferred, although one or more of the doses can be given subcutaneously. Oral administration is also preferred. Vaccination can also be effective in vaccinated and unvaccinated animals, as achieved by planned or natural infection.

[0076] In a further preferred example, female or nulliparous pigs are vaccinated intramuscularly or orally 5 weeks before and then 2 weeks before parturition. The protocol of the present invention is also applicable to the treatment of already seropositive female and nulliparous pigs, as well as also piglets and male pigs. Booster vaccines can also be given, which may be via different routes of administration. It is preferred to re-vaccinate the sow before any subsequent parturition, nevertheless, the vaccine composition of the present invention can still provide protection to the piglets via continuous passive transfer of antibodies even if the sow was vaccinated only in relation to a previous parturition.

[0077] It should be noted that piglets can be vaccinated as early as on the first day of life. For example, piglets can be vaccinated on the first day, regardless of the presence or absence of a booster dose at 3 weeks of age, especially if the dam was vaccinated before breeding but not before parturition. Piglet vaccination can also be effective if the dam was not previously administered either due to natural or planned infection. Piglet vaccination can also be effective when either the mother has not been previously exposed to the virus or was not vaccinated before parturition.

[0078] In other embodiments, the vaccine can be administered to piglets that are about 6 days old or older, or about 14 days old or older, or about 21 days old or older, or about 28 days old or older, or about 35 days old or older, or about 42 days old or older.

[0079] Wild boars (typically, those raised for breeding purposes) need to be vaccinated once every six months. Variations in dosage are desirable within the practice of the art. It should be noted that the vaccine of the present invention is safe for use in pregnant animals (all three trimesters) and neonatal pigs. The vaccine of the present invention is attenuated to a level of safety (i.e., no mortality, transient mild clinical signs or only normal signs in neonatal pigs) that is acceptable even in the most sensitive animals, including neonatal pigs, again. Of course, from the perspective of protecting pig herds from both PRV epidemics and persistent low-level PRV occurrences, a program of continuous sow vaccination is of great importance. It will be understood that sows or gilts immunized with PRV MLV passively transfer immunity to piglets, including PRV-specific IgA that protects the piglets from PRV-related diseases and death. Additionally, generally, pigs immunized with PRV MLV are protected from a decrease in quantity and / or duration, or from the excretion of PRV in their feces, and furthermore, pigs immunized with PRV MLV are protected from the clinical pathologies of PRV, including but not limited to death, reproductive, neurological, and respiratory pathologies of PRV, and furthermore, PRV MLV will help to stop or control the PEDV transmission cycle.

[0080] Also, it should be noted that animals vaccinated with the vaccine of the present invention are immediately safe for human consumption without any significant withholding of slaughter, such as 21 days or less.

[0081] When provided therapeutically, the vaccine is provided in an effective amount upon detection of the signs of an actual infection. A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by the recipient. Such a composition is said to be administered in a "therapeutically or prophylactically effective amount" if the amount administered is physiologically significant.

[0082] Using a pharmaceutical composition as described herein, at least one vaccine or immunogenic composition of the invention can be administered by any means that achieve the intended purpose. For example, the route of administration of such a composition can be by parenteral, oral, oronasal, intranasal, intratracheal, topical, subcutaneous, intramuscular, transdermal, intradermal, intraperitoneal, intraocular, and intravenous administration. In one embodiment of the invention, the composition is administered intramuscularly. Parenteral administration can be by bolus injection or by gradual perfusion over time. Any suitable device can be used to administer the composition, including syringes, drip devices, needleless injection devices, patches, etc. The route and device selected for use depend on the adjuvant, antigen, and composition of the subject, and such are well known to those skilled in the art. Oral or alternatively subcutaneous administration is preferred. Oral administration can be direct, via water, or via feed (solid or liquid feed). When provided in liquid form, the vaccine can be reconstituted and lyophilized, or added directly to the feed (mixed or poured on top), or provided as a paste for addition to water or liquid feed in another way.

[0083] Diagnostic kit The present invention also provides a diagnostic kit. This kit can be useful for distinguishing between swine animals naturally infected with a field strain of PRV virus and swine animals vaccinated with any of the PRV vaccines described herein. The kit can also be useful because animals potentially infected with a field strain of PRV virus can be detected prior to the presence of clinical symptoms and excluded from the herd or kept isolated from administered or vaccinated animals.

[0084] The kit contains reagents for analyzing samples from porcine animals for the presence of antibodies against specific components of a specific PRV virus. The diagnostic kit of the present invention can contain, as components, peptides from mutant PRV strains of the present invention that are present in field strains but not in the vaccine of interest or vice versa, and the selection of such suitable peptide domains is made possible by extensive amino acid sequencing. Such peptides can be used in any immunoassay system known in the art, including, but not limited to, radioimmunoassay, enzyme-linked immunosorbent assay, "sandwich" assay, precipitation reaction, gel diffusion immunodiffusion assay, agglutination assay, fluorescence immunoassay, protein A immunoassay, and immunoelectrophoresis assay. Some U.S. Patent No. 4,629,783 and the patents cited therein also describe suitable assays.

[0085] For example, the kit can contain immunogenic peptides that are present in unmodified TK, gE, and / or gI proteins, optionally in the products of modified US1, US2, and / or US9 genes, and absent in the expression products of the modified genes. When the peptide binds an antibody to one of these proteins upon contact with a sample from an animal suspected of being infected with PRV, this indicates that the animal is infected. The absence of binding indicates that the animal is not infected but may have been vaccinated with the vaccine of the present invention.

[0086] The kit can also contain peptides that are present in both the attenuated and wild-type strains of PRV. Suitable non-limiting examples of such peptides include envelope proteins encoded by the UL53, UL49.5, UL27, UL34 genes. When the peptide binds an antibody to one of these proteins upon contact with a sample from an animal suspected of being infected with PRV, this indicates that the animal is infected or vaccinated. The absence of binding indicates that the animal is not infected or vaccinated.

[0087] The following examples are intended to illustrate the above invention and should not be construed as limiting its scope. One skilled in the art will readily recognize that the examples suggest many other ways in which the invention can be practiced. It should be understood that numerous variations and modifications can be made while remaining within the scope of the present invention.

[0088] Example 1 Piglets negative for both PRV antigen and antibody were assigned to groups having 7 piglets each. The piglets were provided with a commercial sample and free access to water.

[0089] Strain M1707 (containing SEQ ID NO: 3 and having a deletion of nucleotides 480 - 846 of the UL23 gene encoding TK) was formulated with MEM, gelatin, NZ amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin - streptomycin.

[0090] A second group of pigs was vaccinated with strain Bartha K61. A third group of pigs was vaccinated with DMEM. The vaccination method was intramuscular injection into the neck. The inoculum volume for the treatment groups was 1 mL per piglet. After inoculation, clinical observations including measuring the rectal temperature of the pigs were performed daily.

[0091] Data showed that F35 - level laboratory - produced strain M1707 was >10 6 safe in piglets at 3 - 4 weeks of age (7 pigs treated) and at the target age of 7 weeks (14 pigs treated). By three different batches of laboratory - produced 5 TCID 50 / pig treatment. The body temperature of all pigs including the control pigs was normal and no clinical signs were shown during the 14 - day observation period.

[0092] Example 2 Piglets negative for both PRV antigen and antibody were assigned to groups with 7 piglets in each group. The piglets were provided with commercial samples and free access to water.

[0093] Three lots (Lot A, Lot B, and Lot C) of the PRV strain M1707 were prepared. The virus was formulated with MEM, gelatin, NZ amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin.

[0094] On day 0, one formulation of the lot at a dose of 10 5.0 TCID 50 was intramuscularly injected per dose to treat the pigs. The control group was treated with DMEM only. After inoculation, the rectal temperature of the pigs was measured daily. In the observation of clinical symptoms, it was found that all pigs had normal body temperature, good appetite, normal mental state, no respiratory and digestive symptoms, and no neurological symptoms during the 21-day observation period. The three vaccinated groups and the control group were intranasally challenged with the strain FS21PF1115, 2 mL (10 5.0 TCID 50 ) on day 21.

[0095] Protection was determined by the severity (or absence) of symptoms. In the three control groups, 19 out of 20 pigs (7 out of 7 in each of Lot A and B, 6 out of 7 in Lot C) were protected. In the control group, 0 out of 7 pigs were protected.

[0096] Example 3 Piglets negative for both PRV antigen and antibody were assigned to groups with 5 piglets in each group. The piglets were provided with commercial samples and free access to water.

[0097] The PRV strain 1707 was formulated with MEM, gelatin, NZ amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin. Each vaccinated pig received 10 5.0 TCID50 Received the antigen. The control group was treated with DMEM. The formulation was administered by intramuscular injection. Both the vaccinated group and the control group were challenged intranasally with 2 mL (10 6.0 TCID 50 ) of strain FS21PF1115 6 months after vaccination.

[0098] The duration of immunity was determined by the severity (or absence) of symptoms. Five out of five pigs in the vaccinated group showed protective titers, while none in the control group showed protective titers. Claims at the time of international filing [Claim 1] A attenuated porcine herpesvirus 1 (pseudorabies virus), wherein the TK, gI, and gE genes thereof are modified with respect to the parental field strain, and the resulting virus is safe and effective for use as a live vaccine that protects swine animals from attack by virulent pseudorabies virus, and the parental strain is selected from the group consisting of strain FS18 (SEQ ID NO: 1), strain JS2012 (SEQ ID NO: 2), strain TJ (GenBank accession number KJ789182), strain HeN1 (GenBank accession number KP098534), strain HLJ8 (GenBank accession number KT824771), strain HN1201 (GenBank accession number KP722022), and any strain encoded by a nucleotide sequence that is at least 85% identical to SEQ ID NO: 1 or SEQ ID NO: 2. An attenuated porcine herpesvirus 1 (pseudorabies virus). [Claim 2] The virus according to claim 1, further comprising an attenuation modification of one or more of the US1, US2, and US9 genes, provided that at least one of the US2 and US9 genes is not modified. [Claim 3] The virus according to claim 1, wherein the US1, US2, and US9 genes are unmodified. [Claim 4] The virus according to any one of claims 1 to 3, wherein the attenuation gene modification comprises a complete or partial deletion, a frameshift mutation, a nucleotide exchange, or an insertion. [Claim 5] The virus according to any one of claims 1 to 4, derived from the FS18 strain (encoded by SEQ ID NO: 1) or the JS2012 strain (encoded by SEQ ID NO: 2). [Claim 6] Encoded by SEQ ID NO: 3 or a sequence that is at least 85% identical thereto, said sequence being a) Deletion of nucleotides 480 to 846 of the UL23 gene (isolate M1707), or b) Deletion of nucleotides 526 to 607 of the UL23 gene (isolate M1705), or ​ ​ ​ [Item 7] The virus according to claim 2, wherein the gE, US9, and US2 genes are completely deleted, the gI and TK genes are at least partially deleted, and one or more copies of the US1 gene are at least partially deleted. [Item 8] An attenuated porcine herpesvirus I (pseudorabies virus), wherein the virus is derived from strain FS18 (SEQ ID NO: 1), strain JS2012 (SEQ ID NO: 2), strain TJ (GenBank accession number KJ789182), strain HeN1 (GenBank accession number KP098534), strain HLJ8 (GenBank accession number KT824771), or strain HN1201 (GenBank accession number KP722022), or any strain encoded by a nucleotide sequence that is at least 85% identical to SEQ ID NO: 1 or SEQ ID NO: 2, and the attenuated product is encoded by a DNA sequence, and the DNA sequence has the following deletions: For the gE gene, all of the nucleotides of the ORF are deleted, For the gI gene, at least nucleotides 269 to 1101 of the 1101-nucleotide ORF are deleted, For the TK gene, deletions are selected from the nucleotide sequences consisting of positions 526 to 607, 480 to 846, 280 to 723, and 364 to 615 from the 963-nucleotide ORF, an attenuated porcine herpesvirus I (pseudorabies virus). [Item 9] The attenuated virus according to claim 8, further comprising a complete deletion of the US2 gene, a complete deletion of the US9 gene, and deletions of at least nucleotides 909 to 1034 and / or at least nucleotides 301 to 315 of the 1260-nucleotide ORF of the US1 gene. [Item 10] The attenuated virus according to claim 9, encoded by SEQ ID NO: 3 (M1707) or a sequence that is at least 85% identical thereto. [Item 11] The attenuated virus according to claim 8, wherein the US1, US2, and US9 genes are not modified. [Item 12] A vaccine composition comprising the live virus according to any one of claims 1 to 11 and a pharmaceutically acceptable carrier. [Item 13] A vaccine composition comprising the virus according to any one of claims 1 to 7, wherein the virus is provided in a killed form. [Item 14] A method of vaccinating a porcine animal to provide protection against challenge with a virulent pseudorabies virus, the method comprising administering one or more doses of the vaccine composition according to claim 12 or 13. [Item 15] Wherein a single dose of said virus M1707 is used and said dosage provides 10 4.5 ~10 9 [[ID=6,2]] TCID 50 The method according to claim 14. [Item 16] The method according to claim 14, wherein said vaccine is safe when administered to piglets in a single administration treatment of 10 7 TCID 50 . [Item 17] The method according to claim 14, wherein said porcine animal is a boar, a sow, a gilt, or a piglet. [Item 18] The virus according to claim 2, wherein the deletion in the nucleotide sequence of said US-1 gene is the sequence ctcctcttcc tcgtc (SEQ ID NO: 4), or any larger sequence of said US-1 gene containing said sequence. [Item 19] The virus according to claim 2, wherein the deletion in the nucleotide sequence of said US-1 gene is the sequence cgag gaagaggaag aggaagagga agacggggac gaggacgaggaagaggagga cgaggaagag gaggacgagg aagaggagga cgaggaagag gaggacgagg aagaggagga cgaggaagag ga (SEQ ID NO: 5), or any larger sequence of said US-1 gene containing said sequence. [Item 20] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence gcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgggggcgcgcgccgcgcttcgacca gaccgtgcgcgactgcctcgcgctcaacgagctctgccgccgcgcgacgaccccgagctccaggacaccctcttcggcgcgtacaaggcgcccgagctctgcgaccggcgcgggcgccc gctcgaggtgcacgcgtgggcgatggacgcgctcgtggccaagctgctgccgctgcgcgtctccaccgtcgacctggggccctcgcc (SEQ ID NO: 6), or any larger sequence of the TK gene containing said sequence. [Item 21] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence JS2012 nucleotides 526 to 607 (cgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcg, SEQ ID NO: 7), or any larger sequence of the TK gene containing said sequence. [Item 22] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence JS2012 nucleotides 280 to 723 (gggcccgcggtcgagggcccgcccgagatgacggtcgtctttgaccgccacccggtggccgcgacggtgtgcttcccgctggcgcgcttcatcgtcggggacatcagcgcggcggccttcgtgggcctggcggccacgctgcccggggagccccccggcggcaacctggtggtggcctcgctggacccggacgagcacctgcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgggggcgcgcgccgcgcttcgaccagaccgtgcgcgactgcctcgcgctcaacgagctctgccgcccgcgcgacgaccccgagctccaggacaccctcttcggcgcgtac, SEQ ID NO: 8), or any larger sequence of the TK gene containing said sequence. [Item 23] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence JS2012 nucleotides 364 to 615 (cgcttcatcgtcggggacatcagcgcggcggccttcgtgggcctggcggccacgctgcccggggagccccccggcggcaacctggtggtggcctcgctggacccggacgagcacctgcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgg, SEQ ID NO: 9), or any larger sequence of the TK gene containing said sequence. [Item 24] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the US-1 gene is a sequence from FS18 similar to SEQ ID NO: 4, or any larger sequence of the US-1 gene containing said sequence. [Item 25] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the US-1 gene is a sequence from FS18 similar to SEQ ID NO: 5, or any larger sequence of the US-1 gene containing said sequence. [Item 26] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence FS18 / M1707 nucleotides 480 to 846 (SEQ ID NO: 6), or any larger sequence of the TK gene containing said sequence. [Item 27] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence FS18 / M1705 nucleotides 526 to 607 (SEQ ID NO: 7), or any larger sequence of the TK gene containing said sequence. [Item 28] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence FS18 / M1708 nucleotides 280 to 723 (SEQ ID NO: 8), or any larger sequence of the TK gene containing said sequence. [Item 29] The virus according to claim 2, wherein the deletion in the nucleotide sequence of the TK gene is the sequence FS18 / M1710 nucleotides 364 to 615 (SEQ ID NO: 9), or any larger sequence of the TK gene containing said sequence. [Item 30] An isolated DNA polynucleotide molecule encoding the virus according to claim 1 or 2. [Item 31] A plasmid capable of directly transfecting a host cell, comprising the DNA polynucleotide molecule according to claim 30 and a promoter capable of enabling transcription of the coding sequence.

Claims

1. A live attenuated porcine herpesvirus 1 (pseudorabies virus), wherein the TK, gI, and gE genes thereof are modified relative to the parental field strain, and the resulting virus is safe and effective for use as a live vaccine that protects porcine animals from challenge with virulent pseudorabies virus, and said virus is encoded by the sequence of SEQ ID NO: 1 or a sequence that is at least 95% identical to SEQ ID NO: 1, a) deletion of nucleotides 480 to 846 of the UL23 gene (isolate M1707); or b) deletion of nucleotides 526 to 607 of the UL23 gene (isolate M1705); or c) deletion of nucleotides 280 to 723 of the UL23 gene (isolate M1708); or d) deletion of nucleotides 364 to 615 of the UL23 gene (isolate M1710) and comprising a virus.

2. The virus according to claim 1, which is encoded by SEQ ID NO:

3.

3. A live attenuated porcine herpesvirus I (pseudorabies virus) encoded by the sequence of SEQ ID NO: 1 or a sequence that is at least 95% identical to SEQ ID NO: 1, having the following deletions: For the gE gene, all of the nucleotides of the ORF are deleted, For the gI gene, at least nucleotides 269 to 1101 of the 1101-nucleotide ORF are deleted, For the TK gene, a deletion is selected from the nucleotide sequences consisting of positions 526 to 607, 480 to 846, 280 to 723, and 364 to 615 from the 963-nucleotide ORF, and comprising a live attenuated porcine herpesvirus I (pseudorabies virus).

4. The live attenuated virus according to claim 1, further comprising a complete deletion of the US2 gene, a complete deletion of the US9 gene, and a deletion of at least nucleotides 909 to 1034 and / or at least nucleotides 301 to 315 of the 1260-nucleotide ORF of the US1 gene.

5. The live attenuated virus according to claim 3, which is encoded by SEQ ID NO: 3 (M1707).

6. A vaccine composition comprising the live virus according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

7. A vaccine composition comprising the virus according to claim 1 or 2, wherein the virus is provided in a killed form.

8. A method of vaccinating a swine animal to provide protection against challenge with a virulent pseudorabies virus, the method comprising administering one or more doses of the vaccine composition according to claim 6.

9. The single-dose virus M1707 is used, and the dosage is 10 4.5 to 10 9 TCID 50 The method according to claim 8, which provides.

10. The vaccine is 10 7 TCID 50 The method according to claim 8, which is safe when administered to piglets in a single-dose treatment of

11. The method according to claim 8, wherein the swine animal is a boar, a sow, a gilt, or a piglet.

12. A single dose of virus M1707 is used, and the dosage is 10 5.0 to 10 5.5 TCID 50 The method according to claim 9, which provides.

13. An isolated DNA polynucleotide molecule encoding the virus according to claim 1 or 2.

14. A plasmid capable of directly transfecting a host cell, the plasmid comprising the DNA polynucleotide molecule according to claim 13 and a promoter capable of enabling transcription of the coding sequence.

Citation Information

Patent Citations

  • Porcine Herpesvirus Gene Deletion Strain, Vaccine Composition, Production Method and Application Thereof

    JP2016531545A