MAPK gene and its use against fungal infections

Abstract

To provide: means for enhancing the fungal resistance of polar using genetic engineering means by exploring infections, disease-resistant genes and internal signal pathways related to poplar against S. musiva infection: and means for improving the disease resistance of poplar by exploring the related mechanisms.SOLUTION: A PtMAPK3-1 gene is a poplar MAPK cascade gene family member and plays an important role in stress resistance and a disease resistance process of poplar. According to the invention, it is discovered that through construction of an expression vector and agrobacterium tumefaciens transgenic overexpression MAPK3-1, accumulation of ROS in a poplar body after overexpression PagMAPK3-1 is infected by S.musiva provides nutrition for further infection and reproduction of pathogenic fungi in a plant body, and the PagMAPK3-1 in a K8 poplar plays a negative regulation role in poplar disease resistance reaction. The invention provides a molecular marker for screening disease-resistant poplar varieties, and also provides a regulation and control means for improving the disease resistance of poplar.SELECTED DRAWING: Figure 5

Description

[Technical Field]

[0001] The present invention relates to the field of plant biology, and in particular to MAPK genes and their use in combating fungal infection of pine trees. [Background technology]

[0002] As the economy and population grow, human demand for wood products and bioenergy raw materials is increasing. However, rising temperatures, limited water availability, and an increased likelihood of natural disasters are limiting the productivity of forest trees. Because of their fast growth rate, adaptability, and short rotation period, poplar trees have been widely cultivated worldwide for use as boards and pulpwood. However, over time, poplar trees have been cultivated over large areas, exposing them to numerous pests and diseases. Sphaerulinamusiva (S. musiva) canker and leaf spot disease can cause premature defoliation, reduced photosynthetic area, and stem breakage, reducing annual timber production and potentially even resulting in the death of poplar trees and the failure of plantations. Poplar leaf spot disease is a fungal disease that primarily affects poplar trees and their relatives. Sphaerulina sp. fungi are a type of leaf spot pathogen that can cause defoliation and rot in plants, with mild cases resulting in reduced yield and severe cases resulting in plant death. Sphaerulina musiva can cause leaf spot and canker disease in poplar trees. It is native to black poplar (Populus deltoides) in eastern America and only causes leaf spot symptoms. In susceptible hybrid poplar trees, S. musiva causes leaf necrosis, early defoliation, and cankers on stems and branches, reducing growth rates and making the tree susceptible to microorganisms. Currently, there is no method to prevent the spread of S. musiva in poplar-growing areas, but once S. musiva has spread to an area, it is difficult to eradicate. Currently, chemical and biological control measures can significantly reduce the incidence of disease in poplar trees, and the creation of disease-resistant transgenic poplar trees is another effective means of controlling poplar disease. Chinese Patent No. CN202210837131.X proposed overexpression of the PtoCXE06 gene in angelica tree to enhance the angelica tree's resistance to angelica tree blight. Chinese Patent No. CN202211588272.9 discovered an effect protein, SmCSEP3, in S. musiva infection and proposed the instantaneous expression or overexpression of SmCSEP3 in angelica tree to enhance the angelica tree's ability to resist S. musiva infection.Therefore, combining genetic engineering technology with plant disease resistance to conduct disease resistance research on poplar trees and explore the relevant control mechanisms of disease resistance is of great significance for improving the survival rate of poplar plantations, increasing timber production, and protecting the landscape ecology. Summary of the Invention

[0003] At present, there are relatively few studies exploring the related infection, anti-disease genes, and internal signaling pathways of Angelica sinensis against S. musiva infection, and using genetic engineering methods to enhance the anti-fungal ability of Angelica sinensis, and more in-depth research is needed. The purpose of this invention is to explore the related mechanisms and propose more methods for improving the anti-disease ability of Angelica sinensis.

[0004] Based on this, the present invention proposes the following technical solution.

[0005] In one aspect of the present invention, the present invention provides a negative regulatory gene of Yangshu Antibacterial Agent, which gene is PagMAPK3-1, the nucleic acid sequence of which is set forth in SEQ ID NO.3.

[0006] In one aspect, the present invention provides an expression vector comprising a PagMAPK3-1 gene, the sequence of which is set forth in SEQ ID NO. 3. The expression vector may be a prokaryotic or eukaryotic expression vector.

[0007] In one aspect, the present invention provides a genetically engineered bacterium containing the expression vector. Preferably, the engineered bacterium is Escherichia coli or a species of Rhizobium.

[0008] In one aspect, the present invention provides a use of the MAPK3-1 gene as a screening marker for resistance to S. musiva infection in poplar trees, preferably Populus trichocarpa or 84K poplar trees.

[0009] The PagMAPK3-1 gene expression of the tested poplar varieties was wild-type.84K If the expression level is significantly higher than that of Yangshu, the cultivar has poor resistance to S. musiva infection, and the PagMAPK3-1 gene expression of the test Yangshu cultivar is wild-type. 84K When the expression level is significantly lower than that of Yangshu, the cultivar has good resistance to S. musiva infection.

[0010] In one aspect, the present invention provides a method for reducing MAPK3-1 gene expression in poplar trees by instantaneous or stable transfection, thereby improving the ability of poplar trees to resist S. musiva infection. Technical Effects

[0011] Genomic analysis revealed that PtMAPK3-1, PtMKK7, PtMKK9, and PtRaf23-1 showed significant changes in transcription levels under various biotic and abiotic stresses, including salt, drought, and M. brunnea fungal stress. In particular, PtMAPK3-1 was found to be a novel MAPK family member capable of responding to various adverse stresses.

[0012] After the overexpressing PagMAPK3-1 transgenic poplar trees were inoculated with S. musiva, both of the transgenic poplar trees showed more necrotic lesions. Physiological and biochemical indicators such as DAB staining, PAL activity, CAT activity, POD activity, and MDA content further demonstrated that PagMAPK3-1 plays a negative regulatory role in the disease resistance of poplar trees. This provides a molecular marker for screening disease-resistant poplar tree varieties and a control method for enhancing the disease resistance of poplar trees. [Brief explanation of the drawings]

[0013] [Figure 1] Gel electrophoresis analysis after PCR amplification of the PagMAPK3-1 gene.

[0014] [Figure 2]1 shows the PagMAPK3-1 gene sequence and predicted conserved domains, where (a) is the sequence of the 84K Yangshu PagMAPK3-1 gene sequence, and (b) is the structural conserved domain prediction analysis of the PagMAPK3-1 gene.

[0015] [Figure 3] PCR electrophoresis detection of transgenic angelica tree (O. gondii) gene group, where lane M is DNA 2000 Marker, lane +, WT are the positive and negative control groups, respectively, and lanes 1, 3, 4, 9, 10, and 11 correspond to transgenic angelica tree (OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11) positive plants, respectively.

[0016] [Figure 4] Expression level detection of PagMAPK3-1 overexpressing transgenic Yangshuo plant.

[0017] [Figure 5] Phenotypic analysis of PagMAPK3-1 transgenic poplar trees after inoculation with S. musiva. (a) Photographs of actual lesions four days after inoculation of S. musiva spore suspensions on leaves of wild-type (WT) and PagMAPK3-1 transgenic poplar trees. (b) Statistical analysis of lesion size six days after inoculation.

[0018] [Figure 6] Physiological and biochemical indexes were detected 2 days after inoculation of PagMAPK3-1 transgenic poplar trees with S. musiva. (a) The figure shows the actual leaves of WT, OE-1, and OE-3 plants 2 days after inoculation with S. musiva. (b) The results of measuring the PAL, CAT, POD, and MDA contents in the leaves of WT, OE-1, and OE-3 plants 2 days after inoculation with S. musiva. DETAILED DESCRIPTION OF THE INVENTION

[0019] The plant material used in this invention, hybrid Yangshu 84K (Populus alba × Populus glandulosa), was a gift from Professor Wang Liuqiang of the Chinese Academy of Forestry. All other biological reagents, except for special instructions, are conventional reagents obtained from commercial biological reagent companies. All relevant molecular biological manipulation methods, except for special instructions, are based on "Guidelines for Molecular Cloning Experiments" (edited by J. Sambrook and DW Russell, Science Press).

[0020] Example 1: Identification of family members of Yangshu MAPK cascade genes

[0021] Gene set data for the assembled versions v1.0 and v3.0 of the Poppy tree gene set were obtained from the PhycoCosm database (http: / / genome.jgi-psf.org / Poptr1 / Poptr1.home.html) and the Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html). Protein sequences for 21 PtMAPKs and 11 PtMAPKKs in the Poppy tree gene set v1.0 were obtained from a previous study (Hamel LP, Nicole MC, Sritubtim S, et al. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families [J]. Trends in plant science, 2006, 11(4): 192-198). Using the 32 protein sequences as queries, the BLAST tool in TBtools was used to obtain PtMAPKs (i.e., MAPKs in PtMAPKKs) and PtMAPKK gene IDs from the PtMAPKK protein library (v3.0). To identify potential members of the PtMAPKKK gene family, PtMAPKK gene and protein sequences were downloaded from the Plant Gene Database (https: / / phytozome.jgi.doe.gov / pz / portal.html). A BLAST search of the PtMAPKK protein database was then performed using the retrieved MAPKKK protein sequences from Pseudo-Nan mustard, Jujube, Mafu-shu, and Kiwifruit as queries. A crypto-Markov model (HMM) was then used to search for genes containing a serine / threonine protein kinase domain (PF00069) in PtMAPKK. Genes obtained from the BLAST and HMM searches were compared to eliminate genes that did not simultaneously satisfy both criteria, and redundant transcripts were removed. Finally, the gene numbers of 21 PtMAPKs and 11 PtMAPKKs in the new version were obtained.To better understand the gene expression levels of MAPK cascade genes in response to adverse conditions, the present invention obtained transcriptome data on asters and abiotic stresses (drought and salt) and biotic stress (Marssoninabrunnea infection) from the NCBI GEO database. The results showed that PtMPK3-1, PtMKK9, PtMKK7, and PtRaf23-1 significantly increased after pathogen infection, and PtMAPK3-1 responded to various stresses. Based on this, the MAPK3-1 gene is an important candidate gene for resistance and disease prevention in asters.

[0022] Example 2: Cloning and analysis of the Yangshu MAPK cascade gene family member PagMAPK3-1 gene

[0023] Maoguoyang is mainly an overseas poplar tree variety. Based on the results of the Maoguoyang gene set analysis in Example 1, the inventors studied the correlation status of MAPK3-1 gene in Chinese poplar tree variety 84K.

[0024] The full-length cDNA of 84K Angelica sinensis was used as a template to clone PagMAPK3-1 (ie, 84K Angelica sinensis MAPK3-1 gene), and the relevant primers used in PCR tests were as follows: PagMAPK3-1-F:ATGGCGAATTATGCACAGGGAAATG(SEQ ID NO.1) PagMAPK3-1-R:CTAGCATGCATATTCTGGATTAAGTGC(SEQ ID NO.2)

[0025] The PCR product gum was recovered, and the recovered PCR product was ligated into the clone carrier pEasy-BluntSimple and transformed into E. coli.

[0026] Analysis: The PCR product was purified and separated by 1% agarose gel electrophoresis. The results showed a single bright strip between 2000 bp and 1000 bp (Figure 1). Gene sequence annotation indicated the PagMAPK3-1 gene size of 1116 bp, indicating successful amplification of the PagMAPK3-1 gene. The bright rubber block was cut and recovered, then attached to a clone carrier and sent to a sequencing company for sequencing. The sequencing results were compared using DNAMAN software. The results showed a sequence match, proving successful cloning of the target gene. Comparison of the PagMAPK3-1 and PtMAPK3-1 sequences revealed that the CDS sequences of MAPK3-1 in the 84K poplar tree and the poplar tree differed by eight bases, resulting in three amino acid differences when translated into protein.

[0027] The sequence of the 84K Yangshu PagMAPK3-1 gene is shown in SEQ ID NO. 3. The PagMAPK3-1 gene size is 1116 bp as shown in Figure 2(a). The predicted structural conserved domains of the PagMAPK3-1 gene are shown in Figure 2(b).

[0028] Example 3: Identification of the disease-resistant function of transgenic overexpressed poplar

[0029] 3.1 Obtaining overexpression recombinant strains

[0030] (1) Career Development

[0031] The PagMAPK3-1 overexpression vector is constructed using Gateway technology.

[0032] a. Gateway splices were added to the F and R ends of the PagMAPK3-1 gene clone primer, and the PagMAPK3-1 clone carrier constructed in Example 2 was used as a template for cloning. The splice primer sequences were added as shown in Table 1 below.

[0033] Table 1 Primer sequences: JPEG0007720113000001.jpg44167

[0034] Then, the PCR product gum is recovered.

[0035] b. The PCR product was cloned into the intermediate carrier pDONR207 by BP reaction, and the reaction system is shown in Table 2. Table 2 BP reaction system JPEG0007720113000002.jpg3376

[0036] The mixture was incubated at 25°C for 6 hours, after which the PCR product was collected, transformed, and sequenced.

[0037] c. Construction of the intermediate carrier in the previous step After the sequencing was correct, the two genes were constructed into the overexpression vector pMDC32 using LR reaction. The reaction system is shown in Table 3.

[0038] Table 3 LR reaction system JPEG0007720113000003.jpg3177

[0039] After 6 hours of incubation at 25°C, the PCR product was collected, transformed, sequenced, and extracted, and then transfected into the recipient cell line GV3101 of Bacillus subtilis.

[0040] (2) Yangshu genetic transformation:

[0041] a. The agrobacterium obtained in (1) above is added to LB medium containing the corresponding Kan and Rif, and amplified so that the OD600 value reaches approximately 0.6.

[0042] b. On the ultra-clean table, place the cut and damaged 84K poplar leaves into the bacterial solution from the previous process and shake at low speed for about 20 minutes.

[0043] c. After aspirating excess bacterial solution from the soaked leaves, place them in differentiation medium and incubate in the dark at 24°C for 2 days.

[0044] d. After 2 days of dark incubation, the leaves are transferred to screening medium containing shiomycin and temetin for screening. Resistant shoots generally appear after about 20 days.

[0045] e. Resistant seedlings are cut off and transferred to a living root medium containing the same resistance, and after the roots are formed, they are amplified and the expression level is detected.

[0046] The composition of differentiation medium system 1 L is shown in Table 4.

[0047] Table 4. Differentiation medium composition JPEG0007720113000004.jpg5272

[0048] Screening medium system 1 L: 1 L of differentiation medium was sterilized, cooled to 50°C, and added with chomycin (0.0003 g / L) and temetin (0.2 g / L) on an ultra-cleaning table.

[0049] The composition of 1 L of the fresh root medium is shown in Table 5.

[0050] Table 5 Fresh root medium composition JPEG0007720113000005.jpg5677

[0051] After sterilization, the mixture was cooled to 50°C, and then chomycin (0.0003 g / L) and temetin (0.2 g / L) were added to the ultraclean table.

[0052] (3) Genetic group PCR verification:

[0053] The gene sequence of Yangshuo was extracted using the CTAB method, and then PCR was performed using the extracted gene sequence as a template to detect the PagMAPK3-1 gene. The overexpression vector was used as a positive control. After the PCR reaction was completed, gel electrophoresis was performed to detect the positive plants. Plants with PCR strips at the corresponding positions of the positive control were identified as positive plants. Figure 3 shows the PCR detection results for the six positive plants used in subsequent experiments. The six positive transgenic plants were named OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11, respectively.

[0054] (4) Relative expression level analysis of positive strains: RNA was extracted from each of the positive plants (OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11), and reverse-transcribed using a reverse transcription kit (TSK302M) from Beijing Tsingke Biotechnology Co., Ltd. to obtain cDNA. The obtained cDNA was used as a template for qRT-PCR to detect the relative expression level of the target gene in each strain system (qRT-PCR was performed using the Green qPCR Super Mix kit from Beijing Tsingke Biotechnology Co., Ltd.). Results: In the PagMAPK3-1 overexpressing recombinant strains, the PagMAPK3-1 gene expression levels in OE-1 and OE-3 were increased by more than 20 times (see Figure 4). Therefore, these two strains were selected for further analysis.

[0055] Example 4: Disease resistance study of PagMAPK3-1 transgenic poplar trees

[0056] 4.1S. musiva infection

[0057] S. musiva was cultured on PDA medium by isolating leaves from poplar trees with leaf spot disease. The mycelium was scraped off with a gun head or sowing needle and dissolved in a sterile 0.05% Toon 80 solution to adjust the number of spores in the spore suspension. Healthy leaves from poplar tree transplants were collected and placed on culture plates lined with moist gauze. The dorsal side of the leaf was facing up, and 25 μl of the prepared spore suspension was dripped onto both sides of the leaf, avoiding the veins. The culture plates were placed in a culture box at 25°C and cultured in the dark, with daily observations for disease development.

[0058] Results: Leaves of 84K poplar trees (wild-type control, WT) and PagMAPK3-1 transgenic poplar trees were inoculated with a spore suspension of S. musiva. Four days later, lesions were observed. The results are shown in Figure 5(a). Six days after inoculation, slight lesions appeared on 84K poplar leaves, but the necrotic areas on PagMAPK3-1 transgenic poplar leaves were larger than those on WT. Statistical analysis of lesion size six days after inoculation revealed that the lesion sizes of OE-1 and OE-3 were significantly larger than those of WT (Figure 5(b)). These results suggest that overexpression of PagMAPK3-1 reduced the resistance of poplar trees to S. musiva.

[0059] 4.2 Physiological and biochemical index measurements

[0060] When threatened by pathogens, plants rapidly accumulate reactive oxygen species (ROS), which can lead to cell death. Therefore, to eliminate excess ROS, plants activate endogenous antioxidant enzymes, such as peroxidase (CAT), peroxidase (POD), and phenylalanine enzyme (PAL). Malonaldehyde (MDA) is a commonly used indicator of oxidative stress in plants and can reflect the degree of peroxidation of plant membrane lipids. DAB staining of WT, OE-1, and OE-3 plant leaves on day 2 after inoculation with S. musiva can detect the accumulation of ROS, i.e., H2O2, in plants.

[0061] (1) Measurement of CAT (hydrogen peroxidase), POD (peroxidase) activity, and PAL (phenylalanine enzyme). For POD and CAT detection methods, see Maehly AC, Chance B. The assay of catalases and peroxidases [J]. Methods of Biochemical Analysis, 1954, 1:357-424. For PAL detection methods, see Beaudoin-Eagan LD, Thorpe TA. Tyrosine and phenylalanine ammonia lyase activities during shoot initiation in tobacco callus cultures. Plant Physiol. 1985, 78:438-41.

[0062] (2) Measurement of MDA content: The thiobarbituric acid method was used to measure the malonaldehyde content. The specific experimental method was based on the “Plant Physiology Experimental Course” edited by Wang Sangen and published by Science Publishing House in 2017.

[0063] (3) DAB staining: Place the affected area of poplar leaves in a 50ml centrifuge tube, add DAB staining solution, and immerse the leaves. Shake at 80 r / min at 25-28°C for 4-7 hours under dark conditions. After discarding the staining solution, add bleaching solution (bleaching solution preparation: ethanol:acetic acid:glycerin = 3:1:1). Transfer the centrifuge tube to a thermostatic water bath (95°C) and bleach for 15 minutes. The bleaching solution can be changed once or twice during this period.

[0064] For each of the above indicators, poplar leaves were collected from the diseased area, and each sample was replicated three times. Histograms and ANOVA difference significance analysis (*p<0.05, **p<0.01) were presented using GraphPadPrism5 software.

[0065] Results: As shown in Figure 6(b), measurements of PAL, CAT, and POD activities showed that PAL and CAT activities increased in wild-type (WT) plants, but decreased in the PagMAPK3-1-overexpressing transgenic plants, significantly lower than those in the WT. POD activity increased in the WT on the second day after sowing, but decreased in the PagMAPK3-1-overexpressing transgenic plants, significantly lower than those in the WT.

[0066] As shown in Figure 6(b), after pathogen treatment, the MDA content of the transgenic lines was obviously higher than that of the WT plants.

[0067] As shown in Figure 6(a), two days after inoculation with S. musiva, yellow-brown precipitates appeared on the leaves of WT, OE-1, and OE-3 plants, indicating that S. musiva can induce the accumulation of reactive oxygen species in plants after invading the plants. The precipitates in WT leaves were less than those in the two transgenic plants, indicating that the PagMAPK3-1 transgenic plants caused more cell death and H2O2 accumulation after invading S. musiva, providing nutrients for further invasion and reproduction of the pathogenic fungus within the plant.

[0068] The above has described the present invention in more detail based on specific embodiments, and the specific implementation of the present invention cannot be deemed to be limited to these descriptions. Those skilled in the art may make some simple inferences or substitutions without departing from the concept of the present invention, and all of them should be considered to fall within the scope of protection defined by the claims submitted by the present invention.

Claims

1. A negative regulatory gene for disease resistance in poplar (Populus), characterized in that the gene is PagMAPK3-1, the nucleic acid sequence of which is set forth in SEQ ID NO.

3.

2. The PagMAPK3-1 gene is included, The sequence of the PagMAPK3-1 gene is shown in SEQ ID NO.

3.

3. A genetically engineered bacterium comprising the expression vector of claim 2.

4. 4. The genetically engineered fungus of claim 3, wherein the engineered fungus is Agrobacterium tumefaciens.

5. 10. The use of the gene according to claim 1 as a screening marker for resistance to S. musiva infection in poplar trees, wherein the poplar trees are 84K poplar trees (Populus alba × Populus glandulosa).

6. If the expression level of the PagMAPK3-1 gene in the test poplar variety is significantly higher than that of the wild-type 84K poplar variety, the variety has poor resistance to S. musiva infection. The use of claim 5, wherein if the expression level of the PagMAPK3-1 gene in the test poplar tree variety is significantly lower than that of the wild-type 84K poplar tree variety, the variety has good resistance to S. musiva infection.

7. A method for improving the resistance of poplar trees to S. musiva infection by reducing the expression of MAPK3-1 gene in poplar trees by instantaneous or stable transfection, wherein the poplar trees are 84K poplar trees (Populus alba × Populus glandulosa), and the sequence of the MAPK3-1 gene in the poplar trees is set forth in SEQ ID NO. 3.

Images