Drug targets for idiopathic pulmonary fibrosis

Abstract

The present invention relates to a drug target for idiopathic pulmonary fibrosis and its use. The drug target is AREG signaling in pulmonary AT2 cells. The drug target can be used to screen for drugs that treat and / or prevent pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals and humans.

Description

[Background technology]

[0001] Fibrosis is formed by thickening or scarring of connective tissue following injury and is characterized by excessive proliferation of fibroblasts and accumulation of extracellular matrix (ECM) components. This condition is common in organs such as the lungs, liver, and kidneys, and can lead to the destruction of tissue structures and severe impairment of organ function. 1、2 In fact, fibrosis can occur in almost any organ and is a major cause of end-stage organ failure and death in a variety of chronic diseases. 3 A common feature of pulmonary fibrosis is the excessive proliferation of fibroblasts around the air sacs (alveoli) of the lungs. 4 Extensive biomedical research has shown that the combination of increased fibroblast numbers and excessive ECM deposition in these lungs ultimately leads to disruption of alveolar architecture, reduced lung compliance, and impaired gas exchange. 5-7 .

[0002] The most common type of pulmonary fibrosis is idiopathic pulmonary fibrosis (IPF). This disorder eventually affects entire lung lobes, but begins as tiny peripheral fibrotic lesions that gradually progress inwards, ultimately resulting in respiratory failure. 8、9 IPF is a fatal disease, with a median survival time of only 2-4 years from diagnosis. 10 Scientifically speaking, the mechanisms and nature of IPF pathogenesis have not yet been fully elucidated, and several studies have suggested the contribution of a specific subset of alveolar epithelial cells, alveolar type II (AT2) cells. 4、11 .

[0003] Patients with pulmonary fibrosis experience reduced lung compliance, impaired gas exchange, and ultimately respiratory failure and death. It is estimated that IPF affects 1 in 200 adults aged 65 years or older in the United States, with a median survival time of 2 to 4 years. The estimated incidence of IPF in China is 3 to 5 per 100,000, accounting for approximately 65% ​​of all interstitial lung diseases. Diagnosis is usually made between the ages of 50 and 70, with a male-to-female ratio of 1.5 to 2:1. Patient survival is usually only 2 to 5 years.

[0004] Currently, IPF cannot be cured. Two known drugs, nintedanib and pirfenidone, have similar effects on the rate of decline in forced vital capacity within one year. Although these drugs have shown a tendency to reduce mortality, they have not been able to significantly extend survival. One of the main reasons for this is that there is still no ideal drug target for pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF), to screen candidate drugs for treating pulmonary fibrosis, especially IPF. Summary of the Invention

[0005] The present invention relates to a drug target for idiopathic pulmonary fibrosis and uses thereof. The drug target is AREG signaling in pulmonary AT2 cells. The drug target can be used to screen for drugs that treat and / or prevent pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF). The present invention further provides a method for screening candidate drugs for treating pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF), using the drug target.

[0006] First, the present invention provides a drug target for idiopathic pulmonary fibrosis, which is AREG signaling in pulmonary AT2 cells (hereinafter referred to as the AREG target).

[0007] In the present invention, it was found that AREG was detected in AT2 cells of all IPF specimens, but not in AT2 cells of control lungs.

[0008] In the present invention, it was found that AREG signals could not be detected in control lungs of subjects who had undergone or had not undergone PNX, and that AREG signals could not be detected in AT2 cells in control lungs derived from subjects who had undergone or had not undergone PNX.

[0009] The present invention further revealed that AREG could be detected in AT2 cells in Cdc42-null AT2 lungs, and that the expression level of AREG in the lungs of Cdc42-null AT2 lungs after PNX gradually increased.

[0010] Thus, the expression level of AREG was significantly upregulated in AT2 cells from both the progressive fibrosis mouse model and pulmonary fibrosis patients.

[0011] The present invention further revealed that overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0012] Preferably, ectopic expression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0013] Preferably, the AREG target is AREG in pulmonary AT2 cells derived from a subject.

[0014] Preferably, the AREG target is the receptor for AREG in pulmonary AT2 cells derived from a subject.

[0015] Preferably, the AREG target is EGFR in lung fibroblasts from the subject.

[0016] In the present invention, it was demonstrated that the strength of EGFR signaling in α-SMA-positive fibroblasts depends on the expression of AREG in AT2 cells.

[0017] In the present invention, it was demonstrated that reducing the AREG expression level in pulmonary AT2 cells derived from subjects significantly attenuated the progression of pulmonary fibrosis in Cdc42-null AT2 mice.

[0018] Therefore, the present invention demonstrated that AREG and its receptor EGFR are therapeutic targets for treating fibrosis.

[0019] Next, the present invention provides a method for generating Areg AT2-overexpressing transgenic mice in which AREG is specifically overexpressed in pulmonary AT2 cells.

[0020] Preferably, the method comprises specifically inducing Areg expression in AT2 cells after doxycycline treatment, and preferably, the transgenic mouse produced is an Spc-rtTA / teto-Areg mouse. Preferably, the Spc-rtTA / teto-Areg mouse has the characteristic sequence shown in SEQ ID NO:18.

[0021] Preferably, the Spc-rtTA / teto-Areg mice can be identified by the following primer sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

[0022] Third, the present invention provides a transgenic mouse in which AREG is specifically overexpressed in pulmonary AT2 cells. The mouse is a transgenic mouse in which Areg AT2 is overexpressed.

[0023] Preferably, in the transgenic mouse, Areg expression is specifically induced in AT2 cells after doxycycline treatment. Preferably, the transgenic mouse is an Spc-rtTA / teto-Areg mouse. Preferably, the Spc-rtTA / teto-Areg mouse has the characteristic sequence shown in SEQ ID NO: 18.

[0024] Preferably, the Spc-rtTA / teto-Areg mice can be identified by the following primer sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

[0025] Fourth, the present invention provides the use of AREG in pulmonary AT2 cells and / or its receptor EGFR in fibroblasts as drug targets for treating pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF).

[0026] Fifth, the present invention provides use of the AREG target or the transgenic mouse for screening drugs for treating pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF).

[0027] Sixth, the present invention provides use of an agent for detecting AREG and / or an agent for detecting its receptor EGFR for producing a diagnostic kit for diagnosing pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals and humans.

[0028] Preferably, the kit can be used with a sample from a subject suspected of having pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF). The sample can be a biopsy tissue. For example, the biopsy tissue can be lung tissue from the subject. Preferably, the biopsy tissue can be from the lower, middle, or upper lobe of the subject's lung. If AREG is detected in the upper lobe of the subject's lung, the subject can be diagnosed as having severe pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF). Idiopathic pulmonary fibrosis is considered to be the most common type of pulmonary fibrosis, in which fibrotic lesions begin in the periphery of the lung lobe, progress to the center of the lung lobe, and then to the upper lobe, ultimately causing respiratory failure.

[0029] Seventh, the present invention provides use of a substance that targets AREG and / or its receptor in pulmonary AT2 cells, for example, EGFR in fibroblasts, for the manufacture of a medicament for treating pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals and humans.

[0030] Preferably, the substance is an inhibitor of AREG in pulmonary AT2 cells or an inhibitor of EGFR in pulmonary fibroblasts.

[0031] The animal can be a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey, or chimpanzee.

[0032] The present invention includes all combinations of the specific embodiments described in the specification. [Brief explanation of the drawings]

[0033] [Figure 1] FIG. 1 shows the generation of a mouse strain in which the Cdc42 gene was specifically deleted in AT2 cells. [Figure 2] Figure 2 shows a fragment of the Cdc42 DNA sequence before and after deletion of exon 2 of the Cdc42 gene in AT2 cells. [Figure 3] FIG. 3 shows that loss of the Cdc42 gene in AT2 cells impairs AT2 cell differentiation during alveolar regeneration or alveolar steady state after PNX. [Figure 4] FIG. 4 shows that loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-treated mice. [Figure 5] FIG. 5 shows that loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-naive aged mice. [Figure 6] FIG. 6 shows the development of α-SMA+ fibroblast foci in the lungs of Cdc42 null AT2 mice. [Figure 7] FIG. 7 shows that AREG is strongly and specifically expressed in AT2 cells of Cdc42-null AT2 lungs. [Figure 8]FIG. 8 shows that AREG is strongly and specifically expressed in AT2 cells from human pulmonary fibrosis patients. [Figure 9] FIG. 9 shows the sequence of teto-Areg. [Figure 10] Figure 10 shows that Areg expression is specifically induced in AT2 cells of Spc-rtTA / teto-Areg mice after doxycycline treatment. Overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis. [Figure 11] FIG. 11 shows the Areg DNA sequence before and after deletion of exon 3 of the Areg gene in AT2 cells. [Figure 12] FIG. 12 shows that deletion of the Areg gene in AT2 cells in Cdc42-null AT2 lungs significantly attenuates the development of pulmonary fibrosis. [Figure 13] FIG. 13 Targeting AREG and its receptor EGFR to treat IPF and other fibrotic diseases. DETAILED DESCRIPTION OF THE INVENTION

[0034] The descriptions of specific embodiments and examples are for purposes of illustration and not limitation, as those of ordinary skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.

[0035] Idiopathic pulmonary fibrosis (IPF) is a chronic lung disease characterized by a progressive and irreversible decline in lung function. Symptoms usually begin with shortness of breath and a dry cough. Other changes may include fatigue and Hippocratic nails. Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.

[0036] The alveolar epithelium of the lung consists of both alveolar type I (AT1) and type II (AT2) cells. AT2 cells are alveolar stem cells and can differentiate into AT1 cells during the alveolar steady state and during the repair phase after injury. 12、13AT1 cells, which ultimately constitute approximately 95% of the alveolar surface in the adult lung, are large, flattened cells that function as the epithelial component of the thin blood-air barrier. 14 In IPF tissues, abnormally proliferated AT2 cells are usually located near fibroblast nests. 15 In clinical practice, gene mutations affecting the function of AT2 cells are commonly observed in IPF tissues. 16、17 In addition, recent advances in identifying the molecular profile of IPF lungs have revealed that TGFβ signaling (a pro-fibrotic signaling pathway common to many fibrotic diseases) is activated in AT2 cells in IPF lungs. Although these multiple lines of evidence together demonstrate the clear pathological influence of AT2 cells in pulmonary fibrosis, the exact pathological mechanisms underlying the abnormal physiological function of AT2 and progressive pulmonary fibrosis remain to be elucidated.

[0037] After administering tamoxifen to the animals, the Sftpc gene promoter-driven recombinase (Spc-CreER) is used to specifically delete genes in AT2 cells. The CreER mouse strain is commonly used for inducible gene knockout studies.

[0038] Amphiregulin (AREG) is a member of the epidermal growth factor family. AREG is synthesized as a membrane-anchored precursor protein and can act directly on neighboring cells as a juxta-crine factor. After proteolytic processing by plasma membrane proteases (TACE / ADAM17), AREG is secreted and functions as an autocrine or paracrine factor. AREG is a ligand for the transmembrane tyrosine kinase epidermal growth factor receptor (EGFR). By binding to EGFR, AREG can activate major intracellular signaling cascades that control cell survival, proliferation, and differentiation. 19-21 .

[0039] Physiologically, AREG plays an important role in the development and maturation of mammary glands, bone tissue, and oocytes. 20、22Under normal conditions, AREG is expressed at low levels in adult tissues other than the placenta. However, chronic elevation of AREG expression has been shown to be associated with several pathological conditions. Increased AREG expression is associated with skin phenotypes such as psoriasis and several inflammations. 23 Several studies have documented the oncogenic role of AREG in lung, breast, colorectal, ovarian, and prostate cancers, as well as in several hematologic and mesenchymal cancers. 24、25 AREG may also be involved in drug resistance to some cancer treatments. 26、27 .

[0040] It has been shown that TGFβ can activate AREG expression in a bleomycin-induced mouse pulmonary fibrosis model 28 It has also been shown that AREG expression levels are elevated in liver fibrosis, cystic fibrosis, and polycystic kidney disease. 23 Therefore, it is thought that AREG may contribute to the proliferation and survival of fibrogenic cells in these fibrotic diseases, especially in idiopathic pulmonary fibrosis (IPF). However, the mechanisms and nature of the pathological progression of IPF have not yet been fully elucidated. 29 Although AREG has been speculated to play a role in the progression of IPF, the cells in which AREG is expressed during the process of progressive pulmonary fibrosis remain unknown. Furthermore, due to the lack of a mouse model of progressive pulmonary fibrosis, the effect of targeting AREG in progressive pulmonary fibrosis is also unknown.

[0041] In an embodiment of the present invention, it was shown that AREG signals could not be detected in control lungs of subjects who had or had not undergone PNX, and that AREG signals could not be detected in AT2 cells in control lungs derived from subjects who had or had not undergone PNX.

[0042] In embodiments of the present invention, AREG was detected in AT2 cells from PNX-treated Cdc42-null AT2 lungs or aged Cdc42-null AT2 mice, and the expression level of AREG gradually increased in the lungs of Cdc42-null AT2 lungs after PNX. Surprisingly, AREG was detected in AT2 cells from all IPF specimens. Thus, the present invention is the first to demonstrate that AREG expression levels were significantly upregulated in AT2 cells from both a mouse model of progressive fibrosis and patients with pulmonary fibrosis.

[0043] In an embodiment of the present invention, transgenic mice were generated in which AREG was specifically overexpressed in pulmonary AT2 cells, and the transgenic mice had obvious fibrotic changes in the lungs.

[0044] In an embodiment of the present invention, transgenic mice lacking both the Areg and Cdc42 genes were generated. These transgenic mice are Areg & Cdc42 double-null AT2 mice. Areg & Cdc42 double-null AT2 mice exhibited slight fibrosis 21 days after PNX, whereas Cdc42-null AT2 mice exhibited significant pulmonary fibrosis. Therefore, reducing the expression level of AREG significantly attenuates the progression of pulmonary fibrosis in Cdc42-null AT2 mice. Therefore, the present invention proposes that AREG and its receptor EGFR are therapeutic targets for treating fibrosis. AREG refers to AREG in pulmonary AT2 cells, and EGFR refers to EGFR on pulmonary fibroblasts.

[0045] In embodiments of the present invention, inhibition of AREG and its receptor EGFR has been shown to be a potential therapeutic approach for treating IPF and other fibrotic diseases. [Example]

[0046] method Mice and survival curve recording Rosa26-CAG-mTmG (Rosa26-mTmG) and Cdc42 flox / flox mouse 30 All experiments were performed in accordance with the recommendations of the National Institute for Biological Sciences Guide for the Care and Use of Laboratory Animals. To monitor mouse survival, both control and Cdc42-null AT2 mice were weighed weekly after PNX treatment. Mice were sacrificed when they reached pre-defined endpoint criteria. Endpoints were defined based on pre-defined criteria. 31、32 .

[0047] We generated Spc-CreER / rtTA (Spc-CreER) knock-in mice. CreERT2, p2a, and rtTA elements were enzymatically ligated and inserted into the endogenous Sftpc gene of mice. The insertion site was the stop codon of the endogenous Sftpc gene, followed by the generation of a new stop codon at the 3' end of rtTA. The CreERT2-p2a-rtTA fragment was then inserted into the genome using CRISPR / Cas9 technology.

[0048] Areg flox / flox Preparation of mice Based on previous studies, Areg flox / flox mouse 33 Briefly, Areg exon 3 was anchored by loxp. loxp1 (GACACGGATCCATAACTTCGTATAATG TATGCTATACGAAGTTATCGAGTC (SEQ ID NO: 3)) was inserted at position 3704 of Areg DNA, and loxp2 (CCGCGGATAACTTCGTATAATGT ATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO: 4)) was inserted at position 4208 of Areg DNA. After tamoxifen-induced Cre-loxP recombination, exon 3 of the Areg gene was deleted, inhibiting AREG function.

[0049] Generation of teto-Areg mice A tetracycline response element was inserted in front of the CMV promoter-driven Areg gene, allowing for inducible Areg expression upon treatment of mice with doxycycline (Dox). The sequence of the tetracycline response element is as follows: 5'TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGT GATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGA3'(SEQ ID NO:5).

[0050] A minimal CMV promoter was inserted in front of the Areg cDNA to overexpress Areg. The sequence of the CMV promoter is as follows: 5'GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT3' (SEQ ID NO:6).

[0051] The sequence of Areg cDNA is as follows: 5'' (SEQ ID NO: 7).

[0052] The tetracycline response element, CMV promoter and Areg cDNA were enzymatically ligated and inserted into the mouse genome. The sequence of teto-Areg is as follows:

[0053] In Spc-rtTA / teto-Areg mice, Areg expression was specifically induced in AT2 cells after doxycycline treatment.

[0054] The primer sequences for sequencing the teto-Areg sequence are as follows: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

[0055] Pneumectomy (PNX) Eight-week-old male mice were injected with tamoxifen (75 mg / kg) every other day for a total of four times. 14 days after the last tamoxifen injection, the mice were anesthetized and connected to a ventilator (Kent Scientific, Topo). An incision was made in the chest wall at the fourth intercostal space, and the left lung lobe was removed.

[0056] Pulmonary function tests Pulmonary function parameters were measured using an invasive pulmonary function testing system (DSI Buxco® PFT Controller). Mice were first anesthetized, and then an endotracheal cannula was inserted into their trachea. Dynamic compliance results were obtained from resistance and compliance measurements. Forced vital capacity results were obtained from pressure-volume tests.

[0057] Hematoxylin and eosin (H&E) staining and immunostaining Lungs were inflated with 4% paraformaldehyde (PFA) and continuously fixed in 4% PFA for 24 h at 4°C. Lungs were then cryoprotected in 30% sucrose and embedded in OCT (Tissue Tek).

[0058] H&E staining experiments followed standard H&E protocols. Briefly, slides were washed with water to remove OCT. Cell nuclei were stained with hematoxylin (Abcam, ab150678) for 2 minutes, and cytoplasm was stained with eosin (Sigma, HT110280) for 3 minutes. After dehydration and clearing, sections were sealed with neutral resin.

[0059] Immunofluorescence staining experiments followed a previously described protocol. 34 Briefly, after removing the OCT, lung sections were blocked with 3% BSA / 0.1% TritonX-100 / PBS for 1 hour, and then the sections were incubated with primary antibodies overnight at 4°C. After washing the slides three times with 0.1% TritonX-100 / PBS, the slides were incubated with secondary antibodies for 2 hours at room temperature.

[0060] The primary antibodies used herein are as follows: [Table 1]

[0061] The secondary antibodies used herein are as follows: [Table 2]

[0062] For p-SMAD2 staining experiments, tissues were fixed in 4% PFA with 1X phosphatase inhibitor (Bimake, B15002). Tyramide signal amplification was used for pSMAD2 staining.

[0063] Human lung tissue was fixed in 4% PFA for 24 hours at 4°C, cryoprotected in 30% sucrose, and embedded in OCT. All experiments were performed with the approval of the institutional review boards of both the Beijing National Institute for Biological Sciences and the Beijing China-Japan Friendship Hospital.

[0064] Statistical analysis. All data are presented as mean ± sem (as in the example figures). Data shown in the figures were collected from multiple independent experiments performed on different days using different mice. Unless otherwise stated, most data shown in the figures are based on at least three independent experiments. Inferential statistical significance of differences between samples was assessed using an unpaired, two-tailed Student's t-test.

[0065] Isolation of mouse AT2 cells After four injections of tamoxifen, lungs from Spc-CreER, Rosa26-mTmG mice were dissociated as previously described. 23 Briefly, anesthetized mice were perfused with neutral protease (Worthington-Biochem, LS02111) and DNase I (Roche, 10104159001). AT2 cells were directly sorted based on GFP fluorescence using single-cell selection mode on BD FACS Aria II and III instruments.

[0066] Quantitative RT-PCR (qPCR) Total RNA was isolated from whole lung or primary AT2 cells using the Zymo Research RNA Mini Prep Kit (R2050). Reverse transcription was performed using a 2-step cDNA synthesis kit (Takara, catalog number 6210A / B) according to the manufacturer's recommendations. qPCR was performed using the CFX96 Touch™ real-time PCR detection system. Target gene mRNA levels were normalized to Gapdh mRNA levels. The primers used for qPCR were as follows:

[0067] The primers used for qPCR are as follows: [Table 3]

[0068] AREG ELISA AREG concentrations in whole lung lysates were detected using a mouse AREG immunoassay kit (R&D Systems, DY989). Specifically, entire lung lobes were pulverized with liquid nitrogen and then lysed with cell lysis buffer. The lung lysates were then added to the wells of a microwell plate to be used. After the reaction, the absorbance at 450 nm was measured. AREG concentrations in human lung tissue lysates were detected using a human AREG immunoassay kit (Abnova, B0RB01090J00018). Briefly, human lung tissues were pulverized with liquid nitrogen and then lysed with cell lysis buffer. The lung lysates were then added to the wells of a microwell plate to be used. After the reaction, the absorbance at 450 nm was measured. All experiments were performed with the approval of the institutional review boards of both the Beijing National Institute for Biological Sciences and the Beijing China-Japan Friendship Hospital.

[0069] Primer sequences for sequencing fragments of Cdc42 DNA sequence before and after deletion of exon 2 of Cdc42: Forward: CTGCCAACCATGACAACCTAA(SEQ ID NO:1), Reverse direction:AGACAAAACAACAAGGTCCAG(SEQ ID NO:2).

[0070] Primer sequences for sequencing fragments of Areg DNA sequence before and after deleting exon 3 of Areg: Forward: AAACAAAACAAGCTGAAATGTGG(SEQ ID NO:14), Reverse: AAGGCCTTTAAGAACAAGTTGT (SEQ ID NO: 15).

[0071] Example 1. Generation and characterization of Cdc42 null AT2 mice To establish an animal model of progressive pulmonary fibrosis, we generated Cdc42-null AT2 mice by specifically knocking out the Cdc42 gene in alveolar type II cells (AT2).

[0072] To specifically delete the Cdc42 gene in AT2 cells, we generated mice carrying the Spc-CreER allele and Cdc42 floxed (Cdc42 flox / flox ) mice were crossed (Figure 1A). flox / flox In mice, exon 2 of the Cdc42 gene, which contains the translation initiation exon, contains two loxP sites. Spc-CreER / Cdc42 flox / flox After tamoxifen treatment in mice, exon 2 of the Cdc42 gene was specifically deleted in AT2 cells by Cre / loxp-mediated recombination (Figure 1B). Spc-CreER / Cdc42 flox / flox The mice were named Cdc42 null AT2 mice.

[0073] Fragments of the Cdc42 DNA sequence before and after deletion of exon 2 of the Cdc42 gene are shown in FIG.

[0074] Control and Cdc42-null AT2 mice underwent PNX, and alveolar regeneration and AT2 cell differentiation were analyzed 21 days after PNX (Figure 3A). As shown in Figure 3A, 200-μm lung sections from control and Cdc42-null AT2 mice were immunostained with antibodies against GFP, Pdpn, and Prospc. At 21 days after PNX, numerous newly differentiated AT1 cells and newly formed alveoli were observed in control lungs without prostheses (Figure 3B). However, in Cdc42-null AT2 lungs, at 21 days after PNX, only a few AT2 cells had differentiated into AT1 cells, and no new alveoli had formed (Figure 3B). The peripheral alveoli in Cdc42-null AT2 lungs were observed to be significantly and excessively expanded (Figure 3B).

[0075] Under normal steady-state conditions, AT2 cells slowly self-renewed, differentiated into AT1 cells, and formed new alveoli. To examine whether Cdc42 is essential for AT2 cell differentiation during steady-state conditions, we deleted the Cdc42 gene in AT2 cells when mice were 2 months old and analyzed the fate of AT2 cells until the mice were 12 months old. At 12 months, lungs were harvested from control and PNX-untreated Cdc42-deficient mice (Figure 3C). Images show maximum intensity of 200 μm Z-projections of lung sections stained with antibodies against GFP, Pdpn, and Prospc. Numerous new alveolar formations were observed in the lungs of 12-month-old control mice (Figure 3D). However, enlarged alveoli were observed in the lungs of 12-month-old Cdc42-deficient mice (not subjected to PNX), and no new AT1 cells were formed (Figure 3D).

[0076] Longer-term observations were performed on Cdc42-null AT2 and control mice after PNX (Fig. 4A). Surprisingly, at 21 days after PNX, some Cdc42-null AT2 mice showed significant weight loss and increased respiratory rate. Indeed, at 60 days after PNX, approximately 50% of PNX-treated Cdc42-null AT2 mice reached the predefined health criteria for endpoint euthanasia (Fig. 4B). At 180 days after PNX, approximately 80% of PNX-treated Cdc42-null AT2 mice reached endpoint (Fig. 4B).

[0077] H&E staining of control and Cdc42-null AT2 mice after PNX revealed severe fibrosis in the lungs of Cdc42-null AT2 mice at the endpoint (Figure 4D vs. Figure 4C). To confirm the onset of pulmonary fibrosis in Cdc42-null AT2 mice after PNX, we analyzed the lungs of Cdc42-null AT2 mice using H&E staining at different time points after PNX (Figure 4D). At 21 days after PNX, signs of tissue thickening were observed in the subpleural region of some Cdc42-null AT2 lungs (Figure 4D). By the endpoint, dense fibrosis had already progressed to the center of the majority of Cdc42-null AT2 lungs (Figure 5D). The situation observed in post-PNX and aged Cdc42-null mice resembled the characteristic progression of IPF, in which fibrotic lesions first develop in the periphery of the lung and then progress inward toward the center of the lung lobes.

[0078] Strong immunofluorescence signals for collagen I were detected in these dense fibrotic areas in the lungs of Cdc42-null AT2 mice (Figure 4E). Furthermore, we observed a gradual increase in the percentage of collagen I-expressing areas per lung lobe in Cdc42-null AT2 mice after PNX (Figure 4F). qPCR analysis also demonstrated a gradual increase in collagen I mRNA expression levels from day 21 after PNX (Figure 4G). Furthermore, we observed a gradual decrease in lung compliance in PNX-treated Cdc42-null AT2 mice compared with PNX-treated control mice from day 21 after PNX (Figure 4H). This is an intriguing finding, given that lung compliance is known to frequently decrease during lung fibrosis.

[0079] Because impaired AT2 differentiation and alveolar enlargement were found in 12-month-old Cdc42-null AT2 mice (Figure 3D), we analyzed the lungs of PNX-untreated control and Cdc42-null AT2 mice aged 10 to 24 months (Figure 5A). No fibrotic changes were observed in the lungs of control mice, even at 24 months of age (Figure 5B). Significant fibrotic changes were not observed in Cdc42-null AT2 mice before reaching 10 months of age (Figure 5C). Further observation up to 12 months revealed that fibrosis clearly began to develop in the subpleural region of Cdc42-null AT2 lungs and progressed toward the center of the lungs by 12 months (Figure 5C).

[0080] Fibroblast nests are recognized as relevant morphological markers of progressive pulmonary fibrosis and are considered to be sites where the fibrotic response is initiated and / or sustained in progressive pulmonary fibrosis. 35 Fibroblast nests are composed of proliferating α-SMA + Cdc42 null AT2 mice were stained with antibodies against α-SMA on day 21 after PNX (Fig. 6A). In the relatively normal alveolar regions of Cdc42 null AT2 lungs, some α-SMA was detected. + Fibroblasts were observed to begin to gather around the AT2 cell clusters (area 1, Figure 6A). Furthermore, dense fibrotic areas of the lung were characterized by α-SMA expression. + The lungs were filled with fibroblasts (area 2, Figure 6A). Furthermore, immunostaining with antibodies against both α-SMA and the proliferation marker Ki67 revealed that α-SMA was not present in the lungs of Cdc42 null AT2 mice 21 days after PNX. + These results suggest that the proliferation of α-SMA cells is significantly increased. + We show that fibroblasts contribute to the development of pulmonary fibrosis in Cdc42-null AT2 mice ( Fig. 6B ).

[0081] Taken together, loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-treated mice. Furthermore, this progressive pulmonary fibrosis phenotype also begins in PNX-untreated Cdc42-null AT2 mice at approximately 12 months of age. All these results demonstrate that loss of Cdc42 in AT2 cells leads to IPF-like progressive pulmonary fibrosis in mice. Therefore, a mouse model of IPF-like progressive pulmonary fibrosis can be constructed and used to study human IPF disease.

[0082] Example 2. Sequence characterization of Cdc42 null AT2 mice Spc-CreER, Cdc42 flox / - Genome purification and PCR amplification were performed on mice, and then the floxed and deleted bands of Cdc42 were purified and sequenced using the following primers: CTGCCAACCATGACAACCTAA(SEQ ID NO:1), AGACAAAACAACAAGGTCCAG(SEQ ID NO:2).

[0083] A fragment of the sequence of Cdc42 DNA before and after deletion of exon 2 of the Cdc42 gene is shown in FIG.

[0084] Example 3. Amphiregulin (AREG) is strongly expressed in AT2 cells of Cdc42-null AT2 lungs after PNX treatment In the Cdc42-null AT2 fibrosis model, Cdc42-null AT2 lungs began to show fibrotic changes starting at day 21 after PNX (Figure 4D). Control and Cdc42-null AT2 cells after PNX treatment have already been characterized (Figure 7A). By both RNA sequencing and quantitative PCR (qPCR), AREG was observed to be one of the most upregulated genes in AT2 cells of Cdc42-null AT2 lungs at day 21 after PNX (Figure 7B). Immunostaining revealed that AREG was detectable in AT2 cells of Cdc42-null AT2 lungs at day 21 after PNX (Figure 7C). At day 21 after PNX, AREG signaling was undetectable in control lungs (Figure 7C). This is consistent with information from the Human Tissue Atlas. AREG expression is below detectable levels in adult lung tissue. Furthermore, AREG signaling was specifically detected in AT2 cells. AREG protein expression in Cdc42-null AT2 lungs was measured using the AREG Elisa kit. We observed that the expression level of AREG gradually improved in the lungs of Cdc42-null AT2 mice from day 21 after PNX to day 60 after PNX (Fig. 7D).

[0085] Example 4. AREG is strongly expressed in AT2X cells from patients with pulmonary fibrosis As shown in Example 3, a positive correlation between AREG expression levels and the progression of pulmonary fibrosis was observed in Cdc42-null AT2 mice. AREG expression levels were analyzed in the lungs of two donors and three IPF patients. Surprisingly, AREG was detected in AT2 cells (HTII-280-expressing cells) of all IPF specimens, but not in AT2 cells of donor lungs (Figure 8A). AREG expression was measured in the lungs of IPF patients and patients with autoimmune-induced pulmonary fibrosis using an AREG Elisa kit. AREG expression levels were found to be significantly elevated in the lungs of IPF patients and patients with autoimmune-induced pulmonary fibrosis (Figure 8B).

[0086] Taken together, these results demonstrated that the expression level of AREG was significantly upregulated in AT2 cells from both a mouse model of progressive fibrosis and a patient with pulmonary fibrosis.

[0087] Example 5. Overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis Generation of teto-Areg mice A tetracycline response element was inserted in front of the CMV promoter-driven Areg gene, allowing for inducible Areg expression upon treatment of mice with doxycycline (Dox). The sequence of the tetracycline response element is as follows: 5'TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGT GATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGA3'(SEQ ID NO:5).

[0088] A minimal CMV promoter was inserted in front of the Areg cDNA to overexpress Areg, and the sequence of the CMV promoter is as follows: 5'GGTAGGCGTGTACGGTGGGAGG CCTATATAAGCAGAGCT3' (SEQ ID NO: 6).

[0089] The sequence of Areg cDNA is as follows: 5'' (SEQ ID NO: 7).

[0090] The tetracycline response element, CMV promoter and Areg cDNA were enzymatically ligated and inserted into the mouse genome. The sequence of teto-Areg is as follows:

[0091] In Spc-rtTA / teto-Areg mice, Areg expression was specifically induced in AT2 cells after doxycycline treatment.

[0092] The primer sequences for sequencing the teto-Areg sequence are as follows: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

[0093] To evaluate the function of increased AREG expression in AT2 cells, we generated Areg AT2-overexpressing transgenic mice, which enable the specific overexpression of Areg in AT2 cells. First, we generated transgenic mice in which Areg is expressed under the control of the tetracycline-responsive promoter element (tetO). To obtain offspring carrying Spc-rtTA / teto-Areg, we crossed mice carrying the Spc-rtTA allele with mice carrying the teto-Areg allele. Exposure of Spc-rtTA / teto-Areg mice to doxycycline (Dox), a tetracycline analog, specifically induced Areg expression in AT2 cells. These Spc-rtTA / teto-Areg mice overexpressed Areg. AT2OE It was named mouse (Fig. 10A).

[0094] Areg AT2OE Mice were treated with Dox in water for 21 days (Fig. 10B). AT2OE Lungs from mice were harvested for analysis. qPCR analysis showed that Areg expression was significantly elevated after Dox treatment. AT2OE The expression of Areg mRNA was significantly induced in mouse AT2 cells (Fig. 10C). H&E staining revealed that Dox-treated Areg AT2OEObvious fibrotic changes were observed in the lungs of the mice (Fig. 10D). Many cells in the fibrotic areas expressed high levels of α-SMA (Fig. 10E).

[0095] These results demonstrate for the first time that ectopic expression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0096] Example 6. Generation of Areg null AT2 mice Areg flox / flox Generation of mice: Based on previous studies, Areg flox / flox The mice were generated 33 Briefly, Areg exon 3 was anchored by loxp. loxp1 (GACACGGATCCA TAACTTCGTATAATGTATGCTATACGAAGTTATCGAGTC (SEQ ID NO: 3)) was inserted at position 3704 of Areg DNA, and loxp2 (CCGCGGA TAACTTCGTATAATGTATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO: 4)) was inserted at position 4208 of Areg DNA. After tamoxifen-induced Cre-loxP recombination, Areg exon 3 was deleted, resulting in the inhibition of AREG function.

[0097] Fragments of the Areg DNA sequence before and after deletion of exon 3 of the Areg gene are shown in FIG.

[0098] Example 7. Deletion of the Areg gene in Cdc42-null AT2 cells significantly attenuates the development of pulmonary fibrosis Considering the fibrotic effects of AREG in AT2 cells, we evaluated whether reducing AREG expression in Cdc42-null AT2 cells would attenuate the progression of fibrosis in Cdc42-null AT2 lungs. We generated Areg flox mice with two loxp sites on either side of exon 3 of the Areg gene. We analyzed mice with systemic Areg gene deletion. - / -The mice were viable and fertile, demonstrating that the Areg gene is not essential for mouse survival and development. After several generations of breeding, we obtained Areg&Cdc42 double-null AT2 mice, in which both the Areg and Cdc42 genes were deleted in AT2 cells.

[0099] We then investigated the effects of Areg gene deletion in Cdc42-null AT2 cells. Fourteen days before PNX, control, Cdc42-null AT2, and Areg & Cdc42 double-null AT2 mice were exposed to four doses of tamoxifen (Figure 12A). Lungs of these mice were analyzed at different time points after PNX. On day 21 after PNX, qPCR analysis showed that Areg expression levels were not elevated in Areg & Cdc42 double-null AT2 cells on day 21 after PNX, demonstrating the deletion of the Areg gene in the AT2 cells (Figure 12B).

[0100] AREG binds to EGFR, which can activate the phosphorylation of EGFR. Immunostaining experiments using antibodies against GFP (labeling AT2 cells), p-EGFR, and α-SMA revealed that α-SMA was phosphorylated. + We examined p-EGFR expression in fibroblasts. In Cdc42-null AT2 lungs, we observed strong p-EGFR expression in α-SMA-positive fibroblasts (Figure 12C). In Areg & Cdc42 double-null AT2 lungs, not only were there significantly fewer α-SMA-positive fibroblasts, but the expression level of p-EGFR was also reduced (Figure 12C). This demonstrated that the strength of EGFR signaling in α-SMA-positive fibroblasts depends on AREG expression in AT2 cells. Furthermore, on day 21 after PNX, Areg & Cdc42 double-null AT2 lungs showed minimal fibrosis, whereas Cdc42-null AT2 lungs showed significant pulmonary fibrosis (Figure 12D). Survival curves also demonstrated that Areg & Cdc42 double-null AT2 mice had a significantly longer lifespan than Cdc42-null AT2 mice (Figure 12E).

[0101] Collectively, these results demonstrated that reducing AREG expression levels in AT2 cells significantly attenuated the progression of pulmonary fibrosis in Cdc42-null AT2 mice, and also demonstrated that AREG and its receptor EGFR are therapeutic targets for treating fibrosis.

[0102] Example 8. Sequence characterization of Areg null AT2 mice Spc-CreER, Areg flox / - Genome purification and PCR amplification were performed on mice, and then the floxed and deleted bands of purified Areg were purified and sequenced using the following primers: AAACAAAAACAAGCTGAAATGTGG(SEQ ID NO:14), AAGGCCTTTAAGAACAAGTTGT(SEQ ID NO:15).

[0103] Example 9. Targeting AREG and its receptor EGFR to treat IPF and other fibrotic diseases Considering the fact that EGFR in α-SMA-positive fibroblasts is activated by AREG (Figure 12C), we investigated the effect of inhibiting the activity of the AREG receptor EGFR on the progression of pulmonary fibrosis. PNX-treated Cdc42-null AT2 mice were treated with PBS alone or the EGFR inhibitor gefitinib from day 6 to day 30 after PNX (Figure 13A). Gefitinib treatment was also found to significantly inhibit the development of fibrosis in the lungs of Cdc42-null AT2 mice (Figure 13B).

[0104] Taken together, these results demonstrate that inhibiting AREG and its receptor EGFR is an ideal therapeutic method for treating IPF and other fibrotic diseases.

[0105] References: 1. Wynn, TA. Cellular and molecular mechanisms of fibrosis, The Journal of pathology 214, 199-210, doi:10.1002 / path.2277 (2008). 2 Wynn, TA & Ramalingam, TR Mechanisms of fibrosis: therapeutic translation for fibrotic disease, Nature medicine 18, 1028-1040, doi:10.1038 / nm.2807 (2012). 3 Mehal, WZ, Iredale, J. & Friedman, SL. Scraping fibrosis: expressway to the core of fibrosis. Nature medicine 17, 552-553, doi:10.1038 / nm0511-552 (2011). 4 Barkauskas, CE & Noble, PW. Cellular mechanisms of tissue fibrosis. 7. New insights into the cellular mechanisms of pulmonary fibrosis. American journal of physiology. Cell physiology 306, C987-996, doi:10.1152 / ajpcell.00321.2013 (2014). 5 Rock, JR et al., Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition, Proceedings of the National Academy of Sciences of the United States of America 108, E1475-1483, doi:10.1073 / pnas.1117988108 (2011). 6 Gross, TJ & Hunninghake, GW Idiopathic pulmonary fibrosis, New England Journal of Medicine 345, 517-525 (2001). 7 Vyalov, S.L., Gabbiani, G. & Kapanci, Y. Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis, The American journal of pathology 143, 1754 (1993). 8 King Jr, TE, Pardo, A. & Selman, M. Idiopathic pulmonary fibrosis, The Lancet 378, 1949-1961 (2011). 9 Plantier, L. et al., Ectopic respiratory epithelial cell differentiation in bronchiolized distal airspaces in idiopathic pulmonary fibrosis, Thorax 66, 651-657, doi:10.1136 / thx.2010.151555 (2011). 10 Steele, MP & Schwartz, DA. Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276, doi:10.1146 / annurev-med-042711-142004 (2013). 11 Camelo, A., Dunmore, R., Sleeman, M.A. & Clarke, D.L. The epithelium in idiopathic pulmonary fibrosis: breaking the barrier, Frontiers in pharmacology 4, 173, doi:10.3389 / fphar.2013.00173 (2014). 12 Barkauskas, CE et al., Type 2 alveolar cells are stem cells in the adult lung, The Journal of clinical investigation 123, 3025-3036, doi:10.1172 / JCI68782 (2013). 13 Desai, TJ, Brownfield, DG & Krasnow, MA. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature 507, 190-194, doi:10.1038 / nature12930 (2014). 14 Haies, D.M., Gil, J. & Weibel, E.R. Morphometric study of rat lung cells: I. Numerical and dimensional characteristics of parenchymal cell population. American Review of Respiratory Disease 123, 533-541 (1981). 15 Selman, M. & Pardo, A. Idiopathic pulmonary fibrosis: an epithelial / fibroblastic cross-talk disorder. Respiratory research 3, 3 (2001). 16 Kropski, JA, Blackwell, TS & Loyd, JE. The genetic basis of idiopathic pulmonary fibrosis. European Respiratory Journal 45, 1717-1727 (2015). 17 Goodwin, A.T. & Jenkins, G. Molecular endotyping of pulmonary fibrosis. Chest 149, 228-237 (2016). 18 Xu, Y. et al., Single-cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis, JCI insight 1 (2016). 19 Sternlicht, MD & Sunnarborg, SW. The ADAM17-amphiregulin-EGFR axis in mammary development and cancer. Journal of mammary gland biology and neoplasia 13, 181-194 (2008). 20 Berasain, C. & Avila, M.A. Seminars in cell & developmental biology, 31-41 (Elsevier). 21 Sternlicht, MD et al., Mammary ductal morphogenesis requires paracrine activation of stromal EGFR via ADAM17-dependent shedding of epithelial amphiregulin, Development 132, 3923-3933 (2005). 22 Macias, H. & Hinck, L. Mammary gland development, Wiley Interdisciplinary Reviews: Developmental Biology 1, 533-557 (2012). 23 (citation invalid). 24 Busser, B., Sancey, L., Brambilla, E., Coll, J.-L. & Hurbin, A. The multiple roles of amphiregulin in human cancer. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1816, 119-131 (2011). 25 Chen, Z. et al., Aberrantly activated AREG-EGFR signaling is required for the growth and survival of CRTC1-MAML2 fusion-positive mucoepidermoid carcinoma cells, Oncogene 33, 3869 (2014). 26 Busser, B. et al., Amphiregulin promotes resistance to gefitinib in non-small cell lung cancer cells by regulating Ku70 acetylation, Molecular Therapy 18, 536-543 (2010). 27 Wang, X., Masri, S., Phung, S. & Chen, S. The role of amphiregulin in exemestane-resistant breast cancer cells: evidence of an autocrine loop. Cancer research 68, 2259-2265 (2008). 28 Zhou, Y. et al., Amphiregulin, an epidermal growth factor receptor ligand, plays an essential role in the pathogenesis of transforming growth factor-β-induced pulmonary fibrosis, Journal of Biological Chemistry 287, 41991-42000 (2012). 29 Steele, MP & Schwartz, DA. Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276 (2013). 30 Chen, L. et al., Cdc42 deficiency causes Sonic hedgehog-independent holoprosencephaly, Proceedings of the National Academy of Sciences 103, 16520-16525 (2006). 31 Council, NR Guide for the care and use of laboratory animals (National Academies Press, 2010). 32 Foltz, CJ & Ullman-Cullere, M. Guidelines for assessing the health and condition of mice, Resource 28 (1999). 33 Luetteke, NC et al., Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development, Development 126, 2739-2750 (1999). 34 Wang, Y. et al., Pulmonary alveolar type I cell population consists of two distinct subtypes that differ in cell fate, Proceedings of the National Academy of Sciences, 201719474 (2018). 35 Lynch, DA et al., Diagnostic criteria for idiopathic pulmonary fibrosis: a Fleischner Society White Paper, The Lancet Respiratory Medicine 6, 138-153, doi:10.1016 / s2213-2600(17)30433-2 (2018).

Claims

1. A method for producing an Areg AT2-overexpressing transgenic mouse, comprising specifically overexpressing AREG in pulmonary AT2 cells of the mouse.

2. 2. The method of claim 1, comprising specifically inducing Areg expression in AT2 cells after doxycycline treatment.

3. The method of claim 1, wherein the transgenic mouse produced is an Spc-rtTA / teto-Areg mouse.

4. The method of claim 1, wherein the transgenic mouse produced has the characteristic sequence shown in SEQ ID NO:

18.

5. 2. The method of claim 1, comprising identifying a transgenic mouse using a pair of primer sequences having the following sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

Images