Baculovirus Expression System
The method integrates multiple transgenes into baculoviruses efficiently, addressing inefficiencies in existing systems by using replication-deficient baculoviruses and transfer vectors, enabling stable and industrially viable protein production.
Patent Information
- Application Number
- JP2020523301
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-10-25
- Filing Date
- 2018-10-25
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2038-10-25
AI Technical Summary
Existing methods for producing recombinant proteins in baculovirus expression systems are laborious and inefficient, particularly when integrating multiple transgenes, and often result in poor replication and low yields of infectious virus particles.
A method involving replication-deficient baculoviruses with non-functional genes for viral replication, combined with transfer vectors and homologous recombination, allows for the easy integration of multiple transgenes, including protein maturation enzymes and polypeptides of interest, into the baculovirus genome.
Enables the production of stable, recombinant proteins with proper maturation, suitable for industrial scale, by ensuring even distribution of transgenes and maintaining viral replication efficiency.
Smart Images

Figure 0007738389000013 
Figure 0007738389000014 
Figure 0007738389000015
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for producing a recombinant baculovirus, wherein the genome of the recombinant baculovirus comprises one or more transgenes each encoding a protein maturation enzyme and at least two transgenes each encoding a polypeptide of interest, a baculovirus or recombinant baculovirus genome obtained by this method, a set of homologous recombination elements, a cell comprising the recombinant baculovirus or recombinant baculovirus genome, and the use of the baculovirus or recombinant baculovirus genome for the production of a polypeptide of interest. [Background technology]
[0002] Baculoviruses are a family of arthropod-specific rod-shaped viruses that comprise four genera (Alphabaculovirus, Betabaculovirus, Deltabaculovirus, and Gammabaculovirus) encompassing 49 species. Baculoviruses are not capable of replication in mammalian or other vertebrate cells.
[0003] The baculovirus genome consists of a circular, double-stranded DNA molecule between 80 and 180 kb in size. The baculovirus genome is associated with a 605 kDa highly basic protein within a nucleocapsid of helical symmetry containing a 39 kDa capsid protein. The size of the genome determines the length of the nucleocapsid. The nucleocapsid is then enclosed in a lipoprotein envelope to form a virus particle, or virion. These structures may be surrounded by a crystalline or polyhedral matrix composed essentially of a single protein (polyhedrin) of approximately 30 kDa. Polyhedra are large structures, varying in size from 1 to 15 μm in diameter, with an outer polysaccharide envelope that provides additional protection.
[0004] Baculoviruses whose genomes have been genetically modified are used in biotechnology for the production of recombinant proteins (i.e., recombinant baculoviruses). After entry into insect cells, these recombinant baculoviruses attempt to use the insect cell machinery to produce the recombinant protein.
[0005] Recombinant baculoviruses are obtained by inserting one or more genes from other species (e.g., humans, other vertebrates, bacteria, and viruses) into the genome of a parent baculovirus. These genes are placed under the control of a viral or cellular promoter (e.g., the promoter of the polyhedrin gene) to create a recombinant baculovirus genome. The promoter allows the foreign gene to be transcribed into messenger RNA, which is then translated into protein in insect cells infected with the recombinant baculovirus. An advantage of using this system is that the level of recombinant protein production in insect cells infected with the recombinant baculovirus can be extremely important. The recombinant protein can then be purified from the infected cells if the protein is intracellular, or alternatively, from the culture medium if the protein is secreted. The baculovirus expression system is widely used in industry and in research laboratories. In addition to the significant productivity of the baculovirus expression system, this system is highly valued for its ability to produce biologically active recombinant proteins. In fact, insect cells generally allow for appropriate post-translational modifications to be obtained.
[0006] However, certain proteins require post-translational modifications that insect cells are not able to perform, and these post-translational modifications are normally carried out by the maturation enzymes of the particular protein.
[0007] For example, most human glycoproteins have so-called complex glycosylation, which is generally sialylated (Figure 12A). Sialylation is an important factor in stabilizing the structure of certain proteins, making them more soluble, heat-resistant, and protease-resistant. The sialylation level of a protein can directly affect its half-life in serum, and desialylated proteins are rapidly captured by receptors for asialoproteins. Antibodies are an exception to this half-life model. In fact, the half-life of antibodies is essentially controlled by their interaction with the Fc receptor (FcR) ("fragment crystallizable":Fc for specific antibody constant regions, referred to as receptor FcRn (Figure 13). However, glycosylation, particularly N-glycosylation present in the CH2 domain of the IgG constant region on Asn297, plays a crucial role in controlling antibody activity (Figure 13). Indeed, this nature of N-glycosylation allows for the modulation of what are called antibody effector activities, e.g., activities that allow the killing of tumor cells targeted by the antibody. In particular, it has been demonstrated that (i) ADCC (antibody-dependent cell-mediated cytotoxicity) is highly significantly increased when α1,6 fucose is excluded from the glycan core, and (ii) CDC (complement-dependent cytotoxicity) is dependent on the presence of galactose. Finally, sialylation of this glycan motif may be important for blocking the pro-inflammatory activity of antibodies, even if the mechanistic effect is still highly controversial.
[0008] Therefore, for example, if it is desired to produce a highly cytotoxic antibody, an antibody capable of inducing high ADCC and CDC activity, for the specific destruction of tumors, it is ideal to produce a galactosylated antibody.On the other hand, if an antibody is simply used as a ligand, for example, a ligand of a cell receptor for inducing apoptosis, or alternatively for imaging by specifically marking tissues, it is desirable to use an antibody that is not capable of inducing cellular cytotoxicity, in which case a sialylated antibody would be the most suitable.
[0009] Numerous studies of the N-glycosylation capacity of insect cells have clearly demonstrated that while glycan addition is specific—that is, always carried out at the same asparagine residue that is naturally glycosylated in the original protein expressed by the tissue (e.g., Asn297 in antibodies)—the glycans are structurally distinct and are short and not complex (Figure 12B). These truncated structures have also been shown to result from the absence or low activity of several enzymes involved in the biosynthesis of complex glycans, such as N-acetylglucosaminyltransferase II (GnT-II), β-1,4 galactosyltransferase (β-1,4GalT), and sialyltransferase, as well as the absence of the sugar-nucleotide, CMP-NeuAc.
[0010] It is therefore important to complete the enzymatic maturation capacity of insect cells in order to obtain the correct mature protein of interest.
[0011] Baculoviruses containing genes encoding protein maturation enzymes have been described.
[0012] Palmberger et al. (2012) describes a recombinant baculovirus containing sequences encoding two glycosylation enzymes in the same locus. This baculovirus is used to produce the HIV antibody 3D6 anti-gp41. Two genes encoding the heavy and light chains of the antibody were inserted into the genome of this baculovirus. These recombinant baculoviruses are produced in bacteria from bacmids (infectious in insect cells). The construction method uses the Cre / Lox system and Tn7 transposition for the repeated integration of different genes (a gene of interest and a protein maturation gene). To produce recombinant baculoviruses, bacteria must be selected with different antibiotics to isolate infectious recombinant bacmids, which are then introduced into insect cells in the form of DNA.
[0013] Chang et al. (2003) discloses a recombinant baculovirus that expresses both a polypeptide of interest (human α1-antitrypsin) and a series of glycosyltransferases at a single locus. Recombination is carried out in insect cells using non-infectious linearized viral DNA. Repair of this DNA, followed by homologous recombination with a transfer vector, allows for the reconstruction of circular and thus infectious viral DNA.
[0014] The method for constructing these baculoviruses is based on a process of recursive integration of the gene of interest and the protein maturation gene utilized in conventional integration systems. (i) in bacteria, such as Tn7 transposition or cre / lox systems (Palmberger et al. 2012); (ii) or in a conventional homologous recombination step in insect cells between linearized viral DNA and a transfer vector (Chang et al. 2003).
[0015] In both cases, for each integrated transgene, a selection step is required: (i) in bacteria, selection is required based on the presence of antibiotic resistance genes flanking the transgene, or (ii) in insect cells, each recombination step requires the presence of a new, unique site in the viral DNA for specific cleavage by a restriction enzyme that can again linearize the viral DNA and allow de novo integration to occur. Repair of this DNA followed by homologous recombination with a transfer vector makes it possible to reconstitute circular and thus infectious viral DNA.
[0016] Therefore, there remains a need to develop a method that is easy to implement, allows to produce recombinant proteins of interest in a baculovirus expression system, in particular proteins comprising several distinct subunits such as antibodies, and is capable of inducing proper maturation of the protein of interest, in particular one that can be developed on an industrial scale.
[0017] To produce a particular recombinant protein of interest that is composed of several peptide subunits, it is particularly necessary to have a baculovirus expression system into which several transgenes, each encoding a subunit, can be easily integrated, preferably in a single step.
[0018] However, to be able to integrate several transgenes in baculovirus, previously known methods required: - several successive steps are carried out, each step capable of integrating one or two transgenes ("head to tail"); therefore, integrating more than two transgenes into the baculovirus genome in a single step is technically possible, but extremely laborious; - or the integration of multiple transgenes into a single locus. However, homologous recombination for the integration of large DNA fragments (expression cassettes) consisting of several transgenes is often complicated or even impossible without inducing renaturation of the viral genome. Therefore, it is preferable to spread the integration sites of several transgenes evenly throughout the genome of the baculovirus.
[0019] In order to eliminate the selection step for recombinant baculoviruses that have successfully integrated a transgene of interest, a method based on the joint use of: - baculoviruses in which the genes necessary for viral replication are non-functional, and - a transfer vector comprising a nucleotide sequence making it possible to restore the function of a gene essential for replication and a transgene encoding a polypeptide of interest.
[0020] This method is described inter alia in patent application WO01 / 12829 and in the article by Possee et al., 2008.
[0021] However, this method only allows the integration of one or two transgenes of interest into a single locus (head to tail). To integrate a third or fourth transgene into another locus linked to another gene required for replication that must be non-functional, the procedure must be repeated several times.
[0022] Furthermore, integration of a transgene upstream or downstream of a gene essential for replication, as described by Possee, can alter replication and therefore produce viruses that replicate poorly, i.e., have a significantly lower content of infectious virus particles (PFU / ml) in the culture supernatant than wild-type virus. Summary of the Invention
[0023] Based on this finding, the applicant has developed a method for preparing homogeneous, stable recombinant baculoviruses that is particularly efficient and easy to implement, making it possible to envisage its development on an industrial scale for the production of recombinant proteins, for example multimeric proteins comprising several distinct subunits.
[0024] In a first aspect, the present invention provides a method for producing a recombinant baculovirus, wherein the genome of the recombinant baculovirus comprises one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, said method comprising: a) a1) a replication-deficient recombinant baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; and a2) i) a nucleotide sequence that allows restoring the function of one of n non-functional genes essential for viral replication; ii) one of the n transgenes encoding a polypeptide of interest n transfer vectors each containing preparing in an insect cell by homologous recombination between one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, the set of nucleotide sequences i) of the n transfer vectors is capable of restoring replication of a replication-deficient baculovirus genome; n is an integer at least equal to 2; b) generating a recombinant baculovirus in insect cells containing the recombinant baculovirus genome obtained in step a); The present invention relates to a method, including:
[0025] In a second aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) Formula (I): [Transgene encoding a polypeptide of interest]-[spacer nucleotide sequence]-[gene essential for functional viral replication] (I) a sequence of n nucleotides of the spacer of the nucleic acid sequence is composed of 0 to 600 base pairs, preferably 1 to 600 base pairs; The genes essential for functional viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), and DNA Selected from Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), lef-2 (ORF6), n nucleotide sequences, where n is an integer at least equal to 2; b) one or more transgenes, each encoding a protein maturation enzyme; The present invention relates to a recombinant baculovirus or a recombinant baculovirus genome comprising:
[0026] In a third aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; b) i) a sequence of nucleic acid that allows to restore the function of one of n non-functional genes essential for viral replication; ii) a transgene encoding a polypeptide of interest n transfer vectors each containing Including, n is an integer at least equal to 2, Concerning a set of homologous recombination elements.
[0027] In a fourth aspect, the present invention relates to a cell comprising a recombinant baculovirus or a recombinant baculovirus genome according to the invention or a set of homologous recombination elements according to the invention.
[0028] In a fifth aspect, the present invention relates to the use of a recombinant baculovirus or a recombinant baculovirus genome according to the invention or a cell according to the invention for the production of n polypeptides of interest. [Brief explanation of the drawings]
[0029] [Figure 1]Figure 1 illustrates the steps in preparing BacMid1. Captions: ORF: Open reading frame. Polyhedrin or PH: Baculovirus gene encoding polyhedrin: a gene not essential for viral replication. ORF603: Baculovirus gene encoding protein 603, a non-essential gene. ORF1629: Baculovirus gene encoding protein 1629: a gene essential for viral replication. pVT: Plasmid transfer vector. Mini-F: Origin of bacterial replication. KanR: Bacterial expression cassette expressing the kanamycin resistance gene. AmpR: Bacterial expression cassette expressing the ampicillin resistance gene. Recombination fragment: A fragment of DNA containing an expression cassette for integration into target DNA. This fragment has flanking regions on either side of the expression cassette that can specifically target the region to undergo homologous recombination by Red recombinase. [Figure 2] Figure 2 illustrates the steps for the partial deletion of the gene dna pol for the preparation of BacMid2, a gene encoding a viral DNA polymerase. Captions: gp37: The baculovirus gene encoding the glycoprotein gp37, a gene not essential for viral replication. gp37 Δ252 aa: The gene gp37 deleted from the region encoding the 252 N-terminal amino acids. DNAPol: The baculovirus gene encoding the viral DNA polymerase, a gene essential for viral replication. DNAPol Δ466 aa: The dna pol gene deleted from the region encoding the 466 C-terminal amino acids. HygroR: A bacterial expression cassette expressing the hygromycin resistance gene. Recombination fragment: A fragment of DNA containing an expression cassette for integration into target DNA. This fragment has flanking regions on either side of the expression cassette that can specifically target the region undergoing homologous recombination by Red recombinase. [Figure 3]Figure 3 illustrates the steps of partial deletion of the gene encoding gp64 for the preparation of BacMid3. Captions: Chit: baculovirus gene encoding chitinase, a gene not essential for viral replication. Cath: baculovirus gene encoding viral cathepsin, a gene not essential for viral replication. gp64: baculovirus gene encoding viral glycoprotein gp64, a gene essential for viral replication. gp64·Δ188 aa: gene gp64 deleted from the region encoding 188 C-terminal amino acids. ZeoR: bacterial expression cassette expressing the Zeocin resistance gene. Recombination fragment: a fragment of DNA containing an expression cassette for integration into target DNA. This fragment has flanking regions on either side of the expression cassette that can specifically target the region undergoing homologous recombination by Red recombinase. [Figure 4] Figure 4 illustrates the transfer vector pVT / gp37 and its use together with BacMid2 for the generation of a recombinant baculovirus genome containing transgene X. Captions: pVT: plasmid transfer vector. gp37: baculovirus gene encoding glycoprotein gp37, a gene not essential for viral replication. DNAPol: baculovirus gene encoding viral DNA polymerase, a gene essential for viral replication. DNAPol.Δ466 aa: dna pol gene deleted from the region encoding the 466 C-terminal amino acids. Foreign gene: transgene of interest. P: viral or cellular promoter controlling expression of the transgene. HygroR: bacterial expression cassette expressing the hygromycin resistance gene. [Figure 5]Figure 5 illustrates the construction and use of transfer vector PH pVT / PH together with BacMid2 for the generation of recombinant baculovirus genomes containing transgene X. Captions: pVT / PH: polyhedrin transfer vector plasmid. PH: all or part of the baculovirus gene encoding polyhedrin, a gene non-essential for viral replication. ORF603: baculovirus gene encoding protein 603, a non-essential gene. ORF1629: baculovirus gene encoding protein 1629, a gene essential for viral replication. Foreign gene: transgene of interest. P: viral or cellular promoter controlling expression of the transgene. KanR: bacterial expression cassette expressing the kanamycin resistance gene. Mini-F: origin of bacterial replication. [Figure 6] Figure 6 illustrates the construction and use of the transfer vector pVT / gp37Cγ together with BacMid2 for the generation of a recombinant baculovirus genome containing an antibody heavy chain. Captions: pVT: Plasmid transfer vector. pVT / gp37-Cγ1: Plasmid transfer vector specific for the immunoglobulin heavy chain. Cγ1: DNAc encoding the human immunoglobulin constant domain γ1. VH: DNAc encoding the variable domain of the immunoglobulin heavy chain. DNAPol: Baculovirus gene encoding the viral DNA polymerase, a gene essential for viral replication. DNAPolΔ466 aa: DNAPol gene deleted from the region encoding the 466 C-terminal amino acids. P: Viral or cellular promoter controlling transgene expression. HygroR: Bacterial expression cassette expressing the hygromycin resistance gene. PS: DNAc encoding a signal sequence (heavy chain secretion). [Figure 7]Figure 7 illustrates the construction and use of the transfer vector pVT / PH Cκ together with BacMid2 for the generation of a recombinant baculovirus genome containing an antibody light chain. Captions: ORF603: baculovirus gene encoding protein 603. ORF1629: baculovirus gene encoding protein 1629: a gene essential for viral replication. Mini-F: origin of bacterial replication. pVT: plasmid transfer vector. pVT / PH-Cκ: plasmid transfer vector specific for the immunoglobulin light chain. Cκ: DNAc encoding the human immunoglobulin kappa constant domain. VL: DNAc encoding the variable domain of the immunoglobulin light chain. P: viral or cellular promoter controlling transgene expression. KanR: bacterial expression cassette expressing the kanamycin resistance gene. PS: DNAc encoding a signal sequence (light chain secretion). [Figure 8] Figure 8 illustrates the construction and use of the vector pVT / Chit-Cath together with BacMid3 to generate a recombinant baculovirus genome containing a transgene. Caption: pVT Chit / Cath: A plasmid transfer vector capable of recombining at a locus containing two nonessential genes, ChiA encoding a chitinase and Cath encoding a cathepsin. gp64Δ188 aa: The gp64 gene deleted from the region encoding the 188 C-terminal amino acids, an essential gene. Foreign gene: The transgene of interest. P: A viral or cellular promoter controlling expression of the transgene. ZeoR: A bacterial expression cassette expressing the Zeocin resistance gene. [Figure 9]Figure 9: A) Southern blot analysis of the genomes of three purified, independent recombinant baculoviruses generated during the same transfection. B) Analysis of the recombinant antibody after purification on Protein A Sepharose (GE Healthcare). Captions: A: Analysis of the genome organization of three independent recombinant baculoviruses expressing antibody 13B8II. These baculoviruses were isolated from a single transfection experiment. Hybridization performed with probes specific for the constant region of the kappa light chain (probe Cκ) and the constant region of the heavy chain gamma 1 (probe Cκ1), respectively, demonstrates the exact same organization of the three recombinant viruses. B. Analysis of the purified recombinant antibody by electrophoresis on a polyacrylamide gel (SDS, 2-mercaptoethanol) and silver staining. Antibody secreted into the culture medium of cells infected with the recombinant baculovirus was purified on a Protein A Sepharose column. PC1: Plasmid control, a plasmid containing the gene for the kappa light chain. PC2: Plasmid control, heavy chain γ1, R1-3, plasmids containing genes of recombinant baculovirus 1, 2 and 3. MW: size marker. [Figure 10] Figure 10 is a Southern blot analysis of the genome of a triple recombinant virus expressing flu virus proteins M, HA and NA. Captions: M: flu virus gene encoding matrix protein. HA: flu virus gene encoding hemagglutinin. NA: flu virus gene encoding neuraminidase. bp: size of the DNA fragment in base pairs. [Figure 11]Figure 11 illustrates, in A, the structure of a bispecific antibody and, in B, electrophoretic analysis in a polyacrylamide gel of a bispecific antibody purified on a Protein A Sepharose column. Captions: A: Diagrammatic representation of the structure of a bispecific antibody. L1: light chain of antibody 1, L2, light chain of antibody 2. B: Purified bispecific antibody analyzed by electrophoresis in a polyacrylamide gel. Proteins were revealed by silver staining. (1) Electrophoresis under reducing conditions (SDS, 2-mercaptoethanol). (2) Electrophoresis under non-reducing conditions. H: antibody heavy chain, L: antibody light chain, H2L4: Composition of the bispecific antibody: two fused heavy chains linked by four disulfide bridges at the level of two hinge regions + four light chains (L1 of two chains + L2 of two chains) paired in a specific manner to the corresponding regions VH1-CH1 and VH2-CH1. [Figure 12] FIG. 12 is a representation of glycan structures attached to glycoproteins synthesized by (A) human cells and (B) lepidopteran cells. [Figure 13] Figure 13 is a representation of a human immunoglobulin (IgG). The asparagine residue 297 (Asn297) attached to the N-glycan is represented by a diamond. The nature of this N-glycosylation, such as the presence of galactose and sialic acid, can be an important element of antibody structure, as it allows for modulation of specific effector activities, such as ADCC and CDC. [Figure 14]Figure 14 is a representation of the various steps required for the construction of BacMid2 / MPT (MPT: post-translational modification), i.e., BacMid2, whose genome contains transgenes encoding glycan biosynthetic enzymes, or more generally, BacMid2, whose genome contains one or more transgenes, each encoding a protein maturation enzyme. Figure 14 specifically illustrates the integration of a transgene encoding GNT-II into the intergenic region orf35(v-ubi)-orf36(39k) (IG35 / 36) of BacMid2. Two expression cassettes were inserted consecutively into the region IG35 / 36, previously cloned into the pUC plasmid: (i) a viral expression cassette consisting of an early viral promoter (see Table 2) and a gene encoding GNT-II, and (ii) a bacterial expression cassette controlling the Zeocin resistance gene (ZeoR). A "recombinant fragment" containing the two cassettes was generated by digestion of the above plasmid with two restriction endonucleases. The latter was introduced into bacteria EL350 / BacMid2 by electroporation. Homologous recombination occurred between the flanking regions of the recombinant fragment and the DNA of BacMid2, allowing the integration of the two expression cassettes. The resulting recombinant bacteria were selected with Zeocin, and the gene encoding resistance to this antibiotic was then eliminated from the bacmid DNA by a simple digestion / repair / religation procedure. The resulting bacmid, designated BacMid2-GNTII, was reintroduced into bacteria EL350 (EL350 / BacMid2-GNT-II) by electroporation. [Figure 15]Figure 15 shows BacMid2-fur and BacMid2Gal-Fur. A and B: Control of genome organization of BacMid BacFur and BacGal-Fur. A. The DNA of the two bacmids was digested with EcoRI, and the resulting fragments were separated on a 1% agarose gel and then stained with ethidium bromide. B. The DNA was transferred to a nylon membrane according to the Southern technique. The membrane was incubated with a probe specific for the gene fur expressed by Sf9 cells. Captions: A: Agarose gel stained with ethidium bromide; well 1: restriction profile of BacMid2Gal-Fur with EcoRI; well 2: restriction profile of BacMid2-Fur with EcoRI. B: Southern blot; well 1: restriction profile of BacMid2Gal-Fur with EcoRI; well 2: restriction profile of BacMid2-Fur with EcoRI. C and D: Two recombinant viruses co-expressing the HIV-1 Pr55Gag and gp160 polyproteins were constructed, one from BacMid2 and the other from BacMid2-Fur. Sf9 cells were infected with the various viruses for 48 hours, and the proteins secreted into the culture supernatant were either concentrated or not using Retro Concentin™ Virus Precipitation (SBI, Reference RV100A-1) solution. They were then precipitated on a 10% polyacrylamide gel under denaturing and reducing conditions and analyzed by Western blot. C. Proteins were revealed using an anti-gp120 antibody (Reference Ab21179, Abcam). D. Proteins were revealed using an anti-Pr55Gag antibody (Reference 63917, Abcam).Captions: BACWT: wild type baculovirus, BACgp160 / Gag / Fur: triple recombinant baculovirus expressing HIV-1 gp160 and polyprotein Pr55Gag and furin from Sf9 cells, BACgp160 / Gag: double recombinant baculovirus expressing HIV-1 gp160 and polyprotein Pr55Gag, BACgp120: single recombinant baculovirus expressing HIV-1 gp120, BACGag: single recombinant baculovirus expressing HIV-1 polyprotein Pr55Gag. [Figure 16]Figure 16 shows the principle of using BacMid2-Gal (BacGal) to generate double or single recombinant baculovirus genomes. A. Generation of Double Recombinant Baculovirus Genomes. Two transgenes of interest are cloned into their respective transfer vectors: pVT / PH, targeting the GNE / GE PH / 1629 pair, and pVT / gp37, targeting the GNE / GE gp37 / DNAPol pair. Sf9 cells are transfected with the two pVT and BacMid2-Gal DNAs. Upon homologous recombination, the two transgenes of interest are integrated into the BacMid2-Gal genome, while the nonfunctional genes 1629 and dnapol from BacMid2-Gal are simultaneously replaced by functional copies. These events result in the elimination of the bacterial origin of replication and the generation of an infectious recombinant baculovirus genome. Recombinant baculovirus is then produced, secreted into the culture medium, and then cloned by phage plaque assay. B. Generation of a Single Recombinant Baculovirus Genome. A gene of interest is cloned into the transfer vector pVT / gp37. Sf9 cells are transfected with DNA from pVT / gp37 containing the transgene, pVT / PH without the transgene, and BacMid2-Gal. Upon homologous recombination, there is repair of the bacmid at the two loci, thus generating infectious baculovirus.Captions: GE: essential gene GNE: nonessential gene pVT / PH: transfer vector targeting the pair GNE / GE PH / 1629 pVT / gp37: transfer vector targeting the pair GNE / GE gp37 / DNAPol DNA PolNF: gene encoding a non-functional viral DNA polymerase DNA PolF: gene encoding a functional viral DNA polymerase 1629NF: gene encoding non-functional protein 1629 1629F: gene encoding functional protein 1629 β1,4GalT: β1,4 galactosyltransferase GNT-II: N-acetylglucosaminyltransferase II KanR: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene. [Figure 17]Figure 17 shows the principle of preparing a double recombinant baculovirus genome expressing a galactosylated antibody. Sf9 cells are transfected with pVT / H (see Figure 6), pVT / L (see Figure 7), and BacMid2-Gal DNA. Upon homologous recombination, the transgenes encoding the heavy and light chains are integrated into the genome of BacMid2-Gal, while the nonfunctional genes 1629 and dnapol from BacMid2-Gal are replaced by functional copies, rendering the baculovirus genome infectious. Recombinant baculoviruses are then produced, secreted into the culture medium, and subsequently cloned by phage plaque assay. Captions: GE: essential gene GNE: nonessential gene pVT / PH: transfer vector targeting the pair GNE / GE PH / 1629 pVT / gp37: transfer vector targeting the pair GNE / GE gp37 / DNAPol DNA PolNF: gene encoding a non-functional viral DNA polymerase DNA PolF: gene encoding a functional viral DNA polymerase 1629NF: gene encoding non-functional protein 1629 1629F: gene encoding functional protein 1629 β1,4 GalT: β1,4 galactosyltransferase GNT-II: N-acetylglucosaminyltransferase II KanR: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene [Figure 18]Figure 18 shows Western blot and lectin blot analyses of antibodies produced by Sf9 cells infected with recombinant baculoviruses generated from BacMid2 or BacMid2-Gal. These human antibodies (recombinant antibody 13B8II has a constant human domain) and mouse antibodies lacking glycosylation in their paratopes; therefore, the analysis reveals the nature of the N-glycosylation originating from their constant domains. Captions: A and B. Western blots. A: The membrane was incubated with sheep anti-human IgG whole antibody peroxidase-conjugated (reference NA933V, GE Healthcare). B: The membrane was incubated with sheep anti-mouse IgG whole antibody peroxidase-conjugated (reference NA931V, GE Healthcare). A. Well 1: Fetuin (61-68 kDa) provided in the "Dig Glycan Differentiation" kit from Roche. This α2,3 and α2,6 sialylated protein constitutes a positive control for analysis using lectin blots, whether for SNA, MAA, or diCBMA. According to the supplier, the molar mass (*) of this protein varies between 68 and 61 kDa. Well 2: recombinant antibody 13B8II / BacGal; Well 3: recombinant antibody 13B8II / BacMan. B. Well 1: recombinant mouse antibody / BacGal; Well 2: recombinant mouse antibody / BacMan. C. Lectin blot. The membrane was incubated in the presence of biotin-conjugated RCA120. The presence of lectin was revealed as described in Example 17. Well 1: fetuin (61-68 kDa), well 2: recombinant mouse antibody / BacMan, well 3: recombinant mouse antibody / BacGal, well 4: recombinant antibody 13B8II / BacMan, well 5: recombinant antibody 13B8II / BacGal. [Figure 19]Figure 19 is a diagram describing the use of BacMid2-Sia for the preparation of multiple recombinant baculovirus genomes and the construction of the second generation of a novel BacMidSia, BacMidSia6-II. In Figure 19A, transgenes 1 and 2 are cloned into pVT / PH, targeting the GNE / GE PH / 1629 pair, and pVT / gp37, targeting the GNE / GE gp37 / DNAPol pair, respectively. The BacMid-Sia genome contains all genes required for α2,3 sialylation [α2,3 sialyltransferase] (BacMid2-Sia3 or BacSia3), α2,6 sialylation [α2,6 sialyltransferase] (BacMid2-Sia6 or BacSia6 and BacMid2Sia6-II or BacSia6-II), or α2,3 + α2,6 sialylation [α2,3 sialyltransferase + α2,6 sialyltransferase] (BacMid2-Sia3 / 6 or BacSia3 / 6), as well as two genes required for the biosynthesis of the sugar nucleotide CMP-NeuAC. Sf9 cells were transfected with the DNA of one of the two pVT and BacMid-Sia vectors. Upon homologous recombination, the two transgenes are integrated into the genome of BacMid2-Sia, and simultaneously, the non-functional genes 1629 and dnapol from BacMid2-Sia are replaced by functional copies, which render the baculovirus genome infectious. The recombinant baculovirus is then produced, secreted into the culture medium, and then cloned by phage plaque assay.Captions: GE: essential gene GNE: nonessential gene pVT / PH: transfer vector targeting the pair GNE / GE PH / 1629 pVT / gp37: transfer vector targeting the pair GNE / GE gp37 / DNAPol DNA PolNF: gene encoding a nonfunctional viral DNA polymerase DNA PolF: gene encoding a functional viral DNA polymerase 1629NF: gene encoding nonfunctional protein 1629 1629F: gene encoding functional protein 1629 β1,4 GalT: β1,4 galactosyltransferase GNT-II: N-acetylglucosaminyltransferase II α2,3 ST: α2,3 sialyltransferase α2,6 ST: α2,6 sialyltransferase KanR: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene Figure 19B shows a Southern blot analysis of the genomes of two clones of BacMid2Sia6-II, the construction of which is described in Example 14. Captions: a: Analysis of the electrophoretic profiles of the digestion with EcoRI of two clones of BacMid2Sia6-II (1 and 2) in comparison with BacMid2-GNTII-β1, 4GT-CMPNeuAcS-NeuAcS(T) shows that the integration of the cassette ST6GalI in the Pif1 region results in two fragments EcoRI of 3122 bp and 6138 bp. b: Hybridization carried out with a probe specific for ST6GalI makes it possible to confirm the marking of the two fragments EcoRI of 3122 bp and 6138 bp and of the control plasmid (PC), a plasmid containing the ST6GalI gene, demonstrating the correct and identical organization of the two bacmids obtained. MW: Smart Ladder (Eurogentec). [Figure 20]Figure 20 shows the analysis by Western blot and lectin blot of the glycosylation of the viral protein gp64 expressed by different viruses generated from different bacmids. The glycoprotein gp64 is the major glycoprotein of baculoviruses and is located on the surface of the baculovirus. This glycoprotein has been shown to be capable of being galactosylated and sialylated. Cells were infected with different recombinant viruses. Baculoviruses secreted into the culture supernatant were precipitated and then taken up in lysis buffer to be analyzed by Western blot and then by lectin blot. A. Western blot. The membrane was incubated with the antibody anti-gp64 AcV5 (reference SC65499, Santa Cruz Biotechnology). B and C: Lectin blot. B. Membranes were incubated in the presence of SNA, a lectin that specifically recognizes α2,6-linked sialic acid. (C) Di-CBM40, a lectin that recognizes α2,3-linked sialic acid, and to a lesser extent α2,6-linked sialic acid. Captions: Fet: Fetuin. Mq: Molecular weight marker. ST3: Virus produced from bacmid BacSia3. ST6: Virus produced from bacmid BacSia6. ST3 / 6: Virus produced from bacmid BacSia3 / 6. Man: Virus produced from bacmid BacSia2. [Figure 21]Figure 21 shows Western blot and lectin blot analyses of recombinant protein X produced thanks to a recombinant baculovirus generated from BacSia6. The protein was soluble, and the following analyses were performed on the purified protein. After electrophoresis in a polyacrylamide gel and subsequent transfer to a membrane, the protein was incubated in the presence of either a specific antibody for Western blot analysis (A) or specific lectins, SNA (B) or MAA (C), for lectin blot analysis. Captions: Well 1, protein X produced after infection of Sf9 cells with a recombinant baculovirus generated from BacMid2. Well 2, protein X produced after infection of Sf9 cells with a recombinant baculovirus generated from BacSia6. Well 3, commercially available protein X produced in CHO cells. The presence of lectin was revealed as described in Example 17. MW: molecular weight marker (prestained marker, Biolabs reference P7706). [Figure 22]Figure 22 shows the analysis by Western blot and lectin blot of the protein VSVg produced thanks to a recombinant baculovirus generated from BacSia6. The protein VSVg is membranous and the analysis was carried out on the pellet of infected Sf9 cells. A and B: Analysis of the protein VSVg. A. Western blot, electrophoresis in a polyacrylamide gel followed by transfer to a membrane, after which the protein was incubated in the presence of a specific antibody directed against VSVg (mouse antibody peroxidase conjugated, reference A5977 Sigma). Caption: Well 1, fetuin; wells 2 and 3, Sf9 cells infected with a recombinant baculovirus expressing the protein VSVg generated from BacSia6 (well 2) or Bacmid2 (well 3). B. Lectin blot. The proteins transferred to the nitrocellulose membrane were placed in the presence of the lectin SNA (Sambucus nigra agglutinin), which is specific for α2,6-linked sialic acid residues. The presence of the lectin was revealed as described in Example 17. C and D. Analysis of the viral protein gp64. We also confirmed that recombinant baculoviruses expressing sialylated VSVg also possess sialylated gp64. To do so, baculoviruses secreted into the culture supernatant were precipitated and then taken up in lysis buffer to be analyzed by Western blot and then by lectin blot. C. Western blot. gp64 was revealed using a specific antibody (antibody anti-gp64 AcV5, reference SC65499, Santa Cruz Biotechnology). D. Lectin blot. In the presence of the lectin SNA, as described in Example 17. Caption: Well 1, fetuin; wells 2 and 3, baculovirus particles prepared from the culture supernatant of cells infected with recombinant baculovirus made from BacMid2-Sia6 (well 2) or Bacmid2 (well 3), expressing the protein VSVg. DETAILED DESCRIPTION OF THE INVENTION
[0030] definition Within the context of the present invention, the expression "baculovirus" is taken to refer to a rod-shaped virus specific to arthropods. Baculoviruses generally contain a nucleocapsid that encloses the baculovirus genome. Examples of baculoviruses include BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV, and TeNPV.
[0031] Within the context of the present invention, the expression "baculovirus genome" is taken to refer in particular to the entire genetic material of a baculovirus, including all of the baculovirus coding and non-coding nucleotide sequences.
[0032] Within the context of the present invention, the expression "replication-deficient baculovirus genome" refers to a baculovirus genome in which at least two genes essential for viral replication have been deleted (in whole or in part) or mutated in such a way that the baculovirus genome has lost its ability to replicate in insect cells. For example, a gene essential for viral replication no longer expresses itself or is transcribed and then translated into a non-functional protein. Thus, a deleted (in whole or in part) or mutated gene is referred to as a "non-functional gene essential for viral replication." A viral replication-deficient baculovirus genome is prepared from a parent baculovirus genome using molecular biology techniques well known to those skilled in the art, which allow, among other things, the insertion and / or deletion of nucleotide sequences in the parent baculovirus genome. Preferably, the replication-deficient baculovirus genome contains at least one nucleotide sequence that allows replication in bacterial cells. A nucleotide sequence that allows replication in bacterial cells is not a transgene of interest within the meaning of the present invention. An example of a bacterial replication element is the nucleotide sequence "Mini-F." Such replication elements are well known in the prior art. The bacterial cell is Escherichia coli. A baculovirus genome containing a nucleotide sequence that allows it to replicate in a bacterial cell is known by the name "bacmid". Preferably, the replication-deficient baculovirus genome also contains one or more nucleotide sequences encoding one or more selection markers that allow for the selection or identification of bacterial cells transfected with the replication-deficient baculovirus genome. The selection nucleotide sequence is not a transgene of interest in the sense of the present invention. It may be, for example, an ampicillin resistance gene, a kanamycin resistance gene, a hygromycin resistance gene, a zeocin resistance gene and / or a tetracycline resistance gene.
[0033] Within the context of the present invention, the expression "recombinant baculovirus genome" is taken to refer to a baculovirus genome comprising one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest. The term "recombinant baculovirus genome" according to the present invention corresponds to a baculovirus genome obtained by carrying out the method according to the present invention, i.e. a baculovirus genome obtained by homologous recombination between a replication-defective baculovirus genome and n transfer vectors.
[0034] Within the context of the present invention, the expression "recombinant baculovirus" is taken to refer to a baculovirus whose genome is a recombinant baculovirus genome, i.e., whose genome comprises one or more transgenes, each encoding a protein maturation enzyme, and n transgenes, each encoding a polypeptide of interest. Recombinant baculoviruses can be produced after replication of the recombinant baculovirus genome in insect cells. Recombinant baculoviruses are capable of infecting insect cells. Preferably, the recombinant baculovirus according to the present invention is infectious to insect cells.
[0035] A "gene" is taken to refer to a nucleotide sequence that is capable of being transcribed and then translated into a polypeptide, e.g., a protein. Reference is then made to a gene that encodes a polypeptide.
[0036] Within the context of the present invention, a "transgene" is taken to refer to a gene that does not naturally occur in the genome of the baculovirus. For example, it may be a gene of human, animal, plant, viral or bacterial origin. Within the context of the present invention, a transgene is either a "transgene encoding a protein maturation enzyme" or a "transgene encoding a polypeptide of interest."
[0037] "Distinct transgenes" is taken to refer to transgenes that do not have the same nucleotide sequence.
[0038] In the sense of the present invention, the transgene is placed under the control of suitable elements for its expression in insect cells. "Suitable elements" is taken to refer to the set of elements necessary for its transcription into messenger RNA (RNAm) and for the translation of RNAm into polypeptides. Among the elements necessary for transcription, the promoter bears special importance. It may be a constitutive promoter or a regulated promoter, and may be of baculovirus origin or arthropod origin (e.g., insect origin). The important point is that the selected promoter is suitable for the expression of the transgene in insect cells. Generally speaking, promoters for use in the present invention may be modified to contain regulatory sequences. Examples of promoters include the polyhedrin promoter, the P10 promoter, the synthetic polyhedrin-derived promoter and the P10 promoter, the IE1 promoter of the baculovirus CfMNPV, the IE1 promoter of the baculovirus LdMNPV, the gp64 promoter of the baculovirus OpMNPV, the IE1 promoter of the shrimp virus WSSV (white spot syndrome virus), the P9 promoter of the Junonia coenia densovirus (JcDNV), and the cellular A3 (actin 3) promoter of the silkworm, Bombyx mori. In a specific embodiment, one or more transgenes are placed under the control of a synthetic promoter derived from the wild-type promoter P10 (SEQ ID NO: 1), preferably the synthetic promoter P10S1A (SEQ ID NO: 2) or P10S1B (SEQ ID NO: 3).
[0039] An "expression cassette" is generally taken to refer to a nucleotide sequence consisting of one or more genes and elements suitable for their expression, eg, a transgene and elements suitable for its expression in an insect cell.
[0040] A "protein maturation enzyme" is taken to refer to an enzyme involved in the maturation of a protein. In particular, maturation engineered by a protein maturation enzyme leads to the production of a stable protein and / or a protein having all or part of its biological activity. For example, a protein maturation enzyme may act at the level of the protein's peptide sequence (e.g., by cleavage), at the folding level (as is the case, for example, with chaperone proteins), at the glycosylation level, or at any other post-translational modification level, such as phosphorylation or methylation. A protein maturation enzyme may be a signal peptidase, furin, proprotein convertase, glycosyltransferase, glycosidase, chaperone protein, disulfide isomerase, acyltransferase, methyltransferase, hydroxylase, transglutaminase, farnesyltransferase, geranylgeranyltransferase, N-myristoyltransferase, palmityltransferase, protein kinase, phosphatase, transpeptidase, carboxylase, and / or ubiquitin ligase.
[0041] "Glycosyltransferase" is generally taken to refer to an enzyme capable of catalyzing the transfer of a monosaccharide from a sugar (donor) activated by phosphate to an acceptor molecule (usually an alcohol or amine). The transfer acceptor can also be a peptide residue, usually serine, threonine, or more rarely tyrosine, hydroxylysine, and hydroxyproline in O-glycosylation (O-mannose, O-fucose, O-GalNAc, O-GlcNAc, O-galactose, and O-glucose), or asparagine in N-glycosylation. Activated mannose can also be transferred to tryptophan to form C-mannosyltryptophan. The glycosyltransferase may be selected from N-acetylglucosaminyltransferases I, II, III, IV, V, VB, VI, and IX, galactosyltransferases such as beta-1,4-galactosyltransferases 1, 2, 3, 4, 5, 6, and 7, e.g., beta-1,4-galactosyltransferase, CMP-NeuAc synthase, NeuAc synthase, protein-O-mannosyltransferases 1 and 2, protein-O-fucosyltransferases 1 and 2, protein-O-glucosyltransferase 1, protein-O-GlcNAc transferase, GalNAc transferase, fucosyltransferases 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 (FUT1 to FUT11), and sialyltransferases such as α2,3 sialyltransferase and α2,6 sialyltransferase.
[0042] "Polypeptide" is taken to refer to a chain of amino acids linked by peptide bonds. For example, a polypeptide can be a protein, a protein subunit, a protein fragment, or simply a chain of amino acids. Generally, a polypeptide is formed from at least 10 amino acids.
[0043] A "polypeptide of interest" or "recombinant polypeptide of interest" is taken to refer to a polypeptide encoded by a transgene. For example, a polypeptide of interest may be a subunit of a multimeric protein. Advantageously, the polypeptide is of therapeutic and / or diagnostic interest, i.e., a polypeptide that can be used in therapy or diagnosis.
[0044] "Distinct polypeptides of interest" are taken to refer to polypeptides that do not have an identical sequence of amino acids.
[0045] "Distinct subunits" is taken to refer to subunits of a multimeric protein that do not have identical sequences of amino acids. Thus, a "protein comprising n distinct subunits" is a protein that comprises n subunits, each having a particular sequence of amino acids that are bound together by non-covalent and / or covalent bonds.
[0046] A "multimeric protein" is taken to refer to a protein comprising several subunits. A multimeric protein may comprise several identical subunits (homomultimeric protein) or several distinct subunits (heteromultimeric protein).
[0047] A "protein complex" is taken to refer to an assembly made up of several proteins that have functional or structural connections to each other, such as a "virus-like particle" (VLP) or a multienzyme complex.
[0048] According to the present invention, the expression "replication" or "viral replication" is understood to cover both the replication of the baculovirus genome and the replication of the baculovirus. Given that the replication of the baculovirus genome in insect cells is essential for the replication of the baculovirus in insect cells, genes essential for viral replication are therefore taken to refer to genes essential for the replication of the baculovirus in insect cells. The replication of the baculovirus in insect cells allows the production of infectious baculovirus. Thus, the method of the present invention allows the production of infectious recombinant baculovirus in cells, particularly insect cells.
[0049] Within the context of the present invention, the expression "homologous recombination" is taken to refer to the exchange of genetic information between two different nucleotide sequences, which requires the presence of homologous sequences between the two different nucleotide sequences.
[0050] The term "antibody" is used herein in the broadest sense and encompasses various antibody structures widely described in the literature, including, but not limited to, antibodies, regardless of their origin, monoclonal antibodies, polyclonal antibodies, and antibody fragments, so long as they exhibit the desired activity (e.g., binding to an antigen). Antibodies can be monospecific, multispecific, e.g., bispecific. Antibodies can be IgA, IgD, IgE, IgG, or IgM. Examples of antibody fragments include, but are not limited to, fragments Fv, Fab, Fab', F(ab')2, diabodies, scFv / Fc, camelid-type antibodies (e.g., VHH), and single-chain antibody molecules (e.g., scFv).
[0051] Methods for preparing recombinant baculovirus The present invention provides a method for producing a recombinant baculovirus, wherein the genome of the recombinant baculovirus comprises one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, said method comprising: a) a1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; and a2) i) a nucleotide sequence that allows restoring the function of one of n non-functional genes essential for viral replication; ii) one of the n transgenes encoding a polypeptide of interest n transfer vectors each containing preparing in an insect cell by homologous recombination between one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, the set of nucleotide sequences i) of the n transfer vectors is capable of restoring replication of a replication-deficient baculovirus genome; n is an integer at least equal to 2; b) generating a recombinant baculovirus in insect cells containing the recombinant baculovirus genome obtained in step a); The present invention relates to a method, including:
[0052] The n transgenes, each encoding a polypeptide of interest, are carried by n transfer vectors that are recombined with a replication-deficient baculovirus genome in which the n genes essential for viral replication are non-functional and which contain one or more transgenes, each encoding a protein maturation enzyme. After recombination, the n transgenes, each encoding a polypeptide of interest, are integrated into the genome of the recombinant baculovirus.
[0053] Process a) Recombination occurs in insect cells between (a1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional and which contains one or more transgenes, each encoding a protein maturation enzyme, and (a2) n transfer vectors.
[0054] Advantageously, within the context of the present invention, recombination occurs in a single step in insect cells, whatever the number n of transgenes to be integrated. That is, the recombination of the n transgenes, each encoding a polypeptide of interest, with the replication-defective baculovirus genome occurs simultaneously or quasi-simultaneously in insect cells. This simultaneous recombination is one of the main advantages of the method of the present invention, as it allows for the rapid, single-step production of the desired recombinant baculovirus genome.
[0055] In certain embodiments, the replication-deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from the genome of BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or TeNPV, preferably AcMNPV.
[0056] In a preferred embodiment, the replication-deficient baculovirus genome carried out in the method is in circular form. Thus, the method according to the invention does not require linearization of the replication-deficient genome.
[0057] Transfer vectors may also contain one or more nucleotide sequences that enable them to replicate in bacterial cells. They may also contain a gene encoding a selectable marker that allows for the selection or identification of bacterial cells that have been transformed with the transfer vector.
[0058] One of the main advantages of the method of the present invention is that the replication ability of a replication-deficient viral baculovirus genome is restored by recombination with n transfer vectors. In fact, each of the n transfer vectors encodes a nucleotide sequence that allows the function of one of the n non-functional genes essential for viral replication to be restored in addition to one of the n transgenes encoding a polypeptide of interest. Therefore, only recombination with a set of n transfer vectors allows the replication of a replication-deficient baculovirus genome to be restored. Therefore, the method of the present invention ensures that only recombinant baculovirus genomes containing n transgenes encoding a polypeptide of interest can generate infectious recombinant baculovirus. This method avoids the need for expensive and time-consuming tests to identify recombinant baculoviruses containing n transgenes encoding a polypeptide of interest.
[0059] In a preferred embodiment, the genes essential for viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA The genes are selected from Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6). These genes are preferred because they are adjacent to genes that are not essential for viral replication. Thus, in a preferred embodiment, in the replication-deficient baculovirus genome, each of the n non-functional genes essential for viral replication is adjacent to a gene that is not essential for viral replication. As detailed in this application, the n transgenes are each recombined at a locus of a gene that is non-essential for viral replication adjacent to a gene essential for viral replication that is non-functional. Given that the genes that are non-essential for viral replication are not essential for replication of the baculovirus genome, the recombination does not affect the ability of the recombinant baculovirus genome to replicate.
[0060] The n transgenes are integrated within a gene that is not essential for viral replication or in the intergenic region between two non-essential genes, or alternatively, either upstream or downstream of a gene that is essential for viral replication.
[0061] When the transgene is integrated upstream or downstream of an essential gene (such as the construction of BacMid2-GNTII-β1, 4GT-CMPNeuAcS-NeuAcS-ST3 (or BacSia3) described in Example 12, which integrates the gene ST3 downstream of orf51), however, the baculovirus thus generated may have altered replication and therefore relatively low viral titers, even if viable.
[0062] According to a preferred embodiment of the present invention, the n transgenes are integrated into n genes that are not essential for viral replication, which results in a baculovirus that is significantly more stable during the replication cycle and thus makes it possible to obtain viral titers sufficient to envisage an industrial product.
[0063] Examples of the integration of transgenes into genes that are not essential for viral replication are described in the examples, inter alia, in Example 9 with the integration of the gene fur in the gene Chit / Cath, in Example 10 with the integration of the gene β1,4GalT in the gene egt, in Example 12 with the integration of the genes NeuAc synthase and CMP-NeuAc synthase in the gene iap2, and in Example 14 for the cloning of the transgene α2,6-sialyltransferase I (ST6GalI) in ORF119 (PIF1) of BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS.
[0064] In the sense of the present invention, when two genes are adjacent to each other, the non-functional gene essential for viral replication is adjacent to the gene not essential for viral replication or partially overlaps on the baculovirus genome. Preferably, no other genes are included between the non-functional gene essential for viral replication and the gene not essential for viral replication. Advantageously, the two genes are separated by a spacer nucleotide sequence, e.g., a non-coding spacer nucleotide sequence. In particular, the spacer nucleotide sequence has a length ranging from 1 pb to 600 pb. It is also possible for a non-separating nucleotide sequence (i.e., 0 pb) to separate the two genes, i.e., for the two genes to be arranged side by side on the baculovirus genome or to partially overlap. Alternatively, the spacer nucleotide sequence may include a gene not essential for viral replication.
[0065] The applicant has realized that the selection of non-functional genes essential for viral replication adjacent to genes not essential for viral replication is particularly advantageous, allowing for uniform homologous recombination and therefore uniform recombinant baculovirus genomes to be obtained. As explained elsewhere, only complete recombination of n vectors allows for the production of recombinant baculovirus genomes capable of replicating in insect cells. Thus, the genomes of recombinant baculoviruses prepared by the method according to the invention are more than 90%, advantageously more than 95%, preferably more than 99%, and in a completely preferred manner, approximately 100% homogeneous, e.g., all recombinant baculovirus genomes prepared by the method according to the invention are identical.
[0066] In certain embodiments, the genes that are not essential for viral replication are Ph (ORF8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF6 4), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), ORF5.
[0067] Advantageously, the pair of genes essential for viral replication / genes not essential for viral replication is selected from the pairs listed in Table 1 below:
[0068] [Table 1-1] [Table 1-2]
[0069] Grey lines / bold text represent non-functional essential genes in the baculoviruses of Examples 1, 2 and 3.
[0070] In an advantageous embodiment, the n nucleotide sequences capable of restoring the function of n non-functional genes essential for viral replication are each recombined with a non-functional gene essential for viral replication, such as those listed in Table 1, while the n transgenes encoding polypeptides of interest are each recombined with the locus of a gene that is non-essential for viral replication, said non-essential genes being genes adjacent to said essential gene whose function is restored during this step of homologous recombination, such as those presented in Table 1.
[0071] Thus, if the essential gene whose function is to be restored is gene 1629 (ORF9), the transgene encoding the peptide of interest is integrated into the non-essential gene Ph (ORF8); if the essential gene whose function is to be restored is gene Pk1 (ORF10), the transgene encoding the peptide of interest is integrated into the non-essential gene ORF11, and so on for each pair of adjacent genes listed in Table 1.
[0072] The method according to the invention implements the mechanism of homologous intermolecular recombination. Generally speaking, the mechanism of homologous recombination consists of the exchange of homologous nucleotide sequences between a replication-deficient baculovirus genome and n transfer vectors. These nucleotide sequences can be identical or substantially homologous.
[0073] In a particularly advantageous embodiment, the transfer vector contains flanking sequences homologous to the replication-deficient baculovirus genome on either side of the expression cassette for the transgene encoding the polypeptide of interest. The degree of homology of the flanking sequences with the corresponding portions of the replication-deficient baculovirus genome can vary, but must be sufficient to allow intermolecular recombination. For purposes of the present invention, greater than 70% is preferred, advantageously greater than 80%, preferably greater than 90%, and in a completely preferred manner, approximately 100%, preferably identical. Furthermore, short regions of homology may be sufficient to allow intermolecular recombination, i.e., at least 10 consecutive nucleotides (or base pairs) common between the sequence and its homologous sequence in the replication-deficient baculovirus genome. Within the context of the present invention, the length of the flanking sequences can range from 10 pb (i.e., 10 base pairs) to 10 kb (i.e., 10,000 base pairs), advantageously from 100 pb to 6 kb, preferably from 200 pb to 6 kb, and in a completely preferred manner from 400 pb to 6 kb. Thus, the genetic material located between the flanking sequences of the n transfer vectors is replaced by the genetic material located between two sequences homologous to the flanking sequences of the replication-deficient baculovirus genome. This intermolecular exchange makes it possible to obtain a recombinant baculovirus genome capable of generating infectious recombinant baculovirus in insect cells.
[0074] According to the present invention, a set of nucleotide sequences i) of n transfer vectors (i.e., nucleotide sequences that allow for the restoration of the function of n non-functional genes essential for viral replication) is capable of restoring the replication of a replication-deficient baculovirus genome. Indeed, intermolecular exchange allows for the restoration of the function of n non-functional genes essential for viral replication. In other words, restoration of the function of n non-functional genes essential for viral replication occurs when homologous recombination occurs correctly. This is due to the fact that each of the n transfer vectors contains a nucleotide sequence that allows for the restoration of the function of one of the n non-functional genes essential for viral replication.
[0075] For example, when n=2, a replication-deficient baculovirus genome in which two genes essential for viral replication are nonfunctional is recombined with two transfer vectors, each containing a nucleotide sequence that allows the function of one of the two nonfunctional genes essential for viral replication to be restored. This means that recombination with the first transfer vector allows the function of the first nonfunctional gene essential for viral replication to be restored, and recombination with the second transfer vector allows the function of the second nonfunctional gene essential for viral replication to be restored. Therefore, only recombination of the two transfer vectors with the replication-deficient baculovirus genome allows the function of the two nonfunctional genes essential for viral replication to be restored, and therefore the replication of the replication-deficient baculovirus genome to be restored. Restoring the functions of these two essential genes makes it possible to obtain a recombinant baculovirus genome that can generate infectious recombinant baculovirus in insect cells.
[0076] Thus, according to the method of the present invention, recombination or multiple recombination with n transfer vectors is required to restore replication of a replication-deficient baculovirus genome.
[0077] In a surprising way, the present inventors have demonstrated that multiple recombination can be carried out simultaneously in a single step in insect cells. This is particularly advantageous because a replication-deficient baculovirus genome and n transfer vectors can be simultaneously introduced into insect cells, i.e., the replication-deficient baculovirus genome and n transfer vectors are simultaneously introduced into insect cells; in other words, the replication-deficient baculovirus genome and n transfer vectors are introduced into insect cells in a single step, regardless of the number n of transfer vectors. Multiple recombination in a single step makes it possible to easily and quickly obtain uniform recombinant baculovirus genomes.
[0078] The method according to the present invention makes it possible to produce a recombinant baculovirus containing n transgenes, each encoding a polypeptide of interest. The set of n polypeptides of interest can, for example, form a protein comprising several subunits. The set of n polypeptides of interest can also be constituent proteins of a protein complex, for example, a VLP. The set of n polypeptides of interest is produced by insect cells infected with a recombinant baculovirus containing n transgenes, each encoding a polypeptide of interest.
[0079] Thus, in certain embodiments, n polypeptides of interest form several distinct proteins of interest. These may include several distinct proteins of interest comprising a single polypeptide chain, several distinct proteins of interest comprising several identical subunits, and / or several distinct proteins of interest comprising several distinct subunits. The number of distinct proteins of interest formed by n polypeptides of interest is equal to or less than n. For example, three polypeptides of interest (n=3) may form (i) a first protein of interest comprising a single polypeptide chain and a second protein of interest comprising two distinct subunits, (ii) three distinct proteins of interest each comprising a single polypeptide chain, (iii) a first protein of interest comprising several identical subunits and a second protein of interest comprising two distinct subunits, or (iv) three distinct proteins of interest each comprising several identical subunits.
[0080] In another specific embodiment, the n polypeptides of interest form a single protein, in which the protein then comprises n separate subunits, each of which is one of the n polypeptides of interest.
[0081] Therefore, the method according to the present invention is particularly advantageous for preparing recombinant baculoviruses containing transgenes encoding proteins of interest that contain several distinct subunits, for example, proteins of interest that are active only when all subunits are present. The subunits are generally linked together by non-covalent bonds (e.g., hydrophobic bonds) and / or covalent bonds (e.g., disulfide bridges between two cysteines). The method according to the present invention is therefore particularly advantageous for preparing recombinant baculoviruses containing transgenes encoding multimeric proteins, for example, antibodies or antibody fragments.
[0082] The number of transfer vectors varies depending on the desired number of distinct polypeptides of interest to be produced. For example, two transfer vectors are used for a protein comprising two distinct subunits, three transfer vectors are used for a protein comprising three distinct subunits, etc. Advantageously, each transfer vector contains a transgene encoding a polypeptide of interest that is different from the transgenes encoding other polypeptides of interest contained in other transfer vectors. In certain embodiments, a transfer vector may contain two or more transgenes, for example, two transgenes, each encoding a polypeptide of interest. In this particular embodiment, transgenes, preferably up to two transgenes per locus, may be present in the same locus.
[0083] Advantageously, n is an integer ranging from 2 to 31, for example from 2 to 10. For example, for a protein of interest comprising several distinct subunits, the value of n corresponds to the number of distinct subunits of said protein of interest.
[0084] In a particular embodiment, n=2. In this case, it is possible to distinguish between the following implementations: - Advantageously, the two transgenes each encode a subunit of a protein comprising two subunits, and the two transgenes each encode a distinct subunit of a protein comprising two distinct subunits. For example, the first transgene encodes the light chain of an antibody and the second transgene encodes the heavy chain of the antibody. Such exemplary configurations are described in Example 6. The protein comprising two distinct subunits can also be a monospecific antibody or a peptide hormone comprising two distinct subunits, or - the two transgenes each encode a distinct polypeptide of interest, for example, two distinct polypeptides of interest that constitute two viral protein sets, multienzyme complexes, protein complexes, e.g., VLPs, that are composed of two distinct proteins.
[0085] Figures 16, 17 and 19 illustrate diagrammatically the representation of a baculovirus genome containing two transgenes of interest.
[0086] In a particular embodiment, n=3. In this case, it is possible to distinguish between the following implementations: Advantageously, the three transgenes each encode a subunit of a protein comprising three subunits, and the three transgenes each encode a distinct subunit of a protein comprising three distinct subunits. The protein comprising three distinct subunits may be a bispecific antibody or a peptide hormone comprising three distinct subunits. For example, the first transgene encodes the first light chain of the bispecific antibody, the second transgene encodes the second light chain of the bispecific antibody, and the third transgene encodes the heavy chain of the bispecific antibody, or - Each of the three transgenes encodes a distinct polypeptide of interest. For example, the three polypeptides of interest constitute a set of three viral proteins, a multienzyme complex, a protein complex, e.g., a VLP composed of three distinct proteins. An exemplary configuration of this type is presented in Example 7, where "BacMid3" is used for the production of three proteins of the flu virus (see also Figure 10).
[0087] For this particular embodiment, the baculovirus BacMid3 described in Example 3, in which the genes 1629, DNApol and gp64 essential for replication are non-functional, can be used for the simultaneous integration of these three transgenes. In a particular embodiment, n=4. In this case, it is possible to distinguish between the following implementations: - Advantageously, the four transgenes each encode a subunit of a protein comprising four subunits, and the four transgenes each encode a distinct subunit of a protein comprising four distinct subunits, the protein comprising four distinct subunits may be a peptide hormone comprising four distinct subunits, or - each of the four transgenes encodes a distinct polypeptide of interest, e.g., the four polypeptides of interest constitute a set of four viral proteins, a multienzyme complex, a protein complex, e.g., a VLP, composed of four distinct proteins.
[0088] Advantageously, the recombinant baculovirus produced by practicing the methods of the present invention does not contain nucleic acid sequences that enable it to replicate in bacterial cells. Optionally, nucleic acid sequences that enable the replication-deficient baculovirus genome to replicate in bacterial cells can be eliminated during the step of homologous recombination in insect cells.
[0089] Step a) is carried out after the transfer vector and the replication-deficient baculovirus genome are introduced into the insect cells. This introduction can be carried out using techniques widely described in the prior art. Among others, mention can be made of calcium phosphate technology, DEAE-dextran technology, electroporation, methods based on osmotic shock, microinjection, or methods based on the use of liposomes, preferably lipofection. The method according to the present invention is particularly advantageous because it allows the introduction of n transfer vectors and a replication-deficient baculovirus genome into insect cells in a single step. The amounts of replication-deficient baculovirus genome and transfer vector introduced into the insect cells can vary. It is preferred to use a 5-fold greater amount of each of the n transfer vectors relative to the amount of the replication-deficient baculovirus genome. Advantageously, the replication-deficient baculovirus genome is introduced into the insect cells in circular form, i.e., without prior linearization. Linearization is unnecessary because the baculovirus genome is replication-deficient and, even in circular form, contains non-functional genes essential for viral replication. The absence of a linearization step is one of the major advantages of the method of the present invention.
[0090] As detailed above, the protein maturation enzyme may be selected from a peptidase signal, furin, proprotein convertase, glycosyltransferase, glycosidase, protein chaperone, disulfide isomerase, acyltransferase, methyltransferase, hydroxylase, transglutaminase, farnesyltransferase, geranylgeranyl-transferase, N-myristoyltransferase, palmityltransferase, protein kinase, phosphatase, transpeptidase, carboxylase or ubiquitin ligase.
[0091] The selection of protein maturation enzymes depends on the target polypeptide, particularly the type of maturation that the target polypeptide must undergo.For example, if the target polypeptide forms a target glycosylated protein, such as a subunit of an antibody, the maturation enzyme can be one or more glycosyltransferases that allow desired glycosylation to be obtained.Those skilled in the art can easily select a suitable glycosyltransferase for the function of desired glycosylation. For example, the glycosyltransferase can be selected from N-acetylglucosaminyltransferase I, II, II, IV, V, VB, VI, IX, galactosyltransferase (e.g., beta-1,4-galactosyltransferase selected from beta-1,4-galactosyltransferases 1, 2, 3, 4, 5, 6 and 7, e.g., beta-1,4-galactosyltransferase), CMP-NeuAc synthase, NeuAc synthase, sialyltransferase (e.g., α2,3 sialyltransferase or α2,6 sialyltransferase), protein-O-mannosyltransferase 1 and 2, protein-O-fucosyltransferase 1 and 2, protein-O-glucosyltransferase 1, protein-O-GlcNAc transferase, GalNAc transferase, fucosyltransferase 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11 (FUT1-FUT11).
[0092] In certain embodiments, the glycosyltransferase is one or more glycosyltransferases selected from N-acetylglucosaminyltransferase II, beta-1,4-galactosyltransferase, and sialyltransferase.
[0093] Process a1 In certain embodiments, the replication-deficient baculovirus genome of step a1) is expressed in a bacterial cell as follows: i) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional; ii) one or more nucleotide sequences each comprising one or more transgenes each encoding a protein maturation enzyme; It is prepared by homologous recombination between
[0094] Thus, in this particular embodiment, the method of the present invention comprises: a') In bacterial cells, a'1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional; a'2) one or more nucleotide sequences each comprising one or more transgenes each encoding a protein maturation enzyme preparing a first replication-deficient baculovirus genome by homologous recombination between: a) In insect cells, a1) the first replication-deficient baculovirus genome obtained from step a); and a2) i) a nucleotide sequence that allows restoring the function of one of n non-functional genes essential for viral replication; ii) one of the n transgenes encoding a polypeptide of interest n transfer vectors each containing preparing a replicable second baculovirus genome comprising one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest (recombinant baculovirus genome) by homologous recombination between a set of nucleotide sequences of n transfer vectors i) capable of restoring replication of the first replication-deficient baculovirus genome; n is an integer at least equal to 2; b) producing a recombinant baculovirus in insect cells containing the recombinant baculovirus genome obtained in step b); Includes.
[0095] In this embodiment, the first recombination occurs in a bacterial cell between (a'1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, and (a'2) one or more nucleotide sequences each containing one or more introduced genes each encoding a protein maturation enzyme.
[0096] Preferably, each transgene encoding a protein maturation enzyme is recombined at the locus of a gene that is not essential for viral replication, preferably at the locus of a gene that is not essential for viral replication but is not adjacent to a non-functional gene that is essential for viral replication. Genes that are not essential for viral replication include ptp (ORF1), ctx (ORF3), ORF4, ORF7, odv-e26 (ORF16), ORF17, ORF18, ORF19, ARIF-1, and the like. ORF20-21, pif2 (ORF22), protein F (ORF23), iap1 (ORF27), lef6 (ORF28), ORF29, ORF30, sod (ORF31), fgf (ORF32), gta (ORF42), ORF43, ORF44, ORF45, odv-e66 (ORF46), ORF47, ORF56, ORF57, chaB-like (ORF58 / 59), chaB-like (ORF60), mtase (ORF69), hcf-1 (ORF70), iap2 (ORF71), ORF86, ORF87, ORF11 Advantageously, the gene encoding the pe38 (ORF151), pe38 (ORF152), pe38 (ORF153), or ORF154 is selected from the group consisting of ORF114, pif3 (ORF115), ORF116, ORF117, pif (ORF119), ORF120, ORF121, ORF122, pk2 (ORF123), ORF124, lef7 (ORF125), chitinase (ORF126), gp16 (ORF130), p35 (ORF135), p26 (ORF136), p10 (ORF137), p74 (ORF138), ORF149, ORF150, ie2 (ORF151), pe38 (ORF153), and ORF154.
[0097] In this particular embodiment, the bacterial cell is a bacterium that supports replication of a baculovirus genome containing the mini-F origin of replication. The bacterial cell is preferably E. coli, especially DH10B or EL350.
[0098] Step b) Step b) comprises producing a recombinant baculovirus in an insect cell containing the recombinant baculovirus genome obtained in step a), which may be, for example, the insect cell of step a).
[0099] Advantageously, the insect cells are cultured under suitable conditions to express the recombinant baculovirus, especially in a culture medium suitable for cell growth, which may contain serum of animal origin or may be a serum-free culture medium.
[0100] Advantageously, the insect cells are chosen from Sf9, Sf21, Tn5-b14, lepidoptera cell lines sensitive to the baculovirus AcMNPV, strain Sf21, strain "High Five", preferably Sf9.
[0101] The recombinant baculovirus thus produced can be used to infect other insect cells. These insect cells infected with the recombinant baculovirus can then each produce the transgene. Thus, the production of each transgene allows n polypeptides of interest to be obtained by the protein maturation enzyme.
[0102] In certain embodiments, recombinant baculoviruses may be used to infect eukaryotic cells, and indeed, baculoviruses have been shown to be able to infect eukaryotic cells.
[0103] Thus, the method according to the invention allows for the easy and rapid production of recombinant baculoviruses whose genomes contain one or more transgenes each encoding a protein maturation enzyme and n separate transgenes each encoding a separate polypeptide of interest.
[0104] Recombinant baculovirus The present invention also provides a) one or more transgenes, each encoding a protein maturation enzyme; b) Formula (I): [Transgene encoding a polypeptide of interest]-[spacer nucleotide sequence]-[gene essential for functional viral replication] (I) and n nucleotide sequences of Including, the spacer nucleic acid sequence is composed of 0 to 600 base pairs, preferably 1 to 600 base pairs; The genes essential for functional viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), and DNA Selected from Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6). n is an integer at least equal to 2, The purpose is to protect the recombinant baculovirus or the recombinant baculovirus genome.
[0105] Advantageously, the recombinant baculovirus or recombinant baculovirus genome according to the invention does not contain nucleic acid sequences that allow it to replicate in bacterial cells. Indeed, it has been demonstrated that the absence of such sequences makes it possible to increase the stability of the recombinant baculovirus compared to recombinant baculoviruses that contain such sequences (Piljmann et al. (2003) Journal of General Virology).
[0106] The recombinant baculovirus or recombinant baculovirus genome according to the present invention may comprise Ph (ORF8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF Advantageously, the recombinant baculovirus or recombinant baculovirus genome does not contain any of the n genes that are not essential for viral replication selected from ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5. Because cathepsins can have deleterious effects on the target polypeptide being produced, it is advantageous that one of the n genes that are not essential for viral replication and that is not contained in the recombinant baculovirus or recombinant baculovirus genome is a gene encoding a cathepsin.
[0107] According to the present invention, as detailed in the section above "Method for preparing recombinant baculovirus", n is an integer at least equal to 2, for example in the range of 2 to 30, for example in the range of 2 to 10, more particularly an integer equal to 2, 3 or 4.
[0108] According to a particular embodiment of the invention, n is 3 or greater.
[0109] The present invention also provides a) one or more transgenes, each encoding a protein maturation enzyme; b) Formula (I): [Transgene encoding a polypeptide of interest]-[spacer nucleotide sequence]-[gene essential for functional viral replication] (I) and n nucleotide sequences of Including, the spacer nucleic acid sequence is composed of 0 to 600 base pairs, preferably 1 to 600 base pairs; The genes essential for functional viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), and DNA Selected from Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), lef-2 (ORF6), It is intended to protect a recombinant baculovirus or a recombinant baculovirus genome obtainable by the production method according to the invention, wherein n is an integer at least equal to 2.
[0110] Advantageously, the n nucleotide sequences of formula (I) are spread throughout the genome of the recombinant baculovirus, which makes it possible to improve its stability. Therefore, the n nucleotide sequences of formula (I) are spaced far enough apart on the genome of the baculovirus. Advantageously, each of the n nucleotide sequences of formula (I) is spaced at least 500 nucleotides apart from another one of the n nucleotide sequences of formula (I). Obtaining a recombinant baculovirus or a recombinant baculovirus genome in which the n nucleotide sequences of formula (I) are spread throughout the genome does not present any particular difficulty for those skilled in the art, since the distribution on the genome is related to the selected "essential gene / non-essential gene" pair.
[0111] This is inherent in the implementation of the preparation method according to the invention and is advantageous because the n nucleotide sequences of formula (I) are not duplicated in the genome of the recombinant baculovirus. In fact, a decrease in the stability of the recombinant baculovirus has been demonstrated when sequences are duplicated in the genome (data not shown).
[0112] Set of homologous recombination elements The present invention also provides a) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; b) i) a nucleic acid sequence that allows restoring the function of one of the n non-functional genes essential for viral replication; ii) a transgene encoding a polypeptide of interest; and and n transfer vectors each containing The aim is to protect a set of homologous recombination elements, where n is an integer at least equal to 2.
[0113] As described above in the section "Methods for preparing recombinant baculoviruses", non-functional genes essential for viral replication are advantageously each flanked by genes that are not essential for viral replication.
[0114] In certain embodiments, the transfer vector comprises flanking sequences homologous to the replication-deficient baculovirus genome on either side of the transgene expression cassette. Advantageously, each flanking sequence of the transfer vector is homologous to all or part of the non-functional genes essential for viral replication, as well as to all or part of the genes not essential for viral replication. The flanking sequences can range from 10 pb (i.e., 10 base pairs) to 10 kb (i.e., 10,000 base pairs), advantageously ranging from 100 pb to 6 kb, preferably from 200 pb to 6 kb, and in a completely preferred manner from 400 pb to 6 kb. Flanking sequences are described in detail above in the section "Methods for Preparing Recombinant Baculoviruses."
[0115] As detailed in the section above "Methods for preparing recombinant baculoviruses", n is advantageously an integer in the range of 2-31, for example in the range of 2-10.
[0116] cell The present invention also aims to protect cells containing a recombinant baculovirus or a recombinant baculovirus genome according to the invention or a set of homologous recombination elements according to the invention.
[0117] In certain embodiments, as described in more detail in the section above "Methods for Preparing Recombinant Baculoviruses," the cells are preferably insect cells selected from Sf9, Sf21, Tn5-b14, a lepidoptera cell line susceptible to the baculovirus AcMNPV, strain Sf21, preferably Sf9.
[0118] use The present invention also targets the use of a recombinant baculovirus or a recombinant baculovirus genome according to the invention or a cell according to the invention for the production of n transgenes, each encoding a polypeptide of interest.
[0119] The production of recombinant polypeptides of interest from baculovirus is well described in the prior art and can be readily carried out by techniques well known to those skilled in the art.
[0120] "Mono-recombinant" baculovirus In certain embodiments, the methods of the present invention may be used to produce "single recombinant" baculoviruses, ie, baculoviruses that contain a single transgene encoding a polypeptide of interest.
[0121] In this particular embodiment, there is provided a method of producing a recombinant baculovirus, wherein the genome of the recombinant baculovirus comprises one or more transgenes, each encoding a protein maturation enzyme and a transgene encoding a polypeptide of interest, the method comprising: a) a1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; and a2) preparing in insect cells, by homologous recombination between n transfer vectors each comprising a nucleotide sequence (i) that allows the function of one of the n non-functional genes essential for viral replication to be restored, a replicable recombinant baculovirus genome, each comprising one or more transgenes encoding a protein maturation enzyme and a transgene encoding a polypeptide of interest, one of the n vectors comprises a transgene encoding a polypeptide of interest; a set of nucleotide sequences (i) of n transfer vectors capable of restoring replication of a replication-deficient baculovirus genome; n is an integer at least equal to 2; b) generating a recombinant baculovirus in insect cells containing the recombinant baculovirus genome obtained in step a); Includes. [Example]
[0122] Examples 1-3 relate to the construction of replication-deficient baculoviruses in which one, two or three genes, respectively, are non-functional.
[0123] Examples 4 and 5 describe the generation of recombinant baculoviruses incorporating two or three transgenes, respectively.
[0124] Examples 6-8 relate to the use of these recombinant baculoviruses incorporating two or three transgenes for the production of proteins of interest.
[0125] Examples 9-15 describe the construction of recombinant baculoviruses containing transgenes encoding protein maturation enzymes.
[0126] Examples 16-19 demonstrate that the proteins of interest produced by virtue of the baculoviruses of Examples 9-15 have satisfactory maturation and / or glycosylation.
[0127] Example 1: Construction of a replication-deficient baculovirus genome (BacMid1) in which one gene essential for viral replication is non-functional BacMid1 has a deletion of gene 1629, a gene essential for viral replication. 1. Integration of a bacterial origin of replication into the baculovirus genome This manipulation is carried out in insect cells. The bacterial origin of replication, Mini-F, was introduced into the polyhedrin locus of the baculovirus genome, AcMNPV, by homologous recombination in insect Sf9 cells (Spodoptera frugiperda). To do so, cells were transfected with (i) Mini-F plus kanamycin resistance (Kan R The transfer vector PH (pVT / Mini-F-Kan) was replaced by a fragment of DNA carrying a bacterial expression cassette conferring R) and (ii) the baculovirus genome AcMNPV (a baculovirus isolated from the lepidopteran Autographa californica). The generated baculoviruses were purified by phage plaque assay technique and then transfected with the Mini-F and expression cassette Kan. R The baculovirus was selected and then transferred into the bacterium Escherichia coli EL350, thus generating the first bacmid (BacMid0, not defective for viral replication in insect cells).
[0128] 1. Deletion of essential gene 1629 Ampicillin resistance (Amp R ) and a bacterial expression cassette with the 5' and 3' restriction sites MauBI (sites not present in the baculovirus genome AcMNPV) was transformed into the bacterial expression cassette Kan by homologous recombination in the bacterium Escherichia coli EL350. R During this recombination process, a DNA fragment encoding the 27 C-terminal amino acids of protein 1629 was deleted, rendering protein 1629 non-functional (BacMid0 / amp R ). After digestion with MauBI and subsequent religation, the ampicillin resistance gene was then eliminated, thus creating BacMid1. The baculovirus genome (i.e., BacMid1) is then defective for replication in insect cells because a gene essential for viral replication (i.e., the gene encoding protein 1629) is non-functional. Bacteria containing BacMid1 are hereafter referred to as "bacteria E. coli EL350 / BacMid1."
[0129] FIG. 1 illustrates the steps in the preparation of BacMid1.
[0130] Example 2: Construction of a replication-deficient baculovirus genome (BacMid2) in which two genes essential for viral replication are non-functional BacMid2 shows the deletion of two genes essential for viral replication, gene 1629 and the gene encoding viral DNA polymerase (DNAPol). The deletion of gene DNAPol from BacMid1 resulted in the deletion of a portion of the gene encoding gp37 (252 amino acids) and a portion of the gene encoding DNAPol (466 C-terminal amino acids), and the insertion of a bacterial expression cassette (Hygro) that allows the production of hygromycin B phosphotransferase. R After electroporation of the 4222 bp recombinant fragment, which was replaced by 222 bp of the 222 bp fragment, the recombinant was carried out in the bacterium E. coli EL350 / BacMid1 and induced hygromycin resistance (Hygro R ) was given in this way. R The gene was placed under the control of the bacterial promoter EM7 (derived from the commercial vector pSelect-Hygro-mcs, Invitrogen) and the terminator glms was R The gene was introduced downstream of the gene (Gay NJ et al. Biochem J., 1986, 234, 111-117). Bacteria containing BacMid2 (E. coli EL350 / BacMid2) were selected for their hygromycin resistance. The baculovirus genome (i.e., BacMid2) is defective for replication in insect cells because two genes essential for viral replication (i.e., the gene encoding protein 1629 and the gene encoding DNAPol) are nonfunctional.
[0131] FIG. 2 is a diagram illustrating the process of deleting a portion of the gene DNAPol to prepare BacMid2.
[0132] NOTE: It is possible to produce a single protein using BacMid2 (see Example 4). It is sufficient to have two transfer vectors, one providing the transgene and all or part of the deleted essential gene 1 and the other providing the wild-type gene corresponding to the deleted essential gene 2. The two deleted genes are repaired upon homologous recombination.
[0133] Example 3: Construction of a replication-deficient baculovirus genome (BacMid3) in which three genes essential for viral replication are non-functional BacMid3 has deletions of three essential genes, 1629, DNAPol, and gp64. The deletion of the gp64 gene from BacMid2, which contains 779 bp of the cathepsin gene and the sequence encoding 259 amino acids of chitinase, and part of the gp64 gene, a 566 bp deletion encoding 188 amino acids, is carried by a bacterial expression cassette (Zeo R This was carried out in the bacterium Escherichia coli EL350 / BacMid2 after electroporation of a 3260 bp recombinant fragment in which the nucleotide sequence was replaced by the nucleotide sequence (Drocourt et al., Nucleic Acids Research, vol. 18 no. 13, 1990). R The gene was placed under the control of the bacterial promoter T5N25 derived from phage T5 (Gentz and Bujard, J. Bacteriology, vol. 164 n1, 1985), followed by the transcription terminator rrnBT1 (E. coli ribosomal RNA operon T1 terminator) (Kwon et al., J. Biol. Chem., vol. 274 n°41, 1999). Bacteria containing BacMid3 (E. coli EL350 / BacMid3) were selected for their zeocin resistance. The baculovirus genome (i.e., BacMid3) is defective for replication in insect cells because three genes essential for viral replication (i.e., the gene encoding protein 1629, the gene encoding DNAPol, and the gene encoding gp64) are nonfunctional.
[0134] FIG. 3 is a diagram illustrating the steps of gp64 deletion for the preparation of BacMid3.
[0135] Example 4: Use of BacMid2 The transfer vector pVT / gp37 was constructed to allow the generation of recombinant baculoviruses expressing two transgenes. To do so, the EcoRI F fragment of the baculovirus genome AcMNPV, which contains the gp37 and DNAPol genes, was cloned into the bacterial plasmid pUC, thus generating pUC / gp37.
[0136] This plasmid was then modified in the following ways: a large portion of the gene encoding gp37 was deleted (724 pb), and the ATG initiator was mutated and replaced by two unique restriction sites, XbaI and AvrII, allowing integration of the transgene under the control of the native promoter of gp37. These modifications thus led to the transfer vector pVT / gp37.
[0137] Sf9 cells were transfected by lipofection using the transfer vectors pVT / PH and pVT / gp37 loaded with the transgene and BacMid2 DNA. Viruses generated after homologous recombination were cloned by phage plaque assay. Recombinant protein production was confirmed by appropriate methods (e.g., ELISA, Western blot, enzyme assay). The genome of the recombinant virus was confirmed by Southern blot, and the sequence of the transgene integrated into the viral genome was confirmed by PCR amplification followed by sequencing.
[0138] FIG. 4 is a diagram illustrating the transfer vector pVT / gp37 for expression of gene X (where X is a gene different from the gene encoding the heavy chain of an antibody).
[0139] The genome of the recombinant baculovirus generated after homologous recombination between BacMid2 and the transfer vector no longer expresses gp37, a protein not essential for viral replication.
[0140] A second recombination must occur with the transfer vector PH, with or without a transgene, for viral DNA to be repaired at the two loci of BacMid2. In all cases, the DNA of the baculovirus genome is repaired, resulting in infection.
[0141] It is also possible to use pVT / PH containing the wild-type sequence leading to the production of polyhedrin, i.e., containing the wild-type expression cassette (unmodified). pVT / PH can also be "empty," i.e., containing no transgene or polyhedrin gene.
[0142] Similarly, it is possible to integrate a transgene into the PH locus. In this case, the gp37 / DNApol locus is restored using a non-deleted pVT / gp37 (functional non-essential gene) or a completely or partially deleted pVT / gp37, such as that described in Figure 4. It should be noted that, as explained herein below, the sequence of the gene gp37 present in pVT / gp37 described in Figure 4 has been modified, the ATG initiator (ATGi) has been mutated and the gene gp37 has been deleted from 240 amino acids:
[0143] [ka] caption: Sequence of bolded genes Underlined ATG initiator Polylinker XbaI / AvrII / BamHI in the boxed section The nucleic acid sequence exemplified above is sequence SEQ ID NO:16.
[0144] FIG. 5 is a diagram illustrating the construction and use of transfer vector PH pVT / PH for the expression of transgene X, where X is a transgene different from the gene encoding the light chain of an antibody.
[0145] Antibody heavy chain expression Construction of specific pVT / gp37 and pVT / gp37-Cγ1 This transfer vector contains the following expression cassettes: - wild-type virus promoter P10 (SEQ ID NO: 1) - DNA sequence encoding the signal sequence of human immunoglobulin (secretory sequence) - Two unique restriction sites for in-phase cloning of antibody variable domains (VH) (the regions that confer antibody specificity) - DNA sequences encoding the constant regions of epsilon, mu or alpha human IgG (γ1-4).
[0146] FIG. 6 is a diagram illustrating the construction and use of the transfer vector pVT / gp37Cγ1 for expression of an antibody heavy chain.
[0147] Antibody light chain expression Construction of specific pVT / PH and pVT / PH-CL This transfer vector contains the following expression cassettes: - viral promoter P10 P10S1B (SEQ ID NO: 3) - DNA sequence encoding the signal sequence of human immunoglobulin (secretory sequence) - Two unique restriction sites for in-phase cloning of the variable regions (VL) of the antibody (the regions that confer antibody specificity). - DNA sequences encoding the constant region of the light chain (CL) kappa (κ) or lambda (λ) of human IgG.
[0148] FIG. 7 is a diagram illustrating the construction and use of the transfer vector pVT / PHC for the expression of an antibody light chain.
[0149] Example 5: Use of BacMid3. A transfer vector, pVT / Chit-Cath, was constructed to generate a recombinant baculovirus genome expressing three transgenes. The fragment BstXI-XbaI from the EcoRI E and H regions of the baculovirus AcMNPV was cloned into the plasmid pUC. The EcoNI-EcoRI deletion of 1175 bp makes it possible to inactivate the gene encoding a nonessential chitinase and also a nonessential cathepsin. The addition of an XbaI site between the EcoNI and EcoRI sites allows the transgene to be integrated. These modifications thus led to the transfer vector pVT / Chit-Cath.
[0150] Sf9 cells were transfected by lipofection using the transfer vectors pVT / PH, pVT / gp37, and pVT / chitCath loaded with the transgene and BacMid3 DNA. Viruses generated upon homologous recombination were cloned by phage plaque assay. Recombinant protein production was controlled by appropriate methods, such as ELISA, Western blot, and enzyme assay. The recombinant viral genome was controlled by Southern blot, and the transgene sequence was controlled after PCR amplification.
[0151] FIG. 8 is a diagram illustrating the construction of the vector pVT / Chit-Cath and its homologous recombination with BacMid3.
[0152] Example 6: Production of monoclonal antibody anti-CD4 (13B8II) using BacMid2 The DNAc encoding the VH and VL domains of the antibody were inserted into the transfer vectors pVT / PH-C and pVT / gp37-Cγ1, respectively. Recombinant baculoviruses were generated after homologous recombination between the DNA of the two pVTs and BacMid2 from Example 4.
[0153] DNAc encoding the VL region of the antibody was introduced into pVTPH / Ck, which was recombined with the PH / 1629 region of BacMid2.
[0154] DNAc encoding the VH region of the antibody was cloned into pVT / gp37-Cγ1, which was recombined with the gp37 region of BacMid2.
[0155] Sf9 cells were transfected by lipofection using BacMid2 and the two transfer vectors obtained in Example 4, and then incubated at 28° C. for 4 days. The culture supernatant was collected, and the recombinant baculoviruses produced and secreted into the culture medium were cloned by phage plaque assay technology.
[0156] The genome organization of the recombinant baculovirus was controlled by Southern blot (see Figure 9A), and the integrated transgenes (i.e., VL and VH) were confirmed after PCR amplification, cloning, and subsequent sequencing. The recombinant antibodies secreted into the culture medium were purified on a Protein A Sepharose column (GE Healthcare) and then analyzed after migration on a polyacrylamide gel and silver staining (Figure 9B).
[0157] Example 7: Use of BacMid3 for the production of VLPs (virus-like particles) Production of flu VLPs To produce these VLPs, three genes of the flu virus, M, HA and NA, were co-expressed.
[0158] These three genes were incorporated into three transfer vectors that needed to be recombined with BacMid3 in Example 5:
[0159] The gene M was introduced into the transfer vector pVT / PH as described in FIG.
[0160] The gene HA was introduced into the transfer vector pVT / gp37 as described in FIG.
[0161] The gene NA was introduced into the transfer vector pVT / Chit / Cath as described in FIG.
[0162] Sf9 cells were transfected with BacMid3 and the three transfer vectors obtained above by lipofection and then incubated at 28°C for 4 days. The recombinant baculoviruses produced and secreted into the culture supernatant were then cloned by phage plaque assay.
[0163] The genome organization of the recombinant baculovirus was controlled by Southern blot (see Figure 10), and the integrated genes were confirmed after PCR amplification, cloning, and subsequent sequencing. Southern blots were performed on the genomic DNA of a recombinant virus expressing the three proteins HA, NA, and M of the flu virus. This experiment, performed with probes specific for these three genes, allows the detection of the presence of DNA encoding the three proteins in the recombinant baculovirus genome.
[0164] Example 8: Use of BacMid3 for the production of bispecific antibodies The bispecific antibody constructed according to International Application WO2013 / 005194 consists of a heavy chain composed of domains VH+CH1+CH2+CH3 of Antibody 1, fused N-terminally to domains VH+CH1 of Antibody 2. Mutations introduced at the interface of regions CL and CH1 of Antibody 1 support correct pairing between domains VL1 and VL2 of separately produced light chains L1 and L2 and the corresponding domains VH1 and VH2. Production of this antibody requires the simultaneous production of equal amounts of the three chains: the fused heavy chain, light chain L1, and light chain L2.
[0165] As depicted in FIG. 5, DNAc encoding the light chain L1 was introduced into the transfer vector pVT / PH.
[0166] As depicted in FIG. 4, DNAc encoding the light chain L2 was introduced into the transfer vector pVT / gp37.
[0167] As depicted in FIG. 8, DNAc encoding the fused heavy chain was introduced into the transfer vector pVT / Chit-Cath.
[0168] FIG. 11 illustrates, in A, the structure of a bispecific antibody and, in B, polyacrylamide gel electrophoretic analysis of a bispecific antibody purified on a Protein A Sepharose column (GE Healthcare).
[0169] Example 9: Construction of BacMid2-Fur, which allows the generation of recombinant baculoviruses that accurately express mature mannosylated proteins The general principle used to introduce into the bacmids genes that allow optimizing post-translational modification of proteins (BacMid2 / MPT (MPT: post-translational modification)) is described in Figure 14 and detailed in Example 10. If several genes are necessary, they are repeatedly integrated into regions or genes that are not essential for viral replication. Table 2 below lists the integration sites and the nature of the integrated genes in the various bacmids that were constructed.
[0170] [Table 2]
[0171] Table 2 caption: Genes involved in the elaboration of post-translational modifications (e.g., glycosylation, intracellular proteolytic cleavage) were inserted into nonessential genes / regions of the bacmid. The promoters used to control the expression of these genes are early, in order to produce these enzymes before the biosynthesis of the protein of interest, except in the case of overexpression of cellular furin, which is produced under the control of the strong late promoter P10S1.
[0172] BacMid2-Fur was constructed from BacMid2 obtained in Example 2. The gene encoding furin (fur) of lepidopteran cells Sf9 was cloned downstream of the synthetic late promoter P10S1 with the following sequence: 5'-ATAAGTATTTTAATCTTTTCGTTTGTATATTAATTAAAATACTATACTGTATAAAAAAACCTATAAATATCCCGGATTATTCATACCGTCCCACCATCGGGCGTACGCCACC-3' (SEQ ID NO: 17).
[0173] The gene fur was integrated into the chitinase-cathepsin locus. The transfer vector pVT / Chit-Cath, the construction of which is described in Example 5, was used. An expression cassette containing the gene fur under the control of the synthetic promoter P10S1 was introduced into the unique XbaI site of pVT / Chit-Cath (position 106160 in the baculovirus genome) to obtain the plasmid pVT / Chit-Cath-Fur. The gene fur was cloned in the same orientation as the inactivated cathepsin gene.
[0174] The bacterial expression cassette “Zeocin resistance (Zeo)” was constructed as follows: R )": the bacterial promoter T5N25-Zeo containing the Bsu36I site on either side R -terminator rrnBT1] was cloned into the EcoRI site of pVT / Chit-Cath-Fur to give the plasmid pVT / Chit-Cath-Fur-Zeo R This second cassette encodes the gene Zeo R This allows expression of ΛΜΡΙ ...
[0175] Plasmid pVT / Chit-Cath-Fur-Zeo by BglII RAfter digestion of the 5927 bp recombinant fragment was prepared, thus creating flanking regions for homologous recombination of 652 bp and 704 bp on either side of the fragment. After electroporation in bacteria EL350 / BacMid2, bacteria were selected on Zeocin. As shown in Figure 14, the bacterial expression cassette Zeocin was inserted into the 5927 bp recombinant fragment. R was eliminated by digestion with Bsu36I, repair, and then ligation.
[0176] BacMid2 / Fur was thus obtained. The genomes of these new BacMids were controlled by Southern (FIG. 15) and then by sequencing the integrated gene fur.
[0177] Example 10: Construction of BacMid2-Gal to enable the generation of recombinant baculoviruses expressing galactosylated proteins BacMid2-Gal was constructed from BacMid2 obtained in Example 2. DNA encoding two glycosyltransferases that are lost in lepidopteran cells and are required for the biosynthesis of galactosylated glycans, human N-acetylglucosaminyltransferase II (GNT-II) (EC 2.4.1.143, accession number NM_002408.3) and bovine β1,4 galactosyltransferase (β1,4GalT) (EC 2.4.1.38, accession number NM_177512.2), was introduced into a nonessential gene or region of BacMid2 by homologous recombination. To ensure that the enzymatic activities of β1,4GalT and GNT-II were expressed prior to the synthesis of the transgene of interest encoding the polypeptide of interest, the transgenes encoding GNT-II and β1,4GalT were cloned downstream of an early viral promoter, such as those listed in Table 2.
[0178] Figure 14 illustrates generally the various steps required for the construction of bacmid BacMid2 / MPT, which contains one or more transgenes, each encoding a protein maturation enzyme. In particular, in Figure 14, the transgene encoding the protein maturation enzyme is the gene encoding GNTII (gene GNTII).
[0179] The addition of transgenes encoding GNT-II and β1,4GalT, respectively, was carried out in replicates in BacMid2.
[0180] - Insertion of the transgene GNT-II The transgene was introduced into the viral genome at position 29226 by homologous recombination between orf35 (v-ubi) and orf36 (39k), referred to as the intergenic region IG35 / 36. To be able to insert the expression cassette into the genome of BacMid, unique cloning sites XbaI (italicized) and Bsu36I (underlined) were incorporated into the region IG35 / 36 by PCR using the following primers: Antisense ig35 / 36 5'-CCTGGTAATTTTTGACCACGG-3' (position 28806 in the viral genome) (SEQ ID NO: 7) and [ka] Next [ka] and Sense ig35 / 36 5'-CGCAGCAATTCCAGCGAGC-3' (position 29657 in the viral genome) (SEQ ID NO: 4)
[0181] The resulting PCR fragment of 861 bp was cloned into the plasmid pGEM® Teasy and controlled by sequencing, resulting in the plasmid pGEM-IG35 / 36.
[0182] The two expression cassettes were introduced into the above-mentioned plasmid pGEM-IG35 / 36.
[0183] A viral expression cassette constructed as follows (densovirus-JcNDV promoter P9-GNTII-encoding transgene-stop TkpA) was inserted at the level of the XbaI site to obtain the plasmid pGEM-IG35 / 36-GNTII. The promoter P9 of the densovirus JcNDV is described in Shirk PD, Bossin H, Furlong RB, Gillett JL. Regulation of Junonia coenia densovirus P9 promoter expression. Insect Mol Biol. 2007 Oct;16(5):623-33. Epub 2007 Aug 22.
[0184] The bacterial expression cassette “Zeocin resistance” (Zeo R ) (obtained from the commercially available plasmid pCR® Blunt, InVitrogen): [bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned at the level of the Bsu36I site. This second cassette was inserted into Zeo R The plasmid pGEM-IG35 / 36-GNTII-Zeo allows expression of the gene and thus confers zeocin resistance to bacteria carrying it. RThe bacterial promoter T5N25 is described in Gentz R, Bujard H. Promoters recognized by Escherichia coli RNA polymerase selected by function: highly efficient promoters from bacteriophage T5. J Bacteriol. 1985 Oct;164(1):70-7. The transcription terminator rrnBT1 is described in Kwon YS, Kang C. Bipartite modular structure of intrinsic, RNA hairpin-independent termination signal for phage RNA polymerases. J Biol Chem. 1999 Oct 8;274(41):29149-55.
[0185] The plasmid pGEM-IG35 / 36-GNTII-Zeo prepared above in bacteria EL350 / BacMid2 R A 3493 bp recombinant fragment was obtained after digestion with EcoRI, with flanking regions for homologous recombination of 420 bp and 428 bp on either side of the recombinant fragment. <IG35 / 36-GNTII-Zeo R > was electrophoresed. BacMid2 / GNTII-Zeo R Containing bacteria (Escherichia coli EL350 / BacMid2 / GNTII-Zeo R ) was selected for its kanamycin, hygromycin, and zeocin resistance. R DNA of the three clones was extracted and then cloned into GNT-II and Zeo R The gene was controlled by PCR followed by sequencing.
[0186] The bacterial expression cassette flanking either side of the Bsu36I site was then eliminated by simple digestion with Bsu36I, repairing the DNA ends with Klenow DNA polymerase, and then ligating the plasmid back onto itself. It should be noted that the "repaired" sequence Bsu36I [5'CCTNATNAGG3'] was preserved in the Bacmid2 / GNTII gene thus generated after ligation of the plasmid. This sequence may therefore be present in the recombinant baculovirus and constitute a specific signature.
[0187] The transgene encoding GNTII was cloned in the same orientation as gene 39K.
[0188] BacMid2 / GNTII was thus obtained, then manipulated as described above, and subsequently used for the insertion of the gene encoding β1,4GalT.
[0189] Insertion of the gene β1,4GalT A transgene encoding β1,4GalT was integrated into the locus of the non-essential gene egt (ecdysteroid glycosyltransferase, ORF15, genomic positions 11426-12946 in the viral genome of AcMNPV) of BacMid2 / GNTII according to the general principles described above. A 5110-bp PstI-BamHI fragment containing the gene egt (positions 9999-15110 in the viral genome of AcMNPV) was previously cloned into the pUC plasmid to obtain the plasmid pUC-EGT. A viral expression cassette containing DNA encoding bovine β1,4GalT under the control of the OpMNPV promoter gp67 was then inserted into the gene egt by insertion at the unique XbaI site (position 12782 in the baculovirus genome) present in the sequence encoding the gene egt (insertion-mediated gene inactivation), resulting in the plasmid pUC-EGT-GalT. The transgene encoding β1,4GT was cloned in the same orientation as the gene egt.
[0190] The adapter NsiI-Bsu36I-NsiI was then inserted into the NsiI site located downstream of the gene β1,4GalT, thereby forming the bacterial expression cassette Zeo R The introduction of the plasmid pUC-EGT-GalT-Zeo R was produced.
[0191] The 3128 bp recombinant fragment was ligated into the above plasmid pUC-EGT-GalT-Zeo by SnaBI-NruI. R The fragment was prepared after digestion with 474 bp and 866 bp of flanking regions for homologous recombination on either side of the fragment. After electroporation in bacteria EL350 / BacMid2-GNTII, the bacteria were selected on Zeocin. As before, the bacterial expression cassette Zeocin was inserted into the bacterial expression cassette Zeocin. R was eliminated by digestion with Bsu36I, repair, and then ligation.
[0192] BacMid2 / GNTII / β1,4GalT (also called BacMid2-Gal or BacGal) was thus obtained. The genome of BacMid2-Gal was controlled by Southern analysis followed by sequencing of all integrated genes.
[0193] Example 11: Construction of BacMid2Gal-Fur, which allows the generation of recombinant baculoviruses that accurately express mature galactosylated proteins BacMid2-Gal-Fur was constructed as described for BacMid2-Fur (Example 9).
[0194] Bacteria EL350 / BacMid2-Gal were electrophoresed with the 5927 pb recombinant fragment described in Example 9 and then selected on Zeocin. As before, the bacterial expression cassette Zeocin Rwas eliminated by digestion with Bsu36I, repair, and then ligation. BacMid2Gal-Fur was thus obtained. The genome of the bacmid was controlled by Southern (Figure 15) and then by sequencing of the newly integrated gene.
[0195] Example 12: Construction of BacMid-Sia3 (or BacSia3) Transgenes encoding human CMPNeuAc synthase (CMPNeuAc synthase or CMPNeuAcS) (EC 2.7.7.43, accession number NM_018686.5), human NeuAc synthase (NeuAc synthase or NeuAcS) (EC 2.5.1.56, accession number AF257466), and human α2,3 sialyltransferase (ST3), ST3GalIV (EC 2.4.99.4, accession number X74570) were inserted in an iterative manner into BacMid2 / GNTII-β1,4GT according to the general principles described in Figure 14.
[0196] Cloning of two transgenes encoding NeuAc synthase and CMP NeuAc synthase, respectively, into the iap2 locus of BacMid2-Gal The Applicant chose these two enzymes to be cloned head-to-tail under the control of the immediate early promoter, the promoter IE1 (immediate early 1) of the Choristoreura fumiferana baculovirus for the control of expression of the gene CMP NeuAc synthase, and that of the Lymantria dispar baculovirus for the control of expression of the gene NeuAc synthase (see Table 2).
[0197] The region containing the gene iap2 (ORF71) of the baculovirus AcMNPV (positions 61016 to 61765 in the genome) was previously amplified by duplex PCR using the following primers: Sense iap2 5'-GATATTGTGTGCTCAATGTC-3' (position 60736 in the viral genome) (SEQ ID NO: 8) [ka] Next [ka] Antisense iap2 5'-CGATCACCGTCGCTGTCGTCTTC-3' (position 61951 in the viral genome) (SEQ ID NO: 11)
[0198] These sequential PCRs also allowed the incorporation of the unique sites Bsu36I (underlined above) and XbaI (double underlined above) and (ii) the deletion of most of the iap2 coding sequence, 335 bp / 112 amino acids. The 896 bp amplified fragment was cloned into the plasmid pGEM® Teasy to obtain the plasmid pGEM-IAP2.
[0199] A viral expression cassette constructed as follows [stop SV40-CMPNeuAc synthase-promoter IE1Cf-promoter IE1Ld-NeuAc synthase] was inserted at the XbaI site of pGEM-IAP2, resulting in the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS.
[0200] The bacterial expression cassette “Zeocin resistance” (Zeo R ): [bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned into pGEM-iap2-CMPNeuAcS-NeuAcS at the Bsu36I site to give the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo R This second cassette was released on Zeo R It allows expression of the gene, thus conferring zeocin resistance to bacteria carrying this plasmid.
[0201] The 4548 pb recombinant fragment [CMPNeuAc-NeuAcS-Zeo R ] was purified by restriction endonuclease NotI to the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo R This generated flanking regions for homologous recombination of 486 bp and 396 bp on either side of the fragment. Bacteria EL350 / BacMid2-GNTII-β1,4GT were electrophoresed with the recombinant fragment, BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS-Zeo R was thus generated. As before, the Zeocin resistance cassette was eliminated after digestion with Bsu36I, repair, and then religation. BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS was thus obtained.
[0202] Cloning of the transgene α2,3-sialyltransferase IV (ST3GalIV) in the intergenic region between orf51 and orf52 (IG51 / 52) of BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS This region, located in the fragment EcoRI N of the baculovirus AcMNPV, was isolated after amplification by double PCR using the following primers: sense IG51 / 52 5'-GGAAAACTCTTTCCGAAGACGAAC (position 43814 in the viral genome) (SEQ ID NO: 12) and [ka] Next [ka] and Antisense IG51 / 52 5'-GGTGCAGAACATAATGACGTGGCCTTAC (position 44723 in the viral genome) (SEQ ID NO: 15)
[0203] During these successive PCRs, there is the addition of two unique sites, Bsu36I (underlined above) and XbaI (double underlined above), in the intergenic region ORF51 / ORF52, which allows the integration of the expression cassette ST3 at site XbaI in the viral genome at position 44298. The resulting fragment of 922 bp was cloned into pGEM® T easy (Promega), resulting in the plasmid pGEM-IG51 / 52.
[0204] As with other enzymes, ST3GalIV must be present in the cell before the glycoprotein of interest is expressed. We chose the promoter IE1 of the shrimp virus WSSV (white spot syndrome virus), which was identified as an "immediate early" type functional cellular promoter, Sf9 (see Table 2) (Liu et al., Virology, 2005; Liu et al. J of virology, 2007; Gao et al. J. Biotechnology, 2007).
[0205] The viral expression cassette constructed as follows [promoter WSSV-ST3] was inserted into the XbaI site of pGEM-IG51 / 52 to obtain the plasmid pGEM-IG51 / 52-ST3: ST3GalIV was cloned in the opposite orientation to orf51.
[0206] The bacterial expression cassette “Zeocin resistance (Zeo)” was constructed as follows: R )":[bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned into pGEM-ORF51-ST3 at the Bsu36I site to give the plasmid pGEM-IG51 / 52-ST3-Zeo R This second cassette was released on Zeo R It allows expression of the gene, thus conferring zeocin resistance to bacteria carrying this plasmid.
[0207] The 2589 pb recombinant fragment [ST3GalIV-Zeo R] to pGEM-IG51 / 52-ST3-Zeo R The expression cassette was generated from BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS by digestion with the restriction endonuclease NotI. This digestion generated 498 bp and 411 bp of flanking regions for homologous recombination on either side of the expression cassette. Homologous recombination was performed in the bacterium EL350 / BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS to generate BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS-ST3 (or BacSia3). The genome of BacSia3 was controlled by Southern blot analysis followed by sequencing of all integrated genes.
[0208] Example 13: Construction of BacMid-Sia6 (or BacSia6) Cloning of the transgene α2,6-sialyltransferase I (ST6GalI) in the intergenic region orf51 / orf52 (IG51 / 52) of BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS The method for cloning the gene encoding the human α2,6 sialyltransferase, ST6GalI (EC 2.4.99.1, accession number X17247), is similar to that described in Example 12 for the transgene encoding ST3GalIV, summarized as follows: - The viral expression cassette constructed as follows [promoter WSSV-ST6] was inserted at the XbaI site of pGEM-IG51 / 52 to obtain the plasmid pGEM-IG51 / 52-ST6: ST6GalI is cloned in the opposite orientation relative to orf51. - A bacterial expression cassette "Zeocin resistance" (Zeo R ): [bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned into pGEM-ORF51-ST6 at the Bsu36I site to give the plasmid pGEM-IG51 / 52-ST6-Zeo R This second cassette was prepared using Zeo RIt allows expression of the gene, thus conferring zeocin resistance to bacteria carrying this plasmid. - 2825 pb recombinant fragment [ST6GalI-Zeo R ] to pGEM-IG51 / 52-ST6-Zeo R The expression cassette was generated from BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS by digestion with the restriction endonuclease NotI. This digestion generated 498 bp and 411 bp of flanking regions for homologous recombination on either side of the expression cassette. Homologous recombination was performed in the bacterium EL350 / BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS to generate BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS-ST6 (or BacSia6). The genome of BacSia6 was controlled by Southern blot analysis followed by sequencing of all integrated genes.
[0209] Example 14: Construction of BacMid-Sia6II (or BacSia6-II) a. Cloning of the transgene α2,6-sialyltransferase I (ST6GalI) in ORF119 (PIF1) of BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS ORF119 (positions 100699 to 102291 in the genome), which encodes PIF1, a protein not essential for viral replication, is located in the fragment EcoRI E of the baculovirus AcMNPV. Fragments on either side of the gene were obtained after amplification by duplex PCR using the following primers: Sense pif1 5'-GAATACAACGCCACATCTATTCCTAGTACAAC-3' (position 100247 in the viral genome) (SEQ ID NO: 18) and [ka] Next [ka] and RevPif1 5'-CATTAACAATTACTACGGCGCATTTTGACCATC-3' (position 102825 in the viral genome) (SEQ ID NO: 21)
[0210] These successive PCRs made it possible to eliminate the entire ORF119 and to incorporate the unique sites Bsu36I (underlined above) and XbaI (double underlined above). The XbaI site allowed the integration of the expression cassette ST6 at position 100697 in the viral genome. The resulting fragment of 998 bp was cloned in pGEM® Teasy (Promega) to obtain the plasmid pGEM-PIF1.
[0211] The viral expression cassette [promoter WSSV-ST6] described in Example 12 was inserted at the XbaI site of pGEM-PIF1 to obtain the plasmid pGEM-PIF1-ST6. ST6GalI was cloned in the pif1 direction.
[0212] The bacterial expression cassette “Zeocin resistance (Zeo)” was constructed as follows: R )":[bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned into the Bsu36I site of pGEM-PIF1-ST6 to give the plasmid pGEM-PIF1-ST6-Zeo R This second cassette was released on Zeo R It allows expression of the gene, thus conferring zeocin resistance to bacteria carrying this plasmid.
[0213] The 2903 pb recombinant fragment [ST6GalI-Zeo R ] to pGEM-PIF1-ST6-Zeo RThe expression cassette was generated from BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS by digestion with the restriction endonuclease NotI. This digestion generated 498 bp and 411 bp of flanking regions for homologous recombination on either side of the expression cassette. Homologous recombination was performed in bacteria EL350 / BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS to generate BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS-ST6-II (or BacSia6-II). The genome of BacSia6-II was controlled by Southern analysis (Figure 19B) and subsequent sequencing of all integrated genes.
[0214] Example 15: Construction of BacMid-Sia3 / 6 or BacSia3 / 6 Head-to-tail cloning of transgenes ST6GalI and ST3GalIV in the intergenic region orf51 / orf52 (IG51 / 52) in BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS The cloning strategy is similar to that described in Examples 12 and 13 for the transgenes encoding ST3GalIV and ST6GalI, summarized as follows: - A viral expression cassette containing a transgene encoding ST6GalI and a transgene encoding ST3GalIV, constructed as follows: [ST6-promoter WSSV-actin promoter 3 B. mori-ST3-stop actin 3], was inserted at the XbaI site of pGEM-IG51 / 52 to obtain the plasmid pGEM-IG51 / 52-ST3 / ST6. - A bacterial expression cassette "Zeocin resistance" (Zeo R ): [bacterial promoter T5N25-Zeo R -terminator rrnBT1] was cloned into pGEM-IG51 / 52-ST3 / ST6 at the Bsu36I site to form the plasmid pGEM-IG51 / 52-ST3 / ST6-Zeo R This second cassette was released on Zeo RIt allows expression of the gene, thus conferring zeocin resistance to bacteria carrying this plasmid.
[0215] The 5008 pb recombinant fragment [ST3 / ST6-Zeo R ] to pGEM-IG51 / 52-ST3 / ST6-Zeo R The expression cassette was generated from BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS by digestion with the restriction endonuclease NotI. This digestion generated 490 bp and 426 bp of flanking regions for homologous recombination on either side of the expression cassette. Homologous recombination was performed in the bacterium EL350 / BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS to obtain BacMid2-GNTII-β1,4GT-CMPNeuAcS-NeuAcS-ST3 / ST6 (or BacSia3 / 6). The genome of BacSia3 / 6 was controlled by Southern blot analysis followed by sequencing of all integrated genes.
[0216] Example 16: Use of BacMid2-Fur for the production of mature HIV-1 glycoprotein gp160 HIV1 gp160 must undergo a maturation process in order for the virus to be infectious and for the viral surface glycoproteins to assemble into trimers. These structures are now believed to be essential for the formation of epitopes of interest, which are necessary for the elaboration of vaccines against HIV-1. This maturation is carried out by cellular furin, which attempts to cleave gp160 into gp120 + gp41. The production of recombinant gp160 generally leads to a partially mature form, whatever the expression system.
[0217] To obtain fully mature gp160, we integrated the gene encoding Sf9 furin into the viral genome under the control of a highly active promoter, promoter P10-like, termed P10S1, to construct BacMid2-Fur (Example 9).
[0218] From this bacmid, we constructed a double recombinant virus expressing two HIV1 proteins, the polyprotein Pr55Gag and gp160. The production of these two proteins leads to the secretion of virus-like particles (VLPs) into the culture medium. In this experiment, we concentrated the secreted VLPs (marked C for concentrated VLPs and NC for unconcentrated VLPs) using a solution of "Retro Concentin™ Virus Precipitation" (SBI, reference RV100A-1). Various samples obtained after infection with wild-type virus BACWT or with a single recombinant virus, such as a multiple recombinant virus expressing gp160 and Pr55Gag (BAC / gp160 / Gag), a multiple recombinant virus expressing gp160, Pr55Gag, and furin (BAC / gp160 / Gag), or a virus expressing only soluble gp120 (BAC gp120) and only the polyprotein Pr55Gag (BACGag) were analyzed by Western blot using antibodies anti-gp120, panel A (goat polyclonal antibody against HIV-1 gp120, ref. Ab21179, Abcam) or anti-Gag, panel B (anti-p55+p24+p17, ref. Ab63917, Abcam).
[0219] As shown in Figure 15C, cellular furin activity is not sufficient to mature the entire gp160 produced (well BACgp160 / Gag), whereas when there is overexpression of this enzyme, there is complete maturation of gp160 to gp120 (well BACgp160 / Gag / fur).
[0220] Example 17: Use of BacMid2-Gal for the production of galactosylated antibodies Terminal N-galactosylation is characteristic of the glycosylation of Asn297, located in the constant domain of IgG (FIGS. 12 and 13), and the examples described below relate to the production of recombinant antibodies.
[0221] For single-step generation of double recombinant baculovirus (Figures 16 and 17), BacMid2-Gal was used, as previously described for BacMid2 (Examples 4 and 6). As with BacMid2, co-transfection with BacMid2-Gal led to extremely high yields of recombinant virus, approaching 100% (Figure 9A).
[0222] Insertion of transgenes encoding antibody heavy and light chains 1. Principle of recombinant baculovirus production DNAc encoding the variable regions VH and VL of the antibody of interest was inserted into specific baculovirus transfer vectors (pVT) for the heavy and light chains of the antibody: pVT / gp37-H (for cloning the variable region of the heavy chain) (Figure 6) and pVT / PH-L (for cloning the variable region of the light chain) (Figure 7). These vectors are described in the paper (Juliant et al., 2013). Sf9 cells were then transfected with the two loaded pVT and BacMid2-Gal DNAs. A double recombinant virus co-expressing the heavy and light chains of the antibody was then produced in a single step (Figure 17).
[0223] 2. Construction of Recombinant Viruses Expressing Galactosylated Antibodies Recombinant viruses expressing the same antibody were produced from BacMid2 and BacMid2-Gal. Antibodies produced after infection of Sf9 cells with recombinant viruses derived from BacMid2 served as controls because they possess "insect" glycosylation, i.e., paucimannoside type, and a lower proportion of oligomannoside type glycan motifs (Fig. 12).
[0224] Cloning in transfer vectors DNA fragments encoding the heavy and light chain variable regions of the antibody of interest were cloned into the respective transfer vectors (pVT / gp37-H and pVT / PH-L), resulting in the reconstitution of the complete genes encoding the two antibody chains (Figures 6 and 7). ·Recombinant baculovirus generation and cloning Sf9 cells were transfected by lipofection with the loaded pVT / gp37-H and pVT / PH-L and Bacmid2-Gal or BacMid2 DNA (Figure 17). Seven days after infection at 28°C, secreted baculoviruses in the culture supernatant were cloned by phage plaque assay technique. Control of genome organization of recombinant viruses Several baculovirus clones were selected and amplified, and their genomes were extracted and analyzed by Southern blot. The genes encoding the heavy and light chains inserted into the baculovirus genome were also amplified by PCR and then sequenced. Recombinant antibody production and purification Sf9 cells adapted for growth in serum-free medium were infected at a level of 3 PFU / cell. Three days after infection, culture supernatants were collected and loaded onto a Protein A Sepharose column (GE-Healthcare). The amount of antibody was confirmed after electrophoresis on a polyacrylamide gel and silver staining. Glycosylation analysis by lectin blotting Principle of lectin blotting: Lectins are molecules that specifically attach themselves to glycan motifs. Therefore, electrophoresis in a polyacrylamide gel, transfer onto a nitrocellulose membrane, and transfer of biotin-conjugated lectins (e.g., biotinylated lectin RCA) to the membrane are performed. 120After incubation with lectins (e.g., lectins from the "DIG Glycan Differentiation Kit", reference B1085, Vector Laboratories) or with digoxigenin (e.g., lectins from the "DIG Glycan Differentiation Kit", reference 11210238001, Roche), it is extremely easy to demonstrate the presence of specific glycans bound to proteins. The presence of lectins is then indirectly detected thanks to antibodies against biotin or digoxigenin itself, conjugated with peroxidase or alkaline phosphatase. The presence of these enzymes is then detected thanks to their enzymatic activity, which produces either a brown precipitate for peroxidase or a blue coloration for alkaline phosphatase. ·experiment Antibody production was monitored by Western blotting. Proteins were separated by electrophoresis on a 10% polyacrylamide gel in the presence of SDS and 2-mercaptoethanol and then transferred to a nitrocellulose membrane (Protran™ 0.45 μm NC, GE Healthcare). Protein transfer was confirmed after Ponceau Red staining. The membrane was incubated with (Figure 18A) a sheep polyclonal antibody against human IgG and conjugated peroxidase (Reference NA933V, GE Healthcare) or (Figure 18B) a sheep polyclonal antibody against mouse IgG and conjugated peroxidase (Reference NA931V, GE Healthcare). Peroxidase was revealed by chemiluminescence using the SuperSignal® West Pico Chemiluminescent Substrate System (Reference: 34077, Thermo Scientific).
[0225] Analysis by lectin blot (Figure 18C). In this example, we used the biotinylated lectin RCA, which attaches itself specifically on beta-galactosyl residues. 120(Ricinus communis agglutinin) was used. Proteins were separated by electrophoresis on polyacrylamide gels as described above and transferred to Protran™ 0.45 μm NC membranes (GE Healthcare) for Western blotting. Biotinylated RCA was then used. 120 The lectin was indirectly revealed after incubation of the membrane with a peroxidase-conjugated anti-biotin antibody (goat antibody, reference A4541, Sigma). Color development was carried out in the presence of a chemiluminescent substrate (SuperSignal® West Pico Chemiluminescent Substrate, Thermo Scientific).
[0226] 3.Results Human (Figure 18A) and mouse (Figure 18B) recombinant antibodies were produced, purified with Protein A Sepharose (GE Healthcare), and then analyzed by Western blot (Figures 18A and B) and by lectin blot (Figure 18C). Figures 18A and B indeed confirm the presence of human and mouse recombinant antibodies, wells 2 and 3; wells 4 and 5. Figure 18C shows that only antibodies—human or mouse—produced by cells infected with recombinant baculovirus made from BacMid2-Gal were detected by RCA. 120 (wells 3 and 5). Antibodies produced upon infection with recombinant viruses derived from BacMid2 are not recognized by the lectin, wells 2 and 4.
[0227] These experiments clearly demonstrate that BacGal viruses are capable of complementing Sf9 cells to produce galactosylated glycoproteins.
[0228] Example 18: Use of BacMid-Sia3 1. Construction of Recombinant Baculovirus Expressing Its Alpha 2,3 Sialylated Glycoprotein Envelope gp64 The activity of BacSia3 was monitored using the viral surface glycoprotein, gp64, as a model protein. Glycoprotein gp64 is the major glycoprotein of baculoviruses and is involved in all first steps of infection. It is located on the viral surface. This glycoprotein has been shown to be capable of being galactosylated and sialylated (Jarvis et al., 1995). To do so, recombinant viruses were obtained by homologous recombination between BacMidSia3 and the empty transfer vectors pVTPH and pVT / gp37. The presence of the α2,3 sialyl motif was demonstrated by lectin blot analysis performed with the lectin di-CBM40 described in the literature (Ribeiro et al., 2016).
[0229] ·Recombinant baculovirus generation and cloning Sf9 cells were transfected by lipofection using empty pVTPH and pVT / gp37 and Bacmid2 (control) or BacMid-Sia3 DNA obtained in Example 12 according to the principle of Figure 19A. Seven days after infection at 28°C, the secreted viruses in the culture supernatant were cloned by phage plaque assay technique. Four virus clones were selected and amplified, and their genomes were extracted and analyzed by Southern blot. The genes inserted into the virus genome were amplified by PCR and then sequenced.
[0230] Glycosylation analysis by lectin blotting The lectin used in this example was biotinylated di-CBM40. The protocol used was the same as that described in Example 17. After saturation, the membrane was incubated with diCBM40-biotinylated lectin diluted 1 / 200 in TBS-T (5.7 μg / ml) or with SNA-Dig lectin (Roche, kit DIG Glycan Differentiation Kit) diluted 1 / 1000 in TBS-T. Membrane development was performed as described in Example 17. The presence of gp64 was monitored by Western blot in the presence of an anti-gp64 antibody (monoclonal mouse antibody AcV5 reference SC65499, Santa Cruz Biotechnology).
[0231] 2.Results As shown in Figure 20A, gp64 is detected in all samples studied. In panel B, the SNA lectin, which highly specifically recognizes α2,6-linked sialic acid that is uniquely bound to gp64 when produced using viruses co-expressing ST6 (see Example 19), does not bind to gp64 produced upon infection with viruses co-expressing ST3.
[0232] On the other hand, Figure 20C shows that lectin di-CBM40 indeed recognizes gp64 produced upon infection with ST3-producing virus. There is no marking of mannosylated gp64 produced when cells are infected with wild-type virus. However, weaker, but distinct, marking of gp64 bearing α2,6-linked sialic acid is noted.
[0233] These experiments clearly demonstrate that the virus BACSia3 is able to complement Sf9 cells to produce α2,3 sialylated glycoproteins.
[0234] Example 19: Use of BacMid-Sia6 1. Construction of Recombinant Baculovirus Expressing Recombinant Alpha 2,6-sialylated Protein The activity of BacSia6 was controlled using glycoprotein G of vesicular stomatitis virus, VSVg, protein X and baculovirus glycoprotein gp64 as model proteins.
[0235] ·Recombinant baculovirus generation and cloning DNA fragments encoding proteins of interest were cloned into pVTPH according to the general principles described in Figure 19A. Sf9 cells were transfected by lipofection with the loaded pVTPH, modified pVT / gp37, and Bacmid2 (control) or BacMid-Sia6 DNA obtained in Example 13. Seven days after infection at 28°C, the secreted viruses in the culture supernatant were cloned by phage plaque assay technique. Four virus clones were selected and amplified, and their genomes were extracted and analyzed by Southern blot. The genes inserted into the viral genome were amplified by PCR and then sequenced.
[0236] Recombinant protein production The protein was produced as described in Example 18.
[0237] Glycosylation analysis by lectin blotting The presence of recombinant proteins was controlled by Western blotting. After protein transfer, the nitrocellulose membranes were incubated in the presence of various specific antibodies: anti-VSVg (mouse monoclonal antibody peroxidase-conjugated, reference A5977, Sigma), anti-gp64 (mouse monoclonal antibody AcV5, reference SC65499, Santa Cruz Biotechnology). Color development was performed directly, as described in Example 16, when the antibody was directly conjugated with peroxidase, or after incubation with a secondary antibody peroxidase-conjugated (rabbit anti-mouse IgG serum peroxidase-conjugated, reference A9044). Peroxidase was revealed by chemiluminescence using the ECL SuperSignal® West Pico Chemiluminescent System (reference 34077, Thermo Scientific).
[0238] The lectin used in this example was SNA (Sambuscus nigra agglutinin), which recognizes α2,6-linked sialic acid. SNA was characterized as described in Example 17.
[0239] 2.Results a. Glycosylation of protein X expressed by recombinant baculovirus generated from BacSia6 As shown by Western blot (FIG. 21A), when protein X was produced using a recombinant virus derived from BacMid2, its size was clearly smaller than that of the commercially available protein produced by mammalian cells, here CHO cells (comparison wells 1 and 3). Conversely, when produced using a recombinant baculovirus derived from BacSia6, protein X had a size comparable to that produced in CHO cells (comparison wells 2 and 3).
[0240] Analysis by lectin blot (Figure 21B) confirmed the presence of α2,6-linked sialic acid in this protein when produced using a recombinant baculovirus derived from BacSia6 (well 2). Protein X was indeed recognized by SNA (revelation protocol described in Example 17), thus explaining the increased molecular weight of protein X. This experiment also demonstrated the absence of such a motif in the commercially available protein produced in CHO cells (well 3); indeed, CHO lines uniquely express α2,3 sialyltransferase. Thus, as shown in Figure 21C, protein X expressed in CHO (well 3) was recognized by MAA (revelation protocol described in Example 17), which is specific for α2,3-linked sialic acid, which is not the case for the protein expressed using a recombinant baculovirus derived from tBacSia6 (well 2).
[0241] b. Glycosylation of VSVg expressed by recombinant baculovirus generated from BacSia6 VSVg is a membrane protein, and we analyzed pellets of infected cells. As shown in Figure 22A (wells 2 and 3), the protein VSVg was produced after infection of Sf9 cells with two recombinant viruses, one derived from BacMid2 and the other from BacSia6.
[0242] Conversely, analysis by lectin blot using SNA (development protocol described in Example 17) showed a strong marking of the VSVg protein uniquely when expressed from BacSia6-derived baculovirus (Fig. 22B, well 2). With the VSVg protein produced after infection with BacMid2-derived baculovirus, only nonspecific marking (Fig. 22B, well 3) was noted. The "positive control" protein, fetuin, provided by the Dig Glycan Differentiation Kit, was marked very well by SNA (Fig. 22B, well 1).
[0243] c. Glycosylation of gp64 from recombinant baculovirus produced from BacSia6 We also confirmed that recombinant viruses expressing sialylated VSVg (see above) also possess sialylated gp64. To do so, baculovirus secreted into the culture supernatant was sedimented (35,000 rpm for 60 minutes in a Beckman Optima LE-80K centrifuge, TI-70-1 rotor), then harvested with lysis buffer and analyzed by Western blot followed by lectin blot. As before, fetuin was used as a positive marker for SNA (Figures 22C and 22D, well 1).
[0244] Figure 22C clearly shows the presence of gp64 in wells 2 and 3. Similar to what we observed with VSVg, the gp64 produced after infection with BacSia6-derived virus (well 2) was the only one recognized by SNA (revelation protocol described in Example 17) (Figure 22D), thus confirming that gp64 is α2,6-sialylated. Note also the presence of nonspecific marking in wells 2 and 3 (identical marking in both wells).
[0245] These experiments clearly demonstrate that the BacSia6 virus is able to complement Sf9 cells to produce α2,6 sialylated glycoproteins.
[0246] Example 20: BacMid Sia6-II virus We analyzed the genome of BacMidSia6II by Southern blot to control its genome organization.
[0247] As shown in Figure 19B, the restriction and hybridization profiles are in accordance with the expected results: the gene for ST6 is therefore fully integrated into the pif1 locus.
[0248] Example 21: Use of BacMid Sia3 / 6 1. Construction of Recombinant Baculovirus Expressing Recombinant Alpha2,3 and Alpha2,6 Sialylated Proteins The activity of BacSia3-6 was controlled using the viral surface glycoprotein, gp64, as a model protein. To do so, recombinant viruses were obtained by homologous recombination between BacMidSia3 / 6 and the empty transfer vectors pVTPH and pVT / gp37. The presence of α2,3 sialyl- and α2,6 sialyl-motifs was analyzed by lectin blot analysis performed in the presence of the lectins di-CBM40, which recognizes α2,3 sialic acid and, to a lesser extent, α2,6-linked sialic acid, and SNA, which recognizes only α2,6-linked sialic acid but not α2,3-linked sialic acid.
[0249] ·Recombinant baculovirus generation and cloning Sf9 cells were transfected by lipofection with empty pVTPH and pVT / gp37 and Bacmid2 (control) or BacMid-Sia3 / 6 DNA obtained in Example 15. Seven days after infection at 28°C, the secreted viruses in the culture supernatant were cloned by phage plaque assay technique. Four virus clones were selected and amplified, and their genomes were extracted and analyzed by Southern blot. The genes inserted into the viral genome were amplified by PCR and then sequenced.
[0250] Recombinant protein production The protein was prepared as described in Example 17.
[0251] Glycosylation analysis by lectin blotting The analytical protocol was the same as that described in Examples 20, 21 and 22.
[0252] 2.Results The gp64 produced by the GalSia3-6 virus was the only one recognized by both SNA (Fig. 20B) and di-CBM40 (Fig. 20C), clearly demonstrating that two types of sialic acid are attached to gp64.
[0253] These experiments clearly demonstrate that the BacSia3-6 virus is able to complement Sf9 cells to produce α2,3 and α2,6 sialylated glycoproteins.
[0254] References Patent documents WO01 / 12829 WO2013 / 005194 Citations and References Palmberger D, Wilson IB, Berger I, Grabherr R, Rendic D. SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells. PLoS One. 2012;7(4):e34226. Chang GD, Chen CJ, Lin CY, Chen HC, Chen H. Improvement of glycosylation in insect cells with mammalian glycosyltransferases. J Biotechnol. 2003 Apr 10;102(1):61-71. Possee RD, Hitchman RB, Richards KS, Mann SG, Siaterli E, Nixon CP, Irving H, Assenberg R, Alderton D, Owens RJ, King LA. Generation of baculovirus vectors for the high-throughput production of proteins in insect cells. Biotechnol Bioeng. 2008 Dec 15;101(6):1115-22. Tan J, D'Agostaro AF, Bendiak B, Reck F, Sarkar M, Squire JA, Leong P, Schachter H. The human UDP-N-acetylglucosamine: alpha-6-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase II gene (MGAT2). Cloning of genomic DNA, localization to chromosome 14q21, expression in insect cells and purification of the recombinant protein. Eur J Biochem. 1995 Jul 15;231(2):317-28. D'Agostaro G, Bendiak B, Tropak M. Cloning of cDNA encoding the membrane-bound form of bovine beta 1,4-galactosyltransferase. Eur J Biochem. 1989 Jul 15;183(1):211-7. Munster AK, Eckhardt M, Potvin B, Muhlenhoff M, Stanley P, Gerardy-Schahn R. Mammalian cytidine 5'-monophosphate N-acetylneuraminic acid synthetase: a nuclear protein with evolutionarily conserved structural motifs. Proc Natl Acad Sci U S A. 1998 Aug 4;95(16):9140-5. Lawrence SM, Huddleston KA, Pitts LR, Nguyen N, Lee YC, Vann WF, Coleman TA, Betenbaugh MJ. Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero- D-galacto-nononic acid biosynthetic ability. J Biol Chem. 2000 Jun 9;275(23):17869-77. Kitagawa H, Paulson JC. Cloning of a novel alpha 2,3-sialyltransferase that sialylates glycoprotein and glycolipid carbohydrate groups. J Biol Chem. 1994 Jan 14;269(2):1394-401. Grundmann U, Nerlich C, Rein T, Zettlmeissl G. Complete cDNA sequence encoding human beta-galactoside alpha-2,6-sialyltransferase. Nucleic Acids Res. 1990 Feb 11;18(3):667. Cieplik M, Klenk HD, Garten W. Identification and characterization of spodoptera frugiperda furin: a thermostable subtilisin-like endopeptidase. Biol Chem. 1998 Dec;379(12):1433-40. Juliant S, Leveque M, Cerutti P, Ozil A, Choblet S, Violet ML, Slomianny MC, Harduin-Lepers A, Cerutti M. Engineering the baculovirus genome to produce galactosylated antibodies in lepidopteran cells. Methods Mol Biol. 2013;988:59-77. Jarvis DL, Finn EE. Biochemical analysis of the N-glycosylation pathway in baculovirus-infected lepidopteran insect cells. Virology. 1995 Oct 1;212(2):500-11. Ribeiro JP, Pau W, Pifferi C, Renaudet O, Varrot A, Mahal LK, Imberty A. Characterization of a high-affinity sialic acid-specific CBM40 from Clostridium perfringens and engineering of a divalent form. Biochem J. 2016 Jul 15;473(14):2109-18
Claims
1. 1. A method for producing a recombinant baculovirus, wherein the genome of said recombinant baculovirus comprises one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, said method comprising: a) a1) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, the genome comprising one or more transgenes each encoding a protein maturation enzyme; a2) i) a nucleotide sequence that allows restoring the function of one of the n non-functional genes essential for viral replication, and ii) one of the n transgenes encoding a polypeptide of interest n transfer vectors each containing preparing in an insect cell by homologous recombination with a replicable recombinant baculovirus genome comprising one or more transgenes each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, the set of nucleotide sequences i) of the n transfer vectors is capable of restoring replication of a replication-deficient baculovirus genome; n is an integer equal to or greater than 2; b) producing a recombinant baculovirus in insect cells containing the recombinant baculovirus genome obtained in step a); Including, the recombination is carried out in a single step in said insect cell; the protein maturation enzyme is selected depending on the type of maturation the polypeptide of interest is to undergo, the n non-functional genes essential for viral replication are each flanked by genes that are not essential for viral replication; and A method wherein the n transgenes encoding said polypeptides of interest are each recombined at a locus of a gene that is not essential for viral replication adjacent to a non-functional gene that is essential for viral replication.
2. a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional, - one or more nucleotide sequences each comprising one or more transgenes each encoding a protein maturation enzyme 2. The method of claim 1, wherein the replication-deficient baculovirus genome of step a1) is prepared in a bacterial cell by homologous recombination with
3. The genes essential for viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), and DNA 3. The method of claim 1, wherein the gene is selected from the group consisting of Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6).
4. Genes that are not essential for viral replication include Ph (ORF8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, and ORF72.
4. The method of claim 1, wherein the gene is selected from ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.
5. The method of any one of claims 1 to 4, wherein the protein maturation enzyme is selected from signal peptidases, furin, proprotein convertases, glycosyltransferases, glycosidases, chaperone proteins, isomerase disulfides, acyltransferases, methyltransferases, hydroxylases, transglutaminases, farnesyltransferases, geranylgeranyltransferases, N-myristoyltransferases, palmityltransferases, proteins, phosphatases, transpeptidases, carboxylases, and ubiquitin ligases.
6. 6. The method of any one of claims 2 to 5, wherein the transgenes encoding protein maturation enzymes are each recombined at a locus of a gene that is not essential for viral replication.
7. The method of claim 6, wherein each of the introduced genes encoding protein maturation enzymes is recombined at a locus of a gene that is not essential for viral replication and is not adjacent to a non-functional gene that is essential for viral replication.
8. Genes that are not essential for viral replication include ptp (ORF1), ctx (ORF3), ORF4, ORF7, odv-e26 (ORF16), ORF17, ORF18, ORF19, and ARIF-1. ORF20-21, pif2 (ORF22), protein F (ORF23), iap1 (ORF27), lef6 (ORF28), ORF29, ORF30, sod (ORF31), fgf (ORF32), gta (ORF42), ORF43, ORF44, ORF45, odv-e66 (ORF46), ORF47, ORF56, ORF57, chaB-like (ORF58 / 59), chaB-like (ORF60), mtase (ORF69), hcf-1 (ORF70), iap2 (ORF71), ORF86, ORF87, ORF111, O 8. The method of claim 6 or 7, wherein the gene is selected from ORF114, pif3 (ORF115), ORF116, ORF117, pif (ORF119), ORF120, ORF121, ORF122, pk2 (ORF123), ORF124, lef7 (ORF125), chitinase (ORF126), gp16 (ORF130), p35 (ORF135), p26 (ORF136), p10 (ORF137), p74 (ORF138), ORF149, ORF150, ie2 (ORF151), pe38 (ORF153) and ORF154.
9. The method according to any one of claims 1 to 8, wherein the insect cells are selected from Sf9, Sf21, Tn5-b14, a lepidopteran cell line sensitive to the baculovirus AcMNPV, strain Sf21.
10. 10. The method of any one of claims 2 to 9, wherein the bacterial cell is an Escherichia coli selected from DH10B and EL350.
11. 11. The method of any one of claims 1 to 10, wherein the replication-deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from the genomes of BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or TeNPV.
12. 12. The method of any one of claims 1 to 11, wherein n is in the range of 2 to 31.
13. 13. The method of any one of claims 1 to 12, wherein the protein maturation enzyme is one or more glycosyltransferases that allow the n polypeptides of interest to obtain the desired glycosylation.
14. 14. The method of claim 13, wherein the glycosyltransferase is selected from N-acetylglucosaminyltransferase II, beta-1,4-galactosyltransferase, and sialyltransferase.
15. A recombinant baculovirus or a recombinant baculovirus genome obtainable by the method according to any one of claims 1 to 14, a) one or more transgenes, each encoding a protein maturation enzyme; b) Formula (I): [transgene encoding a polypeptide of interest] - [spacer nucleotide sequence] - [gene essential for functional viral replication] (I) a sequence of n nucleotides of the spacer nucleic acid sequence is composed of 0 to 600 pb, The genes essential for functional viral replication are 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA selected from Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64 / 67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), lef-2 (ORF6); a sequence of n nucleotides, where n is an integer equal to or greater than 2; A recombinant baculovirus or a recombinant baculovirus genome comprising:
16. Ph (ORF8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pc na (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, The recombinant baculovirus or recombinant baculovirus genome of claim 15, which does not contain n genes that are not essential for viral replication selected from pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.
17. a) a replication-deficient baculovirus genome in which n genes essential for viral replication are non-functional and which comprises one or more transgenes each encoding a protein maturation enzyme; b) i) a nucleic acid sequence that allows restoring the function of one of the n non-functional genes essential for viral replication; ii) a transgene encoding a polypeptide of interest; and and n transfer vectors each containing n is an integer of 2 or more, and A set of homologous recombination elements, wherein the n non-functional genes essential for viral replication are each flanked by genes that are not essential for viral replication.
18. A cell comprising a recombinant baculovirus or a recombinant baculovirus genome according to claim 15 or 16, or a set of homologous recombination elements according to claim 17.
19. Use of a recombinant baculovirus or a recombinant baculovirus genome according to claim 15 or 16 or a cell according to claim 18 for the production of n polypeptides of interest.
Citation Information
Patent Citations
Replication deficient baculovirus expression system
WO2001012829A2