Chimeric antigen receptor specific for G protein-coupled receptor class C group 5 member D (GPRC5D)

Abstract

Chimeric antigen receptors (CARs) comprising an antibody portion specific for G protein-coupled receptor class C group 5 member D (GPRC5D), and polynucleotides encoding CARs specific for GPRC5D, are provided. The present disclosure further relates to genetically engineered cells comprising such receptors that bind to GPRC5D, and their use in adoptive cell therapy. TIFF2022506598000101.tif159128

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Patent Application No. 62 / 754,576, filed November 1, 2018, entitled "CHIMERIC ANTIGEN RECEPTORS SPECIFIC FOR G PROTEIN-COUPLED RECEPTOR CLASS C GROUP 5 MEMBER D (GPRC5D)"; U.S. Provisional Patent Application No. 62 / 774,159, filed November 30, 2018, entitled "CHIMERIC ANTIGEN RECEPTORS SPECIFIC FOR G PROTEIN-COUPLED RECEPTOR CLASS C GROUP 5 MEMBER D (GPRC5D)"; This application claims priority to U.S. Provisional Patent Application No. 62 / 819,422, filed March 15, 2019, entitled "CHIMERIC ANTIGEN RECEPTORS SPECIFIC FOR G PROTEIN-COUPLED RECEPTOR CLASS C GROUP 5 MEMBER D (GPRC5D)"; U.S. Provisional Patent Application No. 62 / 904,197, filed September 23, 2019, entitled "CHIMERIC ANTIGEN RECEPTORS SPECIFIC FOR G PROTEIN-COUPLED RECEPTOR CLASS C GROUP 5 MEMBER D (GPRC5D)"; and U.S. Provisional Patent Application No. 62 / 904,187, filed September 23, 2019, entitled "BICISTRONIC POLYNUCLEOTIDE CONSTRUCTS ENCODING CHIMERIC ANTIGEN RECEPTORS," the contents of which are incorporated by reference in their entirety for all purposes.

[0002] INCORPORATION-BY-REFERENCE TO SEQUENCE LISTING This application is filed with an electronic Sequence Listing, which is provided in a file entitled 735042013740SeqList.TXT, created on October 31, 2019, and is 294 kilobytes in size. The information in the electronic Sequence Listing is incorporated by reference in its entirety.

[0003] Field In some aspects, the present disclosure relates to chimeric antigen receptors (CARs) comprising an antibody portion specific for G protein-coupled receptor class C group 5 member D (GPRC5D) and polynucleotides encoding CARs specific for GPRC5D. Additionally, the present disclosure relates to genetically engineered cells comprising such receptors that bind to GPRC5D and their use in adoptive cell therapy. [Background technology]

[0004] background G protein-coupled receptor class C group 5 member D (GPRC5D) is a G protein-coupled receptor whose specific function has not yet been determined. GPRC5D expression is high in bone marrow samples from patients with multiple myeloma (MM), whereas GPRC5D expression is minimal in bone marrow samples from patients with other hematopoietic malignancies. Based on its expression, GPRC5D could be a marker and therapeutic target for MM tumors. Various chimeric antigen receptors (CARs) that bind to GPRC5D and cells expressing such CARs are available. However, there remains a need for improved GPRC5D-binding CARs and modified GPRC5D-CAR-expressing targeting cells, for example, for use in adoptive cell therapy. Embodiments that meet this need are provided herein. Summary of the Invention

[0005] overview (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), comprising: (i) a V as set forth in any of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33; H heavy chain variable (V) domains comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V domain amino acid sequence. H ) region; and (ii) a V region as set forth in any of SEQ ID NOs: 22, 24, 26, 28, 30, 32, or 34. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain comprising a nucleotide sequence corresponding to the nucleotide sequence of ...

[0006] Also included is (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), comprising: (i) a V selected from any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33. H The heavy chain variable region (V) includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region. H and (ii) V selected from any one of SEQ ID NOs: 22, 24, 26, 28, 30, 32, or 34. L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L(1) an extracellular antigen-binding domain comprising a nucleotide sequence corresponding to the nucleotide sequence of the target gene; (2) an extracellular antigen-binding domain comprising a nucleotide sequence corresponding to the target gene; (3) a spacer of at least 125 amino acids in length; (4) a transmembrane domain; and (5) an intracellular signaling region.

[0007] Also included is (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), comprising: (i) a heavy chain complementarity-determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 75, 78, 80, 82, 90, 93, 95, 97, 105, 108, 110, 112, 120, 123, 125, 127, 135, 138, 140, 142, 135, 152, 162, 165, 167, or 169; (b) a heavy chain complementarity-determining region 2 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 75, 78, 80, 82, 90, 93, 95, 97, 105, 108, 110, 112, 120, 123, 125, 127, 135, 138, 140, 142, 135, 152, 162, 165, 167, or 169; and (c) a heavy chain complementarity determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 76, 79, 81, 83, 91, 94, 96, 98, 106, 109, 111, 113, 121, 124, 126, 128, 136, 139, 141, 143, 150, 153, 154, 155, 163, 166, 169, or 170; and (d) a heavy chain complementarity determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 77, 84, 92, 99, 107, 114, 133, 129, 137, 144, 151, 156, 164, or 171. H and (ii) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 85, 88, 100, 103, 115, 118, 130, 133, 145, 148, 157, 160, 172, or 174; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 86, 89, 101, 104, 116, 119, 131, 134, 146, 149, 158, or 161; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 87, 102, 117, 132, 147, 159, 173, 175, or 297. L(1) an extracellular antigen-binding domain comprising a nucleotide sequence corresponding to the nucleotide sequence of the target gene; (2) an extracellular antigen-binding domain comprising a nucleotide sequence corresponding to the target gene; (3) a spacer of at least 125 amino acids in length; (4) a transmembrane domain; and (5) an intracellular signaling region.

[0008] In some of any of the provided embodiments, the extracellular antigen-binding domain of the chimeric antigen receptor comprises (i) a V sequence as set forth in any of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33. H heavy chain variable (V) domains comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V domain amino acid sequence. H ) portion; and (ii) V as set forth in any of SEQ ID NOs: 22, 24, 26, 28, 30, 32 or 34. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L ) area.

[0009] In some of any of the provided embodiments, the spacer is 125 or about 125 to 300 or about 300 amino acids in length, 125 or about 125 to 250 or about 250 amino acids in length, 125 or about 125 to 230 or about 230 amino acids in length, 125 or about 125 to 200 or about 200 amino acids in length, 125 or about 125 to 180 or about 180 amino acids in length, 125 or about 125 to 150 or about 150 amino acids in length, 150 or about 150 to 300 or about 300 amino acids in length, 150 or about 150 to 250 or about 250 amino acids in length, 150 or about 150 to 230 or about 230 amino acids in length, 150 or about 150 to 200 or about 200 amino acids in length, 150 Alternatively, the length may be about 150 to 180 or about 180 amino acids, 180 or about 180 to 300 or about 300 amino acids, 180 or about 180 to 250 or about 250 amino acids, 180 or about 180 to 230 or about 230 amino acids, 180 or about 180 to 200 or about 200 amino acids, 200 or about 200 to 300 or about 300 amino acids, 200 or about 200 to 250 or about 250 amino acids, 200 or about 200 to 230 or about 230 amino acids, 230 or about 230 to 300 or about 300 amino acids, 230 or about 230 to 250 or about 250 amino acids, or 250 or about 250 to 300 or about 300 amino acids.In some of any of the provided embodiments, the spacer is at least or at least about 130 amino acids in length, at least or at least about 140 amino acids in length, at least or at least about 150 amino acids in length, at least or at least about 160 amino acids in length, at least or at least about 17 ... 10 or about 170 amino acids in length, at least 180 or about 180 amino acids in length, at least 190 or about 190 amino acids in length, at least 200 or about 200 amino acids in length, at least 210 or about 210 amino acids in length, at least 220 or about 220 amino acids in length, at least 220 or about 220 amino acids in length, at least 221 or about 221 amino acids in length, at least 222 or about 222 amino acids in length, at least 223 or about 223 amino acids in length, at least 224 or about 224 amino acids in length, at least 225 or about 225 amino acids in length or is 225 or about 225 amino acids in length, at least 226 or at least about 226 amino acids in length, at least 227 or at least about 227 amino acids in length, at least 228 or at least about 228 amino acids in length, or at least 229 or at least about 229 amino acids in length, or 229 or about 229 amino acids in length, or has a length between any of the foregoing.

[0010] In some of any of the provided embodiments, the spacer is derived from an immunoglobulin. In some of any of the provided embodiments, the spacer comprises sequences of the hinge region, CH2 region, and CH3 region. In some of any of the provided embodiments, one or more of the hinge, CH2, and CH3 are derived in whole or in part from IgG4 or IgG2, optionally human IgG4 or human IgG2. In some of any of the provided embodiments, the hinge, CH2, and CH3 are derived from IgG4. In some of any of the provided embodiments, one or more of the hinge, CH2, and CH3 are chimeric and comprise sequences derived from IgG4 and IgG2. In some of any of the provided embodiments, the spacer comprises an IgG4 / 2 chimeric hinge, or a modified IgG4 comprising at least one amino acid substitution compared to human IgG4, an IgG2 / 4 chimeric CH2, and an IgG4 CH3 region.

[0011] In some of any of the provided embodiments, the spacer is or comprises: (i) the sequence set forth in SEQ ID NO:17; (ii) a functional variant of SEQ ID NO:17 having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:17; or (iii) a contiguous portion of (i) or (ii) that is at least 125 amino acids in length. In some of any of the provided embodiments, the spacer is or comprises the sequence set forth in SEQ ID NO:17. In some of any of the provided embodiments, the spacer is or comprises the sequence encoded by the nucleotide sequence set forth in SEQ ID NO:48 (also set forth in SEQ ID NO:74).

[0012] In some of any of the embodiments provided, V H Area and V Lthe region comprises the amino acid sequence set forth in SEQ ID NOs: 21 and 22, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 21 and 22, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 23 and 24, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 23 and 24, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 25 and 26, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 25 and 26, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 27 and 28, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 27 and 28, respectively; H Area and V Lthe region comprises the amino acid sequence set forth in SEQ ID NOs: 29 and 30, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 29 and 30, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 31 and 32, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 31 and 32, respectively; or V H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs:33 and 34, respectively, or amino acid sequences having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs:33 and 34, respectively.

[0013] In some of any of the embodiments provided, V H The regions include CDR-H1, CDR-H2, and CDR-H3, each of which comprises the amino acid sequences of SEQ ID NOs: 80, 81, and 77, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 82, 83, and 84, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 88, 89, and 87; HThe regions include CDR-H1, CDR-H2, and CDR-H3, each of which contains the amino acid sequences of SEQ ID NOs: 95, 96, and 92, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 100, 101, and 102; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 97, 98, and 99, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 103, 104, and 102; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 110, 111, and 107, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 115, 116, and 117; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 112, 113, and 114, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 118, 119, and 117; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 127, 128, and 129, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132; HThe regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 140, 141, and 137, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 145, 146, and 147; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 142, 143, and 144, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 148, 149, and 147; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 140, 154, and 151, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 157, 158, and 159; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 142, 155, and 156, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 160, 161, and 159; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 167, 168, and 164, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each containing the amino acid sequences of SEQ ID NOs: 172, 86, and 173; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 169, 170, and 171, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 174, 89, and 175, respectively; or V HThe regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 169, 170, and 171, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 174, 89, and 297, respectively.

[0014] In some of any of the embodiments provided, V H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 21 and 22, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 23 and 24, respectively; H Area and V L The regions contain the amino acid sequences shown in SEQ ID NOs: 25 and 26, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 27 and 28, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 29 and 30, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 31 and 32, respectively; or V H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NOs: 33 and 34, respectively.

[0015] In some of any of the embodiments provided, V H Area and V Lthe region comprises the amino acid sequence set forth in SEQ ID NOs: 21 and 22, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 21 and 22, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 23 and 24, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 23 and 24, respectively; H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NOs: 27 and 28, respectively, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 27 and 28, respectively; or V H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs:31 and 32, respectively, or amino acid sequences having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs:31 and 32, respectively.

[0016] In some of any of the embodiments provided, V H The regions include CDR-H1, CDR-H2, and CDR-H3, each of which comprises the amino acid sequences of SEQ ID NOs: 80, 81, and 77, and V LThe regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 82, 83, and 84, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 88, 89, and 87; H The regions include CDR-H1, CDR-H2, and CDR-H3, each of which contains the amino acid sequences of SEQ ID NOs: 95, 96, and 92, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 100, 101, and 102; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 97, 98, and 99, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 103, 104, and 102; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 127, 128, and 129, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 140, 154, and 151, respectively, and V LThe regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 157, 158, and 159, respectively; or V H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 142, 155, and 156, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 160, 161, and 159, respectively.

[0017] In some of any of the embodiments provided, V H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 21 and 22, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 23 and 24, respectively; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NOs: 27 and 28, respectively; or V H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NOs: 31 and 32, respectively.

[0018] In some of any of the provided embodiments, the extracellular antigen-binding domain is cross-reactive to or binds to mouse GPRC5D and / or cross-reactive to or binds to cynomolgus monkey GPRC5D. In some of any of the provided embodiments, the extracellular antigen-binding domain is not cross-reactive to or does not bind to mouse GPRC5D or cynomolgus monkey GPRC5D.

[0019] In some of any of the embodiments provided, V H Area and V LThe regions comprise the amino acid sequences set forth in SEQ ID NOs:27 and 28, respectively, or amino acid sequences having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs:27 and 28, respectively.

[0020] In some of any of the provided embodiments, the chimeric antigen receptor is V as set forth in SEQ ID NO:27. H The heavy chain variable region (V) includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region. H ); and V as shown in SEQ ID NO:28 L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L In some of any of the provided embodiments, the V H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 127, 128, and 129, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132, respectively. H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 120, 121, and 122, respectively, and V LThe regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 123, 124, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively.

[0021] In some of any of the provided embodiments, the extracellular antigen-binding domain is a single-chain antibody fragment. In some of any of the provided embodiments, the fragment is or comprises a single-chain variable fragment (scFv).

[0022] In some of any of the embodiments provided, V H Area and V L The regions are linked by a flexible linker. H Area and V L The region is the amino acid sequence In some of the embodiments provided, V is linked by a linker comprising H Area and V L The regions are linked by a flexible linker. H Area and V L The region is the amino acid sequence Linked by a linker containing TIFF0007742773000002.tif4128.

[0023] In some of any of the embodiments provided, V H The area is V L and the amino acid sequence is amino-terminal to the region. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7 or 11, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7 or 11. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7 or 11. In some of any of the provided embodiments, the antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:7, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:7. In some of any of the provided embodiments, the antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:7.

[0024] In some of any of the embodiments provided, V H The area is V Land a region carboxy-terminal to the region. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8 or 12, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8 or 12. In some of any of the provided embodiments, the antigen-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8 or 12. In some of any of the provided embodiments, the antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:8, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:8. In some of any of the provided embodiments, the antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:8.In some of any of the provided embodiments, the antigen-binding domain is encoded by the nucleotide sequence shown in SEQ ID NO:264.

[0025] In some of any of the provided embodiments, the intracellular signaling region comprises an intracellular cytoplasmic signaling domain. In some of any of the provided embodiments, the intracellular signaling domain is capable of inducing a primary activation signal in a T cell, is a component of a T cell receptor (TCR), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of any of the provided embodiments, the intracellular signaling domain is or comprises the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof.

[0026] In some of any of the provided embodiments, the intracellular signaling domain is a human intracellular signaling domain or is derived from a human protein. In some of any of the provided embodiments, the intracellular signaling domain is or comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20.

[0027] In some of any of the provided embodiments, the intracellular signaling region further comprises a costimulatory signaling region. In some of any of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of a T cell costimulatory molecule, or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of 4-1BB, or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region is a human costimulatory signaling region or is derived from a human protein. In some of any of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of CD28, for example, the intracellular signaling domain of human CD28.

[0028] In some of any of the provided embodiments, the costimulatory signaling region is or comprises the sequence set forth in SEQ ID NO:46 or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46. In some of any of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of 4-1BB. In some of any of the provided embodiments, the costimulatory signaling region is or comprises the sequence set forth in SEQ ID NO:19 or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19.

[0029] In some of any of the provided embodiments, the costimulatory signaling region is between the transmembrane domain and the intracellular signaling region. In some of any of the provided embodiments, the transmembrane domain is or includes a transmembrane domain derived from CD4, CD28, or CD8. In some of any of the provided embodiments, the transmembrane domain is or includes a transmembrane domain derived from CD28. In some of any of the provided embodiments, the transmembrane domain is a human transmembrane domain or is derived from a human protein. In some of any of the provided embodiments, the transmembrane domain is or includes the sequence set forth in SEQ ID NO:18, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:18.

[0030] Also, (1) an extracellular antigen-binding domain that specifically binds to a human G protein-coupled receptor (GPRC5D), (i) V as shown in SEQ ID NO:27 H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H and (ii) V as set forth in any of SEQ ID NO:28. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L(1) an extracellular antigen-binding domain comprising a CD3-zeta (CD3ζ) chain region; (2) a spacer as set forth in SEQ ID NO:17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain and the intracellular signaling domain of a T cell costimulatory molecule.

[0031] In some of any of the embodiments provided, V H The region is V shown in SEQ ID NO:27 H CDR-H1, CDR-H2, and CDR-H3 are contained within the amino acid sequence of the region, and V L The region is V shown in SEQ ID NO:28 L or V H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 127, 128, and 129, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132; H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 120, 121, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; or V HThe regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 123, 124, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. H The region is V shown in SEQ ID NO:27 H CDR-H1, CDR-H2, and CDR-H3 are contained within the amino acid sequence of the region, and V L The region is V shown in SEQ ID NO:28 L or V H The regions include CDR-H1, CDR-H2, and CDR-H3, which contain the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively, and V L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively.

[0032] Also, (1) an extracellular antigen-binding domain that specifically binds to a human G protein-coupled receptor (GPRC5D), which is represented by V as shown in SEQ ID NO:27. H Heavy chain variable (V) domains, including CDR-H1, CDR-H2, and CDR-H3, contained within the amino acid sequence H ) region; and the V L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L ) region; or a V region comprising CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. LV region including CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 127, 128, and 129, respectively H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132, respectively. L V region including CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 120, 121, and 122, respectively H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L or V comprising CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 123, 124, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L (1) an extracellular antigen-binding domain comprising a region; (2) a spacer as set forth in SEQ ID NO:17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human CD28 or human 4-1BB.

[0033] Also, (1) an extracellular antigen-binding domain that specifically binds to a human G protein-coupled receptor (GPRC5D), which is represented by V as shown in SEQ ID NO:27. H Heavy chain variable (V) domains, including CDR-H1, CDR-H2, and CDR-H3, contained within the amino acid sequence H ) region; and the V L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L) region; or V comprising CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L (1) an extracellular antigen-binding domain that specifically binds to a human G protein-coupled receptor (GPRC5D), the V domain being represented by SEQ ID NO:27; (2) a spacer as set forth in SEQ ID NO:17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human CD28. H Heavy chain variable (V) domains, including CDR-H1, CDR-H2, and CDR-H3, contained within the amino acid sequence H ) region; and the V L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L ) region; or V comprising CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L (1) an extracellular antigen-binding domain comprising a region; (2) a spacer as set forth in SEQ ID NO:17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human 4-1BB.

[0034] In some of any of the provided embodiments, the extracellular antigen-binding domain comprises the VH The amino acid sequence of the region and V shown in SEQ ID NO:28 L and / or in some of any of the provided embodiments, the extracellular antigen-binding domain comprises the scFv set forth in SEQ ID NO:7 or SEQ ID NO:8. In some of any of the provided embodiments, the extracellular antigen-binding domain comprises the V set forth in SEQ ID NO:27. H The amino acid sequence of the region and V shown in SEQ ID NO:28 L and the extracellular antigen-binding domain comprises the scFv shown in SEQ ID NO: 7. In some of any of the provided embodiments, the extracellular antigen-binding domain comprises the V shown in SEQ ID NO: 27. H The amino acid sequence of the region and V shown in SEQ ID NO:28 L and the extracellular antigen-binding domain comprises the scFv shown in SEQ ID NO:8.

[0035] In some of any of the provided embodiments, the transmembrane domain is or comprises the sequence set forth in SEQ ID NO: 18, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some of any of the provided embodiments, the transmembrane domain is or comprises the sequence set forth in SEQ ID NO: 18.

[0036] In some of any of the provided embodiments, the intracellular signaling region comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20, and the sequence set forth in SEQ ID NO:46, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46. In some of any of the provided embodiments, the intracellular signaling region is or comprises the sequence set forth in SEQ ID NO:20 and the sequence set forth in SEQ ID NO:46. In some of any of the provided embodiments, the intracellular signaling region comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20, and the sequence set forth in SEQ ID NO:19, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19. In some of any of the provided embodiments, the intracellular signaling region is or comprises the sequence set forth in SEQ ID NO:20 and the sequence set forth in SEQ ID NO:19.

[0037] In some of any of the provided embodiments, the chimeric antigen receptor comprises, in order from its N-terminus to C-terminus, an antigen-binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0038] Also provided is a polynucleotide comprising a nucleotide sequence encoding any of the chimeric antigen receptors provided herein.

[0039] In some of any of the provided embodiments, the nucleic acid encoding the spacer comprises at least one modified splice donor site and / or modified splice acceptor site, wherein the modified splice donor site and / or modified splice acceptor site comprises one or more nucleotide modifications corresponding to a reference splice donor site and / or reference splice acceptor site contained in the sequence set forth in SEQ ID NO:73. In some of any of the provided embodiments, the one or more nucleotide modifications comprise an amino acid substitution. In some of any of the provided embodiments, the reference splice donor site and / or reference splice acceptor site is a canonical splice site, an atypical splice site, or a cryptic splice site. In some of any of the provided embodiments, the reference splice donor and / or reference splice acceptor site has a nucleotide sequence of at least 0.4, at least 0.5, at least 0.6, at least 0.70, at least 0.75, at least 0.80, at least 0.85, at least 0.90, at least 0.95, at least 0.96, at least 0.97, at least 0.98, at least 0.99, at least 10 ... 5, has a splice site prediction score of at least or about 0.99 or at least 1.0 or about 1.0; and / or the reference splice donor and / or reference splice acceptor site is predicted to be involved in a splice event at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or at least 100% of the time.

[0040] In some of any of the provided embodiments, the reference splice donor site has the sequence TIFF0007742773000003.tif11147; and / or the reference splice acceptor site comprises the sequence Contains TIFF0007742773000004.tif11128.

[0041] In some of any of the provided embodiments, the reference splice donor and / or reference splice acceptor site has a splice site prediction score of at least or about 0.70, at least 0.75 or about 0.75, at least 0.80 or about 0.80, at least 0.85 or about 0.85, at least 0.90 or about 0.90, at least 0.95 or about 0.95, at least 0.99 or about 0.99, or at least 1.0; and / or in some of any of the provided embodiments, the reference splice donor and / or reference splice acceptor site is predicted to be involved in a splice event at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% of the time.

[0042] In some of any of the provided embodiments, the reference splice donor site has the sequence TIFF0007742773000005.tif4128; and / or the reference splice acceptor site is Contains TIFF0007742773000006.tif4128

[0043] In some of any of the provided embodiments, at least one of the one or more nucleotide modifications is present within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues of a splice site junction of the reference splice acceptor and / or reference splice donor site.

[0044] In some of any of the provided embodiments, the one or more nucleotide modifications are silent and / or result in degenerate codons compared to SEQ ID NO:73 and / or do not change the amino acid sequence of the encoding spacer.

[0045] In some of any of the provided embodiments, the modified splice donor site is TIFF0007742773000007.tif11151; and / or modified splice acceptor sites In some of the embodiments provided, the modified splice donor site is TIFF0007742773000009.tif4128 and / or modified acceptor sites Shown in TIFF0007742773000010.tif11128.

[0046] In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:74 (also set forth in SEQ ID NO:48), or a portion thereof. In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:73, or a portion thereof. In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:74, or a portion thereof. In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:283, or a portion thereof. In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:284, or a portion thereof. In some of any of the provided embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO:305, or a portion thereof.

[0047] In some of any of the provided embodiments, upon expression of the polynucleotide in a cell, RNA transcribed from the polynucleotide, optionally messenger RNA (mRNA), exhibits at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% RNA homogeneity.

[0048] In some of any of the provided embodiments, upon expression in a cell, RNA, optionally messenger RNA (mRNA), transcribed from the polynucleotide exhibits reduced heterogeneity compared to the heterogeneity of mRNA transcribed from a reference polynucleotide, wherein the reference polynucleotide encodes the same amino acid sequence as the polynucleotide but differs from the polynucleotide by the presence of one or more splice donor sites and / or one or more splice acceptor sites in the nucleic acid encoding the spacer, and / or comprises one or more nucleotide alterations compared to the polynucleotide, and / or comprises the spacer set forth in SEQ ID NO: 73. In some of any of the provided embodiments, the RNA heterogeneity is reduced by more than or about 10%, more than or about 15%, more than or about 20%, more than or about 25%, more than or about 30%, more than or about 40%, more than or about 50%, or more. In some of any of the provided embodiments, the RNA transcribed from the reference polynucleotide, optionally messenger RNA (mRNA), exhibits an RNA heterogeneity of greater than or about 10%, greater than or about 15%, greater than or about 20%, greater than or about 25%, greater than or about 30%, greater than or about 40%, greater than or about 40%, greater than or about 50%, or greater. In some of any of the provided embodiments, the RNA homogeneity and / or RNA heterogeneity is examined by agarose gel electrophoresis, chip-based capillary electrophoresis, analytical ultracentrifugation, field-flow fractionation, or liquid chromatography.

[0049] In some of any of the embodiments provided, the polynucleotide is codon-optimized for expression in human cells.

[0050] In some of any of the provided embodiments, the chimeric receptor is a first chimeric receptor, and the polynucleotide further comprises a nucleotide sequence encoding a second chimeric antigen receptor. Thus, also provided herein are polynucleotides encoding a first chimeric receptor that targets GPRC5D, such as any of those provided herein, and a second chimeric receptor. In some of any of the provided embodiments, the first chimeric receptor and the second chimeric receptor are separated by one or more multicistronic elements. In some of any of the provided embodiments, the one or more multicistronic elements are or comprise a ribosomal skipping sequence. In some embodiments, the ribosomal skipping sequence is a T2A, P2A, E2A, or F2A element. In some of any of the provided embodiments, the one or more multicistronic elements comprise the amino acid sequence set forth in SEQ ID NO: 37. In some of any of the provided embodiments, the one or more multicistronic elements are encoded by a nucleotide sequence selected from among SEQ ID NOs: 44, 45, and 319. In some of any of the provided embodiments, the nucleotide sequence encoding the one or more multicistronic elements is or comprises the sequence set forth in SEQ ID NO:319.

[0051] In some of any of the provided embodiments, the second chimeric receptor comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma, such as one other than GPRC5D. In some of any of the provided embodiments, the second CAR comprises an extracellular antigen-binding domain that binds to the second antigen, a spacer, a transmembrane domain, and an intracellular signaling region. In some of any of the provided embodiments, the second antigen is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any of the provided embodiments, the second antigen is BCMA.

[0052] In some of any of the provided embodiments, the second CAR comprises (1) an extracellular antigen-binding domain that specifically binds BCMA, the extracellular antigen-binding domain comprising (i) a V domain as set forth in any of SEQ ID NOs: 189, 191, 193, 195, or 197. H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H and (ii) V as set forth in any of SEQ ID NOs: 190, 192, 194, 196, or 198. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain, including a V region; (2) a spacer; (3) a transmembrane region; and (4) an intracellular signaling region. In some of any of the provided embodiments, the V region of the second CAR H The region may be any of the V sequences shown in SEQ ID NOs: 189, 191, 193, 195 or 197. HV includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; L The region may be any of the V sequences shown in SEQ ID NOs: 190, 192, 194, 196, or 198. L The regions include CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence.

[0053] In some of any of the provided embodiments, the second CAR comprises (1) an extracellular antigen-binding domain that specifically binds to BCMA, the extracellular antigen-binding domain comprising (i) the V as set forth in SEQ ID NO:197. H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H ); and (ii) V as set forth in any of SEQ ID NO:198 L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain that specifically binds to BCMA, the extracellular antigen-binding domain comprising (i) a V region as set forth in SEQ ID NO:197; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signaling region. In some of any of the provided embodiments, the second CAR comprises (1) an extracellular antigen-binding domain that specifically binds to BCMA, the V region comprising (i) a V region as set forth in SEQ ID NO:197; H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H ); and (ii) V as set forth in any of SEQ ID NO:198 La light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain comprising a V region; (2) a spacer as set forth in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human 4-1BB. In some of any of the provided embodiments, the V of the second CAR H The region may be any of the V sequences shown in SEQ ID NO:197. H V includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; L The region may be any of the V sequences shown in SEQ ID NO:198. L In some of the provided embodiments, the second CAR is or comprises the amino acid sequence set forth in SEQ ID NO: 251. In some of the provided embodiments, the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO: 246.

[0054] In some of any of the provided embodiments, the second CAR comprises (1) a heavy chain variable region (V) that specifically binds to BCMA, the heavy chain variable region (V) comprising: (i) a heavy chain complementarity determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 199, 202, 206, 209, 212, or 215; (b) a heavy chain complementarity determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 200, 203, 207, 210, 213, or 216; and (c) a heavy chain complementarity determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 201, 204, 205, 208, 211, 214, or 217. H and (ii) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 218, 221, 224, 227, 230, 233, or 235; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, 231, 234, or 236; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 220, 223, 226, 229, or 232. L (1) an extracellular antigen-binding domain, including a spacer region; (2) a transmembrane domain; and (3) an intracellular signaling region.

[0055] In some of any of the provided embodiments, the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 199, 200, and 201, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; HThe regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 212, 213, and 214, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234, and 229, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR LThe regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0056] In some of any of the embodiments provided, the V of the encoded second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively. In some of any of the provided embodiments, the V of the encoded second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively. In some of any of the provided embodiments, the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0057] In some of any of the embodiments provided, the V of the encoded second CARH Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or H Area and V LThe regions comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0058] In some of any of the embodiments provided, the V of the encoded second CAR H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or the V of the second CAR H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. In some of any of the provided embodiments, the V of the encoded second CAR H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NO:197 and SEQ ID NO:198, respectively.

[0059] In some of any of the provided embodiments, the extracellular antigen-binding domain of the encoded second CAR is a single-chain antibody fragment. In some of any of the provided embodiments, the encoded fragment is or comprises a single-chain variable fragment (scFv). In some of any of the provided embodiments, the V of the encoded second CAR is H Area and V L The regions are linked by a flexible linker. In some of any of the provided embodiments, the scFv of the encoded second CAR has the amino acid sequence In some of any of the provided embodiments, the encoded scFv of the second CAR comprises a linker comprising the amino acid sequence In some of the embodiments provided, the second CAR encoded by the V H The area is V L In some of the embodiments provided, the V H The area is V L It is carboxy-terminal to the region.

[0060] In some of any of the provided embodiments, the antigen-binding domain of the encoded second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the provided embodiments, the antigen-binding domain of the encoded second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the provided embodiments, the antigen-binding domain of the encoded second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:241. In some of any of the provided embodiments, the antigen-binding domain of the encoded second CAR comprises the amino acid sequence set forth in SEQ ID NO:241.

[0061] In some of any of the provided embodiments, the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR HThe regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively; and / or the V of the second CAR H and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241. In some of any of the provided embodiments, the VL region of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively. H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or the V of the second CAR H and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241. In some of any of the provided embodiments, the VL region of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively. HThe regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively; and / or the V of the second CAR H the VL region and VL region comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241.

[0062] In some of any of the provided embodiments, the transmembrane domain of the encoded second CAR is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8.

[0063] In some of any of the provided embodiments, the transmembrane domain of the encoded second CAR is or comprises a transmembrane domain derived from human CD28 and / or is or comprises the sequence set forth in SEQ ID NO: 18, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some of any of the provided embodiments, the transmembrane domain of the encoded second CAR is or comprises the sequence set forth in SEQ ID NO: 18.

[0064] In some of any of the provided embodiments, the intracellular signaling region of the encoded second CAR comprises an intracellular signaling domain. In some of any of the provided embodiments, the intracellular signaling domain of the encoded second CAR is capable of inducing a primary activation signal in a T cell, is a component of the T cell receptor (TCR), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of any of the provided embodiments, the intracellular signaling domain of the encoded second CAR is or comprises the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. In some of any of the provided embodiments, the intracellular signaling region of the encoded second CAR comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20.

[0065] In some of any of the provided embodiments, the intracellular signaling region of the encoded second CAR further comprises a costimulatory signaling region. In some of any of the provided embodiments, the costimulatory signaling region of the encoded second CAR comprises the intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region of the encoded second CAR comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, optionally the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. In some of any of the provided embodiments, the costimulatory signaling region of the encoded second CAR comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof. In some of any of the provided embodiments, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor comprises an intracellular signaling region comprising the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally the intracellular signaling domain of human 4-1BB.

[0066] In some of any of the provided embodiments, the costimulatory signaling region of the encoded second CAR comprises the intracellular signaling domain of human CD28; and / or the sequence set forth in SEQ ID NO:46, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46.

[0067] In some of any of the provided embodiments, the costimulatory signaling region of the encoded second CAR comprises the intracellular signaling domain of human 4-1BB; and / or the sequence set forth in SEQ ID NO:19, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19.

[0068] In some of any of the provided embodiments, the encoded second chimeric antigen receptor comprises, in order from its N-terminus to C-terminus, an antigen-binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0069] In some of any of the provided embodiments, at least one of the polynucleotide sequence encoding the first chimeric antigen receptor and the polynucleotide sequence encoding the second chimeric antigen receptor is a codon-divergent form. In some of any of the provided embodiments, the polynucleotide sequence encoding the first chimeric antigen receptor and the polynucleotide sequence encoding the second chimeric antigen receptor have no more than about 30, no more than about 20, or no more than about 10 contiguous base pairs of sequence identity.

[0070] In some of any of the provided embodiments, the nucleotide sequence encoding the CAR is operably linked to a promoter to control expression of the encoded CAR when the polynucleotide is expressed in a cell into which it has been introduced, and optionally the promoter is a heterologous promoter, and optionally the heterologous promoter is or comprises the human elongation factor 1 alpha (EF1α) promoter or MND promoter, or a variant thereof.

[0071] In some of any of the provided embodiments where the polynucleotide encodes two CARs, the nucleotide sequence encoding the first CAR is operably linked to a first promoter for controlling expression of the first CAR when expressed in a cell into which the polynucleotide is introduced, and the nucleotide sequence encoding the second CAR is operably linked to a second promoter for controlling expression of the second CAR when expressed in a cell into which the polynucleotide is introduced. In some embodiments, the first promoter and the second promoter are independently heterologous promoters, for example, where the heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or an MND promoter, or a variant thereof. In some such embodiments, the first promoter and the second promoter are the same. In some such embodiments, the first promoter and the second promoter are different.

[0072] Also provided are vectors comprising any of the provided polynucleotides. In some of any of the provided embodiments, the vector is a viral vector. In some of any of the provided embodiments, the viral vector is a lentiviral vector or a retroviral vector.

[0073] Also provided are modified cells comprising any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the modified cells comprise a chimeric antigen receptor provided herein and further comprise a polynucleotide comprising a nucleotide sequence encoding a second chimeric antigen receptor.

[0074] Also provided are modified cells comprising any of the polynucleotides provided herein.

[0075] In some of any of the provided embodiments, the second chimeric receptor of the provided cell comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma. In some of any of the provided embodiments, the second CAR comprises an extracellular antigen-binding domain that binds to the second antigen, a spacer, a transmembrane domain, and an intracellular signaling region. In some of any of such embodiments, the second antigen is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any of the provided embodiments, the second antigen is BCMA.

[0076] In some of the embodiments of any of the provided modified cells, the second CAR comprises (1) an extracellular antigen-binding domain that specifically binds BCMA, the extracellular antigen-binding domain comprising (i) a V domain as set forth in any of SEQ ID NOs: 189, 191, 193, 195, or 197. H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H and (ii) V as set forth in any of SEQ ID NOs: 190, 192, 194, 196, or 198. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain comprising a V region; (2) a spacer; (3) a transmembrane region; and (4) an intracellular signaling region. H The region may be any of the V sequences shown in SEQ ID NOs: 189, 191, 193, 195 or 197. HV includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; L The region may be any of the V sequences shown in SEQ ID NOs: 190, 192, 194, 196, or 198. L The regions include CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence.

[0077] In some of any of the embodiments of the provided engineered cells, the second CAR comprises (1) a heavy chain variable region (V) that specifically binds to BCMA, the heavy chain variable region (V) comprising: (i) a heavy chain complementarity determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 199, 202, 206, 209, 212, or 215; (b) a heavy chain complementarity determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 200, 203, 207, 210, 213, or 216; and (c) a heavy chain complementarity determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 201, 204, 205, 208, 211, 214, or 217. H and (ii) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 218, 221, 224, 227, 230, 233, or 235; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, 231, 234, or 236; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 220, 223, 226, 229, or 232. L (1) an extracellular antigen-binding domain, including a spacer region; (2) a transmembrane domain; and (3) an intracellular signaling region.

[0078] In some of any of the embodiments of the modified cells provided, the V of the second CAR HThe regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 199, 200, and 201, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 212, 213, and 214, respectively, and the V of the second CAR LThe regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234, and 229, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0079] In some of any of the embodiments of the modified cells provided, the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0080] In some of any of the embodiments of the modified cells provided, the V of the second CAR H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190;H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0081] In some of any of the embodiments of the modified cells provided, the V of the second CAR H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or the V of the second CAR H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NO:197 and SEQ ID NO:198, respectively.

[0082] In some of the embodiments of the modified cells provided, the extracellular antigen-binding domain of the second CAR is a single-chain antibody fragment. In some of such embodiments, the fragment is or comprises a single-chain variable fragment (scFv).

[0083] In some of any of the embodiments of the modified cells provided, the V of the second CAR H Area and V L The regions are connected by a flexible linker. In some such embodiments, the linker has the amino acid sequence TIFF0007742773000013.tif4128. In some such embodiments, the linker comprises the amino acid sequence Includes TIFF0007742773000014.tif4128.

[0084] In some of the embodiments of the modified cells provided, a V H The area is VL In some of the embodiments of the modified cells provided, the V H The area is V L In some of the embodiments of the modified cells provided, the antigen-binding domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241.

[0085] In some of the embodiments of the modified cells provided, the antigen-binding domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of the embodiments of the modified cells provided, the V of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively; and / or the V of the second CAR Hthe VL region and VL region comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241.

[0086] In some of the embodiments of the modified cells provided, the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO: 241. In some of the embodiments of the modified cells provided, the V of the second CAR comprises the amino acid sequence set forth in SEQ ID NO: 241. H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or the V of the second CAR H the VL region and VL region comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241.

[0087] In some of the embodiments of the modified cells provided, the transmembrane domain of the second CAR is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. In some of the embodiments of the modified cells provided, the transmembrane domain of the second CAR is or comprises a transmembrane domain derived from human CD28; and / or the transmembrane domain is or comprises the sequence set forth in SEQ ID NO: 18, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some of the embodiments of the modified cells provided, the transmembrane domain of the second CAR is or comprises the sequence set forth in SEQ ID NO: 18.

[0088] In some of any of the embodiments of the modified cells provided, the intracellular signaling region of the second CAR comprises an intracellular signaling domain.

[0089] In some of the embodiments of any of the provided modified cells, the intracellular signaling domain of the second CAR is capable of inducing a primary activation signal in a T cell and is a component of a T cell receptor (TCR) and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of the embodiments of any of the provided modified cells, the intracellular signaling domain of the second CAR is or comprises the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. In some of the embodiments of any of the provided modified cells, the intracellular signaling region of the second CAR comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20.

[0090] In some of the embodiments of any of the provided modified cells, the intracellular signaling region of the second CAR further comprises a costimulatory signaling region. In some of the embodiments of any of the provided modified cells, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of the embodiments of any of the provided modified cells, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, optionally the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. In some of the embodiments of any of the provided modified cells, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof. In some of the embodiments of any of the provided modified cells, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor comprises an intracellular signaling region comprising the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally the intracellular signaling domain of human 4-1BB.

[0091] In some of any of the embodiments of the modified cells provided, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of human CD28; and / or the sequence set forth in SEQ ID NO:46, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46.

[0092] In some of any of the embodiments of the modified cells provided, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of human 4-1BB; and / or the sequence set forth in SEQ ID NO:19, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19.

[0093] In some of any of the embodiments of the modified cells provided, the encoded second chimeric antigen receptor comprises, in N- to C-terminal order, an antigen-binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0094] In some of any of the provided embodiments, the modified cells are lymphocytes. In some of any of the provided embodiments, the modified cells are NK cells or T cells. In some of any of the provided embodiments, the modified cells are T cells, and the T cells are CD4+ T cells or CD8+ T cells.

[0095] In some of any of the provided embodiments, the modified cells are modified primary cells obtained from the subject.

[0096] In some of any of the provided embodiments, the modified cells, of a plurality of said modified cells, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of said plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0097] Also provided are compositions containing any of the chimeric receptors provided herein. Also provided are compositions containing any of the modified cells provided herein. In some of any of the provided embodiments, the compositions comprise CD4+ T cells and CD8+ T cells, wherein the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1, or about 1:3 to about 3:1, optionally 1:2 to 2:1, or about 1:2 to about 2:1. In some of any of the provided embodiments, the compositions comprise CD4+ T cells and CD8+ T cells, wherein the ratio of CD4+ T cells to CD8+ T cells is about 1:1.

[0098] Also provided are compositions containing a plurality of first modified cells comprising a first chimeric antigen receptor that is any of the chimeric antigen receptors provided herein or encoded by any of the polynucleotides provided herein; and a plurality of second modified cells comprising a second chimeric antigen receptor. In some of any of the provided embodiments, of the plurality of first modified cells, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of the plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling. In some of any of the provided embodiments, of a plurality of said second modified cells, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of said plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0099] In some of any of the provided embodiments, the second chimeric receptor of the plurality of second modified cells in the composition comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma. In some of any of the provided embodiments, the second CAR of the plurality of second modified cells in the composition comprises an extracellular antigen-binding domain that binds to the second antigen, a spacer, a transmembrane domain, and an intracellular signaling region. In some of any of the provided embodiments, the second antigen of the plurality of second modified cells in the composition is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any of the provided embodiments, the second antigen of the plurality of second modified cells in the composition is BCMA.

[0100] In some of any of the provided embodiments, the second CAR of the plurality of second modified cells in the composition comprises (1) an extracellular antigen-binding domain that specifically binds to BCMA, the extracellular antigen-binding domain being (i) a V as set forth in any of SEQ ID NOs: 189, 191, 193, 195, or 197. H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H and (ii) V as set forth in any of SEQ ID NOs: 190, 192, 194, 196, or 198. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain comprising a V region; (2) a spacer; (3) a transmembrane region; and (4) an intracellular signaling region.H The region may be any of the V sequences shown in SEQ ID NOs: 189, 191, 193, 195 or 197. H V includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; L The region may be any of the V sequences shown in SEQ ID NOs: 190, 192, 194, 196, or 198. L The regions include CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence.

[0101] In some of any of the provided embodiments, the second CAR of the plurality of second modified cells in the composition comprises (1) a heavy chain variable region (V) that specifically binds to BCMA, the V V V heavy chain variable region (V) comprising: (i) a heavy chain complementarity determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 199, 202, 206, 209, 212, or 215; (b) a heavy chain complementarity determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 200, 203, 207, 210, 213, or 216; and (c) a heavy chain complementarity determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 201, 204, 205, 208, 211, 214, or 217. H and (ii) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 218, 221, 224, 227, 230, 233, or 235; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, 231, 234, or 236; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 220, 223, 226, 229, or 232. L (1) an extracellular antigen-binding domain, including a spacer region; (2) a transmembrane domain; and (3) an intracellular signaling region.

[0102] In some of any of the provided embodiments, the V of the second CAR of the composition H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 199, 200, and 201, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; HThe regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 212, 213, and 214, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234, and 229, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0103] In some of any of the provided embodiments, the V of the second CAR in the composition H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0104] In some of any of the provided embodiments, the V of the second CAR in the composition H Area and V LThe regions comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or H Area and V LThe regions comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0105] In some of any of the provided embodiments, the V of the second CAR in the composition H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively; or the V of the second CAR in the composition H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; or the V of the second CAR in the composition H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; or the V of the second CAR in the composition H Area and V L The region comprises the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or the V of the second CAR in the composition H Area and V L The regions comprise the amino acid sequences shown in SEQ ID NO:197 and SEQ ID NO:198, respectively.

[0106] In some of any of the provided embodiments, the extracellular antigen-binding domain of the second CAR in the composition is a single-chain antibody fragment. In some such embodiments, the fragment is or comprises a single-chain variable fragment (scFv). In some of any of the provided embodiments, the V of the second CAR in the composition H Area and V LThe regions are connected by a flexible linker. In some of any of the provided embodiments, the linker in the second CAR in the composition has the amino acid sequence In some of any of the provided embodiments, the linker in the second CAR in the composition has the amino acid sequence Includes TIFF0007742773000016.tif4128.

[0107] In some of any of the provided embodiments, V is present in a second CAR in the composition. H The area is V L In some of the provided embodiments, a V H The area is V L In some of any of the provided embodiments, the antigen-binding domain in the second CAR in the composition comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the provided embodiments, the antigen-binding domain in the second CAR in the composition comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241.

[0108] In some of any of the provided embodiments, the V of the second CAR in the composition H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CARL The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 215, 216, and 217, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively; and / or the V of the second CAR in the composition. H and / or the antigen-binding domain of a second CAR in the composition comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241. In some of any of the provided embodiments, the VL region and VL region of a second CAR in the composition H The regions include CDR-H1, CDR-H2, and CDR-H3, each comprising the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and the V of the second CAR L The regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or the V of the second CAR in the composition. Hthe VL region and VL region comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the antigen-binding domain of the second CAR in the composition comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241.

[0109] In some of any of the provided embodiments, the transmembrane domain of the second CAR in the composition is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. and / or the transmembrane domain of the second CAR in the composition is or comprises the sequence set forth in SEQ ID NO: 18, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some of any of the provided embodiments, the transmembrane domain of the second CAR in the composition is or comprises the sequence set forth in SEQ ID NO: 18.

[0110] In some of any of the provided embodiments, the intracellular signaling region of the second CAR in the composition comprises an intracellular signaling domain. In some of any of the provided embodiments, the intracellular signaling domain of the second CAR in the composition is capable of inducing a primary activation signal in a T cell, is a component of a T cell receptor (TCR), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of any of the provided embodiments, the intracellular signaling domain of the second CAR in the composition is or comprises the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. In some of any of the provided embodiments, the intracellular signaling region of the second CAR in the composition comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20.

[0111] In some of any of the provided embodiments, the intracellular signaling region of the second CAR in the composition further comprises a costimulatory signaling region. In some of any of the provided embodiments, the costimulatory signaling region of the second CAR in the composition comprises the intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region of the second CAR in the composition comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, optionally the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. In some of any of the provided embodiments, the costimulatory signaling region of the second CAR in the composition comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally the intracellular signaling domain of human 4-1BB. In some of any of the provided embodiments, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor comprises an intracellular signaling region comprising the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally the intracellular signaling domain of human 4-1BB. In some of any of the provided embodiments, the costimulatory signaling region of the second CAR in the composition comprises the intracellular signaling domain of human CD28; and / or the sequence set forth in SEQ ID NO:46, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46.In some of any of the provided embodiments, the costimulatory signaling region of the second CAR in the composition comprises the intracellular signaling domain of human 4-1BB; and / or the sequence set forth in SEQ ID NO:19, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19.

[0112] In some of any of the provided embodiments, the encoded second chimeric antigen receptor of the composition comprises, in N- to C-terminal order, an antigen-binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0113] In some of any of the provided embodiments, the plurality of first modified cells in the composition comprises T cells, optionally comprising CD4+ T cells and CD8+ T cells, and optionally a ratio of CD4+ T cells to CD8+ T cells of 1:3 to 3:1, or about 1:3 to about 3:1, or optionally 1:2 to 2:1, or about 1:2 to about 2:1. In some of any of the provided embodiments, the plurality of first modified cells in the composition comprises T cells, optionally comprising CD4+ T cells and CD8+ T cells, and optionally a ratio of CD4+ T cells to CD8+ T cells of about 1:1.

[0114] In some of any of the provided embodiments, the plurality of second modified cells in the composition comprises T cells, optionally comprising CD4+ T cells and CD8+ T cells, and optionally a ratio of CD4+ T cells to CD8+ T cells of 1:3 to 3:1, or about 1:3 to about 3:1, or optionally 1:2 to 2:1, or about 1:2 to about 2:1. In some of any of the provided embodiments, the plurality of second modified cells in the composition comprises T cells, optionally comprising CD4+ T cells and CD8+ T cells, and optionally a ratio of CD4+ T cells to CD8+ T cells of about 1:1.

[0115] In some of any of the provided embodiments, the composition comprises a ratio of a first plurality of modified cells to a second plurality of modified cells of 1:3 to 3:1 or about 1:3 to 3:1, optionally 1:2 to 2:1 or about 1:2 to 2:1, and optionally 1:1 or about 1:1. In some of any of the provided embodiments, the composition comprises a first plurality of cells expressing a first chimeric antigen receptor to a second plurality of cells expressing a second chimeric antigen receptor in a ratio of about 1:3 to 3:1, optionally about 1:2 to 2:1. In certain embodiments, the ratio of the first plurality of modified cells to the second plurality of modified cells in the composition is 1:1 or about 1:1. In some of any of the provided embodiments, the composition further comprises a pharmaceutically acceptable excipient. In some of any of the provided embodiments, the composition is sterile.

[0116] Also provided herein are uses of any of the compositions provided herein. In some of any of the provided embodiments, the compositions are for use in treating a subject with a disease or condition. In some of any of the provided embodiments, the disease or condition is cancer. In some of any of the provided embodiments, the disease or condition is multiple myeloma, optionally relapsed / refractory multiple myeloma. The provided uses and compositions for use provided herein can be for treating a subject according to any aspect of the provided methods.

[0117] Also provided herein are methods of treatment that include administering to a subject having a disease or disorder any of the compositions provided herein comprising any of the modified cells provided herein or any of the compositions provided herein comprising any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the dose of cells is 1.0 x 10 7 or approximately 1.0 x 10 7 CAR-expressing T cells ~1.2 x 109 or approximately 1.2 x 10 9 CAR-expressing T cells, approximately 1.25 x 10 7 CAR-expressing T cells ~ approximately 1.2 x 10 9 CAR-expressing T cells, approximately 1.5 x 10 7 CAR-expressing T cells ~ approximately 1.2 x 10 9 CAR-expressing T cells, approximately 5.0 x 10 7 CAR-expressing T cells ~ approximately 4.5 x 10 8 CAR-expressing T cells, approximately 1.5 x 10 8 CAR-expressing T cells ~approximately 3.0 x 10 8 In some of any of the provided embodiments, the dose of cells comprises 2.5 x 10 CAR-expressing T cells. 7 or approximately 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or approximately 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or approximately 4.5 x 10 8 CAR-expressing T cells, 1.5 x 10 8 or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 or approximately 3.0 x 10 8 Contains CAR-expressing T cells.

[0118] In some of either embodiment, the dose of cells is 1×10 7 Or about 1 x 10 7 CAR-expressing T cells ~2 x 10 9 Or about 2 x 10 9 In some of either embodiment, the dose of cells comprises 2.5 x 10 CAR-expressing T cells. 7 Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, or 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 In some of either embodiment, the dose of cells comprises 1.0 x 10 CAR-expressing T cells. 7 or approximately 1.0 x 10 7 pieces, 1.5×10 7 Or about 1.5 x 10 7 pieces, 2.5×10 7 Or about 2.5 x 10 7 pieces, 5.0×10 7 or approximately 5.0 x 10 7 pieces, 7.5×10 7 Or about 7.5 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 2.25×10 8 Or about 2.25 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, 4.5×10 8 or about 4.5 x 10 8 pieces, 6.0×10 8 or approximately 6.0 x 10 8 pieces, 8.0×10 8 or approximately 8.0 x 10 8 pieces, or 1.2 x 10 9 or about 1.2 x 10 9 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, or 4.5 x 10 8 or about 4.5 x 10 8In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, or 4.5 x 10 8 or about 4.5 x 10 8 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 Contains CAR-expressing T cells.

[0119] Also provided herein are uses of a first composition containing a plurality of first modified cells comprising a first chimeric antigen receptor, the first chimeric antigen receptor being any of the chimeric antigen receptors provided herein or any chimeric antigen receptor encoded by any of the polynucleotides provided herein, and a second composition containing a plurality of second modified cells comprising a second chimeric antigen receptor. In some of any of the provided embodiments, the compositions are used together for use in treating a subject with a disease or condition. In some of any of the provided embodiments, the disease or condition is cancer. In some of any of the provided embodiments, the disease or condition is multiple myeloma, optionally relapsed / refractory multiple myeloma. The provided uses and compositions for use provided herein may be for treating a subject according to any of the provided method aspects.

[0120] Also provided herein are methods of treatment comprising administering to a subject having a disease or disorder a composition containing a plurality of first modified cells comprising a first chimeric antigen receptor, the first chimeric antigen receptor being any of the chimeric antigen receptors provided herein or any chimeric antigen receptor encoded by any of the polynucleotides provided herein; and administering to the subject a composition containing a plurality of second modified cells comprising a second chimeric antigen receptor. In some of any of the provided embodiments, the dose of the first plurality of modified cells and the dose of the second plurality of modified cells are independently 1.0 x 10 7 or approximately 1.0 x 10 7 CAR-expressing T cells ~1.5 x 10 9 Or about 1.5 x 10 9 CAR-expressing T cells, 1.25 x 10 7 Or about 1.25 x 10 7 CAR-expressing T cells ~0.6 x 10 8 or approximately 0.6 x 10 8 CAR-expressing T cells, 2.5 x 10 7 Or about 2.5 x 10 7 CAR-expressing T cells ~2.25 x 10 8 Or about 2.25 x 10 8 CAR-expressing T cells, 7.5 x 10 7 Or about 7.5 x 10 7 CAR-expressing T cells ~1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells, 2.5 x 10 7 Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8Or about 3.0 x 10 8 In some of any of the embodiments, the dose of the first plurality of modified cells and the dose of the second plurality of modified cells are independently 1 x 10 or more than 1 x 10 7 Or about 1 x 10 7 CAR-expressing T cells ~2 x 10 9 Or about 2 x 10 9 In some of either embodiment, the dose of cells comprises 2.5 x 10 CAR-expressing T cells. 7 Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, or 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 In some of either embodiment, the dose of cells comprises 1.5 x 10 CAR-expressing T cells. 7 Or about 1.5 x 10 7 pieces, 2.5×10 7 Or about 2.5 x 10 7 pieces, 5.0×10 7 or approximately 5.0 x 10 7 pieces, 7.5×10 7 Or about 7.5 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 2.25×10 8 Or about 2.25 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, 4.5×10 8 or about 4.5 x 10 8 pieces, 6.0×10 8 or approximately 6.0 x 10 8 pieces, 8.0×10 8or approximately 8.0 x 10 8 pieces, or 1.2 x 10 9 or about 1.2 x 10 9 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 or 4.5 x 10 8 or about 4.5 x 10 8 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, or 4.5 x 10 8 or about 4.5 x 10 8 In some of any of the embodiments, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 Contains CAR-expressing T cells.

[0121] In some of any of the provided embodiments, the composition containing the first plurality of modified cells and the composition containing the second plurality of modified cells are administered simultaneously, sequentially, or intermittently. In some of any of the provided embodiments, the composition containing the first plurality of modified cells and the composition containing the second plurality of modified cells are administered sequentially in any order.

[0122] In some of any of the provided embodiments, of a plurality of said first modified cells of a composition in a provided method of treatment or a composition for use in a treatment, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of said plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0123] In some of any of the provided embodiments, of a plurality of said second modified cells of a composition in a provided method of treatment or a composition for use in a treatment, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of said plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0124] In some of any of the provided embodiments, the second chimeric receptor of the composition in the method of treatment or the modified cell of the composition for use in treatment comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma.

[0125] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment comprises an extracellular antigen-binding domain that binds to a second antigen, a spacer, a transmembrane domain, and an intracellular signaling region.

[0126] In some of any of the provided embodiments, the second antigen targeted by the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment includes or is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any of the provided embodiments, the second antigen in the provided methods includes or is BCMA.

[0127] In some of any of the provided embodiments, the second CAR of the engineered cells of the provided methods of treatment or compositions for use in treatment comprises (1) an extracellular antigen-binding domain that specifically binds to BCMA, the extracellular antigen-binding domain being (i) a V as set forth in any of SEQ ID NOs: 189, 191, 193, 195, or 197. H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; H and (ii) V as set forth in any of SEQ ID NOs: 190, 192, 194, 196, or 198. L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the V region amino acid sequence; L (1) an extracellular antigen-binding domain, including a V region; (2) a spacer; (3) a transmembrane region; and (4) an intracellular signaling region. In some of any of the provided embodiments, the V region of the second CAR in the provided methods comprises H The region may be any of the V sequences shown in SEQ ID NOs: 189, 191, 193, 195 or 197. H V includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; LThe region may be any of the V sequences shown in SEQ ID NOs: 190, 192, 194, 196, or 198. L The regions include CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence.

[0128] In some of any of the provided embodiments, the second CAR of the engineered cells of the provided methods of treatment or compositions for use in treatment comprises (1) an extracellular antigen-binding domain that specifically binds to BCMA, wherein (i) V H a heavy chain variable region (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:197; H ); and (ii) V L a light chain variable (V) region comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:198; L (1) an extracellular antigen-binding domain, including a V region; (2) a spacer; (3) a transmembrane region; and (4) an intracellular signaling region. In some of any of the provided embodiments, the V region of the second CAR in the provided methods comprises H The region is V as shown in SEQ ID NO:197. H V includes CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region; L The region is V shown in SEQ ID NO:198. L The regions include CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence.

[0129] In some of any of the provided embodiments, the second CAR of the engineered cells of the provided methods of treatment or compositions for use in treatment comprises (1) a heavy chain variable region (V) that specifically binds to BCMA, the VV comprising: (i) a heavy chain complementarity determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 199, 202, 206, 209, 212, or 215; (b) a heavy chain complementarity determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 200, 203, 207, 210, 213, or 216; and (c) a heavy chain complementarity determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 201, 204, 205, 208, 211, 214, or 217. H and (ii) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 218, 221, 224, 227, 230, 233, or 235; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, 231, 234, or 236; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 220, 223, 226, 229, or 232. L (1) an extracellular antigen-binding domain, including a spacer region; (2) a transmembrane domain; and (3) an intracellular signaling region.

[0130] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment comprises the V of the second CAR. H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 201, respectively; LThe regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively; L the regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively; L the regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively; L the regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively; L the regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 212, 213, and 214, respectively; L the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234, and 229, respectively; or the V of the second CAR HThe second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 215, 216, and 217, respectively; L The region comprises an extracellular antigen-binding domain comprising CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively.

[0131] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment comprises the V of the second CAR. H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively; L the CDR-L1, CDR-L2, and CDR-L3 regions comprise the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V region of the second CAR in the provided method. H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 215, 216, and 217, respectively; L In some of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment comprises an extracellular antigen-binding domain comprising CDR-L1, CDR-L2, and CDR-L3, the CDR-L1 region comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively. H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively; L The region comprises an extracellular antigen-binding domain comprising CDR-L1, CDR-L2, and CDR-L3, which comprise the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively.

[0132] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment is V H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or amino acid sequences that exhibit at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or HThe VL and VL regions comprise an extracellular antigen-binding domain comprising the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0133] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment is V H The VL and VL regions comprise an extracellular antigen-binding domain comprising the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0134] In some of any of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment is V H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 189 and SEQ ID NO: 190, respectively; H the VL region of the second CAR comprises the amino acid sequences set forth in SEQ ID NO: 191 and SEQ ID NO: 192; H the VL region of the second CAR comprises the amino acid sequences set forth in SEQ ID NO: 193 and SEQ ID NO: 194; H the VL region and VL region of the second CAR comprise the amino acid sequences set forth in SEQ ID NO: 195 and SEQ ID NO: 196; or HIn some of the provided embodiments, the second CAR of the modified cells of the provided methods of treatment or compositions for use in treatment comprises an extracellular antigen-binding domain in which the VL region and the VL region comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. H The VL and VL regions comprise an extracellular antigen-binding domain comprising the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively.

[0135] In some of any of the provided embodiments, the extracellular antigen-binding domain of the second CAR of the engineered cell in the provided methods of treatment or compositions for use in treatment is a single-chain antibody fragment. In some of any of the provided embodiments, the fragment is or comprises a single-chain variable fragment (scFv).

[0136] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the V of the extracellular antigen-binding domain of the second CAR of the modified cell in the composition H Area and V L The regions are connected by a flexible linker. In some of any of the provided embodiments, the linker of the second CAR of the engineered cell in the composition has the amino acid sequence In some of any of the provided embodiments, the linker of the second CAR of the engineered cell in the composition has the amino acid sequence Contains TIFF0007742773000018.tif4128.

[0137] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, a V H The area is V LIn some of any of the provided embodiments of the provided methods, a V H The area is V L It is carboxy-terminal to the region.

[0138] In some of the provided embodiments of the provided methods, or some of the provided embodiments for use in therapy, the extracellular antigen-binding domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of the provided embodiments of the provided methods, the antigen-binding domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the extracellular antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:241. In some of the provided embodiments of the provided methods, the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241.

[0139] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the extracellular antigen-binding domain of the second CAR is H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively; L the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; or the V of the second CAR H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 215, 216, and 217, respectively; L the regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively; and / or the V of the second CAR H The VL and VL regions comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. H Area and V L and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241. In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the extracellular antigen-binding domain of the second CAR comprises the V H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively; Lthe regions include CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or the V of the second CAR H The VL and VL regions comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. H Area and V L and / or the antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241.

[0140] In some of any of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the transmembrane domain of the second CAR is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. In some of the provided embodiments of the provided methods, the transmembrane domain of the second CAR is or comprises a transmembrane domain derived from human CD28; and / or the transmembrane domain is or comprises the sequence set forth in SEQ ID NO: 18, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some of the provided embodiments of the provided methods, the transmembrane domain of the second CAR is or comprises the sequence set forth in SEQ ID NO: 18.

[0141] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the intracellular signaling region of the second CAR comprises an intracellular signaling domain. In some of the provided embodiments of the provided methods, the intracellular signaling domain of the second CAR is capable of inducing a primary activation signal in a T cell, is a component of a T cell receptor (TCR), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of the provided embodiments of the provided methods, the intracellular signaling domain of the second CAR is or comprises the cytoplasmic signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. In some of any of the provided embodiments of the provided methods, the intracellular signaling region of the second CAR comprises the sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:20.

[0142] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the intracellular signaling region of the second CAR further comprises a costimulatory signaling region. In some of the provided embodiments of the provided methods, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of a T cell costimulatory molecule, or a signaling portion thereof. In some of the provided embodiments of the provided methods, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, optionally the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. In some of the provided embodiments of the provided methods, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of 4-1BB, or a signaling portion thereof, optionally the intracellular signaling domain of human 4-1BB. In some of any of the provided embodiments, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor comprises an intracellular signaling region that comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally an intracellular signaling region that comprises the intracellular signaling domain of human 4-1BB.

[0143] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in a therapy, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of human CD28; and / or the sequence set forth in SEQ ID NO:46, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46.

[0144] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the costimulatory signaling region of the second CAR comprises the intracellular signaling domain of human 4-1BB; and / or the sequence set forth in SEQ ID NO:19, or an amino acid sequence exhibiting at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19.

[0145] In some of the provided embodiments of the provided methods or some of the provided embodiments for use in therapy, the encoded second chimeric antigen receptor comprises, in order from its N-terminus to C-terminus, an antigen-binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0146] Among the polynucleotides provided herein are polynucleotides comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain; and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain, wherein the first CAR and the second CAR each comprise: (a) the first antigen-binding domain or the second antigen-binding domain, (b) a spacer, (c) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region, wherein one or more of (b) through (d) of the first CAR and the same one or more of (b) through (d) of the second CAR comprise the same amino acid sequence; and the nucleotide sequence encoding one or more of (b) through (d) of the first CAR differs in sequence from the nucleotide sequence encoding the same one or more of (b) through (d) of the second CAR.

[0147] Also disclosed is a polynucleotide comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain capable of binding to one of GPRC5D or BCMA; and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain capable of binding to the other of GPRC5D or BCMA, wherein the first CAR and the second CAR each comprise: (a) the first antigen-binding domain or the second antigen-binding domain, (b) a spacer, (c) a membrane Also provided herein are polynucleotides comprising (b) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region, wherein one or more of (b)-(d) of the first CAR and the same one or more of (b)-(d) of the second CAR comprise identical amino acid sequences; and wherein the nucleotide sequence encoding one or more of (b)-(d) of the first CAR differs in sequence from the nucleotide sequence encoding the same one or more of (b)-(d) of the second CAR.

[0148] In some of any of the provided embodiments, the first antigen-binding domain and the second antigen-binding domain bind to the same antigen. In some of any of the provided embodiments, the first antigen-binding domain and the second antigen-binding domain bind to different epitopes of the same antigen. In some of any of the provided embodiments, the first antigen-binding domain and the second antigen-binding domain bind to different antigens. In some of any of the provided embodiments, the first antigen-binding domain binds to a first antigen expressed by or associated with cells of a disease or pathology, and the second antigen-binding domain binds to a second antigen expressed by or associated with cells of the same disease or pathology.

[0149] In some of any of the provided embodiments, the disease or condition is cancer. In some of any of the provided embodiments, the disease or condition is a cancer that expresses GPRC5D. In some of any of the provided embodiments, the disease or condition is a cancer that expresses BCMA. In some of any of the provided embodiments, the disease or condition is a cancer that expresses BCMA and GPRC5D. In some of any of the provided embodiments, the cancer is a plasma cell malignancy, and the plasma cell malignancy is multiple myeloma (MM) or plasmacytoma. In some of any of the provided embodiments, the cancer is multiple myeloma. In some of any of the provided embodiments, the cancer is relapsed / refractory multiple myeloma.

[0150] In some of any of the provided embodiments, the first antigen-binding domain and the second antigen-binding domain independently bind to an antigen selected from the group consisting of GPRC5D, BCMA, CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5. In some of any of the provided embodiments, the first antigen-binding domain binds to B-cell maturation antigen (BCMA). In some of any of the provided embodiments, the first antigen-binding domain binds to G protein-coupled receptor class C group 5 member D (GPRC5D). In some of any of the provided embodiments, the second antigen-binding domain binds to BCMA. In some of any of the provided embodiments, the second antigen-binding domain binds to GPRC5D.

[0151] In some of any of the provided embodiments, (a) is or comprises a first antigen-binding domain or a second antigen-binding domain, (b) is or comprises a spacer, (c) is or comprises a transmembrane domain, and (d) is or comprises an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the provided embodiments, one or more of (b)-(d) is one of (b)-(d). In some of any of the provided embodiments, one or more of (b)-(d) is two of (b)-(d). In some of any of the provided embodiments, one or more of (b)-(d) is each of (b)-(d).

[0152] In some of any of the provided embodiments, (a) is or comprises a first antigen-binding domain or a second antigen-binding domain, (b) is or comprises a spacer, (c) is or comprises a transmembrane domain, and (d) is or comprises an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the provided embodiments, the nucleotide sequence encoding one or more of (a)-(d) of the first CAR and the nucleotide sequence encoding the same one or more of (a)-(d) of the second CAR comprise about 20 or less consecutive base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR comprise about 20 or less consecutive base pairs of sequence homology. In some of any of the provided embodiments, the nucleotide sequence encoding one or more of (a)-(d) of the first CAR and the nucleotide sequence encoding the same one or more of (a)-(d) of the second CAR comprise about 5 or less to about 15 contiguous base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR comprise about 5 or less and about 15 contiguous base pairs of sequence homology. In some of any of the provided embodiments, the nucleotide sequence encoding one or more of (a)-(d) of the first CAR and the nucleotide sequence encoding the same one or more of (a)-(d) of the second CAR comprise about 10 or less contiguous base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR comprise about 10 or less contiguous base pairs of sequence homology.

[0153] In some of any of the provided embodiments, the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by a nucleotide sequence encoding a multicistronic element, and optionally the multicistronic element is a bicistronic element. In some of any of the provided embodiments, the multicistronic element is an IRES or a ribosomal skipping sequence or a self-cleaving peptide. In some of any of the provided embodiments, the multicistronic element is a ribosomal skipping sequence or a self-cleaving peptide, and the ribosomal skipping sequence or self-cleaving peptide is a T2A, P2A, E2A, or F2A element. In some of any of the provided embodiments, the nucleotide sequence encoding the one or more multicistronic elements is codon divergent. In some of any of the provided embodiments, the nucleotide sequence encoding T2A is codon divergent. In some of any of the provided embodiments, the nucleotide sequence encoding T2A is or comprises the sequence set forth in SEQ ID NO:319.

[0154] In some of any of the provided embodiments, the first nucleic acid sequence encoding the first CAR is codon-optimized for expression in a human cell. In some of any of the provided embodiments, the second nucleic acid sequence encoding the second CAR is codon-optimized for expression in a human cell. In some of any of the provided embodiments, the polynucleotide is codon-optimized for expression in a human cell. In some of any of the provided embodiments, after transcription of the polynucleotide in a human cell (optionally a human T cell), the mRNA, optionally messenger RNA, transcribed from the polynucleotide exhibits at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% RNA homogeneity. In some of any of the provided embodiments, following transcription in a human cell (optionally a human T cell) of a first nucleic acid encoding a first CAR of the polynucleotide, the mRNA, optionally messenger RNA, transcribed from the first nucleic acid exhibits at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% RNA homogeneity. In some of any of the provided embodiments, following transcription in a human cell (optionally a human T cell) of a second nucleic acid encoding a second CAR of the polynucleotide, the mRNA, optionally messenger RNA, transcribed from the second nucleic acid exhibits at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% RNA homogeneity.

[0155] In some of any of the provided embodiments, any potential splice donor sites and / or any potential splice acceptor sites present in the first nucleic acid encoding the first CAR have a nucleotide sequence of less than or at least about 0.70, less than or at least about 0.65, less than or at least about 0.65, less than or at least about 0.60, less than or at least about 0.55, less than or at least about 0.50, less than or at least about 0.45 or at least about 0.40, or less than about 0.35, or at least about 0.30, or less than about 0.25, or at least about 0.20, and / or are predicted to be involved in splice events less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20%. In some of any of the provided embodiments, any potential splice donor site or any potential splice acceptor site in the second nucleic acid encoding the second CAR has a RI of less than or at least about 0.70, less than or at least about 0.65, less than or at least about 0.65, less than or at least about 0.60, less than or at least about 0.55, less than or at least about 0.50, less than or at least about 0.45, exhibit a splice junction prediction score of less than or at least about 0.40, less than or at least about 0.35, less than or at least about 0.30, less than or at least about 0.25, less than or at least about 0.20, and / or are predicted to be involved in splice events less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% of the time.In some of any of the provided embodiments, any potential splice donor site or any potential splice acceptor site in the polynucleotide has a β-amino acid sequence of less than about 0.70 or at least less than about 0.70, less than about 0.65 or at least less than about 0.65, less than about 0.60 or at least less than about 0.60, less than about 0.55 or at least less than about 0.55, less than about 0.50 or at least less than about 0.50, less than about 0.45 or at least less than about 0.45, ... or at least about 0.40, or less than about 0.35, or at least about 0.35, or less than about 0.30, or at least about 0.30, or less than about 0.25, or at least about 0.25, or less than about 0.20, and / or are predicted to be involved in splice events less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% of the time.

[0156] In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) is a single-chain antibody fragment. In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) is or comprises a single-chain variable fragment (scFv). In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) comprises a heavy chain variable (VH) region and a light chain variable (VL) region.

[0157] In some of any of the provided embodiments, the first antigen-binding domain or the second antigen-binding domain comprises a VH region comprising CDR-H1 set forth in SEQ ID NO:209, CDR-H2 set forth in SEQ ID NO:210, and CDR-H3 set forth in SEQ ID NO:211, and a VL region comprising CDR-L1 set forth in SEQ ID NO:230, CDR-L2 set forth in SEQ ID NO:231, and CDR-L3 set forth in SEQ ID NO:232. In some of any of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs:197 and 198, respectively. In any of the provided embodiments, the first antigen-binding domain or the second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:241, or an amino acid sequence exhibiting at least or at least about 90%, at least or at least about 90%, at least or at least about 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least about 99% sequence identity to SEQ ID NO:241.

[0158] In any of the provided embodiments, one of the first or second antigen-binding domains comprises a VH region comprising CDR-H1 set forth in SEQ ID NO: 125, CDR-H2 set forth in SEQ ID NO: 126, and CDR-H3 set forth in SEQ ID NO: 127, and a VL region comprising CDR-L1 set forth in SEQ ID NO: 130, CDR-L2 set forth in SEQ ID NO: 131, and CDR-L3 set forth in SEQ ID NO: 132. In any of the provided embodiments, one of the first or second antigen-binding domains comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs: 27 and 28, respectively. In any of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:8, or an amino acid sequence exhibiting at least or at least about 90%, at least or at least about 90%, at least or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to SEQ ID NO:8.

[0159] In any of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain comprises a VH region comprising CDR-H1 set forth in SEQ ID NO:209, CDR-H2 set forth in SEQ ID NO:210, and CDR-H3 set forth in SEQ ID NO:211, and a VL region comprising CDR-L1 set forth in SEQ ID NO:230, CDR-L2 set forth in SEQ ID NO:231, and CDR-L3 set forth in SEQ ID NO:232; and the other of the first antigen-binding domain or the second antigen-binding domain comprises CDR-H1 set forth in SEQ ID NO:125, CDR-H2 set forth in SEQ ID NO:126, and CDR-H3 set forth in SEQ ID NO:127, and CDR-L1 set forth in SEQ ID NO:130, CDR-L2 set forth in SEQ ID NO:131, and CDR-L3 set forth in SEQ ID NO:132. In some of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NO: 197 and 198, respectively; and the other of the first antigen-binding domain or the second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NO: 27 and 28, respectively. In some of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 241, and the other of the first antigen-binding domain or the second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 8.

[0160] In some of any of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 310. In some of any of the provided embodiments, one of the first antigen-binding domain or the second antigen-binding domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 264 or SEQ ID NO: 311. In some of any of the provided embodiments, the first antigen-binding domain or the second antigen-binding domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 310, and the other of the first antigen-binding domain or the second antigen-binding domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 311.

[0161] In some of any of the provided embodiments, (b) is or comprises a spacer. In some of any of the provided embodiments, (b) comprises a portion of an immunoglobulin. In some of any of the provided embodiments, (b) comprises sequences of a hinge region, a CH2 region, and a CH3 region. In some of any of the provided embodiments, the hinge region comprises all or a portion of an IgG4 hinge region and / or an IgG2 hinge region, wherein the IgG4 hinge region is optionally a human IgG4 hinge region and the IgG2 hinge region is optionally a human IgG2 hinge region; C H 2 regions, IgG4 C H 2 and / or IgG2 C H 2, and the IgG4 C H 2 is optionally human IgG4 C H 2, and the IgG2 C H 2 is optionally human IgG2 C H 2; and / or C H The three regions are IgG4 C H 3 and / or IgG2 C H 3, and the IgG4 C H 3 is optionally human IgG4 C H3, and the IgG2 C H 3 is optionally human IgG2 C H In some of any of the provided embodiments, the hinge region, CH2, and CH3, are all or a portion of a hinge from human IgG4, C H All or part of 2, and C H In some of the embodiments provided, the hinge region, C H 2, and C H 3 is chimeric, and includes a hinge derived from human IgG4 and human IgG2, C H 2, and C H In some of any of the provided embodiments, (b) is selected from the group consisting of an IgG4 / 2 chimeric hinge region, or a modified IgG4 hinge region comprising at least one amino acid substitution compared to a human IgG4 hinge; an IgG2 / 4 chimeric hinge region; H 2 region; and IgG4 C H Includes three areas.

[0162] In some of any of the provided embodiments, (b) is or comprises a spacer. In some of any of the provided embodiments, (b) is 125 or about 125 to 300 or about 300 amino acids in length, 125 or about 125 to 250 or about 250 amino acids in length, 125 or about 125 to 230 or about 230 amino acids in length, 125 or about 125 to 200 or about 200 amino acids in length, 125 or about 125 to 180 or about 180 amino acids in length, 125 or about 125 to 150 or is about 150 amino acids in length, 150 or about 150 to 300 or about 300 amino acids in length, 150 or about 150 to 250 or about 250 amino acids in length, 150 or about 150 to 230 or about 230 amino acids in length, 150 or about 150 to 200 or about 200 amino acids in length, 150 or about 150 to 180 or about 180 amino acids in length, 180 or about 180 to 300 or about 300 amino acids in length, 180 or Approximately 180 to 250 or approximately 250 amino acids in length, 180 or approximately 180 to 230 or approximately 230 amino acids in length, 180 or approximately 180 to 200 or approximately 200 amino acids in length, 200 or approximately 200 to 300 or approximately 300 amino acids in length, 200 or approximately 200 to 250 or approximately 250 amino acids in length, 200 or approximately 200 to 230 or approximately 230 amino acids in length, 230 or approximately 230 to 300 or approximately 300 amino acids in length In some embodiments, (b) is 230 or about 230 to 250 or about 250 amino acids in length, or 250 or about 250 to 300 or about 300 amino acids in length, and optionally the spacer is 224 or about 224 amino acids in length, 225 or about 225 amino acids in length, 226 or about 226 amino acids in length, 227 or about 227 amino acids in length, 228 or about 228 amino acids in length, or 229 or about 229 amino acids in length. In some of any of the provided embodiments, (b) is or comprises the amino acid sequence set forth in SEQ ID NO:17.In some of any of the provided embodiments, one of the first CAR or the second CAR (b) is encoded by the nucleotide sequence set forth in SEQ ID NO:48, and the other of the first CAR or the second CAR (b) is encoded by the nucleotide sequence set forth in SEQ ID NO:305.

[0163] In some of any of the provided embodiments, (c) is or comprises a transmembrane domain. In some of any of the provided embodiments, (c) is or comprises a transmembrane domain of CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. In some of any of the provided embodiments, (c) is or comprises a transmembrane domain of human CD28. In some of any of the provided embodiments, (c) is or comprises the amino acid sequence set forth in SEQ ID NO:18. In some of any of the provided embodiments, (c) of one of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO:56, and (c) of the other of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO:307.

[0164] In some of any of the provided embodiments, (d) is or comprises an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the provided embodiments, the intracellular signaling domain of (d) is capable of inducing a primary activation signal in a T cell, is a component of a T cell receptor (TCR), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some of any of the provided embodiments, the intracellular signaling domain of (d) is or comprises the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. In some of any of the provided embodiments, the intracellular signaling domain of (d) is or comprises the amino acid sequence set forth in SEQ ID NO:20. In some of any of the provided embodiments, the intracellular signaling domain of (d) of one of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO:58, and the intracellular signaling domain of (d) of the other of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO:309. In some of any of the provided embodiments, (d) is or comprises an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the provided embodiments, the costimulatory signaling region of (d) comprises the intracellular signaling domain of a T cell costimulatory molecule, or a signaling portion thereof. In some of any of the provided embodiments, the costimulatory signaling region of (d) comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, optionally the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. In some of any of the provided embodiments, the costimulatory signaling region of (d) comprises the intracellular signaling domain of 4-1BB.In some of any of the provided embodiments, the (d) costimulatory signaling region is or comprises the amino acid sequence set forth in SEQ ID NO: 19. In some of any of the provided embodiments, the (d) costimulatory signaling region of one of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO: 60, and the (d) costimulatory signaling region of the other of the first CAR or the second CAR is encoded by the nucleotide sequence set forth in SEQ ID NO: 308.

[0165] In some of any of the provided embodiments, (a) is or comprises a first antigen-binding domain or a second antigen-binding domain, (b) is or comprises a spacer, (c) is or comprises a transmembrane domain, and (d) is or comprises an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the provided embodiments, one of the first CAR or the second CAR comprises (a) a first antigen binding domain that binds to GPRC5D, optionally encoded by the nucleotide sequence set forth in SEQ ID NO:311, (b) a spacer encoded by nucleotides set forth in SEQ ID NO:305, (c) a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:307, and (d) an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO:308; and the other of the first CAR or the second CAR comprises (a) an antigen binding domain that binds BCMA, optionally encoded by the nucleotide sequence set forth in SEQ ID NO:310, (b) a spacer encoded by nucleotides set forth in SEQ ID NO:48, (c) a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:307, and (d) an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO:308. and (d) an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:58 and a costimulatory signaling domain region encoded by the nucleotide sequence set forth in SEQ ID NO:60.

[0166] In some of any of the provided embodiments, a first nucleic acid sequence encoding a first CAR is located toward the 5' end of the polynucleotide relative to a second nucleic acid sequence encoding the first CAR. In some of any of the provided embodiments, the first CAR comprises an antigen binding domain that binds to GPRC5D, and the second CAR comprises an antigen binding domain that binds to BCMA. In some of any of the provided embodiments, the first CAR comprises an antigen binding domain that binds to BCMA, and the second CAR comprises an antigen binding domain that binds to GPRC5D.

[0167] Also disclosed is a polynucleotide comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), and (iii) a nucleotide sequence encoding a multicistronic element, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic element; the first CAR comprises a first antigen binding domain that binds to GPRC5D, the first antigen binding domain optionally encoded by the nucleotide sequence set forth in SEQ ID NO:311; a spacer encoded by nucleotides set forth in SEQ ID NO:305; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:307; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO:308; and the second CAR comprises a second antigen binding domain that binds BCMA, optionally encoded by the nucleotide sequence set forth in SEQ ID NO:311. Also provided herein is a polynucleotide comprising: a second antigen-binding domain encoded by the nucleotide sequence set forth in SEQ ID NO:310; a spacer encoded by the nucleotides set forth in SEQ ID NO:48; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:56; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:58 and a costimulatory signaling domain region encoded by the nucleotide sequence set forth in SEQ ID NO:60, wherein a first nucleic acid sequence encoding the first CAR is positioned toward the 5' end of the polynucleotide relative to a second nucleic acid sequence encoding the second CAR.

[0168] Also disclosed is a polynucleotide comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), and (iii) a nucleotide sequence encoding a multicistronic element, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic element; the first CAR comprises a first antigen binding domain that binds to BCMA, the first antigen binding domain optionally encoded by the nucleotide sequence set forth in SEQ ID NO:310; a spacer encoded by nucleotides set forth in SEQ ID NO:48; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:56; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:58 and a costimulatory signaling domain region encoded by the nucleotide sequence set forth in SEQ ID NO:60; and the second CAR comprises a second antigen binding domain that binds to GPRC5D, optionally encoded by the nucleotide sequence set forth in SEQ ID NO: Also provided herein is a polynucleotide comprising: a second antigen-binding domain encoded by the nucleotide sequence set forth in SEQ ID NO:311; a spacer encoded by the nucleotides set forth in SEQ ID NO:305; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:307; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO:308, wherein a first nucleic acid encoding the first CAR is positioned toward the 5' end of the polynucleotide relative to a second nucleic acid sequence encoding the second CAR.

[0169] In some of any of the provided embodiments, the multicistronic element comprises the amino acid sequence set forth in SEQ ID NO:37. In some of any of the provided embodiments, the multicistronic element is encoded by the nucleotide sequence set forth in SEQ ID NO:44 or SEQ ID NO:45. In some of any of the provided embodiments, the multicistronic element is encoded by the nucleotide sequence set forth in SEQ ID NO:44. In some of any of the provided embodiments, the multicistronic element is encoded by the nucleotide sequence set forth in SEQ ID NO:45. In some of any of the provided embodiments, the multicistronic element is encoded by the nucleotide sequence set forth in SEQ ID NO:319.

[0170] In some of any of the embodiments provided, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 299. In some of any of the embodiments provided, the polynucleotide encodes the sequence set forth in SEQ ID NO: 298.

[0171] In some of any of the embodiments provided, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 302. In some of any of the embodiments provided, the polynucleotide encodes the sequence set forth in SEQ ID NO: 301.

[0172] In some of any of the embodiments provided, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 315. In some of any of the embodiments provided, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 316.

[0173] Also provided herein is a polynucleotide encoding a GPRC5D-binding domain, a BCMA-binding domain, and an intracellular signaling region comprising the intracellular signaling domain of 4-1BB. In some of any of the provided embodiments, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO:317.

[0174] Also provided are vectors comprising any of the provided polynucleotides. In some of any of the provided embodiments, the vector is a viral vector. In some of any of the provided embodiments, the viral vector is a lentiviral vector or a retroviral vector.

[0175] Also provided are modified cells comprising any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the modified cells comprise a chimeric antigen receptor provided herein and further comprise a polynucleotide comprising a nucleotide sequence encoding a second chimeric antigen receptor.

[0176] Also provided are modified cells comprising any of the polynucleotides provided herein.

[0177] In some of any of the provided embodiments, the modified cells are lymphocytes. In some of any of the provided embodiments, the modified cells are NK cells or T cells. In some of any of the provided embodiments, the modified cells are T cells, and the T cells are CD4+ T cells or CD8+ T cells.

[0178] In some of any of the provided embodiments, the modified cells are modified primary cells obtained from the subject.

[0179] In some of any of the provided embodiments, the modified cells are such that of a plurality of said modified cells, less than or about 10%, less than or about 9%, less than or about 8%, less than or about 7%, less than or about 7%, less than or about 5%, less than or about 4%, less than or about 4%, less than or about 3%, less than or about 2%, or less than or about 1% of the cells of said plurality comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0180] Also provided are compositions containing any of the chimeric receptors provided herein. In some of any of the provided embodiments, the compositions comprise CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1 or about 1:3 to about 3:1. In some embodiments, the ratio of CD4+ T cells to CD8+ T cells in the composition is 1:2 to 2:1. In some embodiments, the ratio of CD4+ T cells to CD8+ T cells in the composition is 1:1. In some of any of the provided embodiments, the composition further comprises a pharmaceutically acceptable excipient. In some of any of the provided embodiments, the composition is sterile.

[0181] Also provided herein are methods of treatment that include administering to a subject having a disease or disorder any of the compositions provided herein comprising any of the modified cells provided herein or any of the compositions provided herein comprising any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the dose of cells is 2.5 x 10 7 Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 108 CAR-expressing T cells, 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 In some of either embodiment, the dose of cells comprises 1 x 10 CAR-expressing T cells. 7 Or about 1 x 10 7 CAR-expressing T cells ~2 x 10 9 Or about 2 x 10 9 In some of either embodiment, the dose of cells comprises 2.5 x 10 CAR-expressing T cells. 7 Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, or 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 In some of either embodiment, the dose of cells comprises 1.5 x 10 CAR-expressing T cells. 7 Or about 1.5 x 10 7 pieces, 2.5×10 7 Or about 2.5 x 10 7 pieces, 5.0×10 7 or approximately 5.0 x 10 7 pieces, 7.5×10 7 Or about 7.5 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 2.25×10 8 Or about 2.25 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, 4.5×10 8 or about 4.5 x 10 8pieces, 6.0×10 8 or approximately 6.0 x 10 8 pieces, 8.0×10 8 or approximately 8.0 x 10 8 pieces, or 1.2 x 10 9 or about 1.2 x 10 9 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 or 4.5 x 10 8 or about 4.5 x 10 8 In some of either embodiment, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 pieces, 1.5×10 8 Or about 1.5 x 10 8 pieces, 3.0×10 8 Or about 3.0 x 10 8 pieces, or 4.5 x 10 8 or about 4.5 x 10 8 In some of any of the embodiments, the dose of cells comprises 5.0 x 10 CAR-expressing T cells. 7 or approximately 5.0 x 10 7 Contains CAR-expressing T cells.

[0182] Also provided herein are methods of treatment that include administering to a subject having a disease or disorder any of the compositions provided herein comprising any of the modified cells provided herein or any of the compositions provided herein comprising any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the dose of cells is 1.0 x 10 7 or approximately 1.0 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 1.5 x 107 Or about 1.5 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, 2.0 x 10 7 Or about 2.0 x 10 7 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 Contains CAR-expressing T cells.

[0183] Also provided herein are methods of treatment comprising administering to a subject having a disease or disorder a composition containing a plurality of modified cells comprising a first chimeric antigen receptor and a second chimeric antigen receptor, each of which is any chimeric antigen receptor provided herein or any chimeric antigen receptor encoded by any polynucleotide provided herein; and administering to the subject a composition containing a plurality of second modified cells comprising the second chimeric antigen receptor. In some of any of the provided embodiments, the dose of the first plurality of modified cells and the dose of the second plurality of modified cells are independently 1.0 x 10 7 or approximately 1.0 x 10 7 CAR-expressing T cells ~1.5 x 10 9 Or about 1.5 x 10 9 CAR-expressing T cells, 1.25 x 10 7 Or about 1.25 x 10 7 CAR-expressing T cells ~0.6 x 10 8 or approximately 0.6 x 10 8 CAR-expressing T cells, 2.5 x 10 7 Or about 2.5 x 10 7 CAR-expressing T cells ~2.25 x 10 8 Or about 2.25 x 10 8 CAR-expressing T cells, 7.5 x 10 7 Or about 7.5 x 10 7 CAR-expressing T cells ~1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells, 2.5 x 10 7Or about 2.5 x 10 7 CAR-expressing T cells ~1.2 x 10 9 or about 1.2 x 10 9 CAR-expressing T cells, 5.0 x 10 7 or approximately 5.0 x 10 7 CAR-expressing T cells ~4.5 x 10 8 or about 4.5 x 10 8 CAR-expressing T cells, 1.5 x 10 8 Or about 1.5 x 10 8 CAR-expressing T cells ~3.0 x 10 8 Or about 3.0 x 10 8 Contains CAR-expressing T cells.

[0184] In some of any of the provided embodiments of the provided methods, the disease or disorder is associated with expression of G protein-coupled receptor class C group 5 member D (GPRC5D).

[0185] In some of any of the provided embodiments of the provided methods, the disease or disorder is further associated with expression of B-cell maturation antigen (BCMA).

[0186] In some of any of the provided embodiments of the provided methods, the disease or disorder is a B-cell associated disorder. In some of any of the provided embodiments of the provided methods, the disease or disorder associated with BCMA is an autoimmune disease or disorder. In some of any of the provided embodiments of the provided methods, the autoimmune disease or disorder is systemic lupus erythematosus (SLE), lupus nephritis, inflammatory bowel disease, rheumatoid arthritis, ANCA-associated vasculitis, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, Chagas' disease, Graves' disease, Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathy, vasculitis, diabetes mellitus, Raynaud's syndrome, antiphospholipid syndrome, Goodpasture's disease, Kawasaki's disease, autoimmune hemolytic anemia, myasthenia gravis, or progressive glomerulonephritis.

[0187] In some of any of the provided embodiments of the provided methods, the disease or disorder is cancer. In some of any of the provided embodiments of the provided methods, the cancer is a GPRC5D-expressing cancer. In some of any of the provided embodiments of the provided methods, the cancer is a plasma cell malignancy, and the plasma cell malignancy is multiple myeloma (MM) or plasmacytoma. In some of any of the provided embodiments of the provided methods, the cancer is multiple myeloma (MM). In some of any of the provided embodiments of the provided methods, the cancer is relapsed / refractory multiple myeloma.

[0188] In some of any of the provided embodiments of the provided methods, the subject is refractory to BCMA-targeted therapy, optionally to T cells comprising a CAR that specifically binds BCMA, or has relapsed after administration of BCMA-targeted therapy, optionally after administration of T cells comprising a CAR that specifically binds BCMA. In some of any of the provided embodiments of the provided methods, a subject who is refractory to BCMA-targeted therapy, optionally to T cells comprising a CAR that specifically binds BCMA, or has relapsed after administration of BCMA-targeted therapy, optionally after administration of T cells comprising a CAR that specifically binds BCMA, is selected for treatment. In some of any of the provided embodiments of the provided methods, the subject has previously undergone administration of a BCMA-targeted therapy for the treatment of the disease or disorder prior to administration of the dose of cells. In some of any of the provided embodiments of the provided methods, the subject has previously undergone administration of a BCMA-targeted therapy for the treatment of the disease or disorder prior to administration of the first dose of cells and the second dose of cells.

[0189] In some of any of the provided embodiments of the provided methods, the BCMA-targeted therapy comprises a composition comprising T cells comprising a CAR that specifically binds BCMA. In some of any of the provided embodiments of the provided methods, the subject is refractory to the BCMA-targeted therapy, optionally to T cells comprising a CAR that specifically binds BCMA, or has relapsed after administration of the BCMA-targeted therapy, optionally after administration of T cells comprising a CAR that specifically binds BCMA. In some of any of the provided embodiments of the provided methods, the subject comprises multiple myeloma cells that exhibit loss of the BCMA antigen or epitope, downregulation of BCMA, and / or BCMA-negative tumor cells after the previous administration. [The present invention 1001] (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:21, 23, 25, 27, 29, 31, or 33; H ) area; and (ii) a light chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68, or 69; L )region an extracellular antigen-binding domain comprising: (2) a spacer at least 125 amino acids long; (3) a transmembrane domain; and (4) Intracellular signal transduction region A chimeric antigen receptor comprising: [The present invention 1002] (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), (i) V selected from SEQ ID NOs: 21, 23, 25, 27, 29, 31, and 33 H heavy chain variable (V) region, including heavy chain complementarity determining region 1 (CDR-H1), heavy chain complementarity determining region 2 (CDR-H2), and heavy chain complementarity determining region 3 (CDR-H3), which are contained within the amino acid sequence of the heavy chain variable (V) region. H ) area; and (ii) V selected from SEQ ID NOs: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68, and 69 L The light chain variable (V) region includes the light chain complementarity determining region 1 (CDR-L1), the light chain complementarity determining region 2 (CDR-L2), and the light chain complementarity determining region 3 (CDR-L3), which are contained within the amino acid sequence of the V L )region an extracellular antigen-binding domain comprising: (2) a spacer at least 125 amino acids long; (3) a transmembrane domain; and (4) Intracellular signal transduction region A chimeric antigen receptor comprising: [The present invention 1003] (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), (i) a CDR-H1 comprising an amino acid sequence selected from SEQ ID NOs: 75, 78, 80, 90, 93, 95, 105, 108, 110, 120, 123, 125, 135, 138, 140, 152, 162, 165, and 167; (b) a CDR-H2 comprising an amino acid sequence selected from SEQ ID NOs: 76, 79, 81, 91, 94, 96, 106, 109, 111, 121, 124, 126, 136, 139, 141, 150, 153, 154, 163, 166, and 168; and (c) a CDR-H3 comprising an amino acid sequence selected from SEQ ID NOs: 77, 92, 107, 122, 137, 151, and 164. H ) area; and (ii) a light chain variable (V) comprising: (a) a CDR-L1 comprising an amino acid sequence selected from SEQ ID NOs: 85, 100, 115, 130, 145, 157, and 172; (b) a CDR-L2 comprising an amino acid sequence selected from SEQ ID NOs: 86, 101, 116, 131, 146, and 158; and (c) a CDR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 87, 102, 117, 132, 147, 159, 173, and 297. L )region an extracellular antigen-binding domain comprising: (2) a spacer at least 125 amino acids long; (3) a transmembrane domain; and (4) Intracellular signal transduction region A chimeric antigen receptor comprising: [The present invention 1004] the extracellular antigen-binding domain (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:21, 23, 25, 27, 29, 31, or 33; H ) area; and (ii) a light chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68, or 69; L )region The chimeric antigen receptor of the present invention 1002 or 1003, comprising: [The present invention 1005] The spacer is 125 to 300 or about 125 to about 300, 125 to 250 or about 125 to about 250, 125 to 230 or about 125 to about 230, 125 to 200 or about 125 to about 200, 125 to 180 or about 125 to about 180, 125 to 150 or about 125 to about 150, 150 to 300 or about 150 to about 300, 150 to 250 or about 150 to about 250, 150 to 230 or about 150 to about 230, 150 to 200 or about 150 to about 200, 150 to 180 or about 150 to about 180, 180 to 300 or about The chimeric antigen receptor of any of the present inventions 1001 to 1004, having a length of 180 to about 300, 180 to 250 or about 180 to about 250, 125 to 300 or about 125 to about 300, 180 to 230 or about 180 to about 230, 180 to 200 or about 180 to about 200, 200 to 300 or about 200 to about 300, 200 to 250 or about 200 to about 250, 200 to 230 or about 200 to about 230, 230 to 300 or about 230 to about 300, 230 to 250 or about 230 to about 250, or 250 to 300 or about 250 to about 300. [The present invention 1006] The spacer is 130 amino acids or at least about 130 amino acids in length, 140 amino acids or at least about 140 amino acids in length, 150 amino acids or at least about 150 amino acids in length, 160 amino acids or at least about 160 amino acids in length, 170 amino acids or at least about 170 amino acids in length, 180 amino acids or at least about 180 amino acids in length, 190 amino acids or at least about 190 amino acids in length, 200 amino acids or at least about 200 amino acids in length, 210 amino acids or at least about 210 amino acids in length, or 220 amino acids or at least about 220 amino acids in length. is 221 amino acids in length, or at least about 221 amino acids in length, 222 amino acids in length, or at least about 222 amino acids in length, 223 amino acids in length, 224 amino acids in length, 225 amino acids in length, or at least about 225 amino acids in length, 226 amino acids in length, 227 amino acids in length, 228 amino acids in length, or 229 amino acids in length, or having a length between any of the foregoing; or The spacer is about or at least about 130 amino acids in length, about or at least about 140 amino acids in length, about or at least about 150 amino acids in length, about or at least about 160 amino acids in length, about or at least about 170 amino acids in length, about or at least about 180 amino acids in length, about or at least about 190 amino acids in length, about or at least about 200 amino acids in length, about or at least about 210 amino acids in length, or about or at least about 220 amino acids in length. or at least about 221 amino acids in length, about 222 amino acids in length, about 223 amino acids in length, about 224 amino acids in length, about 225 amino acids in length, about 226 amino acids in length, about 227 amino acids in length, about 228 amino acids in length, or about 229 amino acids in length, or having a length between any of the foregoing. The chimeric antigen receptor of any one of 1001 to 1005 of the present invention. [The present invention 1007] 1007. The chimeric antigen receptor of any one of 1001 to 1006, wherein the spacer comprises a portion of an immunoglobulin. [The present invention 1008] The chimeric antigen receptor of any of claims 1001 to 1007, wherein the spacer comprises sequences of a hinge region, a CH2 region, and a CH3 region. [The present invention 1009] the hinge region comprises all or a portion of an IgG4 hinge region and / or an IgG2 hinge region, wherein the IgG4 hinge region is optionally a human IgG4 hinge region and the IgG2 hinge region is optionally a human IgG2 hinge region; Said C H 2 domains IgG4 C H 2 and / or IgG2 C H 2, wherein the IgG4 C H 2 is optionally human IgG4 C H 2, and the IgG2 C H 2 is optionally human IgG2 C H 2; and / or Said C H 3 regions IgG4 C H 3 and / or IgG2 C H 3, wherein the IgG4 C H 3 is optionally human IgG4 C H 3, and the IgG2 C H 3 is optionally human IgG2 C H 3, The chimeric antigen receptor of the present invention. [The present invention 1010] The hinge region, CH2, and CH3 are all or a part of a hinge derived from human IgG4, H All or part of 2, and C H 1008 or 1009, a chimeric antigen receptor of the present invention, comprising all or a part of 3. [The present invention 1011] Said hinge area, C H 2, and C H 3 are chimeric, including hinges derived from human IgG4 and human IgG2, C H 2, and C H 3. The chimeric antigen receptor of the present invention 1008 or 1009, [The present invention 1012] The spacer is an IgG4 / 2 chimeric hinge region, or a modified IgG4 hinge region containing at least one amino acid substitution compared to a human IgG4 hinge; an IgG2 / 4 chimeric hinge region;H 2 region; and IgG4 C H A chimeric antigen receptor according to any one of 1001 to 1011 of the present invention, comprising three regions. [The present invention 1013] The spacer is (i) the sequence shown in SEQ ID NO:17; (ii) a functional variant of SEQ ID NO:17 having at least 95%, at least 96%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least 99% sequence identity to SEQ ID NO:17; or (iii) a continuous portion of (i) or (ii) that is at least 125 amino acids in length The chimeric antigen receptor of any one of 1001 to 1012 of the present invention, which is or comprises the same. [The present invention 1014] The chimeric antigen receptor of any of claims 1001 to 1013, wherein the spacer is or comprises the sequence shown in SEQ ID NO: 17. [The present invention 1015] The chimeric antigen receptor of any of claims 1001 to 1014, wherein the spacer is or comprises an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO:74. [The present invention 1016] The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:21; and L the region comprises the amino acid sequence set forth in SEQ ID NO:22, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:22; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:21; and L the region comprises the amino acid sequence set forth in SEQ ID NO:63, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:63; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:23, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:23; and L the region comprises the amino acid sequence set forth in SEQ ID NO:24, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:24; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:23, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:23; and L the region comprises the amino acid sequence set forth in SEQ ID NO:64, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:64; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:25, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:25; and L the region comprises the amino acid sequence set forth in SEQ ID NO:26, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:26; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:25, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:25; and L the region comprises the amino acid sequence set forth in SEQ ID NO:65, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:65; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises the amino acid sequence set forth in SEQ ID NO:28, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:28; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises the amino acid sequence set forth in SEQ ID NO:66, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:66; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:29, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:29; and L the region comprises the amino acid sequence set forth in SEQ ID NO:30, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:30; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:29, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:29; and L the region comprises the amino acid sequence set forth in SEQ ID NO:67, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:67; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:31, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:31; and L the region comprises the amino acid sequence set forth in SEQ ID NO:32, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:32; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:31, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:31; and L the region comprises the amino acid sequence set forth in SEQ ID NO:68, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:68; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:33, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:33; and L the region comprises the amino acid sequence set forth in SEQ ID NO:34, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:34; or The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:33, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:33; and L the region comprises an amino acid sequence set forth in SEQ ID NO:69, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:69; The chimeric antigen receptor of any one of 1001 to 1015 of the present invention. [The present invention 1017] The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 80, 81, and 77, respectively; L whether the regions comprise the amino acid sequences of SEQ ID NOs: 85, 86, and 87, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 95, 96, and 92, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 100, 101, and 102, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 110, 111, and 107, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 115, 116, and 117, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 140, 141, and 137, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 145, 146, and 147, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 140, 154, and 151, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 157, 158, and 159, respectively; The above V H the V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 167, 168, and 164, respectively;L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 172, 86, and 173, respectively; or The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 169, 170, and 171, respectively; L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 174, 89, and 297, respectively; The chimeric antigen receptor of any one of 1001 to 1016 of the present invention. [The present invention 1018] The above V H Region and V L whether the region comprises the amino acid sequences set forth in SEQ ID NOs:21 and 22, respectively, or the amino acid sequences set forth in SEQ ID NOs:21 and 63, respectively; The above V H Region and V L whether the region comprises the amino acid sequence set forth in SEQ ID NOs:23 and 24, respectively, or the amino acid sequence set forth in SEQ ID NOs:23 and 64, respectively; The above V H Region and V L whether the region comprises the amino acid sequence set forth in SEQ ID NOs:25 and 26, respectively, or the amino acid sequence set forth in SEQ ID NOs:25 and 65, respectively; The above V H Region and V L whether the region comprises the amino acid sequence set forth in SEQ ID NOs:27 and 28, respectively, or the amino acid sequence set forth in SEQ ID NOs:27 and 66, respectively; The above V H Region and V L whether the region comprises the amino acid sequence set forth in SEQ ID NOs:29 and 30, respectively, or the amino acid sequence set forth in SEQ ID NOs:29 and 67, respectively; The above V H Region and V L the region comprises the amino acid sequence set forth in SEQ ID NOs:31 and 32, respectively, or the amino acid sequence set forth in SEQ ID NOs:31 and 68, respectively; or The above V H Region and V L The region comprises the amino acid sequence set forth in SEQ ID NOs: 33 and 34 or the amino acid sequence set forth in SEQ ID NOs: 33 and 69, respectively; The chimeric antigen receptor of any one of 1001 to 1017 of the present invention. [The present invention 1019] The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:21; and L the region comprises the amino acid sequence set forth in SEQ ID NO:22, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:22; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:21; and L the region comprises the amino acid sequence set forth in SEQ ID NO:63, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:63; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:23, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:23; and L the region comprises the amino acid sequence set forth in SEQ ID NO:24, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:24; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:23, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:23; and L the region comprises the amino acid sequence set forth in SEQ ID NO:64, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:64; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises the amino acid sequence set forth in SEQ ID NO:28, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:28; The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises the amino acid sequence set forth in SEQ ID NO:66, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:66; The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:31, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:31; and L the region comprises the amino acid sequence set forth in SEQ ID NO:32, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:32; or The above V H wherein the region comprises an amino acid sequence set forth in SEQ ID NO:31, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:31; and L the region comprises an amino acid sequence set forth in SEQ ID NO:68, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:68; The chimeric antigen receptor of any one of 1001 to 1018 of the present invention. [The present invention 1020] The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 80, 81, and 77, respectively; L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87, respectively; The above V H The V region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 95, 96, and 92, respectively; L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 100, 101, and 102, respectively; The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively; L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; or The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 140, 154, and 151, respectively; L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 157, 158, and 159, respectively; The chimeric antigen receptor of any one of 1001 to 1019 of the present invention. [The present invention 1021] The above V H Region and V L whether the region comprises the amino acid sequences set forth in SEQ ID NOs:21 and 22, respectively, or the amino acid sequences set forth in SEQ ID NOs:21 and 63, respectively; The above V H Region and V L whether the region comprises the amino acid sequence set forth in SEQ ID NOs:23 and 24, respectively, or the amino acid sequence set forth in SEQ ID NOs:23 and 64, respectively; The above V H Region and VL the region comprises the amino acid sequence set forth in SEQ ID NOs:27 and 28, respectively, or the amino acid sequence set forth in SEQ ID NOs:27 and 66, respectively; or The above V H Region and V L The region comprises the amino acid sequence set forth in SEQ ID NOs: 31 and 32, respectively, or the amino acid sequence set forth in SEQ ID NOs: 31 and 68, respectively; The chimeric antigen receptor of any one of 1001 to 1020 of the present invention. [The present invention 1022] The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises the amino acid sequence set forth in SEQ ID NO:28, or an amino acid sequence having at least or at least about 90%, at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:28; or The above V H wherein the V region comprises an amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% identity to SEQ ID NO:27; and L the region comprises an amino acid sequence set forth in SEQ ID NO:66, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% identity to SEQ ID NO:66; A chimeric antigen receptor according to any one of 1001 to 1021 of the present invention. [The present invention 1023] V as shown in SEQ ID NO:27 H Heavy chain variable (V) domains, including CDR-H1, CDR-H2, and CDR-H3, contained within the amino acid sequence H ) region; and the V region shown in SEQ ID NO: 28 or 66 L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L 10. The chimeric antigen receptor of any one of claims 1001 to 1022, comprising a nucleotide sequence similar to that of claim 10. [The present invention 1024] The above V H The V region comprises the amino acid sequence of SEQ ID NO: 125, 126 and 122, respectively, and L The chimeric antigen receptor of any of claims 1001 to 1023, wherein the regions comprise the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. [The present invention 1025] The above V H The V region comprises the amino acid sequence of SEQ ID NO: 127, 128 and 129, respectively, and L The chimeric antigen receptor of any of claims 1001 to 1023, wherein the regions comprise the amino acid sequences of SEQ ID NOs: 133, 134 and 132, respectively. [The present invention 1026] The above V H The V region comprises the amino acid sequence of SEQ ID NO: 120, 121 and 122, respectively, and L The chimeric antigen receptor of any of claims 1001 to 1023, wherein the regions comprise the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. [The present invention 1027] The above V H The V region comprises the amino acid sequence of SEQ ID NO: 123, 124 and 122, respectively, and L The chimeric antigen receptor of any of claims 1001 to 1023, wherein the regions comprise the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. [The present invention 1028] The above V H Region and V L The chimeric antigen receptor of any of claims 1001 to 1023, wherein the region comprises the amino acid sequence shown in SEQ ID NOs: 27 and 28, respectively, or the amino acid sequence shown in SEQ ID NOs: 27 and 66, respectively. [The present invention 1029] The chimeric antigen receptor of any of claims 1001 to 1028, wherein the extracellular antigen-binding domain is a single-chain antibody fragment. [The present invention 1030] The chimeric antigen receptor of any of claims 1001 to 1029, wherein the single-chain antibody fragment is or comprises a single-chain variable fragment (scFv). [The present invention 1031] The above V H Region and V L The chimeric antigen receptor of any of 1001 to 1030, wherein the regions are linked by a flexible linker. [The present invention 1032] The linker comprises the amino acid sequence TIFF0007742773000019.tif4128 The chimeric antigen receptor of the present invention. [The present invention 1033] The above V H The region is V L The chimeric antigen receptor of any one of 1001 to 1032 of the present invention, wherein the chimeric antigen receptor is located on the amino terminal side of the region. [The present invention 1034] the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11 and 13, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11 and 13; and / or the extracellular antigen-binding domain is encoded by a nucleotide sequence selected from SEQ ID NOs: 257, 259, 261, 263, 265, 267, and 269, or a nucleotide sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 257, 259, 261, 263, 265, 267, and 269; The chimeric antigen receptor of any one of 1001 to 1033 of the present invention. [This invention 1035] The chimeric antigen receptor of any of claims 1001 to 1034, wherein the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11 and 13. [The present invention 1036] The chimeric antigen receptor of any of claims 1001 to 1034, wherein the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 1, 3, 7, and 11, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 1, 3, 7, and 11. [This invention 1037] The chimeric antigen receptor of any one of claims 1001 to 1036, wherein the antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 1, 3, 7, and 11. [The present invention 1038] The chimeric antigen receptor of any of claims 1001 to 1034 or 1037, wherein the antigen-binding domain comprises an amino acid sequence set forth in SEQ ID NO:7, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:7. [This invention 1039] The chimeric antigen receptor of any of claims 1001 to 1038, wherein the antigen-binding domain comprises the amino acid sequence shown in SEQ ID NO:7. [The present invention 1040] The above V H The region is V L The chimeric antigen receptor of any one of 1001 to 1032 of the present invention, wherein the chimeric antigen receptor is located on the carboxy-terminal side of the region. [This invention 1041] the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14, or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14; and / or the extracellular antigen-binding domain is encoded by a nucleotide sequence selected from SEQ ID NOs: 258, 260, 262, 264, 266, 268, and 270, or a nucleotide sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 258, 260, 262, 264, 266, 268, and 270; The chimeric antigen receptor of any one of 1001 to 1032 and 1040 of the present invention. [The present invention 1042] The chimeric antigen receptor of any one of claims 1001 to 1032, 1040 and 1041, wherein the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14. [This invention 1043] The chimeric antigen receptor of any of claims 1001 to 1032, 1040, and 1041, wherein the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 2, 4, 8, and 12, or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 2, 4, 8, and 12. [This invention 1044] The chimeric antigen receptor of any one of claims 1001 to 1032 or 1040 to 1043, wherein the extracellular antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 2, 4, 8 and 12. [This invention 1045] The chimeric antigen receptor of any of claims 1001 to 1032, 1040, 1041 and 1043, wherein the antigen-binding domain comprises an amino acid sequence set forth in SEQ ID NO:8, or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:8. [The present invention 1046] The chimeric antigen receptor of any one of claims 1001 to 1032 or 1040 to 1045, wherein the extracellular antigen-binding domain comprises the amino acid sequence shown in SEQ ID NO:8. [This invention 1047] The chimeric antigen receptor of any of claims 1001 to 1046, wherein the intracellular signaling region comprises an intracellular cytoplasmic signaling domain. [This invention 1048] 1047. The chimeric antigen receptor of the present invention, wherein said intracellular signaling domain is or comprises the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof. [This invention 1049] 1047. The chimeric antigen receptor of any of the present invention 1047 or 1048, wherein the intracellular signaling domain is or comprises an amino acid sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least 99% sequence identity to SEQ ID NO:20. [The present invention 1050] The chimeric antigen receptor of any of 1047 to 1049 of the present invention, wherein the intracellular signaling region further comprises a costimulatory signaling region. [This invention 1051] 1050. The chimeric antigen receptor of the present invention, wherein said costimulatory signaling region comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof. [This invention 1052] 1050 or 1051, the chimeric antigen receptor of the present invention, wherein said costimulatory signaling region comprises the intracellular signaling domain of CD28. [This invention 1053] The chimeric antigen receptor of any of claims 1050 to 1052, wherein the costimulatory signaling region is or comprises the amino acid sequence set forth in SEQ ID NO:46 or an amino acid sequence having at least or at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO:46. [This invention 1054] 1050 or 1051, the chimeric antigen receptor of the present invention, wherein the costimulatory signaling region comprises the intracellular signaling domain of 4-1BB. [This invention 1055] The chimeric antigen receptor of any of 1050, 1051 and 1054, wherein the costimulatory signaling region is or comprises the amino acid sequence set forth in SEQ ID NO:19 or an amino acid sequence having at least or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO:19. [This invention 1056] The chimeric antigen receptor of any of 1050 to 1055, wherein the costimulatory signaling region is located between the transmembrane domain and the intracellular signaling region. [This invention 1057] The chimeric antigen receptor of any of claims 1001 to 1056, wherein the transmembrane domain is or comprises a transmembrane domain derived from CD4, CD28, or CD8. [This invention 1058] The chimeric antigen receptor of any of claims 1001 to 1057, wherein the transmembrane domain is or comprises a transmembrane domain derived from CD28. [This invention 1059] The chimeric antigen receptor of any of claims 1001 to 1058, wherein the transmembrane domain is or comprises the amino acid sequence set forth in SEQ ID NO: 18 or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO: 18. [The present invention 1060] (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:27; H ) area; and (ii) a light chain variable (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:28 or 66; L )region an extracellular antigen-binding domain comprising: (2) IgG4 / 2 chimeric hinge or modified IgG4 hinge; IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region containing the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain and the intracellular signaling domain of a T cell costimulatory molecule; A chimeric antigen receptor comprising: [This invention 1061] The above V H The region is V shown in SEQ ID NO:27 H CDR-H1, CDR-H2, and CDR-H3 contained within the V region amino acid sequence, L The region is V shown in SEQ ID NO: 28 or 66 L whether it contains CDR-L1, CDR-L2, and CDR-L3 contained within the region amino acid sequence; The above V H the regions comprising CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively; and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 120, 121, and 122, respectively; L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; or The above V H wherein the V region comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 123, 124, and 122, respectively; L The regions include CDR-L1, CDR-L2, and CDR-L3, each comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively; The chimeric antigen receptor of the present invention. [The present invention 1062] (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), V as shown in SEQ ID NO:27 H V including CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the region H region; and V as shown in SEQ ID NO: 28 or 66 L The light chain variable (V) domain contains CDR-L1, CDR-L2, and CDR-L3. L ) area; or V comprising CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L region; V comprising CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 120, 121, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively.L area; or V comprising CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 123, 124, and 122, respectively. H V region, and CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L region an extracellular antigen-binding domain comprising: (2) IgG4 / 2 chimeric hinge or modified IgG4 hinge; IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human CD28 or human 4-1BB; A chimeric antigen receptor comprising: [This invention 1063] The extracellular antigen-binding domain is V as shown in SEQ ID NO:27 H The amino acid sequence of the region and V shown in SEQ ID NO: 28 or 66 L and / or the extracellular antigen-binding domain comprises an scFv as set forth in SEQ ID NO:7 or SEQ ID NO:8; A chimeric antigen receptor according to any one of 1060 to 1062 of the present invention. [This invention 1064] The chimeric antigen receptor of any of the present inventions 1060 to 1063, wherein the transmembrane domain is or comprises the amino acid sequence set forth in SEQ ID NO: 18 or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to SEQ ID NO: 18. [This invention 1065] the intracellular signaling region is selected from the group consisting of: (a) the amino acid sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:20; and (b) the amino acid sequence set forth in SEQ ID NO:46, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:20. A chimeric antigen receptor of any of the present inventions 1060 to 1064, comprising an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO:46. [The present invention 1066] The chimeric antigen receptor of any of claims 1060 to 1065, wherein the intracellular signaling region is or comprises the sequence shown in SEQ ID NO: 20 and the sequence shown in SEQ ID NO: 46. [This invention 1067] the intracellular signaling region is (a) an amino acid sequence set forth in SEQ ID NO:20 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:20; and (b) an amino acid sequence set forth in SEQ ID NO:19 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:20. The chimeric antigen receptor of any of the present inventions 1060 to 1064, comprising an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO: 19. [The present invention 1068] A polynucleotide comprising a nucleotide sequence encoding any one of the chimeric antigen receptors of the present inventions 1001 to 1067. [The present invention 1069] 1068. The polynucleotide of the present invention, wherein the nucleic acid encoding the spacer comprises at least one modified splice donor site and / or modified splice acceptor site, wherein the modified splice donor site and / or modified splice acceptor site comprises one or more nucleotide modifications corresponding to a reference splice donor site and / or reference splice acceptor site contained in the sequence set forth in SEQ ID NO:73. [The present invention 1070] The polynucleotide of claim 1069, wherein said one or more nucleotide modifications comprise an amino acid substitution. [This invention 1071] the reference splice donor and / or reference splice acceptor site has a splice site prediction score of at least or at least about 0.4, at least 0.5 or at least about 0.5, at least 0.6 or at least about 0.6, at least 0.70 or at least about 0.70, at least 0.75 or at least about 0.75, at least 0.80 or at least about 0.80, at least 0.85 or at least about 0.85, at least 0.90 or at least about 0.90, at least 0.95 or at least about 0.95, at least 0.99 or at least about 0.99, or at least 1.0 or at least about 1.0; and / or the reference splice donor and / or reference splice acceptor site is predicted to be involved in a splice event at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% of the time, The polynucleotide of the present invention 1069 or 1070. [This invention 1072] the reference splice donor site has the sequence TIFF0007742773000020.tif11129 and / or the reference splice acceptor site has the sequence TIFF0007742773000021.tif11128 Including, A polynucleotide of any one of 1069 to 1071 of the present invention. [This invention 1073] the reference splice donor site has the sequence TIFF0007742773000022.tif4128 and / or the reference splice acceptor site has the sequence TIFF0007742773000023.tif4128 Including, A polynucleotide of any one of 1069 to 1072 of the present invention. [This invention 1074] The polynucleotide of any of claims 1069 to 1073, wherein the one or more nucleotide modifications are silent and / or result in degenerate codons compared to SEQ ID NO:73 and / or do not change the amino acid sequence of the encoded spacer. [This invention 1075] the modified splice donor site TIFF0007742773000024.tif11162 and / or the modified splice acceptor site TIFF0007742773000025.tif17138 As shown in A polynucleotide of any one of 1069 to 1074 of the present invention. [This invention 1076] the modified splice donor site TIFF0007742773000026.tif4128 and / or the modified acceptor site TIFF0007742773000027.tif11128 Any of the polynucleotides 1069 to 1075 of the present invention, as shown in [This invention 1077] The polynucleotide of any one of claims 1069 to 1076, wherein the spacer is encoded by the nucleotide sequence shown in SEQ ID NO:74. [This invention 1078] 1068 to 1077, wherein upon expression in a cell, RNA, optionally messenger RNA (mRNA), transcribed from said polynucleotide exhibits reduced heterogeneity compared to the heterogeneity of mRNA transcribed from a reference polynucleotide, said reference polynucleotide encoding the same amino acid sequence as said polynucleotide, said reference polynucleotide differing from said polynucleotide in the presence of one or more splice donor sites and / or one or more splice acceptor sites in the nucleic acid encoding the spacer, and / or comprising one or more nucleotide alterations compared to said polynucleotide, and / or comprising the spacer set forth in SEQ ID NO:73. [This invention 1079] The polynucleotide of any one of 1068 to 1078 of the present invention, wherein the codons are optimized for expression in human cells. [The present invention 1080] The polynucleotide of any of claims 1068 to 1078, wherein the chimeric antigen receptor is a first chimeric antigen receptor, and the polynucleotide further comprises a nucleotide sequence encoding a second chimeric antigen receptor. [This invention 1081] 1080. The polynucleotide of claim 1080, wherein said first chimeric antigen receptor and second chimeric antigen receptor are separated by one or more multicistronic elements. [This invention 1082] 1081. The polynucleotide of claim 1081, wherein said one or more multicistronic elements is or comprises a ribosomal skipping sequence, and optionally said ribosomal skipping sequence is a T2A, P2A, E2A, or F2A element. [This invention 1083] The polynucleotide of claim 1082, wherein the nucleotide sequence encoding said one or more multicistronic elements is of a codon divergent type. [This invention 1084] The polynucleotide of invention 1082 or invention 1083, wherein the nucleotide sequence encoding said one or more multicistronic elements is or comprises the sequence shown in SEQ ID NO:319. [This invention 1085] The polynucleotide of any of claims 1080 to 1084, wherein the second chimeric antigen receptor (CAR) comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma. [The present invention 1086] The polynucleotide of claim 1085, wherein said second CAR further comprises a spacer, a transmembrane domain, and an intracellular signaling region. [This invention 1087] 1085 or 1086, wherein the second antigen is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5. [This invention 1088] The polynucleotide of any one of 1085 to 1087, wherein the second antigen is BCMA. [This invention 1089] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:189, 191, 193, 195, or 197; H ) area; and (ii) a light chain variable (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:190, 192, 194, 196, or 198; L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region The polynucleotide of any one of 1085 to 1088 of the present invention, comprising: [The present invention 1090] V of the second car H The region is V as set forth in SEQ ID NO: 189, 191, 193, 195, or 197. H The second CAR comprises CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of the second CAR; and L The region is selected from the group consisting of V, VL and VL sequences shown in SEQ ID NO: 190, 192, 194, 196, or 198. L The polynucleotide of the present invention 1089, comprising CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence of the region. [This invention 1091] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from SEQ ID NOs: 199, 202, 206, and 209; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from SEQ ID NOs: 200, 203, 207, and 210; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from SEQ ID NOs: 201, 204, 205, 208, and 211. H ) area; and (ii) a light chain variable (V) antibody comprising: (i) a light chain complementarity determining region 1 (CDR-L1) comprising an amino acid sequence selected from SEQ ID NOs: 218, 221, 224, 227, and 230; (b) a light chain complementarity determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, and 231; and (c) a light chain complementarity determining region 3 (CDR-L3) comprising an amino acid sequence selected from SEQ ID NOs: 220, 223, and 226. L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising 3 regions, optionally at or about 228 amino acids in length, or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region The polynucleotide of any one of 1085 to 1088 of the present invention, comprising: [This invention 1092] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 201, respectively, and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; or V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; A polynucleotide of any one of 1089 to 1091 of the present invention. [This invention 1093] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; A polynucleotide of any one of 1089 to 1091 of the present invention. [This invention 1094] V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:189 and SEQ ID NO:190, respectively; or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:189; and a region having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98% sequence identity to SEQ ID NO:190. comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:190; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:191 and SEQ ID NO:192, respectively; or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:191; and a region having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:192. comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:192; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:193 and SEQ ID NO:194, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:193, and comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:194; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:195 and SEQ ID NO:196, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:195, and or comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to NO:196; or V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:197, and comprising an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:198; A polynucleotide of any one of 1089 to 1093 of the present invention. [This invention 1095] V of the second car H Area and V L whether the regions comprise the amino acid sequences set forth in SEQ ID NO:189 and SEQ ID NO:190, respectively; V of the second car H Area and V L whether the region comprises the amino acid sequence shown in SEQ ID NO:191 and SEQ ID NO:192; V of the second car H Area and V L whether the region comprises the amino acid sequence shown in SEQ ID NO:193 and SEQ ID NO:194; V of the second car H Area and V L The region comprises the amino acid sequence set forth in SEQ ID NO:195 and SEQ ID NO:196; V of the second car H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; A polynucleotide of any one of 1089 to 1094 of the present invention. [This invention 1096] V of the second car H The region is V L The polynucleotide of any one of 1089 to 1095, which is located amino-terminally to the region. [This invention 1097] V of the second car H The region is V L The polynucleotide of any one of 1089 to 1095 of the present invention, which is located on the carboxy terminal side of the region. [This invention 1098] The polynucleotide of any of claims 1089 to 1097, wherein the antigen-binding domain of the second CAR comprises an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240, and 241, or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240, and 241. [This invention 1099] The polynucleotide of any one of claims 1089 to 1098, wherein the antigen-binding domain of the second CAR comprises an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240 and 241. [The present invention 1100] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or V of the second car H Area and V L the regions comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the extracellular antigen-binding domain of the second CAR comprises the amino acid sequence set forth in SEQ ID NO:241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to the sequence set forth in SEQ ID NO:241; A polynucleotide of any one of 1089 to 1099 of the present invention. [The present invention 1101] 1086-1100. The polynucleotide of any of claims 1086 to 1100, wherein the transmembrane domain of said second CAR is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. [The present invention 1102] the transmembrane domain of said second CAR is or comprises a transmembrane domain from human CD28; and / or the transmembrane domain of the second CAR is or comprises the amino acid sequence set forth in SEQ ID NO: 18 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to SEQ ID NO: 18; A polynucleotide of any one of 1086 to 1101 of the present invention. [The present invention 1103] The polynucleotide of any of 1086 to 1102, wherein the intracellular signaling region of the second CAR comprises an intracellular signaling domain. [The present invention 1104] 1103. The polynucleotide of the invention 1103, wherein the intracellular signaling domain of said second CAR is or comprises the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof, optionally the cytoplasmic signaling domain of the human CD3 zeta chain. [This invention 1105] The polynucleotide of any of inventions 1103 or 1104, wherein the intracellular signaling region of said second CAR comprises the amino acid sequence set forth in SEQ ID NO:20, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% or at least about 99% sequence identity to SEQ ID NO:20. [The present invention 1106] The polynucleotide of any of claims 1103 to 1105, wherein the intracellular signaling region of said second CAR further comprises a costimulatory signaling region. [This invention 1107] 1106. The polynucleotide of claim 1106, wherein the costimulatory signaling region of said second CAR comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, and optionally comprises the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. [This invention 1108] The polynucleotide of any of claims 1080 to 1107, wherein at least one of the first chimeric antigen receptor and the second chimeric antigen receptor comprises an intracellular signaling region comprising the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally comprising the intracellular signaling domain of human 4-1BB. [This invention 1109] The polynucleotide of any of claims 1106 to 1108, wherein the costimulatory signaling region of said second CAR comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof, and optionally comprises the intracellular signaling domain of human 4-1BB. [The present invention 1110] the costimulatory signaling region of the second CAR comprises: the intracellular signaling domain of human CD28; and / or an amino acid sequence set forth in SEQ ID NO:46, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:46; The polynucleotide of any one of 1106 to 1108 of the present invention, comprising: [The present invention 1111] the costimulatory signaling region of the second CAR comprises: the intracellular signaling domain of human 4-1BB; and / or an amino acid sequence set forth in SEQ ID NO:19, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:19; The polynucleotide of any one of 1106 to 1109 of the present invention, comprising: [The present invention 1112] (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain; and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain; A polynucleotide comprising: the first CAR and the second CAR each comprise (a) the first antigen-binding domain or the second antigen-binding domain, (b) a spacer, (c) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region; one or more of (b)-(d) of the first CAR and the same one or more of (b)-(d) of the second CAR comprise the same amino acid sequence; and the nucleotide sequence encoding one or more of (b)-(d) of the first CAR differs in sequence from the nucleotide sequence encoding the same one or more of (b)-(d) of the second CAR; Polynucleotide. [The present invention 1113] (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain capable of binding to either GPRC5D or BCMA; and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain capable of binding to the other of GPRC5D or BCMA; A polynucleotide comprising: the first CAR and the second CAR each comprise (a) the first antigen-binding domain or the second antigen-binding domain, (b) a spacer, (c) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region; one or more of (b)-(d) of the first CAR and the same one or more of (b)-(d) of the second CAR comprise the same amino acid sequence; and the nucleotide sequence encoding one or more of (b)-(d) of the first CAR differs in sequence from the nucleotide sequence encoding the same one or more of (b)-(d) of the second CAR; Polynucleotide. [This invention 1114] The polynucleotide of any one of claims 1080 to 1113, wherein at least one of the nucleotide sequence encoding the first chimeric antigen receptor and the nucleotide sequence encoding the second chimeric antigen receptor is of a codon-different type. [This invention 1115] 1. A polynucleotide comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR); (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR); and (iii) a nucleotide sequence encoding a multicistronic element, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic element; the first CAR comprises a first antigen-binding domain that binds to GPRC5D, optionally encoded by the nucleotide sequence set forth in SEQ ID NO: 311; a spacer encoded by the nucleotides set forth in SEQ ID NO: 305; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO: 307; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO: 309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO: 308; the second CAR comprises a second antigen-binding domain that binds to BCMA, optionally encoded by the nucleotide sequence set forth in SEQ ID NO:310; a spacer encoded by the nucleotides set forth in SEQ ID NO:74; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:56; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:58 and a costimulatory signaling domain region encoded by the nucleotide sequence set forth in SEQ ID NO:60; a first nucleic acid sequence encoding the first CAR is located toward the 5' end of the polynucleotide relative to a second nucleic acid sequence encoding the second CAR; Polynucleotide. [The present invention 1116] 1. A polynucleotide comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR); (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR); and (iii) a nucleotide sequence encoding a multicistronic element, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic element; the first CAR comprises a first antigen-binding domain that binds to BCMA, optionally encoded by the nucleotide sequence set forth in SEQ ID NO:310; a spacer encoded by the nucleotides set forth in SEQ ID NO:74; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO:56; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO:58 and a costimulatory signaling domain region encoded by the nucleotide sequence set forth in SEQ ID NO:60; the second CAR comprises a second antigen-binding domain that binds to GPRC5D, optionally encoded by the nucleotide sequence set forth in SEQ ID NO: 311; a spacer encoded by the nucleotides set forth in SEQ ID NO: 305; a transmembrane domain encoded by the nucleotide sequence set forth in SEQ ID NO: 307; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence set forth in SEQ ID NO: 309 and a costimulatory signaling region encoded by the nucleotide sequence set forth in SEQ ID NO: 308; a first nucleic acid encoding the first CAR is located toward the 5' end of the polynucleotide relative to a second nucleic acid sequence encoding the second CAR; Polynucleotide. [This invention 1117] The polynucleotide of any of claims 1080 to 1116, wherein the nucleotide sequence encoding the first chimeric antigen receptor and the nucleotide sequence encoding the second chimeric antigen receptor have sequence homology of not more than about 30, not more than about 20, or not more than about 10 consecutive base pairs. [This invention 1118] A vector comprising any one of the polynucleotides of the present invention 1068 to 1117. [This invention 1119] The vector of the present invention 1118, which is a viral vector. [The present invention 1120] A cell comprising a chimeric antigen receptor according to any one of claims 1001 to 1067 of the present invention. [This invention 1121] 1120. The cell of claim 1120, wherein the chimeric antigen receptor is a first chimeric receptor, and the cell further comprises a polynucleotide comprising a nucleotide encoding a second chimeric antigen receptor. [This invention 1122] A cell comprising any one of the polynucleotides of the present invention 1068 to 1117. [This invention 1123] A cell comprising a first polynucleotide, which is any one of the polynucleotides of 1068 to 1079 of the present invention, and further comprising a second polynucleotide comprising a nucleotide sequence encoding a second chimeric antigen receptor (CAR). [This invention 1124] The cell of claim 1121 or claim 1123, wherein said second chimeric antigen receptor (CAR) comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma. [Invention 1125] 1125. The cell of claim 1124, wherein said second CAR further comprises a spacer, a transmembrane domain, and an intracellular signaling region. [The present invention 1126] The cell of claim 1124 or claim 1125, wherein said second antigen is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5. [This invention 1127] The cell of any one of 1124 to 1126 of the present invention, wherein the second antigen is BCMA. [This invention 1128] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:189, 191, 193, 195, or 197; H ) area; and (ii) a light chain variable (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:190, 192, 194, 196, or 198; L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally being at or about 228 amino acids in length, or the spacer shown in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region The cell of any one of claims 1121 to 1127, comprising: [This invention 1129] V of the second car H The region is V as set forth in SEQ ID NO: 189, 191, 193, 195, or 197. H CDR-H1, CDR-H2, and CDR-H3 contained within the V region amino acid sequence, L The region is selected from the group consisting of V, VL and VL sequences shown in SEQ ID NO: 190, 192, 194, 196, or 198. L 1128. The cell of the present invention, comprising CDR-L1, CDR-L2, and CDR-L3 contained within the amino acid sequence of the region. [The present invention 1130] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain complementary determining region 1 (CDR-H1) comprising the amino acid sequence set forth in SEQ ID NO: 199, 202, 206, or 209; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising the amino acid sequence set forth in SEQ ID NO: 200, 203, 207, or 210; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising the amino acid sequence set forth in SEQ ID NO: 201, 204, 205, 208, or 211. H ) area; and (ii) a light chain variable (V) complementarity-determining region 1 (CDR-L1) comprising the amino acid sequence set forth in SEQ ID NO: 218, 221, 224, 227, or 230; (b) a light chain complementarity-determining region 2 (CDR-L2) comprising the amino acid sequence set forth in SEQ ID NO: 219, 222, 225, 228, or 231; and (c) a light chain complementarity-determining region 3 (CDR-L3) comprising the amino acid sequence set forth in SEQ ID NO: 220, 223, or 226. L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region The cell of any one of claims 1121 to 1127, comprising: [This invention 1131] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 201, respectively, and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; or V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; A cell according to any one of claims 1128 to 1130 of the present invention. [This invention 1132] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L 1128 to 1131, wherein the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively. [This invention 1133] V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:189 and SEQ ID NO:190, respectively; or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:189; and a region having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98% sequence identity to SEQ ID NO:190. comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:190; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:191 and SEQ ID NO:192, respectively; or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:191; and a region having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:192. comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:192; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:193 and SEQ ID NO:194, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:193, and comprises an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:194; V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:195 and SEQ ID NO:196, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:195, and or comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to NO:196; or V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively, or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:197, and comprising an amino acid sequence having at least 90%, or at least about 90%, at least 91%, or at least about 91%, at least 92%, or at least about 92%, at least 93%, or at least about 93%, at least 94%, or at least about 94%, at least 95%, or at least about 95%, at least 96%, or at least about 96%, at least 97%, or at least about 97%, at least 98%, or at least about 98%, or at least 99% or at least about 99% sequence identity to NO:198; A cell of any one of 1128 to 1132 of the present invention. [This invention 1134] V of the second car H Area and V L whether the regions comprise the amino acid sequences set forth in SEQ ID NO:189 and SEQ ID NO:190, respectively; V of the second car H Area and V L whether the region comprises the amino acid sequence shown in SEQ ID NO:191 and SEQ ID NO:192; V of the second car H Area and V L whether the region comprises the amino acid sequence shown in SEQ ID NO:193 and SEQ ID NO:194; V of the second car H Area and V L the region comprises the amino acid sequence set forth in SEQ ID NO:195 and SEQ ID NO:196; or V of the second car H Area and V L The regions comprise the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; A cell of any one of 1128 to 1133 of the present invention. [This invention 1135] The cell of any one of claims 1128 to 1134, wherein the single-chain antibody fragment is or comprises a single-chain variable fragment (scFv). [This invention 1136] V of the second car H The region is V of the second CAR L The cell of any one of 1128 to 1135, wherein the region is located amino-terminally to the cell. [This invention 1137] V of the second car H The region is V of the second CARL The cell of any one of 1128 to 1135 of the present invention, wherein the region is located on the carboxy terminal side. [This invention 1138] The cell of any of claims 1128 to 1137, wherein the antigen-binding domain of the second CAR comprises an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240, and 241, or an amino acid sequence having at least 90% or at least about 90%, at least 91% or at least about 91%, at least 92% or at least about 92%, at least 93% or at least about 93%, at least 94% or at least about 94%, at least 95% or at least about 95%, at least 96% or at least about 96%, at least 97% or at least about 97%, at least 98% or at least about 98%, or at least 99% or at least about 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240, and 241. [This invention 1139] The cell of any one of claims 1128 to 1138, wherein the antigen-binding domain comprises an amino acid sequence selected from SEQ ID NOs: 237, 238, 239, 240 and 241. [This invention 1140] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; and / or V of the second car H Area and V L the regions comprise the amino acid sequences set forth in SEQ ID NO:197 and SEQ ID NO:198, respectively; and / or the antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:241, or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID NO:241; A cell of any one of 1128 to 1139 of the present invention. [This invention 1141] 11. The cell of any of claims 1125 to 1140, wherein the transmembrane domain of said second CAR is or comprises a transmembrane domain derived from CD4, CD28, or CD8, optionally a transmembrane domain derived from human CD4, human CD28, or human CD8. [This invention 1142] The cell of any of claims 1125 to 1141, wherein the intracellular signaling region of said second CAR further comprises a costimulatory signaling region. [This invention 1143] 1142. The cell of claim 1142, wherein said costimulatory signaling region comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof, and optionally comprises the intracellular signaling domain of human CD28, human 4-1BB, or human ICOS. [This invention 1144] The cell of invention 1142 or invention 1143, wherein said costimulatory signaling region comprises the intracellular signaling domain of 4-1BB or a signaling portion thereof, optionally comprising the intracellular signaling domain of human 4-1BB. [Invention 1145] A composition comprising any one of the chimeric antigen receptors of the present inventions 1001 to 1067. [Invention 1146] A composition comprising a cell of any one of 1120 to 1144 of the present invention or a plurality of cells of any one of 1120 to 1144 of the present invention. [This invention 1147] The composition of the present invention 1143, wherein the composition comprises CD4+ T cells and CD8+ T cells, and the ratio of the CD4+ T cells to the CD8+ T cells is about 1:3 to about 3:1, optionally about 1:2 to about 2:1. [This invention 1148] A plurality of first cells comprising a first chimeric antigen receptor, wherein the first chimeric antigen receptor is the chimeric antigen receptor of any one of claims 1001 to 1067 of the present invention or is encoded by the polynucleotide of any one of claims 1068 to 1079 of the present invention; and a plurality of second cells comprising a second chimeric antigen receptor; A composition comprising: [This invention 1149] 1148. The composition of claim 1148, wherein said second chimeric receptor comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma. [This invention 1150] The composition of claim 1148 or claim 1149, wherein said second CAR comprises an extracellular antigen-binding domain that binds to a second antigen, a spacer, a transmembrane domain, and an intracellular signaling region. [This invention 1151] The composition of invention 1149 or invention 1150, wherein said second antigen is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5. [This invention 1152] The composition of any of claims 1149 to 1151, wherein said second antigen is BCMA. [This invention 1153] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain variable (V) antibody comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:189, 191, 193, 195, or 197; H ) area; and (ii) a light chain variable (V) comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:190, 192, 194, 196, or 198; L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region Any of the compositions of 1148 to 1152 of the present invention, comprising: [This invention 1154] V of the second car H The region is V as set forth in SEQ ID NO: 189, 191, 193, 195, or 197. H CDR-H1, CDR-H2, and CDR-H3 contained within the V region amino acid sequence, L The region is selected from the group consisting of V, VL and VL sequences shown in SEQ ID NO: 190, 192, 194, 196, or 198. L The composition of the present invention 1153, comprising CDR-L1, CDR-L2, and CDR-L3 contained within the region amino acid sequence. [This invention 1155] The second CAR is (1) an extracellular antigen-binding domain that specifically binds to BCMA, (i) a heavy chain complementary determining region 1 (CDR-H1) comprising the amino acid sequence set forth in SEQ ID NO: 199, 202, 206, or 209; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising the amino acid sequence set forth in SEQ ID NO: 200, 203, 207, or 210; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising the amino acid sequence set forth in SEQ ID NO: 201, 204, 205, 208, or 211. H ) area; and (ii) a light chain variable (V) complementarity-determining region 1 (CDR-L1) comprising the amino acid sequence set forth in SEQ ID NO: 218, 221, 224, 227, or 230; (b) a light chain complementarity-determining region 2 (CDR-L2) comprising the amino acid sequence set forth in SEQ ID NO: 219, 222, 225, 228, or 231; and (c) a light chain complementarity-determining region 3 (CDR-L3) comprising the amino acid sequence set forth in SEQ ID NO: 220, 223, or 226. L )region an extracellular antigen-binding domain comprising: (2) Spacer, optionally an IgG4 / 2 chimeric hinge or a modified IgG4 hinge; an IgG2 / 4 chimeric C H 2 region; and IgG4 C H a spacer comprising three regions and optionally about 228 amino acids in length or the spacer set forth in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region Any of the compositions of 1148 to 1152 of the present invention, comprising: [Invention 1156] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 201, respectively, andL the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 218, 219, and 220, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 202, 203, and 204, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 221, 222, and 223, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 199, 200, and 205, respectively, and L whether the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 224, 225, and 226, respectively; V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 206, 207, and 208, respectively, and L the region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 227, 228, and 229, respectively; or V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L The regions include CDR-L1, CDR-L2, and CDR-L3, each of which comprises the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively; Any of the compositions 1153 to 1155 of the present invention. [This invention 1157] V of the second car H The second CAR region comprises CDR-H1, CDR-H2, and CDR-H3 having the amino acid sequences of SEQ ID NOs: 209, 210, and 211, respectively, and L 1157. The composition of any of claims 1153 to 1156, wherein the regions comprise CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively. [This invention 1158] V of the second car H Area and V L a region having (a) the amino acid sequence set forth in SEQ ID NO:189 and SEQ ID NO:190, respectively; or (b) an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:189; and a region having at least 90%, at least 91%, at lea...

Claims

1. (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), wherein the extracellular antigen-binding domain is: (i) V of SEQ ID NO: 27 H heavy chain variable (V) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 125, heavy chain complementary determining region 2 (CDR-H2) comprising the amino acid sequence of SEQ ID NO: 126, and heavy chain complementary determining region 3 (CDR-H3) comprising the amino acid sequence of SEQ ID NO: 122, H ) area; and (ii) V of SEQ ID NO:66 L a light chain variable (V) CDR comprising a light chain complementarity determining region 1 (CDR-L1) comprising the amino acid sequence of SEQ ID NO: 130, a light chain complementarity determining region 2 (CDR-L2) comprising the amino acid sequence of SEQ ID NO: 131, and a light chain complementarity determining region 3 (CDR-L3) comprising the amino acid sequence of SEQ ID NO: 132, the CDR-L1 comprising the amino acid sequence of SEQ ID NO: 132, the CDR-L2 comprising the amino acid sequence of SEQ ID NO: 133, and the CDR-L3 comprising the amino acid sequence of SEQ ID NO: 134; L )region an extracellular antigen-binding domain comprising: (2) A spacer comprising an IgG4 / 2 chimeric hinge or a modified IgG4 hinge, an IgG2 / 4 chimeric CH2 region, and an IgG4 CH3 region, wherein the spacer is or comprises the sequence shown in SEQ ID NO: 17; (3) a transmembrane domain; and (4) Intracellular signal transduction region A chimeric antigen receptor comprising:

2. the extracellular antigen-binding domain (i) a heavy chain variable (V) comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:27; H ) area; and (ii) a light chain variable (V) comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:66; L )region 2. The chimeric antigen receptor of claim 1, comprising:

3. The above V H Region and V L 3. The chimeric antigen receptor of claim 1 or 2, wherein the regions comprise the amino acid sequences set forth in SEQ ID NOs: 27 and 66, respectively.

4. The chimeric antigen receptor of any one of claims 1 to 3, wherein the extracellular antigen-binding domain is or comprises a single-chain variable fragment (scFv).

5. The chimeric antigen receptor of any one of claims 1 to 4, wherein the extracellular antigen-binding domain comprises the amino acid sequence of SEQ ID NO:8 or an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:

8.

6. 6. The chimeric antigen receptor of any one of claims 1 to 5, wherein the extracellular antigen-binding domain is encoded by the nucleotide sequence of SEQ ID NO:264 or a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of SEQ ID NO:

264.

7. The chimeric antigen receptor of any one of claims 1 to 6, wherein the intracellular signaling region comprises an intracellular signaling domain that is or comprises the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof.

8. The chimeric antigen receptor of claim 7, wherein the cytoplasmic domain of the CD3 zeta chain has the sequence shown in SEQ ID NO:

20.

9. The chimeric antigen receptor of claim 7, wherein the intracellular signaling region further comprises a costimulatory signaling region.

10. 10. The chimeric antigen receptor of claim 9, wherein the costimulatory signaling region comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS, or a signaling portion thereof.

11. The chimeric antigen receptor of claim 10, wherein the costimulatory signaling region comprises the intracellular signaling domain of 4-1BB.

12. The chimeric antigen receptor of claim 10 or 11, wherein the intracellular signaling domain of 4-1BB is the sequence shown in SEQ ID NO:

19.

13. 13. The chimeric antigen receptor of any one of claims 1 to 12, wherein the transmembrane domain is or comprises a transmembrane domain from CD4, CD28, or CD8.

14. 14. The chimeric antigen receptor of claim 13, wherein the transmembrane domain is or comprises a transmembrane domain derived from CD28.

15. The chimeric antigen receptor of claim 13 or 14, wherein the transmembrane domain derived from CD28 is the sequence shown in SEQ ID NO:

18.

16. (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), wherein the extracellular antigen-binding domain is: (i) a heavy chain variable (V) comprising the amino acid sequence set forth in SEQ ID NO:27; H ) region, and (ii) a light chain variable (V) region comprising the amino acid sequence set forth in SEQ ID NO:

66. L )region an extracellular antigen-binding domain comprising: (2) a spacer comprising the sequence set forth in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region containing the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain and the intracellular signaling domain of 4-1BB; A chimeric antigen receptor comprising:

17. (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C group 5 member D (GPRC5D), wherein the extracellular antigen-binding domain is: (i) V comprising CDR-H1, CDR-H2, and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126, and 122, respectively; H and V including CDR-L1, CDR-L2, and CDR-L3, each of which contains the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. L region an extracellular antigen-binding domain comprising: (2) a spacer comprising the sequence set forth in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region containing the cytoplasmic signaling domain of the CD3-zeta (CD3ζ) chain and the intracellular signaling domain of 4-1BB; A chimeric antigen receptor comprising:

18. (a) the extracellular antigen-binding domain is an scFv as set forth in SEQ ID NO:8; (b) the spacer is the sequence shown in SEQ ID NO: 17; (c) the transmembrane domain is the sequence set forth in SEQ ID NO: 18; (d) the intracellular signaling region comprises an intracellular signaling domain that is the cytoplasmic domain of the CD3 zeta chain set forth in SEQ ID NO:20; and (e) the intracellular signaling region further comprises a costimulatory signaling region that is the intracellular signaling domain of 4-1BB as set forth in SEQ ID NO: 19; The chimeric antigen receptor of any one of claims 1 to 17.

19. 19. The chimeric antigen receptor of any one of claims 1 to 18, wherein the spacer is or comprises an amino acid sequence encoded by a nucleotide sequence having 98% identity to the nucleic acid sequence shown in SEQ ID NO:

74.

20. 20. The chimeric antigen receptor of any one of claims 1 to 19, comprising an amino acid sequence set forth in SEQ ID NO: 290 or an amino acid sequence having at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO:

290.

21. 21. The chimeric antigen receptor of claim 20, wherein the chimeric antigen receptor has the sequence shown in SEQ ID NO:

290.

22. 22. The chimeric antigen receptor of any one of claims 1 to 21, wherein the chimeric antigen receptor is encoded by the nucleotide sequence set forth in SEQ ID NO:289 or a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO:

289.

23. 23. The chimeric antigen receptor of claim 22, wherein the chimeric antigen receptor is encoded by the nucleotide sequence shown in SEQ ID NO:

289.

24. A polynucleotide comprising a nucleotide sequence encoding the chimeric antigen receptor of any one of claims 1 to 23.

25. the nucleic acid encoding the spacer comprises at least one modified splice donor site and / or modified splice acceptor site, wherein the modified splice donor site and / or modified splice acceptor site comprises one or more nucleotide modifications corresponding to a reference splice donor site and / or reference splice acceptor site contained in the sequence set forth in SEQ ID NO:73, and wherein the modified splice donor site is tcaactggtatgtgg (SEQ ID NO:183) and / or the modified splice acceptor site is the sequence shown in cagtttcttcctgtatagtagactcaccgtggataaatcaa (SEQ ID NO:186), and / or cgccttgtcctccttgtcccgctcctcctgttgccggacct (SEQ ID NO:188) 25. The polynucleotide of claim 24, wherein the polynucleotide has the sequence shown in

26. the modified splice donor site is tcaactggtatgtgg (SEQ ID NO:183) and / or the modified acceptor site is cagtttcttcctgtatagtagactcaccgtggataaatcaa (SEQ ID NO:186) 26. The polynucleotide of claim 25, which has the sequence shown in

27. 27. The polynucleotide of any one of claims 24 to 26, wherein the spacer is encoded by the nucleotide sequence shown in SEQ ID NO:

74.

28. 28. The polynucleotide of any one of claims 24 to 27, wherein the chimeric antigen receptor is a first chimeric antigen receptor and the polynucleotide further comprises a nucleotide sequence encoding a second chimeric antigen receptor.

29. 29. The polynucleotide of claim 28, wherein the second chimeric antigen receptor (CAR) comprises an extracellular antigen-binding domain that specifically binds to a second antigen, wherein the second antigen is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5.

30. A vector comprising the polynucleotide of any one of claims 24 to 29.

31. A cell comprising the chimeric antigen receptor of any one of claims 1 to 23.

32. 32. The cell of claim 31 , wherein the chimeric antigen receptor is a first chimeric antigen receptor, and the cell further comprises a polynucleotide comprising a nucleotide encoding a second chimeric antigen receptor.

33. (a) comprising the polynucleotide of any one of claims 24 to 29, or (b) comprising the polynucleotide of any one of claims 24 to 27 as a first polynucleotide, and further comprising a second polynucleotide comprising a nucleotide sequence encoding a second chimeric antigen receptor (CAR); cell.

34. 34. The cell of any one of claims 31 to 33, which is a T cell.

35. The cell of claim 34, which is a CD4+ T cell or a CD8+ T cell.

36. 36. A composition comprising the chimeric antigen receptor of any one of claims 1 to 23, a cell of any one of claims 31 to 35, or a plurality of cells comprising the cell of any one of claims 31 to 35.

37. a plurality of first cells comprising a first chimeric antigen receptor, wherein the first chimeric antigen receptor is the chimeric antigen receptor of any one of claims 1 to 23 or encoded by the polynucleotide of any one of claims 24 to 27; and a plurality of second cells comprising a second chimeric antigen receptor; A composition comprising:

38. 38. The composition of claim 37, further comprising a pharmaceutically acceptable carrier.

39. 39. The composition of claim 37 or 38, wherein the second chimeric antigen receptor comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma.

40. 40. The composition of any one of claims 36 to 39 for use in treating a subject having a disease or disorder.

41. 41. The composition of claim 40, wherein the disease or disorder is cancer.

42. 40. Use of a composition comprising a cell according to any one of claims 31 to 35 or a composition according to any one of claims 36 to 39 in the manufacture of a medicament for treating a disease or disorder.

43. 43. The use of claim 42, wherein the disease or disorder is cancer.

44. 28. A medicament for the treatment of a disease or disorder, comprising a composition comprising a first dose of a plurality of first cells comprising a first chimeric antigen receptor which is the chimeric antigen receptor of any one of claims 1 to 23 or encoded by the polynucleotide of any one of claims 24 to 27, and a composition comprising a second dose of a plurality of second cells comprising a second chimeric antigen receptor.

45. The pharmaceutical agent of claim 44, wherein the second chimeric antigen receptor comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma.

46. 46. ​​The pharmaceutical agent of claim 45, wherein the second antigen is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5.

47. The pharmaceutical agent of any one of claims 44 to 46, wherein the disease or disorder is associated with expression of GPRC5D.

48. The pharmaceutical of claim 47, wherein the disease or disorder is further associated with expression of B-cell maturation antigen (BCMA).

49. The pharmaceutical agent according to any one of claims 44 to 48, wherein the disease or disorder is cancer.

50. 50. The pharmaceutical of claim 49, wherein the disease or disorder is multiple myeloma (MM).

51. 28. Use of a composition comprising a first dose of a plurality of first cells comprising a first chimeric antigen receptor which is the chimeric antigen receptor of any one of claims 1 to 23 or encoded by the polynucleotide of any one of claims 24 to 27, and a composition comprising a second dose of a plurality of second cells comprising a second chimeric antigen receptor, for the manufacture of a medicament for treating a disease or disorder.

52. 52. The use of claim 51, wherein the second chimeric antigen receptor comprises an extracellular antigen-binding domain that specifically binds to a second antigen expressed on or associated with multiple myeloma.

53. 53. The use of claim 52, wherein the second antigen is selected from B-cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5.

54. 54. The use according to any one of claims 51 to 53, wherein the disease or disorder is associated with expression of GPRC5D.

55. 55. The use of claim 54, wherein the disease or disorder is further associated with expression of B-cell maturation antigen (BCMA).

56. 56. The use of any one of claims 51 to 55, wherein the disease or disorder is cancer.

57. 57. The use of claim 56, wherein the cancer is multiple myeloma (MM).

58. a plurality of first cells comprising a first chimeric antigen receptor which is the chimeric antigen receptor of any one of claims 1 to 23 and / or is encoded by the polynucleotide of any one of claims 24 to 27; and a plurality of second cells comprising a second chimeric antigen receptor; A composition comprising a combination of:

59. 59. The composition of claim 58 for treating a disease or disorder.

60. 60. The composition of claim 59, wherein the disease or disorder is cancer.

61. 60. Use of the composition of claim 58 for the manufacture of a medicament for treating a disease or disorder.

62. 62. The use of claim 61, wherein the disease or disorder is cancer.

Images