Liver fibrosis model mouse

Abstract

To provide a hepatic fibrillation model mouse that can be obtained in a short period of time.SOLUTION: To provide a transgenic mouse having characters of (i) and (ii) and overexpressing FGF18 in a liver-specific manner: (i) a DNA construct including a promotor sequence, an loxP sequence, stop codon, an loxP sequence, an FGF18 gene in this order from 5' end side in ROSA26 gene is introduced, and (ii) a DNA construct including an albumin promoter, a Cre gene in this order from 5' end side is introduced.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a mouse model of liver fibrosis and use thereof. [Background technology]

[0002] Liver fibrosis (hepatic fibrosis) is a pathological condition associated with chronic inflammation, cell death, and oxidative stress in chronic viral hepatitis and nonalcoholic steatohepatitis (NASH), ultimately leading to cirrhosis and liver cancer. In addition to suppressing inflammation, suppressing progressive fibrosis may be an important factor in preventing the progression of these diseases. From this perspective, extensive research has been conducted into the mechanisms underlying hepatic fibrosis. However, no therapeutic method for suppressing hepatic fibrosis has yet been developed.

[0003] In recent years, nonalcoholic fatty liver disease (NAFLD) has been increasing, and it is estimated that approximately 30% of the population currently suffers from NAFLD. NAFLD is broadly divided into simple fatty liver (NAFL: nonalcoholic fatty liver or SS), in which fat simply accumulates in the liver, and progressive NASH, which is accompanied by hepatocyte death and inflammation. NASH is a disease with a high risk of progressing to cirrhosis and even liver cancer due to fibrosis. It is estimated that approximately 10% of NAFLD cases are NASH, and the increasing number of NASH patients is a problem (Non-Patent Document 1). The mechanisms of onset and progression of NASH, particularly the progression of liver fibrosis, have not been clearly elucidated, and there is currently no fundamental treatment for NASH.

[0004] Typically, animal models of the pathology (e.g., model mice) are used to analyze the mechanisms of pathogenesis, screen for therapeutic drugs and methods, etc. As a NASH model mouse, a diet-induced mouse model of NASH has been reported (e.g., Non-Patent Documents 2 and 3).

[0005] Fibroblast growth factor 18 (FGF18) is known to be a protein involved in the development of certain tissues, such as the lungs, limb buds, palate, skeleton, central nervous system, and hair follicles (Non-Patent Document 4). It has also been reported that mice with FGF18 knockout die of respiratory failure shortly after birth (Non-Patent Document 5). Patent Document 1 reports that, among patients diagnosed with NAFLD, particularly those with NASH, serum FGF18 protein concentrations are higher than those of healthy individuals. However, neither study directly demonstrates the involvement of FGF18 in liver fibrosis. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 2020-106382 [Non-patent literature]

[0007] [Non-Patent Document 1] "NASH / NAFLD Treatment Guide 2021" compiled by the Japan Society of Hepatology, Bunkodo [Non-patent document 2] M. Charlton, et al., Am. J. Physiol. Gastrointest. Liver Physiol., 301, G825-G834 (2011) [Non-patent document 3] A. Asgharpour, et al., J. Hepatol., 65, 579-588 (2016) [Non-patent document 4] AS Hagan, et al., Development Dynamics, 248, 882-893 (2019) [Non-Patent Document 5] N. Ohbayashi, et al., Genes Dev. 16, 870-879 (2002) Summary of the Invention [Problem to be solved by the invention]

[0008] As described above, the use of model animals, particularly model mice, is extremely useful in elucidating the mechanisms of liver fibrosis in diseases such as NASH, as well as therapeutic agents and treatment methods. However, since the model mice described in, for example, Non-Patent Documents 2 and 3, require a long period of 24 to 52 weeks for dietary intake to induce liver fibrosis, a liver fibrosis model mouse that can be obtained efficiently in a shorter period of time is desired.

[0009] An object of the present invention is to provide a mouse model of liver fibrosis that can be obtained in a short period of time. [Means for solving the problem]

[0010] The present inventors discovered that FGF18 is highly expressed in the hepatocytes of mice that have developed liver fibrosis. They then constructed transgenic (Tg) mice that express FGF18 specifically in the liver, and found that these Tg mice developed liver fibrosis efficiently within a short period of time, leading to the completion of the present invention.

[0011] That is, the present invention is as follows. (1) Transgenic mice that overexpress fibroblast growth factor 18 (FGF18) specifically in the liver. (2) The transgenic mouse according to (1), having the following characteristics (i) and (ii): (i) a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene is introduced into the ROSA26 locus; and (ii) A DNA construct containing an albumin promoter and a Cre gene in this order is introduced from the 5' end. (3) The transgenic mouse according to (2), wherein the FGF18 gene comprises an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 70% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1. (4) A transgenic mouse for producing a transgenic mouse that overexpresses FGF18 specifically in the liver, in which a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene was introduced into the ROSA26 locus. (5) The transgenic mouse according to (4), wherein the FGF18 gene comprises an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 70% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1. (6) The transgenic mouse according to (4) or (5), wherein the promoter sequence is a CAG promoter sequence and the DNA construct further comprises a poly A signal on the 3' end. (7) A method for producing a transgenic mouse, comprising crossbreeding the transgenic mouse according to any one of (4) to (6) with an Albumin-Cre mouse. (8) A transgenic mouse obtained by the method described in (7). (9) The transgenic mouse according to (1), (2), or (8), which is a liver fibrosis model mouse. [Effects of the Invention]

[0012] According to the present invention, it is possible to provide a liver fibrosis model mouse that can be obtained in a short period of time. [Brief explanation of the drawings]

[0013] [Figure 1] This is an image of immunostaining with an anti-Ki67 antibody of a liver excised one week after transfection of mouse hepatocytes with cDNA for the FGF18 gene and the GFP gene in Reference Example 2. The scale bar indicates 100 μm. [Figure 2]In Reference Example 2, FGF18 cDNA and GFP cDNA were introduced into mouse hepatocytes, and the livers were excised one week after the introduction. Immunostaining with anti-Ki67 antibody was performed on the livers, and the percentage of Ki67-positive areas in the total tissue area was compared (n=4). An "*" in the figure indicates p<0.05 in an unpaired two-tailed Student's t-test. [Figure 3] This figure shows the structure of the ROSA26 locus in a Tg mouse (CAG-LSL-FGF18 Tg mouse) in which the constructed vector was inserted into the ROSA26 locus by homologous recombination, and in a Tg mouse (FGF18 Tg mouse) obtained by crossing a CAG-LSL-FGF18 Tg mouse with an Albumin-Cre mouse. In the CAG-LSL-FGF18 Tg mouse, the FGF18 gene is not translated due to an upstream stop codon. In the FGF18 Tg mouse, the stop codon between the two loxP sequences is removed, allowing the FGF18 gene to be translated. [Figure 4] This is a bar graph showing the percentage (%) of total body weight of livers excised from 6-week-old FGF18 Tg mice and wild-type mice. While the percentage of liver weight in wild-type mice was approximately 5% of total body weight, in FGF18 Tg mice it increased to approximately 8% (n = 5). "****" in the figure indicates p<0.0001 in an unpaired two-tailed Student's t-test. [Figure 5] These images show the results of immunostaining using anti-Ki67 antibodies on liver tissue sections removed from 6-week-old FGF18 Tg mice and wild-type mice. Hepatocytes and endothelial cells in large blood vessels from FGF18 Tg mice were Ki67-positive, demonstrating the proliferation of these cells. The scale bar indicates 100 μm. [Figure 6] These images show the results of Sirius Red staining of liver tissue sections removed from 6-week-old FGF18 Tg mice and wild-type mice. An increase in stained (positive) areas was observed in the FGF18 Tg mice. The scale bar indicates 100 μm. [Figure 7]This graph shows the results of measuring the amount of hydroxyproline in liver tissue excised from 6-week-old FGF18 Tg mice and wild-type mice (n=5). Hydroxyproline levels were increased in the livers of FGF18 Tg mice. Statistically significant differences are shown by comparing the percentage of Ki67-positive areas in the total tissue area. An "*" in the graph indicates p<0.05 in an unpaired, two-tailed Student's t-test. DETAILED DESCRIPTION OF THE INVENTION

[0014] 1. First embodiment: LSL-FGF18 transgenic mouse A first embodiment of the present invention is a Tg mouse for producing a transgenic (Tg) mouse that overexpresses fibroblast growth factor 18 (FGF18) in a liver-specific manner, characterized in that a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene has been introduced into the ROSA26 locus. More specifically, the first embodiment of the present invention is a Tg mouse for producing a mouse that overexpresses FGF18 in a liver-specific manner through reproduction. Hereinafter, this mouse will also be referred to as an "LSL-FGF18 Tg mouse" based on the structure of the introduced DNA construct.

[0015] As used herein, "Fibroblast Growth Factor 18 (FGF18)" refers to a protein having an amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. As used herein, "sequence identity" refers to a value that can be determined using a protein search system such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), with or without introducing gaps.

[0016] When two recombinase recognition sequences are present in the same orientation within a DNA molecule and a recombinase is present, the recombinase recognizes the sequences, causing site-specific recombination between the two recombinase recognition sequences, resulting in the excision and deletion of the sequence sandwiched between the two recombinase recognition sequences. Examples of site-specific recombination systems that combine a recombinase and its recognition sequences include the Cre-loxP system and the FLP-FRT system. The present invention particularly uses the Cre-loxP system. Examples of recombinase recognition sequences in the Cre-loxP system include the loxP sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT, SEQ ID NO: 2). Furthermore, mutant loxP sequences such as lox511 (ATAACTTCGTATAGtATACATTATACGAAGTTAT, SEQ ID NO: 3), lox2272 (ATAACTTCGTATAGgATACtTTATACGAAGTTAT, SEQ ID NO: 4), and loxFAS (ATAACTTCGTATAtacctttcTATACGAAGTTAT, SEQ ID NO: 5) can also be used. In the present invention, mutant loxP sequences are also referred to as "loxP sequences."

[0017] A first embodiment of the present invention includes the DNA construct described above, which contains, in this order from the 5' end, a promoter sequence, an LSL structure (a loxP sequence, a stop codon, and a loxP sequence), and an FGF18 gene (hereinafter also referred to as "LSL-FGF18"). A marker gene may also be included upstream of the stop codon between the two loxP sequences. The marker gene is not particularly limited as long as it is a marker gene that can confirm gene introduction into cells. Examples of the marker gene include drug resistance genes such as neomycin (neo) resistance genes, HPRT (hypoxanthine phosphoribosyl transferase) genes, and fluorescent protein genes. A DNA construct in which a stop codon and a marker gene are sandwiched between two loxP sequences is sometimes referred to as a LoxP-flanked stop cassette (stop cassette). In the absence of Cre, even if gene transcription begins, transcription terminates at the stop codon between the two loxP sequences, preventing transcription and translation of the downstream FGF18 gene. On the other hand, when Cre is present, the stop codon between the two loxP sites is deleted, allowing the downstream FGF18 gene to be transcribed and translated, resulting in overexpression of the FGF18 protein.

[0018] The promoter sequence is not particularly limited as long as it can promote the expression of the 3'-terminal, i.e., downstream, gene, but in particular, the CAG promoter can be used. When the CAG promoter is used as the promoter sequence, it is preferable that it further has a poly(A) signal at the 3'-terminal.

[0019] The 5' end of the FGF18 gene may be linked to an epitope tag such as a Kozak sequence or FLAG, which is involved in translation initiation, and a stop codon may be added to the 3' end. Alternatively, the 3' end of the FGF18 gene may be linked to an IRES sequence-GFP, allowing cells expressing the FGF18 gene to be sorted as GFP-positive cells.

[0020] In the first embodiment of the present invention, the Tg mouse is constructed by constructing a DNA construct containing LSL-FGF18 on a vector to prepare a targeting vector. The targeting vector can be constructed using commercially available plasmid vectors such as CTV and pBluescript II. The targeting vector is introduced into embryonic stem cells (ES cells), and the DNA construct is inserted into the ROSA26 locus of the ES cells by a known method, such as homologous recombination using the CRISPR / Cas9 method. The ROSA26 locus is known as a safe harbor locus into which genes can be safely inserted. The method for introducing the targeting vector into ES cells is not limited, and can be performed by known methods such as electroporation, microinjection, and the calcium phosphate method.

[0021] Figure 3 shows the sequence structure of the ROSA26 locus for an example of a Tg mouse according to the first embodiment of the present invention. In the illustrated example, a CAG promoter is used as the promoter, and downstream of the promoter are two loxP sequences in the same orientation, with a marker gene and a stop codon sandwiched between them, and further downstream are an FGF18 gene, a stop codon, and a polyA signal. Hereinafter, a Tg mouse having a gene with the sequence structure illustrated in the example is also referred to as a "CAG-LSL-FGF18 Tg mouse."

[0022] ES cells into which a targeting vector has been introduced can be selected by a marker in the vector. For example, when a neomycin resistance gene is used as a marker, ES cells into which a targeting vector has been introduced can be selected by culturing the cells in ES cell medium supplemented with G418. Furthermore, whether the desired DNA construct has been introduced can be confirmed by genotyping using Southern blotting or PCR.

[0023] The ES clone into which the targeting vector has been introduced is introduced into a fertilized egg or an early embryo, such as an 8-cell embryo. Introduction can be performed by microinjection, aggregation, or other methods. The fertilized egg or early embryo is transplanted into a foster mother mouse, and development can be performed to obtain a chimeric mouse. The resulting chimeric mouse can be mated with a mouse of the same strain to obtain F1 mice that are heterozygous for the DNA construct into which the LSL-FGF18 sequence has been inserted. Furthermore, by mating the F1 mice with each other, mice that are homozygous for the DNA construct into which the LSL-FGF18 sequence has been inserted can be obtained.

[0024] 2. Second embodiment: Tg mice overexpressing FGF18 specifically in the liver (FGF18 Tg mice) A second embodiment of the present invention is a Tg mouse that overexpresses FGF18 in a liver-specific manner, specifically, a Tg mouse having the following characteristics (i) and (ii): (i) a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene is introduced into the ROSA26 locus; and (ii) A DNA construct containing an albumin promoter and a Cre gene in this order is introduced from the 5' end. Hereinafter, the Tg mouse according to the second embodiment of the present invention is also referred to as an "FGF18 Tg mouse."

[0025] In the Tg mouse of the second embodiment of the present invention, FGF18 is overexpressed in a liver-specific manner, and liver fibrosis occurs within a relatively short period of approximately six weeks after birth. Therefore, the Tg mouse of the second embodiment of the present invention is useful as a model mouse for mammalian, particularly human, liver fibrosis, and has the advantage that it can be constructed in a short period of time.

[0026] Typically, Tg mice expressing a gene of interest can be generated by crossing a Tg mouse containing a DNA construct containing an LSL structure and a gene of interest with a Cre-expressing Tg mouse transfected with a Cre expression vector. Alternatively, similar Tg mice can be generated by transfecting ES cells transfected with a targeting vector containing an LSL structure and a gene of interest, and then further transfecting the Cre expression vector to obtain ES cell clones.

[0027] The FGF18 Tg mice of the present invention require overexpression of the FGF18 gene in the liver, which has been found to be involved in liver fibrosis. However, since the FGF18 gene is a protein involved in the development of certain tissues, such as the lungs, limb buds, palate, skeleton, central nervous system, and hair follicles, overexpression of the FGF18 gene outside the liver may affect functions related to the survival of the mouse. Therefore, the FGF18 gene introduced into the Tg mice must be expressed in a liver-specific manner. Therefore, in the FGF18 Tg mice of the present invention, the Cre gene introduced must be introduced under the control of the albumin promoter (Albumin-Cre), along with the albumin promoter, which induces liver-specific expression.

[0028] The FGF18 Tg mouse of the present invention can be produced, for example, by a Tg production method that includes crossing the Tg mouse of the first embodiment of the present invention (LSL-FGF18 Tg mouse) with an Albumin-Cre mouse. As used herein, "Albumin-Cre mouse" refers to a Tg mouse that expresses Cre under the control of the albumin promoter. Albumin-Cre mice, for example, can be those described in L. Wu, et al., Genesis, 36, 177-181 (2003). Albumin-Cre mice can also be obtained, for example, from The Jackson Laboratory.

[0029] In the Tg mice obtained by crossbreeding the LSL-FGF18 Tg mice of the present invention with Albumin-Cre mice, Cre recombinase acts only in hepatocytes, removing the stop cassette (LSL) and the termination codon, resulting in liver-specific overexpression of the FGF18 gene.

[0030] When the FLP-FRT system is used instead of the Cre-loxP system, FLP recombinase can be used instead of Cre recombinase, and an FRT sequence can be used instead of the loxP sequence.

[0031] In the second embodiment of the present invention, detailed conditions such as the structure and gene sequence of FGF18, loxP sequence, Cre, marker gene, and materials used are as described in Section "1. First embodiment: LSL-FGF18 transgenic mouse" unless otherwise inconsistent. Furthermore, in addition to the Tg mouse of the second embodiment, the present invention also encompasses a method for producing a Tg mouse, which comprises crossing the Tg mouse of the first embodiment of the present invention with an Albumin-Cre mouse. Detailed conditions for the production method are also as described in Section "1. First embodiment: LSL-FGF18 transgenic mouse" unless otherwise inconsistent.

[0032] 3. Phenotype of the Tg mouse (FGF18 Tg mouse) according to the second embodiment of the present invention The Tg mouse (FGF18 Tg mouse) of the second embodiment of the present invention has the following phenotype. (1) Liver-specific overexpression of FGF18. (2) The Ki67-positive area in liver tissue was larger than in controls. (3) The liver accounts for approximately 8% or more of the body weight. (4) Expression of collagen II and III is increased in the hepatic vascular wall. (5) The amount of hydroxyproline in liver tissue increases. (6) After 20 weeks of age, large cysts form in the liver.

[0033] 4. Use of the Tg mice of the present invention (LSL-FGF18 Tg mice, FGF18 Tg mice) The Tg mouse of the first embodiment of the present invention (LSL-FGF18 Tg mouse) can be used to generate the Tg mouse of the second embodiment of the present invention (FGF18 Tg mouse), which can serve as a model mouse for liver fibrosis.

[0034] The Tg mouse (FGF18 Tg mouse) of the second embodiment of the present invention spontaneously develops fibrosis in the liver within a short period of time, and therefore is expected to be useful for analyzing the mechanisms of fibrosis and for the in vivo evaluation of therapeutic drugs targeting fibrosis. The inventors discovered that FGF18 expression increases during thioacetamide (TAA)-induced liver fibrosis, and found that administering a choline-deficient diet plus ethionine-supplemented water (CDE) diet, a model of human NASH development, to FGF18 Tg mice rapidly progresses the pathology of NASH. Conventional NASH model mice created using a high-fat diet require a very long time—more than a year—to induce fibrosis. The FGF18 Tg mouse can significantly shorten the time required for high-fat diet-induced fibrosis. The FGF18 Tg mouse established by the present invention is extremely useful for rapid disease analysis and therapeutic drug screening using model mice for diseases in which fibrosis is involved in the progression of the disease. [Example]

[0035] The present invention will be specifically explained by the following examples, but the present invention is not limited to these examples.

[0036] [Reference Example 1] Gene expression analysis of mice with thioacetamide-induced liver fibrosis Three mice (6-8 weeks old, C57BL / 6 (obtained from CLEA Japan)) were given drinking water containing 300 mg / L of thioacetamide (TAA) for four weeks, which induced liver fibrosis in all mice. Livers were removed from mice with liver fibrosis (fibrotic mice) and mice (control mice) kept under the same conditions except that they were given drinking water without TAA. Analysis of genes highly expressed only in the fibrotic mice revealed FGF18, a factor not previously reported to be involved in liver fibrosis.

[0037] [Reference Example 2] Transient expression of FGF18 FGF18 was transiently overexpressed in mice using the HTVi (hydrodynamic tail vein injection) method. First, a plasmid vector was constructed by incorporating mouse FGF18 cDNA into pLIVE (obtained from Mirus). This plasmid vector is characterized by hepatocyte-specific expression of the target gene downstream of the mouse AFP enhancer and mouse albumin promoter. Ten micrograms of the plasmid vector per mouse were dissolved in 2 mL of Ringer's solution and injected via the tail vein into four mice (6-8 weeks old, C57BL / 6 (obtained from CLEA Japan)) (test mice). A plasmid vector was prepared by incorporating GFP cDNA (nucleotide sequence of SEQ ID NO: 7) into pLIVE instead of FGF18 cDNA, and this was similarly injected into four mice (control mice). One week after injection, the livers were removed from each mouse, fixed in formalin, and paraffin sections were prepared. Each paraffin section was immunostained using anti-Ki67 antibody (No. Ab16667 (Abcam)).

[0038] Figure 1 shows images of liver tissues from test and control mice immunostained with anti-Ki67 antibodies. Figure 2 shows a graph comparing the percentage of Ki67-positive areas in the total tissue area of ​​liver tissues from test and control mice immunostained with anti-Ki67 antibodies. An "*" in the figure indicates p<0.05 in a paired two-tailed Student's t-test. At least, transient expression of FGF18 alone was not sufficient to induce liver fibrosis.

[0039] [Example 1] Generation of mice that overexpress FGF18 specifically in the liver Mice that overexpress FGF18 in the liver were established as follows. An IRES sequence and EGFP gene were excised from a commercially available vector (CTV (Plasmid #15912, obtained from Addgene)) containing a sequence inserted into the ROSA26 locus: a CAG promoter, a loxP sequence, a stop codon, a neomycin resistance gene (neo) reverse sequence, a loxP sequence, and a poly(A) signal. The FGF18 gene was inserted into the AscI site to prepare an expression vector. The nucleotide sequence of the prepared vector is shown in SEQ ID NO: 8. The prepared vector was electroporated into the ROSA26 locus of mouse ES cells (C57BL / 6xCBA, obtained from Kumamoto University) using the CRISPR / Cas9 method. The vector-introduced ES cells were mated with eggs derived from ICR mice to generate chimeric mice. The chimeric mice were mated with C57 / BL6 mice to allow germline transfer. The resulting chimeric mice were mated with syngeneic mice as F0 generation mice to obtain Tg mice (CAG-LSL-FGF18 Tg mice) that were homozygous for the gene sequence of the introduced DNA construct.

[0040] CAG-LSL-FGF18 Tg mice were crossed with mice expressing Cre recombinase in an Albumin promoter (expressed in hepatocytes)-dependent manner (Albumin-Cre mice (No. 003574, obtained from Jackson Laboratory)) to obtain hybrid mice. In these hybrid mice, Cre is specifically expressed in hepatocytes, resulting in the elimination of the stop codon immediately downstream of the CAG promoter in hepatocytes, resulting in the overexpression of FGF18. Hereinafter, these hybrid mice will be referred to as "FGF18 Tg mice."

[0041] [Example 2] Liver fibrosis in FGF18 Tg mice FGF18 Tg mice were born according to Mendelian laws, were reproductively functional, and showed no apparent abnormalities. However, when mice were dissected at 6-8 weeks of age and their livers were excised, the liver accounted for approximately 5% of the total body weight in wild-type littermates, whereas in FGF18 Tg mice it increased to approximately 8% (Figure 4) (n = 5). "****" in the figure indicates p < 0.0001 in an unpaired two-tailed Student's t-test.

[0042] The excised livers were fixed in formalin and then paraffin sections were prepared for histological analysis. The livers of FGF18 Tg mice showed mononuclear cell infiltration and an increase in endothelial cells in large blood vessels. Furthermore, immunostaining using an anti-Ki67 antibody revealed that hepatocytes and endothelial cells in large blood vessels were Ki67-positive, demonstrating proliferation of these cells (Figure 5). Sirius Red staining was performed according to standard methods, revealing an increase in stained (positive) areas in FGF18 Tg mice (Figure 6). The scale bars in Figures 5 and 6 represent 100 μm. Next, the content of hydroxyproline in liver tissue, a component of collagen that increases with fibrosis, was measured. Specifically, liver tissue from each mouse was hydrolyzed and hydroxyproline was quantified using a hydroxyproline assay kit (No. STA-675, obtained from Cell Biolabs Inc.) (n = 5). As a result, hydroxyproline was increased in the livers of FGF18 Tg mice compared to wild-type mice (Figure 7). The "*" in the figure indicates p<0.05 in an unpaired two-tailed Student's t-test. Based on these results, we have successfully established mice in which FGF18 is overexpressed in hepatocytes, allowing spontaneous induction of liver fibrosis.

[0043] When the FGF18 Tg mice constructed using the above method were fed a choline-deficient diet plus ethionine-supplemented water (CDE) diet, a human model of NASH, fibrosis progressed even more rapidly (data not shown), demonstrating that the FGF18 Tg mice can reflect the pathology of NASH. [Industrial Applicability]

[0044] The liver fibrosis model mouse of the present invention is useful for the development of therapeutic agents and methods for liver fibrosis such as NASH in mammals including humans, and can be used in the fields of medicine, pharmaceutical manufacturing, etc.

Claims

1. A transgenic mouse that overexpresses fibroblast growth factor 18 (FGF18) in a liver-specific manner, A transgenic mouse having the following characteristics (i) and (ii): (i) a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene is introduced into the ROSA26 locus; and (ii) A DNA construct containing an albumin promoter and a Cre gene in this order is introduced from the 5' end.

2. The transgenic mouse of claim 1, wherein the FGF18 gene comprises a base sequence encoding an amino acid sequence represented by sequence number 1 or an amino acid sequence having 90% or more sequence identity to the amino acid sequence represented by sequence number 1.

3. A transgenic mouse for producing a transgenic mouse that overexpresses FGF18 in a liver-specific manner, in which a DNA construct containing, from the 5' end, a promoter sequence, a loxP sequence, a stop codon, a loxP sequence, and an FGF18 gene has been introduced into the ROSA26 locus.

4. The transgenic mouse of claim 3, wherein the FGF18 gene comprises a base sequence encoding an amino acid sequence represented by sequence number 1 or an amino acid sequence having 90% or more sequence identity to the amino acid sequence represented by sequence number 1.

5. The transgenic mouse according to claim 3 or 4, wherein the promoter sequence is a CAG promoter sequence, and the DNA construct further comprises a polyA signal on the 3' end side.

6. A method for producing a transgenic mouse, comprising crossing the transgenic mouse according to any one of claims 3 to 5 with an Albumin-Cre mouse.

7. A transgenic mouse obtained by the method of claim 6.

8. The transgenic mouse according to claim 1 or 7, which is a liver fibrosis model mouse.

Images