Modified photoreceptor chloride channel

A modified photoreceptor chloride channel with improved light response properties, achieved by replacing specific GtACR1 regions with GtACR2 and incorporating ChR1, addresses impaired vision by offering precise neuronal control and treatment for outer retinal disorders.

JP7756391B2Active Publication Date: 2025-10-20IWATE UNIVERSITY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2021157009
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-09-27
Publication Date
2025-10-20
Estimated Expiration
2041-09-27

AI Technical Summary

Technical Problem

Existing photoreceptor chloride channels do not possess optimal light response properties for effective visual function restoration in cases of photoreceptor degeneration or loss, leading to impaired vision and blindness.

Method used

A modified photoreceptor chloride channel is developed by replacing specific regions of the GtACR1 amino acid sequence with those of GtACR2, potentially incorporating additional modifications, and engineered to include the N-terminal region of ChR1 for enhanced localization on cell membranes, with a polynucleotide encoding this channel and an expression vector for cellular expression.

Benefits of technology

The modified channel exhibits superior light response properties with a narrower wavelength sensitivity range and faster kinetics (τon and τoff), enabling precise neuronal control and potential treatment of outer retinal disorders such as retinitis pigmentosa and age-related macular degeneration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007756391000004
    Figure 0007756391000004
  • Figure 0007756391000005
    Figure 0007756391000005
  • Figure 0007756391000006
    Figure 0007756391000006
Patent Text Reader

Abstract

To provide a modified photoreceptor chloride channel with excellent photoresponsive properties.SOLUTION: The present disclosure includes a modified photoreceptor chloride channel and the like comprising an amino acid sequence in which at least the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 is replaced with the corresponding region of GtACR2.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to modified photoreceptor chloride channels. [Background technology]

[0002] Photoreceptor cells are photoreceptor cells located in the outer layer of the retina. They convert received light into electrical signals and transmit them to retinal neurons. When photoreceptor cells degenerate or disappear for some reason, phototransduction is impaired, leading to decreased vision and blindness. Photoreceptor proteins are involved in photoreceptor cell photoreception, and research is underway to restore visual function by genetically introducing photoreceptor proteins. For example, Guillardia theta anion channel rhodopsin-1 (also referred to herein as GtACR1), a photoreceptor chloride channel from the green alga Guillardia theta (Non-Patent Document 1), has attracted attention. A modified photoreceptor chloride channel in which Arg83 and Asn239 of GtACR1 are replaced with Glu has also been reported (Non-Patent Document 2). Thus, modified photoreceptor chloride channels with excellent photoresponsive properties are desired for visual function restoration through optogenetics. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Govorunova, EGet al., Natural light-gated anion channels: a family of microbial rhodopsins for advanced optogenetics.,Science,349,647-650(2015) [Non-patent document 2] Hideaki E. Kato et al.,Structural mechanisms of selectivity and gating in anion channel rhodopsins.,Nature,561,349-354(2018) Summary of the Invention [Problem to be solved by the invention]

[0004] An object of the present disclosure is to provide a modified photoreceptor chloride channel with excellent light response properties. Another object of the present disclosure is to provide a polynucleotide encoding such a modified photoreceptor chloride channel, an expression vector containing the polynucleotide, and a cell expressing such a modified photoreceptor chloride channel. Another object of the present disclosure is to provide a pharmaceutical composition and a method for treating a subject suffering from a disorder of the outer retina. [Means for solving the problem]

[0005] In one aspect, the present disclosure relates to a modified photoreceptor chloride channel comprising an amino acid sequence in which at least the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 is replaced with the corresponding region of GtACR2.

[0006] In one aspect, the disclosure relates to a polynucleotide encoding the modified photoreceptor chloride channel.

[0007] In one aspect, the present disclosure relates to an expression vector comprising the polynucleotide.

[0008] In one aspect, the disclosure relates to a cell expressing the modified photoreceptor chloride channel.

[0009] In one aspect, the disclosure relates to a pharmaceutical composition comprising the modified photoreceptor chloride channel, the polynucleotide, the expression vector, or the cell for treating a subject suffering from an outer retinal disorder.

[0010] In one aspect, the disclosure relates to a method of treating a subject suffering from an outer retinal disorder, the method comprising administering to the subject the modified photoreceptor chloride channel, the polynucleotide, the expression vector, or the cell. [Effects of the Invention]

[0011] The present disclosure provides an engineered photoreceptor chloride channel with excellent light response properties, a polynucleotide encoding such an engineered photoreceptor chloride channel, an expression vector containing the polynucleotide, and a cell expressing such an engineered photoreceptor chloride channel. The present disclosure also provides a pharmaceutical composition for treating a subject suffering from an outer retinal disorder, the composition containing the engineered photoreceptor chloride channel, polynucleotide, expression vector, or cell, and a method for treating an outer retinal disorder, the method comprising administering the engineered photoreceptor chloride channel, polynucleotide, expression vector, or cell to a subject suffering from an outer retinal disorder. [Brief explanation of the drawings]

[0012] [Figure 1] Figure 1 shows the structures of wild-type (GtACR1 and GtACR2) and modified (601, 602, 603, 605, 606) photoreceptor chloride channels. The black box and solid lined regions are derived from GtACR1, and the white box and dashed lined regions are derived from GtACR2. [Figure 2] FIG. 2 shows the vector map for the expression of recombinant 605. [Figure 3] FIG. 3 shows the light-induced currents of GtACR1 and GtACR2, and recombinants 605 and 606. [Figure 4] FIG. 4 shows τ on (opening rate: the time from the start of light irradiation until the channel opens) of GtACR2, and recombinants 605 and 606. [Figure 5]FIG. 5 shows τ off (closing rate: the time from the cessation of light irradiation until the channel closes) of GtACR2 and recombinants 605 and 606. DETAILED DESCRIPTION OF THE INVENTION

[0013] Unless otherwise specified, terms used herein have the meanings commonly understood by those skilled in the art of organic chemistry, medicine, pharmacology, molecular biology, microbiology, etc. Definitions of some terms used herein are provided below, but these definitions take precedence over common understandings in this specification.

[0014] In the present specification, amino acid residues are represented by the following abbreviations as usual. Ala or A: Alanine Arg or R: arginine Asn or N: asparagine Asp or D: aspartic acid Cys or C: cysteine Gln or Q: glutamine Glu or E: glutamic acid Gly or G: glycine His or H: histidine Ile or I: Isoleucine Leu or L: leucine Lys or K: Lysine Met or M: methionine Phe or F: phenylalanine Pro or P: proline Ser or S: serine Thr or T: threonine Trp or W: Tryptophan Tyr or Y: Tyrosine Val or V: Valine Herein, amino acid residues in a certain amino acid sequence may be indicated by an abbreviation representing the amino acid residue and a number representing its position (for example, the 92nd tryptophan residue is referred to as "Trp92").

[0015] The present disclosure relates to modified photoreceptor chloride channels. A photoreceptor chloride channel refers to a chloride channel that opens and closes in response to light. In the present disclosure, a modified photoreceptor chloride channel refers to a photoreceptor chloride channel whose amino acid sequence differs from that of naturally occurring photoreceptor chloride channels. The modified photoreceptor chloride channels of the present disclosure contain portions of the amino acid sequences of Guillardia theta anion channel rhodopsin-1 (also referred to herein as GtACR1) and Guillardia theta anion channel rhodopsin-2 (also referred to herein as GtACR2), which are photoreceptor chloride channels from Guillardia theta. Representative amino acid sequences of GtACR1 and GtACR2 are shown in SEQ ID NOs: 1 and 2, respectively.

[0016] GtACR1 and GtACR2 are seven-transmembrane proteins and have seven transmembrane domains.In this specification, when referring to a certain domain of a protein, the term "nth" refers to the nth domain counted from the N-terminus.Specifically, "nth transmembrane domain" refers to the nth transmembrane domain counted from the N-terminus.In GtACR1 and GtACR2, the regions from the N-terminus to the first transmembrane domain, between the second and third transmembrane domains, between the fourth and fifth transmembrane domains, and between the sixth and seventh transmembrane domains are extracellular domains, and the regions between the first and second transmembrane domains, between the third and fourth transmembrane domains, between the fifth and sixth transmembrane domains, and from the seventh transmembrane domain to the C-terminus are intracellular domains.

[0017] The modified photoreceptor chloride channel of the present disclosure comprises an amino acid sequence in which at least the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 has been substituted with the corresponding region in GtACR2. In addition to the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 being substituted with the corresponding region in GtACR2, the modified photoreceptor chloride channel may also comprise modifications of other domains or regions in the amino acid sequence of GtACR1. For example, the modified photoreceptor chloride channel may comprise an amino acid sequence in which, in addition to the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1, the extracellular domain between the second and third transmembrane domains and / or the extracellular domain between the sixth and seventh transmembrane domains has been further substituted with the corresponding region in GtACR2. For example, a modified photoreceptor chloride channel may comprise an amino acid sequence in which the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1, plus the extracellular domain between the sixth and seventh transmembrane domains, is replaced with the corresponding region of GtACR2.

[0018] In one embodiment, the modified photoreceptor chloride channel comprises an amino acid sequence in which at least the region from the second transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 has been substituted with the corresponding domain from GtACR2. The modified photoreceptor chloride channel may comprise an amino acid sequence in which, in addition to the region from the second transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1, the intracellular domain between the first and second transmembrane domains and / or the extracellular domain between the sixth and seventh transmembrane domains has been further substituted with the corresponding domain from GtACR2. For example, the modified photoreceptor chloride channel may comprise an amino acid sequence in which, in addition to the region from the second transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1, the extracellular domain between the sixth and seventh transmembrane domains has been further substituted with the corresponding domain from GtACR2.

[0019] The seven transmembrane domains (TM1 to TM7) in SEQ ID NOs: 1 and 2 are shown below. In SEQ ID NO: 1, the region from the third to the sixth transmembrane domain is Trp92 to Phe213, and the region from the second to the sixth transmembrane domain is Glu60 to Phe213. In SEQ ID NO: 2, the region from the third to the sixth transmembrane domain is Trp88 to Ile209, and the region from the second to the sixth transmembrane domain is Glu56 to Ile209. TIFF0007756391000001.tif87164

[0020] In one embodiment, the modified photoreceptor chloride channel comprises an amino acid sequence in which the region from the third transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are replaced with the corresponding regions of GtACR2. A representative amino acid sequence of such a modified photoreceptor chloride channel is shown in SEQ ID NO: 6. In the following, the sequence derived from GtACR2 is shown in bold. TIFF0007756391000002.tif43164

[0021] In one embodiment, the modified photoreceptor chloride channel comprises an amino acid sequence in which the region from the second transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are replaced with the corresponding regions of GtACR2. A representative amino acid sequence of such a modified photoreceptor chloride channel is shown in SEQ ID NO: 7. In the following, the sequence derived from GtACR2 is shown in bold. TIFF0007756391000003.tif43164

[0022] The engineered photoreceptor chloride channel may contain, at its N-terminus, the entire or partial amino acid sequence of the N-terminal region of Chlamydomonas reinhardtii channel rhodopsin 1 (also referred to herein as ChR1), a photoreceptor protein of Chlamydomonas reinhardtii. The N-terminal region of ChR1 is known to be involved in localized expression on cell membranes, particularly mammalian cell membranes. As used herein, the "N-terminal region of ChR1" refers to the region from the N-terminus to the first transmembrane domain of ChR1. In the engineered photoreceptor chloride channel, the N-terminal region of ChR1 may be added to the N-terminus of the amino acid sequence of GtACR1, or may replace all or part of the region from the N-terminus to the first transmembrane domain of GtACR1. In one embodiment, the N-terminal region of ChR1 is added to the N-terminus of the amino acid sequence of GtACR1.

[0023] In one embodiment, the modified photoreceptor chloride channel comprises or consists of any one of the amino acid sequences selected from the following (a-1) to (c-1): (a-1) the amino acid sequence of SEQ ID NO: 6; (b-1) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 6, and (c-1) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 6. In one embodiment, the modified photoreceptor chloride channel comprises or consists of the amino acid sequence of SEQ ID NO:6.

[0024] In one embodiment, the modified photoreceptor chloride channel comprises or consists of any one of the amino acid sequences selected from the following (a-2) to (c-2): (a-2) the amino acid sequence of SEQ ID NO: 7; (b-2) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 7, and (c-2) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 7. In one embodiment, the modified photoreceptor chloride channel comprises or consists of the amino acid sequence of SEQ ID NO:7.

[0025] Amino acid modifications include deletion, substitution, addition, and insertion. When an amino acid sequence contains multiple amino acid modifications, each amino acid modification is independently selected from deletion, substitution, addition, and insertion. The number of amino acid modifications can be 1 to 30, 1 to 20, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0026] As used herein, "sequence identity" with respect to an amino acid sequence or a nucleotide sequence refers to the percentage of amino acid residues or nucleotides that match between a sequence being compared and a sequence optimally aligned (maximum match) across the entire region of the sequence. The optimal alignment of the two sequences may include additions or deletions (e.g., gaps). Sequence identity can be calculated using programs such as FASTA, BLAST, and CLUSTAL W available from public databases (e.g., DDBJ (http: / / www.ddbj.nig.ac.jp)). Alternatively, it can be determined using commercially available sequence analysis software (e.g., Vector NTI® software, GENETYX® ver. 12). Sequence identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0027] The amino acid length of the modified photoreceptor chloride channel can be, for example, 260, 270, 280, or 290 or more amino acids, and up to 400, 390, 380, 370, 360, 350, 340, 330, 320, 310, or 300 amino acids.

[0028] In one embodiment, the modified photoreceptor chloride channel has biological activity equivalent to that of a polypeptide consisting of the amino acid sequence of either SEQ ID NO: 6 or 7. Biological activity includes light-induced current, wavelength sensitivity, τon, and τoff. When a modified photoreceptor chloride channel is said to have "equivalent biological activity" to a reference polypeptide, it means that at least one biological activity is equivalent to that of the reference polypeptide. Biological activity can be measured as described in the Examples. In one embodiment, the modified photoreceptor chloride channel has a light-induced current, τon, or τoff that is 70%, 80%, or 90% or more, and 130%, 120%, or 110% or less of the light-induced current, τon, or τoff of the reference polypeptide. In one embodiment, the modified photoreceptor chloride channel has a wavelength sensitivity range of 400 nm to 560 nm.

[0029] The modified photoreceptor chloride channel of the present disclosure can be produced by genetic engineering techniques. For example, the modified photoreceptor chloride channel can be prepared using a polynucleotide encoding the modified photoreceptor chloride channel (hereinafter also referred to as the polynucleotide of the present disclosure). Examples of nucleotide sequences encoding the amino acid sequences of SEQ ID NOs: 6 and 7 are shown in SEQ ID NOs: 13 and 14, respectively. SEQ ID NO: 13: ATGAGCAGCATCACCTGTGATCCCGCCATCTACGGCGAGTGGTCCCGGAGAATCAGTTCTGCGTGGAAAAGAGCCTGATCACCCTGGACGGCATCAAATACGTGCAGCTGGTCATGGCCGTGGTGTCCGCTTGCCAGGTGTTCTTCATGGTCACACGGGCCCCTAAGGTGCCCTGGGAAGCTATCTACCTGCCTACCACCGAGATGATCACCTACAGCCT GGCCTTCACCGGCAACGGCTATATCAGAGTGGCCAACGGCAAGTACCTGCCTTGGAGCCGAATGGCCTCCTGGCTGTGCACCTGTCCAATCATGCTGGGACAGATTTCTAACATGGCTCTGGTGAAGTACAAAAGTATCCCACTGAACCCTATCGCTCAGGCCGCCAGCATCATCAGAGTCGTGATGGGCATCACCGCACCATCTCTCCAGCCGAGTATA TGAAGTGGCTGTTCTTCTTCTTCGGCGCCACCTGTCTGGTGTTCGAGTACAGCGTGGTGTCCACCATCTTCCAAGTGGGCCTGTACGGCTTCGAGAGCGTGGAAACACCTCTGGCTCAGAAAGTGGTCGTGCGGATCAAGATGCTGCGGCTGATCTTCTTTATCGCCTGGACCATGTTTCCCATCGTGTGGCTGATTAGCCCCACCGGCTGTGTGTGAT CACGAGAATACCAGCAGCGTGCTGTACCTGCTGGGAGATGCCCTGTGCAAGAATACCTACGGCATCCTGCTGTGGGCCACACATGGGGACTGCTGAATGGCAAGTGGGACAGAGACTACGTGAAGGGCAGAAACGTGGACGCACCCTGATGCCTGAGTACGAGCAGGATCTGGAAAAGGGCAACACCGAGAGATACGAGGATGCCAGAGCTGGCGAAACG sequence number 14: ATGAGCAGCATCACCTGGTGATCCCGCCATCTACGGCGAGTGGTCCCGCGAGAATCAGTTCTGCGTGGAAAAGAGCCTGATCACCCTGGACGGCATCAAATACGTGCAGCTGGTCATGGCCGTGGTGTCCGCTTGCCAGGTGTTCTTCATGGTCACACGGGCCCCTAAGGTGCCCTGGGAGTCCGTGTACCTGCCCTTTGTCGAATCTATCACTTATGCACT GGCCAGTACTGGCAACGGAACCCTGCAGATGAGGGACGGCAGATTCTTTCCTTGGAGCCGAATGGCCTCCTGGCTGTGCACCTGTCCAATCATGCTGGGACAGATTTCTAACATGGCTCTGGTGAAGTACAAAAGTATCCCACTGAACCCTATCGCTCAGGCCGCCAGCATCATCAGAGTCGTGATGGGCATCACCGCCACCATCTCTCCAGCCGAGTATA TGAAGTGGCTGTTCTTCTTCTTCGGCGCCACCTGTCTGGTGTTCGAGTACAGCGTGGTGTTCACCATCTTCCAAGTGGGCCTGTACGGCTTCGAGAGCGTGGGAACACCTCTGGCTCAGAAAGTGGTCGTGCGGATCAAGATGCTGCGGCTGATCTTTCTTTATCGCCTGGACCATGTTTCCCATCGTGTGGCTGATTAGCCCCACCGGCGTGTGTGTGATC CACGAGAATACCAGCAGCGTGCTGTACCTGCTGGGAGATGCCCTGTGCAAGAATACCTACGGCATCCTGCTGTGGGCCACCACATGGGGACTGCTGAATGGCAAGTGGGACAGAGACTACGTGAAGGGCAGAAACGTGGACGGCACCCTGATGCCTGAGTACGAGCAGGATCTGGAAAAGGGCAACACCGAGAGATACGAGGATGCCAGAGCTGGCGAAACG

[0030] In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel is selected from the following (d-1) to (f-1): (d-1) a polynucleotide comprising or consisting of a base sequence encoding the amino acid sequence of SEQ ID NO: 6; (e-1) A polynucleotide comprising or consisting of a nucleotide sequence encoding an amino acid sequence in which one or more amino acids in the amino acid sequence of SEQ ID NO: 6 have been modified, and (f-1) A polynucleotide comprising or consisting of a base sequence encoding an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel comprises or consists of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:6.

[0031] In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel is selected from the following (d-2) to (f-2): (d-2) a polynucleotide comprising a base sequence encoding the amino acid sequence of SEQ ID NO: 7 or consisting of said base sequence; (e-2) A polynucleotide comprising or consisting of a nucleotide sequence encoding an amino acid sequence in which one or more amino acids in the amino acid sequence of SEQ ID NO: 7 have been modified, and (f-2) A polynucleotide comprising or consisting of a base sequence encoding an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 7. In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel comprises or consists of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:7.

[0032] In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel is selected from the following (g-1) to (i-1): (g-1) a polynucleotide comprising or consisting of the base sequence of SEQ ID NO: 13; (h-1) a polynucleotide that contains the base sequence of SEQ ID NO: 13 or hybridizes under stringent conditions to a complementary strand of a polynucleotide consisting of said base sequence; and (i-1) A polynucleotide comprising a base sequence having at least 90% sequence identity with the base sequence of SEQ ID NO: 13, or consisting of said base sequence. In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel comprises or consists of the base sequence of SEQ ID NO:13.

[0033] In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel is selected from the following (g-2) to (i-2): (g-2) a polynucleotide comprising or consisting of the base sequence of SEQ ID NO: 14; (h-2) a polynucleotide that contains the base sequence of SEQ ID NO: 14 or hybridizes under stringent conditions to a complementary strand of a polynucleotide consisting of said base sequence, and (i-2) A polynucleotide comprising a base sequence having at least 90% sequence identity with the base sequence of SEQ ID NO: 14, or consisting of said base sequence. In one embodiment, the polynucleotide encoding the modified photoreceptor chloride channel comprises or consists of the base sequence of SEQ ID NO:14.

[0034] As used herein, "hybridization under stringent conditions" refers to, for example, hybridization for 1 to 24 hours at 30-50°C in 3-4x SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7.2), 0.1-0.5% SDS, or preferably 1 to 24 hours at 40-45°C in 3.4x SSC, 0.3% SDS, followed by washing. Examples of washing conditions include sequential washing at room temperature with a solution containing 2x SSC and 0.1% SDS, followed by 1x SSC and / or 0.2x SSC. The above combinations of conditions are merely examples, and those skilled in the art will be able to achieve similar stringencies by appropriately combining the above and other factors that determine hybridization stringency (e.g., concentration, length, and GC content of the hybridization probe, hybridization reaction time, etc.).

[0035] The base length of a polynucleotide encoding a modified photoreceptor chloride channel can be, for example, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, or 880 bases or more, or 1200, 1100, 1000, 990, 980, 970, 960, 950, 940, 930, 920, 910, 900, or 890 bases or less.

[0036] The modified photoreceptor chloride channel of the present disclosure can be produced, for example, as follows. First, a polynucleotide encoding the modified photoreceptor chloride channel is prepared. The polynucleotide can be prepared by methods known to those skilled in the art. For example, a polynucleotide encoding the modified photoreceptor chloride channel can be prepared by chemical synthesis based on the sequence information of polynucleotides encoding GtACR1 and GtACR2, respectively. Alternatively, a polynucleotide encoding the modified photoreceptor chloride channel can be prepared by amplifying desired regions of each polynucleotide based on the sequence information of the polynucleotides encoding GtACR1 and GtACR2, respectively, using PCR primers that amplify the desired regions, and then ligating them using, for example, the Gibson Assembly system (New England Biolabs). Next, the polynucleotide operably linked to a promoter is incorporated into an expression vector that can maintain replication in a host, stably express the encoded polypeptide, and stably maintain this polynucleotide. The resulting recombinant expression vector is then used to transform a host, allowing the production of a modified photoreceptor chloride channel in the host. For recombinant techniques, reference can be made to Proc. Natl. Acad. Sci. USA., 1984 81:5662 and Molecular Cloning: A Laboratory Manual (1989) Second Edition, Cold Spring Harbor Laboratory Press, etc.

[0037] Examples of expression vectors that can be used include Escherichia coli-derived plasmids (e.g., pET28, pGEX4T, pUC118, pUC119, pUC18, pUC19, and other plasmid DNAs), Bacillus subtilis-derived plasmids (e.g., pUB110, pTP5, and other plasmid DNAs), yeast-derived plasmids (e.g., YEp13, YEp24, YCp50, and other plasmid DNAs), λ phage (e.g., λgt11 and λZAP), mammalian plasmids (e.g., pCMV and pSV40), viral vectors (e.g., animal virus vectors such as adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and vaccinia virus vectors, and insect virus vectors such as baculovirus vectors), plant vectors (e.g., binary vector pBI series), and cosmid vectors.

[0038] As used herein, a polynucleotide operably linked to a promoter refers to a polynucleotide that is bound to a promoter so as to initiate transcription of the polynucleotide. The promoter is not particularly limited, and a suitable promoter may be selected depending on the host. Known constitutive and inducible promoters can be used, but constitutive promoters are preferred. Examples of promoters include the CMV promoter, SV40 promoter, CAG promoter, synapsin promoter, rhodopsin promoter, CaMV promoter, glycolytic enzyme promoters, lac promoter, trp promoter, tac promoter, GAPDH promoter, GAL1 promoter, PH05 promoter, PGK promoter, thy1 promoter, GRK promoter, and RPEJ promoter. In order to specifically express the modified photoreceptor chloride channel in a particular cell, the transcriptional regulatory region of a polypeptide gene that is specifically expressed in that cell (e.g., the transcriptional regulatory region of IRBP (Interphotoreceptor retinoid binding protein), which is specifically expressed in photoreceptor cells (Marjorie Nicoud et al., The Journal of Gene Medicine, Volume 9, Issue 12, 1013-1107, December 2007)) may be linked upstream of the promoter.

[0039] A polynucleotide encoding a modified photoreceptor chloride channel can be inserted into an expression vector, for example, by creating or ligating restriction enzyme sites flanking the polynucleotide and inserting it into a restriction enzyme site or a multicloning site of an appropriate vector DNA. In addition to a promoter and a polynucleotide of the present disclosure, the expression vector may optionally contain enhancers or other cis-elements, splicing signals, poly(A) addition signals, selection markers (drug resistance gene markers such as ampicillin resistance markers and tetracycline resistance markers, auxotrophy complementation gene markers such as LEU1, TRP1, and URA3, dominant selection markers such as APH, DHFR, and TK, etc.), ribosome binding sites (RBS), etc.

[0040] Transformation of the host can be carried out using the protoplast method, spheroplast method, competent cell method, virus method, calcium phosphate method, lipofection method, microinjection method, gene bombardment method, Agrobacterium method, electroporation, etc. The obtained transformants are cultured under appropriate conditions using a medium containing a carbon source, a nitrogen source, metal salts, vitamins, etc. The transformants are cultured, for example, under aerobic conditions at 25 to 37°C for 3 to 6 hours. The pH is maintained near neutral during the culture period. The pH is adjusted using inorganic or organic acids, alkaline solutions, etc. During culture, antibiotics such as ampicillin or tetracycline may be added to the medium as needed, depending on the selection marker inserted into the recombinant expression vector.

[0041] The host used for transformation is not particularly limited as long as it can express the modified photoreceptor chloride channel, and examples that can be used include bacteria (Escherichia coli and Bacillus subtilis), yeast (Saccharomyces cerevisiae, etc.), animal cells (COS cells, Chinese hamster ovary (CHO) cells, 3T3 cells, BHK cells, HEK293 cells, etc.), and insect cells.

[0042] The modified photoreceptor chloride channel can be obtained in a form that retains its activity by separating and purifying the culture (culture supernatant, cultured cells, cultured bacterial cells, cell or bacterial homogenate, etc.) obtained by culturing the transformant using a conventional method, followed by appropriate use of methods such as ultrafiltration concentration, lyophilization, spray drying, and crystallization. Alternatively, the modified photoreceptor chloride channel may be provided in the form of cells that express the modified photoreceptor chloride channel without isolation or purification. In this case, the host cells used for transformation may be host cells suitable for the subsequent use, such as cells that constitute the retina, specifically neurons (photoreceptors, bipolar cells, ganglion cells, etc.) or retinal pigment epithelial cells, but may also be other cells. In one embodiment, the host cells are cells that constitute the human retina.

[0043] As described above, the present disclosure provides a polynucleotide encoding the modified photoreceptor chloride channel of the present disclosure, an expression vector comprising the polynucleotide, and a cell expressing the modified photoreceptor chloride channel of the present disclosure.

[0044] The modified photoreceptor chloride channel of the present disclosure has a narrower wavelength sensitivity range than GtACR1 and a comparable wavelength sensitivity range compared to GtACR2, but with shorter τon and τoff, resulting in superior photoresponsive properties. The narrow wavelength sensitivity range is effective in facilitating the selection of wavelengths for controlling neuronal excitation and inhibition, while the short τon and τoff are effective in enabling neuronal control with high temporal resolution. Therefore, the modified photoreceptor chloride channel of the present disclosure, polynucleotides encoding the same, expression vectors containing the polynucleotides, and cells expressing the modified photoreceptor chloride channel of the present disclosure can contribute to the suppression of visual dysfunction or impairment due to photoreceptor degeneration or loss, and the improvement of existing visual dysfunction or impairment, and are therefore useful for treating subjects suffering from damage to the outer retina. Furthermore, the modified photoreceptor chloride channel of the present disclosure, the polynucleotide encoding the same, the expression vector containing the polynucleotide, and the cell expressing the modified photoreceptor chloride channel of the present disclosure are also useful for various disorders associated with light responses, such as disorders of the brain or central or peripheral nervous system, spinal cord injury, and autoimmune diseases.

[0045] As used herein, "outer retinal damage" refers to a disease or condition in which visual dysfunction or impairment occurs due to the degeneration or loss of photoreceptors present in the outer retina. In a subject suffering from an outer retinal damage, retinal cells other than photoreceptors may be normal or may retain some of their function. Outer retinal damage includes retinitis pigmentosa, age-related macular degeneration, and retinal detachment. Subjects include, for example, humans and other mammals (e.g., mice, rats, monkeys, rabbits, dogs, cats, cows, and horses). Subjects suffering from an outer retinal damage include subjects who have lost their vision due to an outer retinal damage or subjects at risk of losing their vision. "Treatment" of a subject suffering from an outer retinal damage means restoring the visual function of the subject.

[0046] Expression vectors used for pharmaceutical purposes include viral vectors such as adeno-associated virus vectors, retrovirus vectors, and lentivirus vectors, (autonomously replicating) plasmids, transposons, etc. Plasmids for constructing expression vectors for modified photoreceptor chloride channels can be prepared, for example, according to the methods described in Tomita H et al., Invest Ophthalmol Vis Sci. 2007 Aug; 48(8): 3821-6 and Sugano E et al., Invest Ophthalmol Vis Sci. 2005 Sep; 46(9): 3341-8.

[0047] The modified photoreceptor chloride channel of the present disclosure, a polynucleotide encoding the same, an expression vector containing the polynucleotide, or cells expressing the modified photoreceptor chloride channel of the present disclosure are administered to a subject as an active ingredient. The effective amount is an amount that can provide a therapeutic effect for a given symptom and method of use, and is appropriately determined by a person skilled in the art through animal tests and clinical trials, taking into consideration the age, weight, sex, state and severity of the disease, and administration method of the subject to be administered. For example, in the case of a viral vector, the viral dose is 10 12 ~10 13 capsids / ml (e.g., approximately 10 13 capsids / ml).

[0048] When formulated as a pharmaceutical, the active ingredient may be formulated with one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers include various buffers, such as saline, phosphate, and acetate buffers. Pharmaceutical compositions containing the active ingredient can be formulated, for example, as injections for topical administration, eye drops, eyewashes, and the like. Injectable preparations can be provided in unit dosage forms, such as ampoules or multi-dose containers, with the addition of a preservative. The pharmaceutical composition may also be a lyophilized preparation that is reconstituted before use with a suitable vehicle, such as pyrogen-free sterile water. The pharmaceutical composition is preferably administered to the affected area of ​​the subject. For example, the pharmaceutical composition can be administered by direct injection into the retina or by direct contact with the vitreous.

[0049] The modified photoreceptor chloride channel of the present disclosure, a polynucleotide encoding the same, an expression vector containing the polynucleotide, or a cell expressing the modified photoreceptor chloride channel of the present disclosure may be used in combination with other therapeutic components, such as drugs known to treat retinitis pigmentosa, age-related macular degeneration, retinal detachment, etc.

[0050] In one aspect, the present disclosure provides use of a modified photoreceptor chloride channel of the present disclosure, a polynucleotide encoding the same, an expression vector comprising the polynucleotide, or a cell expressing a modified photoreceptor chloride channel of the present disclosure in the manufacture of a medicament for treating a subject suffering from a disorder of the outer retina. In one aspect, the present disclosure provides a method of treating a subject suffering from a disorder of the outer retina, the method comprising administering to the subject a modified photoreceptor chloride channel of the present disclosure, a polynucleotide encoding the same, an expression vector comprising the polynucleotide, or a cell expressing a modified photoreceptor chloride channel of the present disclosure. In one aspect, the present disclosure provides a use of a modified photoreceptor chloride channel of the present disclosure, a polynucleotide encoding the same, an expression vector comprising the polynucleotide, or a cell expressing a modified photoreceptor chloride channel of the present disclosure, for treating a subject suffering from a disorder of the outer retina.

[0051] Exemplary embodiments of the present disclosure are described below. [1] A modified photoreceptor chloride channel comprising an amino acid sequence in which at least the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of Guillardia theta anion channelrhodopsin-1 (GtACR1) is replaced with the corresponding region in Guillardia theta anion channelrhodopsin-2 (GtACR2). [2] 2. A modified photoreceptor chloride channel according to claim 1, comprising an amino acid sequence in which the extracellular domain between the second and third transmembrane domains and / or the extracellular domain between the sixth and seventh transmembrane domains in the amino acid sequence of GtACR1 are further replaced with the corresponding domains of GtACR2. [3] 3. A modified photoreceptor chloride channel according to 1 or 2, comprising an amino acid sequence in which the region from the third transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are replaced with the corresponding regions of GtACR2. [4] 2. The modified photoreceptor chloride channel according to 1, comprising an amino acid sequence in which at least the region from the second transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 is substituted with the corresponding domain of GtACR2. [5] 5. A modified photoreceptor chloride channel according to 4, comprising an amino acid sequence in which the intracellular domain between the first and second transmembrane domains and / or the extracellular domain between the sixth and seventh transmembrane domains in the amino acid sequence of GtACR1 are further replaced with the corresponding domains of GtACR2. [6] 6. A modified photoreceptor chloride channel according to 5, comprising an amino acid sequence in which the region from the second transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are replaced with the corresponding regions of GtACR2. [7] 7. The modified photoreceptor chloride channel according to any one of 1 to 6 above, wherein GtACR1 consists of the amino acid sequence of SEQ ID NO:1. [8] 8. The modified photoreceptor chloride channel according to any one of 1 to 7 above, wherein GtACR2 consists of the amino acid sequence of SEQ ID NO:2. [9] 9. The modified photoreceptor chloride channel according to any one of 1 to 8 above, which comprises any one of amino acid sequences selected from the following (a-1) to (c-1): (a-1) the amino acid sequence of SEQ ID NO: 6; (b-1) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 6, and (c-1) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 6.

[10] 9. The modified photoreceptor chloride channel according to any one of 1 to 8 above, which comprises any one of the amino acid sequences (a-2) to (c-2) below: (a-2) the amino acid sequence of SEQ ID NO: 7; (b-2) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 7, and (c-2) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 7.

[0052]

[11] 11. A polynucleotide encoding the modified photoreceptor chloride channel according to any one of 1 to 10 above.

[12] 12. The polynucleotide according to 11 above, which is any one of polynucleotides selected from the following (d-1) to (f-1): (d-1) a polynucleotide comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6; (e-1) a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 6; and (f-1) A polynucleotide comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO:6.

[13] 12. The polynucleotide according to 11 above, which is any one of polynucleotides selected from the following (d-2) to (f-2): (d-2) a polynucleotide comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 7; (e-2) a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 7; and (f-2) A polynucleotide comprising a base sequence encoding an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 7.

[14] 12. The polynucleotide according to 11 above, which is any one of polynucleotides selected from the following (g-1) to (i-1): (g-1) a polynucleotide comprising the base sequence of SEQ ID NO: 13; (h-1) a polynucleotide that hybridizes under stringent conditions to a complementary strand of a polynucleotide comprising the base sequence of SEQ ID NO: 13; and (i-1) A polynucleotide comprising a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence of SEQ ID NO: 13.

[15] 12. The polynucleotide according to 11 above, which is any one of polynucleotides selected from the following (g-2) to (i-2): (g-2) a polynucleotide comprising the base sequence of SEQ ID NO: 14; (h-2) a polynucleotide that hybridizes under stringent conditions to a complementary strand of a polynucleotide comprising the base sequence of SEQ ID NO: 14, and (i-2) A polynucleotide comprising a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence of SEQ ID NO: 14.

[0053]

[16] 16. An expression vector comprising the polynucleotide according to any one of 11 to 15 above.

[0054]

[17] 11. A cell expressing the modified photoreceptor chloride channel according to any one of 1 to 10 above.

[18] 18. The cell according to 17 above, wherein the cell is a cell that constitutes the retina.

[0055]

[19] A pharmaceutical composition for treating a subject suffering from a disorder of the outer retina, comprising the modified photoreceptor chloride channel described in any one of 1 to 10, the polynucleotide described in any one of 11 to 15, the expression vector described in 16, or the cell described in 17 or 18.

[20] 20. The pharmaceutical composition according to 19 above, which comprises the modified photoreceptor chloride channel according to any one of 1 to 10 above. [twenty one] 19. The pharmaceutical composition according to 19, comprising the cells according to 17 or 18. [twenty two] 22. The pharmaceutical composition according to any one of 19 to 21 above, wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

[0056] [twenty three] A method for treating a subject suffering from a disorder of the outer retina, comprising administering to the subject the modified photoreceptor chloride channel described in any one of 1 to 10, the polynucleotide described in any one of 11 to 15, the expression vector described in 16, or the cell described in 17 or 18. [twenty four] Use of the modified photoreceptor chloride channel described in any one of 1 to 10, the polynucleotide described in any one of 11 to 15, the expression vector described in 16, or the cell described in 17 or 18 in the manufacture of a medicament for treating a subject suffering from a disorder of the outer retina. [twenty five] Use of the modified photoreceptor chloride channel described in any one of 1 to 10, the polynucleotide described in any one of 11 to 15, the expression vector described in 16, or the cell described in 17 or 18 for treating a subject suffering from a disorder of the outer retina. [Example]

[0057] The present invention will be described in detail below with reference to examples, but the present invention should not be construed as being limited to the following description.

[0058] Example 1: Creation of engineered photoreceptor chloride channels To investigate the optimal combination of transmembrane and intracellular domains of GtACR1 and GtACR2, we examined several recombinants. From these, we selected five recombinants (601, 602, 603, 605, and 606) for evaluation by patch clamp imaging. The combinations of transmembrane and intracellular domains for each recombinant are shown in Figure 1. For these five recombinants and seven of GtACR1 and GtACR2 (see Figure 1), polynucleotides optimized for human codons to achieve high codon adaptation index (CAI) were chemically synthesized and inserted into the multicloning site of a plasmid for adeno-associated virus vector construction. Details of the construction of cell lines expressing recombinants 605 and 606 are described below. The other recombinants, GtACR1 and GtACR2, were constructed in a similar manner. The amino acid sequences of GtACR1, GtACR2, and recombinants 601, 602, 603, 605, and 606 are shown in SEQ ID NOs: 1 to 7, respectively, and the nucleotide sequences of polynucleotides encoding these are shown in SEQ ID NOs: 8 to 14, respectively.

[0059] Example 1-1: Construction of recombinant 605 (SEQ ID NO: 6) expressing cell line A polynucleotide encoding the amino acid sequence from the N-terminus of GtACR1 to the extracellular domain between the second and third transmembrane domains, a polynucleotide encoding the amino acid sequence from the third transmembrane domain to the extracellular domain between the sixth and seventh transmembrane domains of GtACR2, and a polynucleotide encoding the amino acid sequence from the seventh transmembrane domain to the C-terminus of GtACR1 (SEQ ID NO: 13) was chemically synthesized and inserted into the multicloning site of a plasmid for adeno-associated virus vector construction. The vector map of this plasmid is shown in Figure 2. Since this plasmid contains a fluorescent protein gene (venus) in the 3' region of the multicloning site, cells expressing recombinant 605 were identified using venus as an indicator. Human embryonic kidney (HEK) 293 cells were cultured in DMEM medium containing 10% FBS at 37°C with 5% CO2.

[0060] Example 1-2: Construction of recombinant 606 (SEQ ID NO: 7) expressing cell line A polynucleotide encoding the amino acid sequence from the N-terminus of GtACR1 to the intracellular domain between the first transmembrane domain and the second transmembrane domain, a polynucleotide encoding the amino acid sequence from the second transmembrane domain of GtACR2 to the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain, and a polynucleotide encoding the amino acid sequence from the seventh transmembrane domain to the C-terminus of GtACR1 (SEQ ID NO: 14) were linked together to create a polynucleotide with restriction enzyme sequences added to the 5' and 3' ends, which was chemically synthesized and inserted into the multicloning site of a plasmid for producing an adeno-associated virus vector. The production procedure, other than the recombinant sequence, was the same as that described in Example 1-1.

[0061] Test Example 1: Measurement of light-induced current, τ on and τ off using patch clamp method (Measurement method) After confirming venus expression under a microscope, a patch clamp system (EPC-10, HEKA) was used to measure light-induced currents, τon (open rate: the time from the start of light irradiation to the channel opening), and τoff (close rate: the time from the end of light irradiation to the channel closing). The extracellular solution consisted of 138 mM NaCl, 3 mM KCl, 10 mM HEPES, 4 mM NaOH, 1 mM CaCl2, and 2 mM MgCl2, adjusted to pH 7.4 with 1N HCl. The electrode solution consisted of 130 mM CsCl, 1.1 mM EGTA, 2 mM MgCl2, 0.1 mM CaCl2, 10 mM NaCl, 10 mM HEPES, and 2 mM Na2ATP, adjusted to pH 7.2 with 1N CsOH. Light irradiation (light source: LED) was performed for 1 second, with a light intensity of 1 μW / mm. 2 The interstimulus interval was 60 seconds, and the clamp potential was set to 0 mV. The wavelengths were 405, 455, 505, 560, 617, and 656 nm.

[0062] (Measurement results) The results of light-induced current measurements are shown in Figure 3, and the results of τon and τoff measurements are shown in Figures 4 and 5 (n = 8). To clarify the characteristics of the recombinant, the results of measurements of cells expressing the recombinant as well as cells expressing GtACR1 or GtACR2 are also shown.

[0063] Light-induced ionic currents were not observed in cells expressing recombinant 601, 602, or 603. As shown in Figure 3, light-induced ionic currents were observed in cells expressing recombinant 605 or 606, with recombinant 605 exhibiting a particularly high light response. Comparing the wavelength sensitivity ranges of recombinant 605 and 606 with that of GtACR1, the shorter wavelengths were comparable, but the longer wavelengths were shorter for recombinant 605 and 606 than for GtACR1. Comparing the wavelength sensitivity ranges of recombinant 605 and 606 with that of GtACR2, the wavelength sensitivity ranges were nearly identical. Recombinant 605 exhibited higher light-induced ionic currents across the entire wavelength range compared to GtACR2. Recombinant 606 exhibited high light response.

[0064] As shown in Figures 4 and 5, the τon and τoff of the recombinants 605 and 606 were shorter across the entire wavelength range than those of GtACR2.

[0065] These results demonstrate that recombinant 605 and 606, especially 605, are modified photoreceptor chloride channels with excellent photoresponsive properties and are novel photoreceptor chloride channels that may be used in optogenetics in various situations.

Claims

1. A modified photoreceptor chloride channel comprising an amino acid sequence in which at least the region from the third transmembrane domain to the sixth transmembrane domain in the amino acid sequence of Guillardia theta anion channelrhodopsin-1 (GtACR1) is substituted with the corresponding region of Guillardia theta anion channelrhodopsin-2 (GtACR2), and the extracellular domain from the N-terminus to the first transmembrane domain, the first transmembrane domain, the intracellular domain between the first and second transmembrane domains, the seventh transmembrane domain, and the intracellular domain from the seventh transmembrane domain to the C-terminus are not substituted.

2. The modified photoreceptor chloride channel of claim 1, comprising an amino acid sequence in which the extracellular domain between the second transmembrane domain and the third transmembrane domain and / or the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 is further substituted with the corresponding domain of GtACR2.

3. The modified photoreceptor chloride channel of claim 1 or 2, comprising an amino acid sequence in which the region from the third transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are substituted with the corresponding regions of GtACR2.

4. 2. The modified photoreceptor chloride channel of claim 1, comprising an amino acid sequence in which at least the region from the second transmembrane domain to the sixth transmembrane domain in the amino acid sequence of GtACR1 is substituted with the corresponding domain of GtACR2.

5. The modified photoreceptor chloride channel of claim 4, comprising an amino acid sequence in which the region from the second transmembrane domain to the sixth transmembrane domain and the extracellular domain between the sixth transmembrane domain and the seventh transmembrane domain in the amino acid sequence of GtACR1 are substituted with the corresponding regions of GtACR2.

6. The modified photoreceptor chloride channel of any one of claims 1 to 5, wherein GtACR1 consists of the amino acid sequence of SEQ ID NO:

1.

7. The modified photoreceptor chloride channel of any one of claims 1 to 6, wherein GtACR2 consists of the amino acid sequence of SEQ ID NO:

2.

8. The modified photoreceptor chloride channel according to any one of claims 1 to 7, comprising any one of the amino acid sequences (a-1) to (c-1) below: (a-1) the amino acid sequence of SEQ ID NO: 6; (b-1) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 6; and (c-1) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO:

6.

9. The modified photoreceptor chloride channel of any one of claims 1 to 7, comprising any one of the amino acid sequences selected from the following (a-2) to (c-2): (a-2) the amino acid sequence of SEQ ID NO: 7; (b-2) an amino acid sequence in which one or more amino acids have been modified in the amino acid sequence of SEQ ID NO: 7; and (c-2) An amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO:

7.

10. A polynucleotide encoding the modified photoreceptor chloride channel of any one of claims 1 to 9.

11. A cell expressing the modified photoreceptor chloride channel of any one of claims 1 to 9.

12. The cell according to claim 11, wherein the cell is a cell that constitutes the retina.

13. A pharmaceutical composition for treating a subject suffering from an outer retinal disorder, comprising the modified photoreceptor chloride channel of any one of claims 1 to 9, the polynucleotide of claim 10, or the cell of claim 11 or 12.

14. The pharmaceutical composition according to claim 13, wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

Citation Information

Patent Citations

  • Compositions and methods of use of anion channelrhodopsins

    JP2018509909A

  • Modified channel rhodopsin

    WO2020059675A1

  • Nucleic acid construct that encodes chimeric rhodopsin

    WO2021049634A1