Type III CRISPR / Cas-based diagnostics
The CRISPR/Cas-based RNA detection system leverages type III CRISPR effector complexes for RNA detection by determining cOA levels, enhancing diagnostic capabilities through isothermal methods and signal amplification.
Patent Information
- Application Number
- JP2021575360
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-04-07
- Filing Date
- 2020-06-19
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2040-06-19
AI Technical Summary
Existing CRISPR/Cas systems primarily target DNA-based invasion entities, with type III systems uniquely targeting RNA sequences but lacking efficient diagnostic tools due to their nuclease activity and cOA generation not being utilized for detection.
A CRISPR/Cas-based ribonucleic acid detection system using a type III CRISPR effector complex with a Cas protein and crRNA, which determines cyclic oligoadenylate (cOA) levels for RNA detection, utilizing inorganic pyrophosphatase and cOA-dependent endoribonuclease for isothermal detection.
Enables sensitive and specific RNA detection at elevated temperatures, providing a novel diagnostic tool by amplifying detection signals through cOA and pyrophosphate conversion, suitable for various assay methods.
Smart Images

Figure 0007757187000010 
Figure 0007757187000011 
Figure 0007757187000012
Abstract
Description
[Technical Field]
[0001] Field The invention described herein relates to a CRISPR / Cas-associated nucleic acid detection system and its broad use in diagnostic applications. [Background technology]
[0002] 1. Introduction Over the past decade, the world of molecular biology has seen several groundbreaking discoveries that have had consequences far beyond the field itself. Undoubtedly, CRISPR / Cas (clustered regularly interspaced short palindromic repeats, CRISPR / associated genes) can be considered one of these discoveries. The CRISPR / Cas system was identified as a prokaryotic adaptive immune system, providing sequence-specific defense against foreign genetic elements such as bacteriophages and plasmids. However, the CRISPR / Cas system will enable genetic perturbations in most, if not all, organisms, which will have a profound impact on all technological fields.
[0003] CRISPR defense can be described as a three-phase process: adaptation, expression, and interference (Rath et al., 2015. Biochimie 117:119-128; Makarova et al., 2011. Nat Rev Microbiol 9:467-477). During the adaptation phase, gene segments are acquired from foreign invaders and stored in CRISPR memory (Jackson et al., 2017. Science 356:eaal5056). This memory contains foreign DNA sequences called spacers separated by repeated DNA sequences (repeats). Expression of CRISPR loci (phase II) results in the transcription of long RNA molecules, which are subsequently processed into multiple CRISPR RNAs (crRNAs) (Brouns et al., 2008. Science 321:960-964). Additionally, cells express Cas proteins, which are effectors of the CRISPR / Cas system, and form ribonucleoprotein (RNP) complexes by incorporating crRNA. When a foreign genetic element is detected based on sequence complementarity to the crRNA, the associated Cas protein degrades the invading entity using its nuclease activity, often described as an intervention step in the CRISPR defense process.
[0004] A vast amount of research dedicated to CRISPR / Cas over the past decade has led to the discovery of numerous systems within the bacterial and archaeal kingdoms (Fenner et al., 2007, J Biomol Screen 20:1027-1039; van der Oost et al., 2009, Trends Biochem Sciences 34:401-407). CRISPR / Cas systems have been categorized: Class I systems utilize multisubunit Cas complexes, while Class II systems use only a single Cas protein to mediate their activity. Different types are generally characterized based on the presence of signature genes (Wright et al., 2016, Cell 164:29-44).
[0005] Despite the differences that distinguish many CRISPR / Cas systems, the majority share functional similarities. Nearly all CRISPR / Cas types function as DNA-targeting RNPs, likely associated with numerous DNA-based invasion entities. In contrast, RNA-based invasion elements are rarely encountered in the prokaryotic world. Thus, it is somewhat surprising that type III CRISPR / Cas systems have evolved to target RNA sequences (Wright et al., 2016, Cell 164:29-44; Hale et al., 2009, Cell 139:945-956). Studies have attributed this unusual activity to the degradation of transcripts originating from invading bacteriophages, preventing cell lysis (Jiang et al., 2016, Cell 164:710-721; Goldberg et al., 2014, Nature 514:633-637). Type III systems belong to class I. In other words, RNPs consist of multiple subunits.
[0006] The Type III system is unique in that it exhibits three distinct types of nuclease activity. Furthermore, the generation of the messenger molecule cyclic oligoadenylate (cOA) has not been assigned to any other CRISPR / Cas system. Exploiting these features may provide new ways to visualize target recognition, making the Type III system suitable for novel diagnostic tools. Summary of the Invention [Means for solving the problem]
[0007] 2. Brief description of the invention The present invention provides a CRISPR (clustered regularly interspaced short palindromic repeats)-based ribonucleic acid detection system comprising: (a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule; and (b) a means for directly or indirectly determining the level of cyclic oligoadenylate (cOA). The detection system is preferably a type III CRISPR. The Cas is a type IIIB Cas, preferably a type IIIB Cmr. The type III Cas is preferably derived from a thermophilic organism such as Thermus thermophilus.
[0008] The type III Cas preferably lacks cleavage activity, for example, by the D26N mutation in the Cmr4 subunit or by equivalent mutations in other subunits. More preferred cleavage activity-inactivating mutations include Cmr4 D26A, the Cmr4 E227A and E228 double mutant, and Cmr4 D86A (Ramia et al., 2014, Cell Reports 9: 1610-1617; Zhu and Ye, 2015, Nucleic Acids Res 43: 1257-1267). Additionally, Csm3 D32A is a good candidate for a cleavage activity-inactivating type IIIA Csm mutant (Samai et al., 2015, Cell 161: 1164-1174).
[0009] In a preferred detection system of the present invention, the means for directly or indirectly determining the level of cOA comprises a means for determining the level of pyrophosphate (PPi). The preferred detection system of the present invention may further comprise an inorganic pyrophosphatase, preferably derived from a thermophilic organism such as Thermus thermophilus, making it compatible with the preferred Type III CRISPR / Cas system and enabling isothermal detection.
[0010] A preferred detection system according to the present invention further comprises a cOA-dependent non-specific effector endoribonuclease such as Csx1.
[0011] A preferred detection system according to the present invention further comprises a cOA-dependent non-specific effector endoribonuclease, such as Csx1, and a detectable substrate for said endoribonuclease.
[0012] The present invention further provides a method for determining the presence or absence of a target nucleic acid molecule in a sample, comprising providing the sample with a ribonucleic acid detection system according to the present invention, incubating the sample under conditions that allow binding of crRNA to its target nucleic acid molecule, and directly or indirectly determining the level of cyclic oligoadenylate (cOA), wherein an increase in the determined cOA level compared to a control is indicative of the presence of said target molecule in said sample.
[0013] The level of cOA can be determined by determining the level of pyrophosphate, or the level of inorganic phosphate if inorganic pyrophosphatase is present in the detection system. The level of pyrophosphate or inorganic phosphate is preferably determined by a colorimetric, fluorometric, fluorescent, or bioluminescence-based assay.
[0014] The level of cOA can be determined indirectly by determining the level of a cOA-dependent non-specific effector endoribonuclease, such as Csx1, by detecting a detectable substrate for the effector endoribonuclease.
[0015] A preferred method according to the invention comprises incubating the sample with the ribonucleic acid detection system at a temperature between 37°C and 85°C, preferably at about 65°C.
[0016] The present invention further provides a device comprising a ribonucleic acid detection system according to the present invention, said device preferably comprising a plurality of arrayed ribonucleic acid detection systems according to the present invention, said plurality of arrayed ribonucleic acid detection systems preferably having different target nucleic acid molecules.
[0017] The present invention further provides a kit of parts comprising: a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule; and b) means for directly or indirectly determining levels of cyclic oligoadenylate (cOA). [Brief explanation of the drawings]
[0018] 3. Diagram Description [Figure 1A-C] Codon-optimized CmrCas proteins using the IDT Codon Optimization Tool (available at eu.idtdna.com / codonopt). [Figure 2] Sequence alignment of Cmr with Csm. [Figure 3A] In vitro RNase activity assay with the endogenous TtCmr complex. Denaturing polyacrylamide gel electrophoresis (PAGE) analysis of activity assays using 5'-phospho-32-labeled target RNA complementary to the crRNA incubated with the endogenous TtCmr complex. A single-stranded RNA marker ("M") was used as a size standard, as indicated on the left. [Figure 3B] In vitro RNase activity assay with reconstituted TtCmr complex. Activity assay similar to panel A, but using reconstituted complex. [Figure 4A] The RNAse activity of TtCmr is unaffected by targets with mismatches in the first guide nucleotide of the crRNA. [Figure 4B] cOA production is significantly affected by mismatches at nucleotide positions 1, 2, and 5. [Figure 5A]cOA production assay with TtCmr40 incubated with target RNAs containing mismatches at the indicated nucleotide positions (Table 4). [Figure 5B] cOA production assay with TtCmr46 incubated with target RNAs containing mismatches at the indicated nucleotide positions (Table 4). [Figure 6A] Flexible seed region at the 3' end of crRNA. Target RNA degradation and cOA generation assays using the endogenous TtCmr (TtCmr) complex incubated with target RNAs with mismatches at the indicated segments (Table 4). [Figure 6B] Flexible seed region at the 3' end of the crRNA. Target RNA degradation and cOA generation assays using reconstituted TtCmr complexes with 46 nucleotide (nt) crRNA ("TtCmr-46") incubated with target RNAs with mismatches at the indicated segments (Table 4). [Figure 6C] The flexible seed region at the 3' end of the crRNA. Target RNA degradation and cOA generation assays using the reconstituted TtCmr complex with 40 nt crRNA ("TtCmr-40") incubated with target RNAs with mismatches at the indicated segments (Table 4). [Figure 7A] Base pairing between the target RNA and the TtCmr-bound crRNA begins at the 3' end of the crRNA. Electrophoretic mobility shift assay (EMSA) analysis of endogenous TtCmr complexes incubated with different target RNAs (Table 4), each containing a 5-nt stretch mismatched to the TtCmr-bound crRNA. [Figure 7B] Base pairing between the target RNA and the TtCmr-bound crRNA is initiated at the 3' end of the crRNA. EMSA analysis of endogenous TtCmr complexes incubated with short 11-nt target RNAs (Table 4) complementary to the indicated nucleotides of the TtCmr-bound crRNA. [Figure 8A] The absorbance of the colorimetric output for Pi detection was determined using Cmr at a series of added target RNA concentrations as instructed. The reaction time was set to 1 hour and the color development time to 30 minutes (direct cOA detection using the malachite green assay). [Figure 8B] Colorimetric output absorbance measurement of target RNA detection with time-course Pi level determination in fold increase units (direct cOA detection using malachite green assay). [Figure 8C] Detection of cOA-mediated RNAse activity of Csx1 using quencher-fluorophore sequences of ssRNA and ssDNA (indirect cOA detection). [Figure 9] Sensitivity range of the T. thermophilus type IIIB Cmr system against natural target RNA 4.5. Target recognition was monitored using indirect cOA visualization. Random RNA of similar length was used as a negative off-target control. [Figure 10] Sensitivity range of the T. thermophilus type IIIB Cmr system containing the Cmr4 mutant D26N against the native target RNA 4.5. Target recognition was monitored using indirect cOA visualization. Random RNA of similar length was used as a negative off-target control. [Figure 11] Comparison of the norovirus target RNA detection limits of wild-type and dCmr complexes. Target recognition was monitored using indirect cOA visualization. The raw signal output of the assay is shown. Random RNA of similar length was used as a negative off-target control. [Figure 12] cOA generation by type IIIA CRISPR / Cas complexes after addition of complementary target RNA. [Figure 13] Results of the one-pot SARS-CoV-19 N gene detection assay. The graph shows data from the "signal generation incubation" at 65°C. [Figure 14] Results of the one-pot SARS-CoV-19 N gene detection assay on mink samples. The graph shows data from the "signal generation incubation" at 65°C. DETAILED DESCRIPTION OF THE INVENTION
[0019] 4. Detailed Description of the Invention 4.1 Definition As used herein, the term "clustered regularly interspaced short palindromic repeats (CRISPR)" refers to one or more specialized regions of DNA in the genome of a prokaryotic microorganism. These regions are characterized by the presence of spacer-interposed nucleotide repeats (typically direct DNA repeats of about 25 to about 38 bp) separated by unique spacer sequences of similar length derived from previous encounters with invasive elements (Grissa et al., 2007). This serves as a memory for quickly attacking the invader during subsequent infections. The genomic region contains one or more CRISPR-associated effector protein (Cas)-encoding genes located near the CRISPR locus.
[0020] As used herein, the term "CRISPR crRNA" refers to a CRISPR-derived RNA molecule comprising a spacer sequence and 5- and 3-repeat-derived termini. The CRISPR crRNA preferably has a length of at least 30 nucleotides, more preferably at least 34 nucleotides, more preferably at least 40 nucleotides, and more preferably at least 46 nucleotides. The CRISPR crRNA is preferably less than 1000 nucleotides, preferably less than 200 nucleotides, and preferably less than 100 nucleotides. The RNA molecule may contain ribonucleic acid nucleotide analogs, such as inosine, uridine, xanthine, hypoxanthine, 2,6-diaminopurine, and 6,8-diaminopurine-based ribonucleotides and desoxyribonucleotides.
[0021] As used herein, the term "CRISPR-associated effector protein" (Cas) refers to a protein associated with a CRISPR crRNA. CRISPR / Cas systems are currently divided into two classes: Class I systems utilize a multi-subunit Cas complex, while Class II systems use only a single Cas protein to mediate their activity. Class I type III CRISPR-Cas systems have evolved to specifically target RNA sequences. The unique proteins in these systems are Cas3 in Class I systems, Cas9 in Class II systems, and Cas10 in Class I type III systems.
[0022] As used herein, the term "effector complex" refers to a CRISPR-Cas ribonucleoprotein complex that has nuclease activity and can cleave and inactivate an invading nucleic acid sequence that contains a sequence complementary to the spacer sequence of a CRISPR crRNA.
[0023] As used herein, the term "cyclic oligoadenylate (cOA)" refers to a ring structure containing 3-6 molecules of adenosine monophosphate (AMP). The formation of cOA is catalyzed by the cyclase domain of Cas10, which is part of the type III effector system.
[0024] As used herein, the term "Type III Cas" refers to an RNA-targeting multi-subunit CRISPR-associated complex that contains at least the Cas10 protein.
[0025] As used herein, the term "type IIIA Cas" refers to an RNA-targeting type 3 CRISPR / Cas complex that possesses nonspecific DNase activity upon binding to a target RNA molecule. Examples of type IIIA Cas include the type IIIA Csm complexes from Staphylococcus thermophilus, Thermus thermophilus, and Staphylococcus epidermis.
[0026] As used herein, the term "type IIIB Cas" refers to an RNA-targeting type 3 CRISPR-Cas complex that lacks nonspecific DNase activity. The type IIIB Cas complex is composed of six to seven proteins. Examples of type IIIB Cas include the type IIIB Cmr complexes from Pyrococcus furiosus, Thermus thermophilus, and Sulfolobus solfataricus.
[0027] As used herein, the term "PPi" or phosphonatophosphate refers to a salt or ester of pyrophosphate. Alternative names are pyrophosphate, diphosphate, and dipolyphosphate.
[0028] As used herein, the term "inorganic pyrophosphatase" or inorganic diphosphatase refers to an enzyme that catalyzes the conversion of one pyrophosphate ion to two phosphate ions. The enzyme is in the enzyme class EC 3.6.1.1.
[0029] As used herein, the term "cOA-dependent nonspecific effector endoribonuclease" refers to a ribonuclease that nonspecifically degrades RNA using a HEPN (higher eukaryotic and prokaryotic nucleotide-binding) active site. This nuclease is activated by binding of the cOA messenger using its CRISPR-associated Rossmann fold (CARF) domain. Examples of such nonspecific effector endoribonucleases are the Cas accessory proteins Csx1 and Csm6.
[0030] As used herein, the term "biosensor" or "biological sensor" refers to a sensing device comprising a CRISPR-based ribonucleic acid system according to the present invention. A signal, e.g., a colorimetric, fluorometric, fluorescent, or bioluminescent signal, generated upon interaction of the CRISPR-based ribonucleic acid system with an RNA molecule complementary to the crRNA is coupled to a transducer to allow quantification of the signal. The signal is preferably converted into a measurable electrical parameter, such as current or voltage, using a suitable transducer.
[0031] 4.2 CRISPR / Cas-based RNA detection system In one aspect, the present invention provides a CRISPR (clustered regularly interspaced short palindromic repeats)-based ribonucleic acid (RNA) detection system, comprising an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule, and methods and means for directly or indirectly determining levels of cyclic oligoadenylate (cOA).
[0032] The CRISPR / Cas-based ribonucleic acid detection system is preferably derived from a thermophilic organism such as Pyrococcus furiosus, Sulfolobus solfataricus, or Thermus thermophilus. The advantage of a CRISPR / Cas-based ribonucleic acid detection system derived from a thermophilic organism is that detection can be performed at elevated temperatures, e.g., 40°C to 80°C, preferably 50°C to 70°C, e.g., 55°C to 65°C, preferably about 65°C. Incubation at this temperature can accelerate the cOA synthesis reaction compared to incubation at lower temperatures. Additionally, elevated temperatures can inactivate nucleases or proteases, such as DNases and RNases, present in the sample.
[0033] Another advantage of a CRISPR / Cas-based ribonucleic acid detection system derived from a thermophilic organism is that it may provide increased stability to the system and, as a result, allow it to be stored for a longer period of time when compared to a CRISPR / Cas-based ribonucleic acid detection system derived from a mesophilic organism.
[0034] The ribonucleic acid detection system is based on the prokaryotic CRISPR / Cas system, which, similar to the eukaryotic RNA interference (RNAi) system, constitutes an acquired immune system to protect prokaryotic cells from invading viruses and plasmids (Makarova et al., 2006. Biol Direct 1:1-7). The CRISPR-Cas immune response consists of three distinct steps: 1) adaptation, which excises a portion of the invader's target DNA and inserts it into the CRISPR array; 2) expression and maturation of CRISPR (cr)RNA and assembly of the CRISPR / Cas complex; and 3) interference, which uses the crRNA as a guide to recognize sequences complementary to the mature CRISPR sequences in the invading genome of the virus or plasmid, followed by cleavage and inactivation of the foreign nucleic acid by Cas nucleases.
[0035] The general structure of a type III CRISPR / Cas complex is comprised of multiple subunits, Cas7 and Cas11 (Staals et al., 2013. Mol. Cell 52:135-145; Staals et al., 2014. Mol. Cell 56:518-530), capped on one side by Cas5 and Cas10. Of these, Cas7 provides RNase activity upon recognition of the target RNA by the preloaded RNA guide.
[0036] Target recognition has been shown to promote the generation of cyclic oligoadenylate (cOA) by the Cas10 palm domain (Kazlauskiene et al., 2017, Science 357:605-609; Niewoehner et al., 2017, Nature 548:543-548). cOA species are known signaling molecules in eukaryotes, but such activity has not been reported in prokaryotic hosts. However, studies suggest that the presence of cOA leads to a large increase in RNase activity by Csm6 or Csx1 family members. These proteins are often encoded at type III loci but are not directly associated with ribonucleoprotein complexes. Instead, recognition of the invader RNA transcript can result in target RNA degradation by Cas7, nonspecific DNA degradation by class I type IIIA Cas10, or activation of Csm6 or Csx1 to generate cOA, which can cause the concomitant cleavage of other nearby single-stranded RNA molecules.
[0037] Methods for directly determining cOA levels preferably include methods for determining pyrophosphate or PPi levels. The formation of pyrophosphate is coupled to the formation of cOA from ATP by CRISPR / Cas-associated proteins such as Cas10. The formation of cOA, consisting of 3-6 AMP units, leads to the simultaneous formation of 3-6 molecules of PPi.
[0038] Alternatively, the detection system of the present invention can include inorganic pyrophosphatase, which results in the degradation of PPi and the formation of two inorganic phosphate molecules for each PPi molecule. Thus, by determining the level of inorganic phosphate, the number of detectable molecules is amplified from 1 molecule of cOA to 6-12 molecules of Pi.
[0039] A preferred inorganic pyrophosphatase is an enzyme that is active at the same or similar temperature as the type III CRISPR / Cas-based RNA detection system. Additionally, the inorganic pyrophosphatase is preferably active under the same or similar conditions as the type III CRISPR / Cas-based RNA detection system, including the same or similar pH and the same or similar salt concentration. For example, if the type III CRISPR / Cas-based RNA detection system has optimal activity at 50°C, the inorganic pyrophosphatase is preferably active at this temperature. Preferably, the activity of the inorganic pyrophosphatase at 50°C is such that essentially all PPi molecules are degraded to inorganic phosphate molecules. The degradation is preferably instantaneous. Similarly, the activity of the inorganic pyrophosphatase at a selected pH and salt concentration is such that essentially all PPi molecules are degraded to inorganic phosphate molecules. The degradation is preferably instantaneous.
[0040] Preferred inorganic pyrophosphatases are derived from thermophilic organisms such as Pyrococcus furiosus, Sulfolobus solfataricus, and Thermus thermophilus, allowing for simultaneous isothermal detection. Thus, the level of cOA can be determined directly by determining the level of Pi.
[0041] PPi and Pi can be detected using methods known in the art, including colorimetric, fluorometric, fluorescent, or bioluminescence-based assays.
[0042] Suitable methods for determining levels of PPi include fluorometric and / or colorimetric pyrophosphate (PPi) assay kits (Biovision Inc., Milpitas, CA), fluorescent EnzChek® pyrophosphate detection kits (ThermoFisher Scientific; Waltham, MA), fluorometric pyrophosphate assay kits (SigmaAldrich, Saint Louis, MO), and luminescent PPiLight™ assays (Lonza Group AG, Bazel, Switzerland).
[0043] Suitable methods for determining inorganic phosphate or Pi levels include the colorimetric PiColorLock™ assay (Expedeon, Cambridge, UK), the colorimetric Malachite Green Phosphate Assay Kit (Sigma-Aldrich, Saint Louis, MO), a fluorescent phosphate sensor (ThermoFisher Scientific; Waltham, MA), a luminescent readout following the conversion of ATP to ADP (US Patent Application Publication No. 20140273036A), a fluorescent chemosensor (Meng et al., 2015. RSC Advances 5:53189-53197), and photoluminescent graphene quantum dots combined with europium ions (Bai et al., 2013. Chemistry 19:3822-3826).
[0044] Methods and means for directly determining the level of cyclic oligoadenylate (cOA) preferably comprise at least one substrate and, optionally, an enzyme that allows at least one of the indicator detection methods for PPi or Pi.
[0045] A preferred method is a colorimetric assay such as the Malachite Green Phosphate Assay Kit, which allows for rapid determination of PPi or Pi levels as a direct determination of cOA levels.
[0046] Methods for indirectly determining the level of cOA preferably include determining the activity of a cOA-dependent nonspecific effector nuclease, such as CRISPR-assisted nuclease 1 (Can1) or Can2, and determining the activity of a cOA-dependent nonspecific effector endoribonuclease, preferably Csx1. Thus, any detection system according to the present invention preferably comprises a cOA-dependent nonspecific effector endoribonuclease, such as Csx1.
[0047] The cOA-dependent nonspecific effector nuclease, preferably an endoribonuclease, is preferably an enzyme active at the same or similar temperature as the type III CRISPR / Cas-based RNA detection system. Additionally, the cOA-dependent nonspecific effector endoribonuclease is preferably active under the same or similar conditions as the type III CRISPR / Cas-based RNA detection system, including the same or similar pH and the same or similar salt concentration. For example, if the type III CRISPR / Cas-based RNA detection system has optimal activity at 65°C, the cOA-dependent nonspecific effector endoribonuclease is preferably active at this temperature. Preferably, the activity of the cOA-dependent nonspecific effector endoribonuclease at 65°C is such that the cOA-induced activity of the cOA-dependent nonspecific effector endoribonuclease results in the production of a detectable amount of a reaction product of a substrate for the cOA-dependent nonspecific effector endoribonuclease. Similarly, the activity of a cOA-dependent non-specific effector endoribonuclease at a selected pH and salt concentration is one in which the cOA-induced activity of the cOA-dependent non-specific effector endoribonuclease results in the production of a detectable amount of a reaction product of a substrate of said cOA-dependent non-specific effector endoribonuclease.
[0048] The substrate of the cOA-dependent nonspecific effector endoribonuclease is preferably an RNA molecule, the cleavage of which can be detected. Detection can be performed by any method known in the art. For example, detection can be performed directly by mass spectrometry, for example, ultra-high performance liquid chromatography (UHPLC) coupled with tandem mass spectrometry in positive electrospray ionization mode (LC-MS / MS). LC-MS / MS analysis can be performed, for example, by using a high-end UHPLC chromatography system coupled with a triple quadrupole mass spectrometer.
[0049] Detection can further be performed by liquid-liquid phase separation (LLPS, Spoelstra et al., 2018. BioRXiv, CSHL (doi.org / 10.1101 / 471482)).
[0050] A preferred substrate for cOA-dependent nonspecific effector endoribonuclease is an RNA molecule tagged with a fluorescent reporter molecule at one end and a quencher at the other end. The close proximity of the reporter to the quencher prevents its fluorescence from being detected. Cleavage of the substrate by activation of the cOA-dependent nonspecific effector endoribonuclease destroys the reporter-quencher proximity, thus rendering the fluorescent emission unquenchable, allowing its detection after laser excitation. Thus, an increase in the activity of the cOA-dependent nonspecific effector endoribonuclease causes a proportional increase in fluorescence due to cleavage of the substrate and removal of the quencher that quenches the fluorescent reporter.
[0051] Separately from or in addition to the activation of the nonspecific effector endoribonuclease, the level of target recognition can also be determined by determining the activation of the nonspecific effector DNase activity present in the type IIIA CRISPR / Cas effector complex using an appropriate substrate for the nuclease. The appropriate substrate is preferably a DNA molecule tagged with a fluorescent reporter molecule at one end and a quencher at the other end. The close proximity of the reporter to the quencher prevents its fluorescence from being detected. Cleavage of the substrate by activation of the cOA-dependent nonspecific effector DNase disrupts the reporter-quencher proximity, thus preventing the fluorescent emission from being quenched, allowing its detection after laser excitation. Thus, an increase in the activity of the cOA-dependent nonspecific effector DNase causes a proportional increase in fluorescence due to cleavage of the substrate and removal of the quencher that quenches the fluorescent reporter. By using both activation of a nonspecific effector endoribonuclease and activation of a nonspecific effector DNase, two independent ribonucleoprotein complexes, one of which specifically activates a nonspecific effector DNase and the other of which specifically allows for the indirect or direct determination of cOA levels, can be used to determine the presence or absence of two independent target RNA molecules in a single assay. Those skilled in the art will understand that the fluorescent labels present on the substrates due to cOA-dependent activation of a nonspecific effector endoribonuclease and a nonspecific effector DNase must be sufficiently different to allow the level of each activity to be determined as a measure for determining cOA levels.
[0052] Preferred fluorescent labels include Atto425 (ATTO-TEC GmbH, Siegen, Germany), Atto 647N (ATTO-TEC GmbH, Siegen, Germany), Yakima Yellow (Epoch Biosciences Inc., Bothell, WA, USA), Cal610 (BioSearch Technologies, Petaluma, CA, USA), Cal635 (BioSearch Technologies, Petaluma, CA, USA), FAM (Thermo Fisher Scientific Inc., Waltham, MA, USA), TET (Thermo Fisher Scientific Inc., Waltham, MA, USA), HEX (Thermo Fisher Scientific Inc., Waltham, MA, USA), cyanine dyes such as Cy5, Cy5.5, Cy3, Cy3.5, and Cy7 (Thermo Fisher Scientific Inc., Waltham, MA, USA), and Alexa dyes (Thermo Fisher Scientific Inc., Waltham, MA, USA). The substrate may be selected from the group consisting of fluorescein isothiocyanate (FITC, Thermo Fisher Scientific Inc., Waltham, MA, USA), Tamra (Thermo Fisher Scientific Inc., Waltham, MA, USA), ROX (Thermo Fisher Scientific Inc., Waltham, MA, USA), JOE (Thermo Fisher Scientific Inc., Waltham, MA, USA), fluorescein isothiocyanate (FITC, Thermo Fisher Scientific Inc., Waltham, MA, USA), Yakima Yellow® (YY; Epoch Biosciences, Bothell, Washington), and tetramethylrhodamine (TRITC, Thermo Fisher Scientific Inc., Waltham, MA, USA). The substrate is labeled with a detectable label, preferably a fluorescent label, preferably at the 5' end.
[0053] Quenchers, such as tetramethylrhodamine (TAMRA) and dihydrocyclopyrroloindole tripeptide minor groove binders, are known in the art. Preferred quenchers include Black Hole Quencher®-1 (BHQ1) and BHQ2 (Biosearch Technologies, Petaluma, CA, USA). The BHQ1 dark quencher has strong absorption between 480 nm and 580 nm and provides quenching for fluorophores that fluoresce within this range, such as FAM, TET, CAL Fluor® Gold 540, JOE, HEX, CAL Fluor Orange 560, and Quasar® 570 dyes. The BHQ2 dark quencher has strong absorption between 599 nm and 670 nm and provides quenching for fluorophores that fluoresce in this range, such as Quasar® 570, TAMRA, CAL Fluor® Red 590, CAL Fluor Red 610, ROX, CAL Fluor Red 635, Pulsar® 650, Quasar 670, and Quasar 705 dyes. BHQ1 and BHQ2 can quench fluorescence by both FRET and static quenching mechanisms.
[0054] A suitable commercially available substrate is provided by the RNaseAlert® Lab Test Kit v2 (ThermoFisher Scientific; Waltham, Mass.).
[0055] Preferred cOA-dependent nonspecific effector endoribonucleases are derived from thermophilic organisms such as Pyrococcus furiosus, Sulfolobus solfataricus, and Thermus thermophilus, allowing for simultaneous isothermal detection of the activity of cOA-dependent nonspecific effector endoribonucleases.
[0056] The methods and means for indirectly determining the level of cyclic oligoadenylate (cOA) preferably comprise a cOA-dependent non-specific effector endoribonuclease and a substrate for said cOA-dependent non-specific effector endoribonuclease.
[0057] 4.3 Protein production The ribonucleic acid detection system according to the present invention is based on the in vitro assembly of a ribonucleoprotein complex, preferably a type IIIB complex. The required Cas protein is preferably derived from a thermophilic organism such as Thermus thermophilus. The protein is preferably expressed and purified from a suitable expression system.
[0058] Commonly used expression systems for heterologous protein production include E. coli, Bacillus species, baculovirus, yeast, fungi, most preferably filamentous fungi or yeasts such as Saccharomyces cerevisiae and Pichia pastoris, eukaryotic cells such as Chinese hamster ovary cells (CHO), human embryonic kidney (HEK) cells, and PER.C6® cells (Thermo Fisher Scientific, MA, USA), and plants. The efficiency of recombinant protein expression in heterologous systems depends on many factors, both at the transcriptional and translational levels.
[0059] Preferably, the Cas protein is produced using a prokaryotic cell, preferably E. coli. Preferably, the Cas protein is produced by expression cloning of the protein into the prokaryotic cell of interest, preferably E. coli. Preferably, the expression construct, preferably DNA, is produced by recombinant techniques, including the use of polymerases, restriction enzymes, and ligases, as known to those skilled in the art. Alternatively, the expression construct is provided by artificial gene synthesis, for example, by synthesis of partially or completely overlapping oligonucleotides, or by a combination of organic chemistry and recombinant techniques, as known to those skilled in the art.
[0060] Alternatively or additionally, Cas proteins can be isolated from thermophilic organisms by expressing tagged Cas proteins in the organism and isolating ribonucleoprotein complexes containing the Cas proteins based on the tag, which can be isolated using the tagged Cas proteins.
[0061] Preferably, the expression construct is codon-optimized to enhance expression of the Cas protein in the prokaryotic cell of interest, preferably E. coli. Further optimization preferably includes removal of cryptic splice sites, removal of cryptic polyA tails, and / or removal of sequences that result in unfavorable folding of the mRNA. In addition, the expression construct preferably encodes a protein export signal for secretion of the Cas protein from the prokaryotic cell into the periplasm, allowing efficient purification of the Cas protein.
[0062] Methods for purifying Cas proteins are known in the art and are generally based on chromatography, such as affinity chromatography or ion exchange chromatography, to remove contaminants. It may also be necessary to remove contaminants as well as undesirable derivatives of the product itself, such as degradation products or aggregates. Suitable purification process steps are provided in Berthold and Walter, 1994 (Berthold and Walter, 1994. Biologicals 22:135-150).
[0063] Alternatively or additionally, recombinant Cas proteins can be genetically engineered with one or more specific tags to allow the protein to be loaded onto a tag-specific column, thereby isolating it from impurities. The purified protein is then displaced from the affinity column with a decoupling reagent. This method has become increasingly applicable to purifying recombinant proteins. Conventional tags on proteins, such as histidine tags, are used with affinity columns that specifically capture the tag (e.g., Ni-IDA columns for histidine tags) to isolate the protein from other impurities. The protein is then displaced from the column using a decoupling reagent corresponding to the specific tag (e.g., imidazole for histidine tags). This method is more specific than traditional purification methods.
[0064] Suitable additional tags include the c-myc domain (EQKLISEEDL), hemagglutinin tag (YPYDVPDYA), maltose-binding protein, glutathione-S-transferase, FLAG tag peptide, biotin acceptor peptide, streptavidin-binding peptide, and calmodulin-binding peptide, as presented in Chatterjee, 2006 (Chatterjee, 2006. Cur Opin Biotech 17, 353-358). Methods for employing these tags are known in the art and can be used to purify Cas proteins.
[0065] Methods for expressing proteins in E. coli are known in the art and can be used to express and purify Cas proteins.
[0066] In a preferred method, Cas proteins are expressed in E. coli from codon-optimized expression constructs. The constructs are placed in bicistronic expression plasmids containing an N-terminal Strep tag and the amino acid sequence Glu-Asn-Leu-Tyr-Phe-Gln-(Gly / Ser), which is recognized by tobacco etch virus (TEV) protease. The expression plasmids are transformed into E. coli, such as strain Bl21(DE3). After growth at 37°C in the desired culture volume to an OD of approximately 0.6, the cultures are placed on ice for 1 hour, after which isopropyl β-D-1-thiogalactopyranoside is added to a final concentration of 0.1 mM. The cultures are then incubated at 18°C for approximately 16 hours (overnight). Cells are harvested and lysed in Buffer A (100 mM Tris-HCl, 150 mM NaCl) by sonication, followed by centrifugation at 30,000 g for 45 minutes. The clarified lysate is filtered and loaded onto a pre-equilibrated StrepTrap FPLC column (GE Healthcare, Chicago, IL). After washing the column with Buffer A until no more protein is present in the flow-through, the protein of interest is eluted with Buffer B (100 mM Tris-HCl, 150 mM NaCl, and 2.5 mM D-desthiobiotin). The protein is cleaved from the affinity tag by the addition of TEV protease and allowed to incubate overnight at 4°C. The protein of interest is separated from the mixture by HisTrap and StrepTrap affinity chromatography steps and collected from the flow-through. If necessary, an additional size-exclusion chromatography step is added to achieve higher purity.
[0067] Preferred Cas proteins include Csm or Cmr proteins, at least Cmr1 and Cmr4, preferably Cmr1-6, or at least Csm2 and Cas10 (Csm1), preferably Csm2-5 and Cas10, more preferably Csm1-6.
[0068] Preferred proteins include proteins having at least 80% sequence identity, preferably at least 90% sequence identity to the amino acid sequences referenced in Table 2, preferably proteins having the amino acid sequences referenced in Table 2. However, mutants of the proteins, including insertion mutants, deletion mutants, chimeric proteins, and amino acid substitution proteins, may also be used in the CRISPR-based ribonucleic acid systems of the present invention.
[0069] To increase the sensitivity of type III CRISPR / Cas detection methods, catalytically dead mutant Cmr and / or Csm complexes are preferably generated and used in the detection system of the present invention. The term "catalytically dead" refers to the target RNA digestion activity of the CRISPR-based ribonucleic acid system of the present invention. These mutants are referred to as dCmr and dCsm. Mutations are introduced into the Cmr4 and Csm3 subunits, which are involved in target binding and cleavage, and are selected to abolish target cleavage while maintaining target binding. Several mutations in the Cmr4 protein (H15A, D26A, E277A) have been described, with the strongest catalytic impairment observed in the Cmr4 D26A and D26N mutations (Benda et al., 2014, Molecular Cell 56:43-54; Ramia et al., 2014, Cell Reports 9:1610-1617). This inactivating mutation has been experimentally proven to be functional in Pyrococcus furiosis, and sequence alignment of Cmr4 orthologues indicates that this amino acid is highly conserved (data not shown). Furthermore, crystallographic data indicate that this particular amino acid is located in a group of complexes predicted to bind target RNAs (data not shown). Collectively, these results suggest that the D26 amino acid residue is important for the catalytic activity of Cmr4. Alteration of this residue would result in a Thermus thermophilus dCmr4 mutant. Next, alignment of the Pf_Cmr4 amino acid sequence with the Csm3 orthologue also indicates that D26 is one of the few amino acids conserved between the two type III systems and, therefore, can be used to generate dCsm3 mutants. Further cleavage activity-inactivating mutations include the Cmr4 E227A and E228 double mutant and Cmr4 D86A (Ramia et al., 2014. Cell Reports 9:1610-1617; Zhu and Ye, 2015. Nucleic Acids Res 43:1257-1267).Additionally, Csm3 D32A is a good candidate for a type IIIA Csm mutant with inactivated cleavage activity (Samai et al., 2015. Cell 161:1164-1174).
[0070] Additionally, Jia et al. and Park et al. described a dCsm3 mutant created by a D36A substitution (Jia et al., 2019. Mol Cell 73:264-277; Park et al., 2017. EMBO reports 18:826-840). A double mutant, K56A and R60A, was also described, but did not fully abolish target cleavage in Csm3.
[0071] Another type of mutation is based on the suppression of damage by natural CRISPR / Cas-based defense systems. After cOA binds to the CRISPR-associated Rossmann fold (CARF) domain in Csx1 / Csm6, its higher eukaryotic and prokaryotic nucleotide-binding (HEPN) domain is activated, and the protein begins to cleave RNA indiscriminately (Kazlauskiene et al., 2017, Science 357:605-609). Under normal biological conditions, cOA is degraded by Csx1 / Csm6 itself to avoid sustained activation and, therefore, sustained RNase activity (Athukoralage et al., 2019, J Mol Biol 431:2894-2899; Garcia-Doval et al., 2020, Nature Communications 11:1-9). Recently, the mechanism of cOA degradation was elucidated using mutant forms of the Csx1 / Csm6 protein. It has been shown that T10A, T10A / T11A, or T11A Csx1 / Csm6 mutants are unable to degrade cOA, resulting in prolonged RNase activity (Athukoralage et al., 2019, J Mol Biol 431:2894-2899; Garcia-Doval et al., 2020, Nature Communications 11:1-9). This prolonged RNase activity of Csx1 / Csm6, for example, by using T10A, T10A / T11A, or T11A Csx1 / Csm6 mutants or their equivalents, can be exploited to obtain more sensitive and rapid readouts for diagnostic purposes.
[0072] 4.4 Assembly of ribonucleoprotein complexes Although differences exist between different type III subtypes (Cmr, Csm), the general structure consists of multiple subunits, Cas7 and Cas11 (Staals et al., 2013, Mol. Cell 52:135-145; Staals et al., 2014, Mol. Cell 56:518-530), capped at one end by Cas5 and Cas10. Of these, Cas7 provides RNase activity upon recognition of target RNA by a preloaded RNA guide. Furthermore, this recognition also results in DNase activity via the Cas10 HD domain (Kazlauskiene et al., 2016, Mol. Cell 62:295-306).
[0073] Type III CRISPR / Cas systems can be further divided into various subtypes, including type IIIA Csm and type IIIB Cmr (Staals et al., 2013, 2014, Ibid). The Thermus thermophilus Cmr effector complex (ttCmr46) consists of 12 subunits in a stoichiometric ratio of Cmr112131445361 (Staals et al., 2014, Ibid; Taylor et al., 2015, Science 348:581-586) and a 46-nt crRNA. De novo studies by Staals et al. have revealed a similar complex with a 40-nt crRNA (Table 1).
[0074] [Table 1]
[0075] The type IIIA Csm complex is structured similarly to Cmr (Csm1123354151) (Tamulaitis et al., 2017. Trends Microbiol 25:49-61). This complex can be assembled by adding all subunits in the correct molar ratio and incubating the reaction mixture at an incubation temperature such as 60°C or 65°C for a period of time such as 30 minutes.
[0076] Purified Cas proteins, e.g., Csm or Cmr proteins, are assembled onto a suitable crRNA. In one embodiment, the crRNA and assembled ribonucleoprotein complex are present in an aqueous solution. If necessary, one of the Cas proteins, e.g., CAP Cas, e.g., Cmr6, can be tagged, e.g., with a histidine tag and / or a strep tag, and attached to a surface, preferably at a defined location on the surface, for subsequent determination of cOA levels. The surface can be a solid surface, such as glass, plastic, or silicon. The surface can be present in a receptacle, such as a cup, e.g., an Eppendorf tube, or a well of a microplate, or in a device.
[0077] A recent study by Mogila et al. revealed the roles of individual subunits of Streptococcus thermophilus Csm (StCsm) (Mogila et al., 2019. Cell Reports 26:2753-2765). Furthermore, a minimal Csm complex containing only the Csm3, Csm4, and Cas10 (Cmr1) subunits (and crRNA) was engineered, which still retained all three catalytic activities (RNase, ssDNase, and cOA synthase).
[0078] By eliminating some subunits while still retaining all catalytic activity, the practical integration of type III CRISPR / Cas systems is expected. Most notably, cOA production was not reported to be affected (Mogila et al., 2019, Ibid.).
[0079] These minimal complexes contain Cmr1, 3, and 4 for type IIIA CRISPR / Cas and Cmr2, 3, and 4 for type IIIB CRISPR / Cas, as described by Mogila et al., and variation in the copy number of these subunits may be possible. To increase the specificity and sensitivity of cOA generation and target detection, the number of Cmr3 / Cmr4 subunits may be increased.
[0080] Additionally, these subunits can be mutated to optimize their activity.
[0081] The Cmr proteins are preferably provided together with suitable crRNA in the stoichiometric ratios of Cmr1:Cmr3:Cmr4:crRNA of 1:1:4:1 and Cmr1:2:3:4:5:6:crRNA of 1:1:1:4:3:1:1.
[0082] Nucleoprotein complexes can assemble onto the TtCmr46 crRNA as follows.
[0083] First, 3.5 μL crRNA (700 ng) was added to 3.5 μL 1× Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Subsequently, the subunits were added to the reaction mixture in a specific order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) to final concentrations of 0.5 μM, 2.5 μM, 10 μM, 7.5 μM, 2.5 μM, and 2.5 μM, respectively, to make up a total reaction volume of 20 μL. The reaction mixture was incubated at 65°C for 30 minutes.
[0084] A preferred method for reconstituting class I type 3A complexes involves adding 3.5 μL crRNA (700 ng) to 3.5 μL 1× Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl), followed by the addition of subunits Csm4, Csm1, Csm3, Csm2, and Csm5 in the following order to final concentrations of 2.5 μM, 2.5 μM, 12.5 μM, 7.5 μM, and 2.5 μM, respectively, for a total reaction volume of 20 μL. The reaction mixture may be incubated at 60° C. or 65° C. for 30 minutes.
[0085] [Table 2]
[0086] 4.5 RNA detection methods Conventional CRISPR / Cas systems used for diagnostic purposes, such as the Cas12 / Cas14-based system (UC Berkeley, CA, USA) and the Cas13-based system (Broad Institute, MA, USA), rely on the presence of specific motifs adjacent to the target site. This mechanism is used to distinguish self from non-self in biological contexts. Without this motif, these Cas proteins cannot cleave their targets, making them unusable for diagnostic systems. In Cas12 and Cas13, these motifs are called the protospacer-adjacent motif (PAM) and protospacer-flanking site (PFS), respectively [Westra et al., 2013, PLoS Genet 9:e1003742; Abudayyeh et al., 2016, Science 353:aaf5573]. In the case of some Cas12 / Cas14 proteins, this required PAM is TTTN / TTTA, significantly limiting the choice of target sequence. For Cas13, the required motif is less restrictive, favoring H nucleotides (A, C, U) adjacent to the target sequence.
[0087] The type III (B) CRISPR system employs a different self-versus-nonself mechanism to prevent autoimmunity by checking the complementarity between the 5' repeat tag of the crRNA and the corresponding 3' protospacer flanking sequence [Guo et al., 2019. RNA Biol 16:1513-1520]. Although the complementarity between these two regions influences relative cOA production within a certain range, the lack of a requirement for certain PAM / PFS-like sequences for type III CRISPR to exert its desired function confers a significant advantage over currently used systems [Guo et al., 2019. RNA Biol 16:1513-1520].
[0088] Furthermore, the use of Cas13 target selection is also limited by potential secondary structures formed in the target RNA [Smargon et al., 2017. Mol Cell 65:618-630]. Currently used diagnostic systems function at 37°C, in contrast to the Thermus thermophilus type IIIB system, which functions at 65°C [Staals et al., 2013. Mol Cell 52:135-145]. This elevated temperature reduces the amount of secondary RNA structures potentially formed in the target RNA sequence [Wan et al., 2012. Mol Cell 48:169-181].
[0089] The method of the present invention for detecting specific RNA sequences can be used in human healthcare, veterinary diagnostics, plant pathogen detection, water contaminant detection, and food and feed contaminant detection. Additionally, the method of the present invention for detecting specific RNA sequences can be used to detect beneficial organisms. Generally, the method of the present invention can be used to detect bacterial, fungal, archaeal, protist, protozoan, eukaryotic, viral, and viroid pathogens. Additionally, the method of the present invention can also be used to detect and diagnose genetic modifications or traits expressed as RNA molecules in humans, animals, and plants.
[0090] In human healthcare and veterinary diagnostics, nucleic acid material, including RNA, is preferably isolated from biological fluids, preferably cerebrospinal fluid, saliva, nasopharyngeal secretions, oropharyngeal secretions, sweat, urine and feces, or blood. The term "blood" includes plasma, which is prepared by removing red blood cells and white blood cells, such as by centrifugation, and serum, which is prepared by forming a blood clot and removing the clot, such as by a centrifuge. A preferred biological fluid is blood. Methods and compositions for the isolation of nucleic acid material from biological fluids, particularly blood, preferably employ aqueous solvents without the use of organic solvents and chaotropic salts.
[0091] If necessary, nucleic acid material, including RNA, can be purified from the sample using, for example, a combination of physical and chemical methods, preferably using commercially available systems for nucleic acid isolation, such as the NucliSENS® easyMAG® or NucliSENS® minMAG® Nucleic Acid Extraction Systems (bioMerieux, Marcy l'Etoile, France) or the MagNA Pure 96 System (Roche Diagnostics, Almere, The Netherlands).
[0092] To this end, RNA can be isolated from the sample by any technique known in the art, and suitable commercially available RNA isolation kits include, but are not limited to, Trizol (Invitrogen; Carlsbad, California), RNAqueous® (Applied Biosystems / Ambion, Austin, Texas), Qiazol® (Qiagen, Hilden, Germany), Agilent Total RNA Isolation Kits (Agilent; Santa Clara, California), RNA-Bee® (Tel-Test, Friendswood, Texas), RNeasy mini kit (Qiagen, Venlo, The Netherlands), and Maxwell™ 16 Total RNA Purification Kit (Promega; Madison, Wisconsin). The isolated RNA, preferably mRNA, is preferably reverse transcribed into single- or double-stranded cDNA using an RNA-dependent DNA polymerase.
[0093] Uses of the type III CRISPR / Cas of the present invention for diagnostic purposes include, but are not limited to, medical diagnostics, such as urinary tract infections, respiratory tract infections, especially those caused by SARS-CoV-2 and respiratory syncytial virus (RSV), blood infections (sepsis), expression of antibiotic resistance markers such as methicillin-resistant Staphylococcus aureus markers and extended-spectrum beta-lactamase markers, gastrointestinal infections, skin infections, dental infections, vaginal infections, such as candidiasis, Trichomonas vaginalis, and the like. vaginalis infections, and Gardnerella infections, male reproductive system infections, detection of tropical infectious diseases such as malaria, trypanosomiasis, dengue fever, Zika fever, chikungunya fever, sexually transmitted diseases caused by Chlamydia species, gonorrhea, those caused by human immunodeficiency virus, those caused by Herpes species, syphilis, and detection of genetic defects including cancer and autoimmune diseases.
[0094] The type III CRISPR / Cas of the present invention are further useful in the treatment of bovine infectious diseases such as mastitis, bluetongue, foot and mouth disease, those caused by Salmonella spp., Klebsiella spp., Campylobacter spp., swine infectious diseases such as respiratory disease, dermatitis, diarrhea, and porcine parvovirus infection, sheep and goat infectious diseases such as clostridial diseases, contagious ecthyma, pneumonia, and Rift Valley disease. It may be used in veterinary diagnostics, including the detection of viral infections, poultry infectious diseases such as infectious bronchitis, those caused by Salmonella species, feline infectious diseases such as infections with feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV), respiratory infections, canine infectious diseases such as rabies, and infections with Bordetella, Leptospira, and Boriella.
[0095] The Type III CRISPR / Cas detection systems of the present invention may further be used to detect plant pathogens, for example, certain fungi, such as Ascomycetes species and Basidiomycetes species, certain fungus-like organisms, such as Oomycetes and Plasmid Fungi, certain bacteria, such as Burkholderia, Proteobacteria, and Pseudomonas species, viruses, viroids, and virus-like organisms, such as tobacco mosaic virus, cauliflower mosaic virus, nematodes, such as Meloidogyne chitwoodi and M. fallax, and protozoa and algae, such as Phytomonas and Cephaleuro.
[0096] The Type III CRISPR / Cas detection system of the present invention may further be used to detect water contaminants, including detecting bacterial contamination, e.g., Vibrio cholerae, E. coli, Shigella spp., Legionella spp., Salmonella spp., viral contamination, e.g., Hepatitis A virus, Hepatitis E virus, Poliovirus, algal contamination, e.g., the presence of Desmodesmus spp., and parasitic contamination, e.g., the presence of Dracunculiasis spp.
[0097] The Type III CRISPR / Cas detection system of the present invention may further be used to detect food and feed contaminants, including bacterial contamination, such as the presence of Clostridium botulinum, E. coli, Listeria spp., Salmonella spp., Vibrio cholera, viral contamination, such as the presence of Enterovirus spp., Hepatitis A virus, Norovirus spp., and Rotavirus spp., parasitic contamination, such as the presence of Giardia spp. and Trichinella spp., and fungal contamination.
[0098] More specifically, the Type III CRISPR / Cas detection system of the present invention can also be used to detect any organism, as long as all organisms produce RNA during infection, including bacteria, such as Bacillus spp., Clostridium spp., Enterobacter spp., Escherichia spp., Enterococcus spp., Klebsiella spp., Listeria spp., Legionella spp., Salmonella spp., Staphylococcus spp., Streptococcus spp., and the like. us species and combinations thereof, viruses including DNA viruses, e.g., hepatitis B virus, adenovirus, human papillomavirus, RNA viruses, e.g., influenza virus, hepatitis A / C / D / E virus, poliovirus, tobacco mosaic virus, coronavirus, and HIV, viroids, archaea, fungi, e.g., Aspergillus species, Ascomycetes species, Candida species, protozoa, and parasites, e.g., Trypanosoma species.
[0099] The use of the type III CRISPR / Cas detection system of the present invention for the detection of RNA will have clear benefits in diagnostic situations. Two such diagnostic situations are detailed below. However, those skilled in the art will no doubt be able to identify additional diagnostic situations in which the type III CRISPR / Cas detection system of the present invention for the detection of RNA would be useful.
[0100] The first example is exemplified by recent global outbreaks. Accurate point-of-care (PoC) detection would provide many benefits in the COVID-19 pandemic. The recent SARS-CoV-2 outbreak, resulting in the COVID-19 pandemic, spread worldwide within months of its discovery. To slow the spread of the disease, many countries have enacted preventative measures restricting the movement and mobility of their citizens. These restrictions are intended to ultimately "flatten the curve," with the intention of maintaining national health care systems manageable and saving as many lives as possible. However, some countries have clearly been able to manage rising infection rates much more effectively than others. For example, the limited number of infections and subsequent deaths in Singapore, South Korea, and Taiwan likely reflect the success of their rapid response. A key factor in this success was the early and widespread use of mass testing and subsequent self-quarantine, which other countries did not or could not achieve. This diagnostic screening program helped identify and isolate infected people, significantly slowing the spread of the virus and resulting in fewer infections and lower mortality rates. Additionally, the WHO has stated the need for decentralized, widespread testing to enable rapid response to emerging pandemics. The most important diagnostic tool used for COVID-19 testing is based on (RT)-PCR, which detects genetic material (RNA) from the virus. While this test produces reliable results in 4–6 hours, only centralized laboratories are certified to perform it, requiring sample transportation and an expected turnaround time of at least 24 hours per test. Even in developed countries, recent increases in testing volume cannot meet these demands. The only available proof-of-concept tests are immunoassays that do not distinguish between past and current infections and cannot be used for acute diagnosis.
[0101] CRISPR-Cas nucleic acid detection diagnostics offer a solution for building a decentralized screening platform. CRISPR-Cas-based diagnostics have been claimed to be faster than PCR and cheaper to perform on-site (Sheridan, 2020. Nat Biotechnol 38:382-384). We are developing an innovative, proprietary CRISPR-Cas-based proof-of-concept COVID-19 diagnostic approach that will contribute to improving viral monitoring capabilities and thereby limit the spread of COVID-19 and other viruses.
[0102] A second example is provided by the detection of urinary tract infections (UTIs). Current UTI diagnosis is substandard. Particularly in first-line healthcare, general practitioners must rely on unreliable dipsticks, which have a positive predictive value of only 61%. This leads to mass treatment of disease-negative patients and unnecessary prescription of antibiotics (Eriksen and Bing-Jonsson, 2016. Forskning 1-42, available at sykepleien.no / forskning / 2016 / 09 / kan-ikke-stole-blindt-pa-urinstiks).
[0103] Accurate point-of-care diagnostics using the Type III CRISPR / Cas detection system would provide a major advantage over this approach. Based on its specific RNA detection capability, the Type III CRISPR / Cas detection system allows for rapid species identification and detection of antibiotic resistance markers.
[0104] Most UTI cases (70-90%) are caused by uropathogenic Escherichia coli (E. coli), but can also be caused by a range of other pathogens (Flores-Mireles et al., 2015. Nat Rev Microbiol 13:269-284). Identifying which specific pathogen causes the infection would provide additional information and increase the likelihood of appropriate antibiotic dosing.
[0105] For example, identification of specific pathogens can be based on the expression of specific 16S ribosomal RNA species. Van der Zee et al. showed that differentiation among seven UTI-causing pathogens can be based on 16S-based qPCR (van der Zee et al., 2016. PLOS ONE 11:e0150755). Some examples of primers used are provided in Table 3 (Van der Zee et al., 2016. Ibid). The targets of these primers can be adapted to type III CRISPR / Cas guide sequences. Similarly, PCR primer regions for detection of antibiotic resistance markers can also be adapted to be suitable for type III CRISPR / Cas-based detection.
[0106] Another example is provided by the detection of Listeria monocytogenes in raw dairy products. L. monocytogenes is a well-known foodborne pathogen that can cause fatal listeriosis. L. monocytogenes has been shown to contaminate foods, including vegetables, dairy products, and meat products. In Europe, the presence of L. monocytogenes has been reported in 1–4.4% of all raw milk samples and in 1.1–65% of certain non-Pasteurized cheese samples (Lunden et al., 2004, J Dairy Science 87, E6–E12). Type III CRISPR / Cas-based genetic detection of L. monocytogenes can be combined with the detection of other potential pathogens, such as Escherichia coli, Salmonella typhimurium, and Campylobacter jejuni.
[0107] Rapid detection of foodborne pathogens using rapid diagnostics has the potential to prevent the use and consumption of contaminated dairy products. This detection, if possible at the farm, would prevent the transport of contaminated milk to dairy processing plants and prevent the potential spread of contamination, reducing the likelihood of listeriosis.
[0108] As in the first example, type III CRISPR / Cas-based RNA detection can be designed based on similar PCR target sequences, potentially posing complications that may require milk pretreatment and likely require low detection limits.
[0109] If necessary, for example, to increase the detection level, the method of the present invention for detecting a specific RNA sequence can be preceded by amplification of the target sequence. Amplification can be carried out by any suitable amplification system, including, for example, ligase chain reaction (LCR), isothermal ribonucleic acid amplification systems, such as nucleic acid sequence-based amplification (NASBA) and RNA cleavage-based signal amplification, transcription-mediated amplification, strand displacement amplification, and polymerase chain reaction (PCR). As known to those skilled in the art, RNA is preferably reverse transcribed before or during the amplification reaction.
[0110] Preferred amplification reactions are single-tube isothermal reactions, such as NASBA, loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA) reactions, and nicking enzyme amplification reactions (NEAR). A preferred single-tube isothermal reaction is the RPA reaction (TwistDx Ltd., Cambridge, UK).
[0111] The single-tube isothermal reaction, such as RPA, is preferably integrated with the CRISPR-based ribonucleic acid detection system of the present invention as a "one-pot" reaction system. The advantage of such a one-pot or single-tube system is that the risk of sample contamination or cross-contamination of different samples is reduced.
[0112] For detection of cOA by utilizing direct cOA detection methods, the sample may contain endogenous levels of PPi and Pi. In particular, biological fluids such as plasma, serum, urine, and synovial fluid may contain PPi and Pi in amounts of 0.16-3.42 μM and 0.31 mM (plasma), 3.5 μM and 1-1.5 mM (serum), 1.5 mM (urine), and 0.1 μM and 0.3 mM (synovial fluid) (Russell et al., 1970. Lancet 296:899-902; Silcox and McCarty, 1973. J Clin Invest 52:1863-1870; Bansal, 1990. Serum Inorganic Phosphorus. In: Clinical Methods: The History, Physical, and Laboratory Examinations (Butterworths); Le, 2008. First aid for the USMLE step 1 2018). These levels can fluctuate over time and during the course of disease (Armstrong et al., 1975. Clin Chem 21:104-108).
[0113] Pretreatment of samples with high endogenous PPi or Pi levels can be performed by removing small molecules such as Pi and PPi prior to detection of specific RNA sequences. To prevent readout interference due to endogenous PPi or Pi levels, several methods can be employed, including but not limited to those listed below, such as chemical precipitation, dialysis, and the use of cation exchange columns.
[0114] Removal of small molecules such as Pi and PPi can be achieved, for example, by filtering the sample through a filter with a molecular weight cutoff of less than 1,000, preferably less than 500. The molecular weight cutoff is defined as the lowest molecular weight (in Daltons) at which more than 90% of a solute of known molecular weight is retained by the membrane.
[0115] The effect of endogenous phosphorus species on test results can also be counteracted by isolation of genetic material (particularly target sequences) from patient samples and subsequent application in / on PPi / Pi-free media. Methods for isolating nucleic acid material include, but are not limited to, organic extraction, Chelex extraction, solid phase extraction, magnetic beads, and / or anion exchange.
[0116] In addition to reducing endogenous Pi levels, sample preparation steps are also required to address readout interference from other factors in patient samples, including but not limited to proteases, salt concentration, and pH.
[0117] [Table 3]
[0118] 4.6 Suitable Devices The CRISPR / Cas-based ribonucleic acid detection system of the present invention is preferably present in a device. The device preferably includes one or more detection systems targeting one or more specific RNA sequences. The device may include openings, such as inlet and outlet ports, for the introduction and extraction of fluids into and from the device. The openings may be connected to valves, tubing, channels, chambers, syringes, and / or pumps. The device may be connected to fluid flow actuators that enable directional movement of fluids within the microfluidic device. Examples of actuators include, but are not limited to, syringe pumps, mechanically actuated recirculation pumps, electroosmotic pumps, valves, bellows, diaphragms, or bubbles intended to force fluid movement. In certain example embodiments, the device is connected to a controller with programmable valves that operate in unison to move fluids through the device. Additionally, a heating mechanism may be provided for incubating reaction mixtures at desired temperatures.
[0119] Preferably, the CRISPR / Cas-based ribonucleic acid detection system is present in a biosensor, preferably by using a disposable cartridge. Preferred biosensors provide methods and means for detecting the interaction of a target nucleic acid with a CRISPR / Cas-based ribonucleic acid detection system. Preferred biosensors include a reusable handheld reader capable of simple push-button operation for automated analysis of samples, and a cost-effective disposable cartridge, preferably a disposable microfluidic sensor cartridge, functionalized to provide optimal detection and / or quantification of multiple clinically relevant agents, such as pathogens. Possible biosensors are lateral flow test devices based on the accumulation of quantifiable substances, such as magnetic particles.
[0120] In one embodiment, the device or biosensor is a point-of-care (POC) testing device, a transportable, portable, and handheld instrument or test kit that collects samples and provides results in a very short time at or near the patient's location so that treatment regimens can be adjusted as needed. Preferably, the device includes a means for rapid, low-cost, and reliable determination of the presence or absence of a target nucleic acid, and preferably the quantification of the target nucleic acid.
[0121] POCs comprising CRISPR / Cas-based ribonucleic acid detection systems are preferably directed to the detection of a limited number of target nucleic acid molecules, including five or fewer target nucleic acid molecules, four or fewer target nucleic acid molecules, three or fewer target nucleic acid molecules, e.g., two target nucleic acid molecules and one target nucleic acid molecule. To this end, the crRNA ribonucleoprotein complexes are preferably present in a discrete location ribonucleic acid detection system, allowing the level of cOA to be determined for each individual crRNA ribonucleoprotein complex.
[0122] Preferably, the array comprising a CRISPR / Cas-based ribonucleic acid detection system targets at least 5 different target nucleic acid molecules, preferably at least 10 different target nucleic acid molecules, preferably at least 20 different target nucleic acid molecules, preferably at least 50 different target nucleic acid molecules, preferably at least 100 different target nucleic acid molecules. The array comprising a CRISPR / Cas-based ribonucleic acid detection system preferably targets 2 to 12,000 distinct target nucleic acid molecules.
[0123] As will be apparent to those skilled in the art, the different target nucleic acid molecules can all be directed to different organisms, such that each crRNA molecule is derived from and used to detect a different target organism, e.g., a different bacterium, virus, fungus, protozoan, and / or parasite. The different crRNA molecules can also be selected such that a subset of the different crRNA molecules is directed to the same organism. The subset can include two, three, four, or five different crRNA molecules. The number of different crRNA molecules directed to the same organism is preferably limited to a maximum of 10. It will be apparent that detection of the target organism by all the different crRNA molecules provides confirmation that the target organism has been correctly identified.
[0124] Additionally, in the CRISPR / Cas-based ribonucleic acid detection system of the present invention, the specific crRNA molecule can be present in multiple copies in multiple wells of a microtiter plate, for example, a 48-well plate, a 96-well plate, a 192-well plate, a 384-well plate, a 768-well plate, etc. Detection of the target organism with multiple copies of the crRNA molecule provides confirmation that the identification of the target organism is correct. [Example]
[0125] 5. Working Example Example 1 Materials and Methods Detailed description of the purification of the Cmr complex and the expression and purification of recombinant Cmr proteins Cas proteins and Cas complexes were purified as described in Staals et al., 2013 (Staals et al., 2013. Mol Cell 52:135-145).
[0126] In vitro activity assay RNA substrates (Table 4) were 5'-labeled with T4 polynucleotide kinase (NEB) and 5' 32P-γ-ATP, followed by purification from denaturing PAGE using RNA gel elution buffer (0.5 M sodium acetate, 10 mM MgCl2, 1 mM EDTA, and 0.1% SDS). In vitro activity assays were performed using the labeled RNA substrate and 400 nM TtCmr in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 2 mM MgCl2). Unless otherwise noted, reactions were incubated at 65°C for 1 hour. After incubation, RNA loading dye (containing 95% formamide) was added to the samples and boiled at 95°C for 5 minutes. Samples were run on a 20% denaturing polyacrylamide gel (containing 7 M urea) at 15 mA for approximately 3-4 hours or at a constant 4 mA overnight. Images were visualized using phosphor imaging.
[0127] Reconstitution of the Cmr46 and Cmr40 complex First, 3.5 μL crRNA (700 ng) was added to 3.5 μL 1× Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Subsequently, for Cmr46, the subunits were added in the specified order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) to final concentrations of 2.5 μM, 2.5 μM, 2.5 μM, 10 μM, 7.5 μM, and 2.5 μM, respectively, to the reaction mixture, resulting in a total reaction volume of 20 μL. The reaction mixture was incubated at 65°C for 30 minutes. Similarly, for Cmr40, the final concentrations of the subunits (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, and Cmr1) were 2.5 μM, 2.5 μM, 1.875 μM, 6.66 μM, 7.5 μM, and 2.5 μM, respectively.
[0128] Direct cOA detection assay In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl) supplemented with Cmr40 or Cmr46 complex (62.5 nM) and RNA substrate (200 nM, as listed in Table 4). Reactions were incubated at 65°C for 1 hour, after which 0.05 units of pyrophosphatase (ThermoFisher EF0221) were added, followed by incubation at 25°C for 30 minutes. Signals were visualized using a Malachite Green Phosphate Assay Kit from Sigma-Aldrich (MAK307).
[0129] Electrophoretic mobility shift assay (EMSA) EMSA was performed by incubating 400 nM endogenous TtCmr complex with labeled target RNA (Table 4) in Cmr binding buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). All reactions were incubated at 65°C for 1 h and, after 1 h, electrophoresis was performed on a native 5% (w / v) polyacrylamide gel (PAGE) for 2.5 h at 15 mA or overnight at a constant 4 mA. Images were visualized by phosphor imaging.
[0130] result RNA cleavage activity of TtCmr complexes of different sizes Our previous study showed that when purified native Cmr complexes from T. thermophilus HB8 were loaded with a series of mature crRNA guides of different lengths, crRNA-4.5 (T. thermophilus CRISPR array 4, spacer 5) was the most abundant (Staals et al., 2013, Mol. Cell 52:135-145). The endogenous Cmr complex specifically cleaves complementary 5'-labeled target RNAs (4.5 target RNAs) at 6-nt intervals, resulting in 5'-labeled degradation fragments of primarily 21, 27, 33, and 39 nucleotides (Figure 3A). However, heterogeneity in crRNA content in endogenous Cmr complexes complicates interpretation of these results (Staals et al., 2013, Ibid., Taylor et al., 2015, Science 348:581-586). Therefore, to further probe the mechanism of target RNA cleavage, we replaced the endogenous Cmr complex with a reconstituted Cmr complex bound to a single crRNA (crRNA-4.5) of different lengths.
[0131] [Table 4]
[0132] [Table 5]
[0133] [Table 6]
[0134] We chose to include crRNA lengths of 34 (TtCmr-34), 40 (TtCmr-40), and 46 nt (TtCmr-46) based on their abundance in our previous RNA sequencing data (Staals et al., 2013, Ibid). In contrast to the 5'-labeled cleavage products observed with the endogenous complexes, each of the reconstituted complexes primarily generated a single, defined cleavage product (Figure 3B). This is consistent with the idea that complex length is determined by the length of the crRNA, with larger complexes (e.g., TtCmr-46) cleaving closer to the 5' (target) end of the target RNA. Smaller complexes (i.e., TtCmr-40 and TtCmr-34) lack one or two Cas7-Cas11 (Cmr4-Cmr5) scaffold segments, respectively, and therefore cleave the target RNA at more distant positions (further from the 5' label), resulting in larger cleavage products. These results indicate that the population of endogenous TtCmr complexes is a heterogeneous mixture of larger and smaller complexes that cleave their cognate target RNAs at various locations.
[0135] TtCmr seed sequence To investigate the significance of these type III complexes with different stoichiometries, we designed activity assays to probe differences in targeting and seed requirements. In structurally similar type I effector complexes (i.e., Cascade complexes), targeting is governed by two factors: the PAM (protospacer adjacent motif) and the seed (Mojica et al., 2009. Microbiol 155: 733-740; Semenova et al., 2011. Proc Natl Acad Sci USA 108:10098-10103; Wiedenheft et al., 2011. Proc Natl Acad Sci USA 108:10092-10097). However, in the type III system, self-identification is conferred by a so-called rPAM, which checks for complementarity between the 8-nt 5' handle of the crRNA (referred to as nucleotides -8 to -1) and the corresponding 3' region flanking the protospacer (Elmore et al., 2016, Genes Dev 2016, 30:447-459; Kazlauskiene et al., 2016, Mol Cell 62:295-306; Marraffini and Sontheimer, 2010, Nature 463:568-571). In the case of complementarity, the DNase activity of Cas10 is abolished. Because TtCmr lacks DNase activity due to an N-terminally truncated Cas10 protein lacking the HD domain (data not shown) (Staals et al., 2013, Ibid.), we tested whether RNase activity is affected by target RNAs with a match for the 5' handle of the crRNA. However, activity assays showed that these substrates had no discernible effect on RNA cleavage activity, suggesting that RNA targeting by TtCmr does not check targeting of self-RNA (e.g., antisense transcripts from CRISPR arrays), similar to other type III systems (Tamulaitis et al., 2014. Mol Cell 56:506-517; Samai et al., 2015. Cell 161:1164-1174).
[0136] Next, we tested whether TtCmr utilizes a seed similar to the type I system by constructing an activity assay with mutations in the first 8 nt of the guide portion of crRNA (the non-repeat segment of crRNA that base-pairs with the protospacer). Although mismatches at position 5 blocked and eliminated the proximal cleavage site, as demonstrated by the deletion of the 39-nt degradation product, the results indicated that RNA targeting was unaffected by these mutations (Figure 4A, B). As demonstrated in Figure 4A, mutations in the first 8 nt of the guide portion of crRNA do not affect target RNA degradation. However, their impact on cOA generation and subsequent nonspecific RNA degradation has yet to be elucidated. Further insight into the impact of single-nucleotide mismatches on cOA generation was achieved by utilizing a novel assay.
[0137] The results clearly demonstrate the importance of having complementarity at nt positions 1, 2, and 5 for the generation of cOA in the endogenous TtCmr complex as well as in the reconstituted Cmr complex (46 nt and 40 nt, Figure 5) (Figure 3). cOA generation is less affected by mismatches at nt position 4 compared to 1, 2, and 5. Notably, mismatches at nt positions 3, 6, and 7 appear to have little effect on the generation of second messenger molecules.
[0138] These results suggest that full complementarity is not required in this region and that the seed may instead be located in a different region. Indeed, earlier studies on the type IIIB Cmr complex from Sulfolobus islandicus (Peng et al., 2015. Nucleic Acids Res 43:406-417) demonstrated the requirement for strict base pairing at the 3' end of the crRNA.
[0139] To investigate this possibility, we performed activity assays using the endogenous TtCmr complex and RNA targets with different mismatched segments (Figure 6A). Consistent with previous findings, an RNA target with a mismatch in the first segment (nucleotides 1–5) did not interfere with target degradation, despite skipping one cleavage site downstream of the mismatched segment. However, the effect on cOA production was highly significant, almost completely abolishing it (Figure 6). The second and third mismatched segments (nucleotides 7–12 and 13–17) skipped both the upstream and downstream cleavage sites, but the other cleavage site was unaffected. The second segment mismatch completely abolished cOA production, while the third segment mismatch resulted in significant cOA production. However, when mismatches were introduced in the fourth and fifth segments (nucleotides 19–23 and 25–29), RNA degradation was completely abolished, but only the fourth segment mismatch affected cOA production. Mismatches in the final segment (nucleotides 31–35) had no effect on either RNA degradation or cOA production, except for skipping the upstream cleavage site, suggesting that base pairing in the region spanning the fourth and fifth segments is crucial for target recognition and degradation, but also plays a role in initiating cOA production.
[0140] Because the endogenous complex is a mixture of longer and shorter complexes, we switched to using reconstituted complexes with 46 (TtCmr-46) or 40-nt crRNA (TtCmr-40) to more precisely characterize this critical region. The TtCmr-46 complex almost perfectly mirrored the results obtained with the endogenous complex, demonstrating the sensitivity of RNA degradation to mismatches within the fourth and fifth segments and the significant impact of the first, second, and fourth segments on cOA production (Figure 5B). However, this essential region appears shifted by one segment in the TtCmr-40 complex, thus requiring strict base-pairing requirements in the third and fourth segments (Figure 5A). Taken together, these results strongly suggest a 3'-located seed region within TtCmr that shifts significantly toward the 5' end of the guide with smaller crRNA (and therefore complex) sizes. We propose that these regions function together or independently as seed sequences within TtCmr.
[0141] We hypothesized that this seed sequence is involved in initiating binding upon recognition of the complementary RNA target. For this reason, we tested the binding affinity of the same mismatched RNA target in EMSA using the endogenous TtCmr complex (Figure 6A). Consistent with the activity assay, we observed that targets with mismatches in the first three segments (nucleotides 1–5, 7–11, and 13–17) migrated similarly to fully complementary RNA target controls without interfering with binding to the TtCmr complex. However, mismatches in the fourth and fifth segments (nucleotides 19–23 and 25–29) substantially affected the migration of the TtCmr target RNA tertiary complex on the gel. Although migration differed from its unbound state, we expect this may represent partial binding to other downstream (complementary) portions of the target RNA.
[0142] To further confirm that base pairing is initiated at the 3' end of the crRNA, we designed short 11-nt target RNAs in EMSA. Targets complementary to the 5' portion of the crRNA were unable to base pair with the crRNA, whereas targets that base paired with the proposed 3' seed region were able to bind (Figure 6B). These results suggest that the 5' end of the guide is somehow shielded from base-pairing interactions with its cognate target RNA. Rather, crRNA:target duplex formation appears to be initiated at the 3' end of the guide and then propagates toward the 5' end.
[0143] We previously solved cryo-EM structures of apo- and ssRNA-bound TtCmr complexes of different sizes (Taylor et al., 2015, Science 348:581-585). The results confirmed that upon target RNA binding, the complex undergoes a coordinated rearrangement of its subunits. Most notably, the Cas11 (Cmr5) filament rotates away from the center of the complex, thereby exposing the more 5'-located portion of the crRNA within the channel, allowing further propagation of the crRNA:target RNA duplex. These observations are consistent with the seed region identified in this study. For example, the proposed seed resides in a more accessible region and has interactions with Cmr1, Cmr6, and Cmr4. It is also the first segment of the crRNA adjacent to Cmr5 from the top. This suggests that initial target binding may begin in the most accessible "open" region of the Cmr1 head; however, crucial seed sequence residues are required to initiate a conformational change within the complex by inserting between the "closed" major (Cmr4) and minor (Cmr5) scaffolds. Once the seed region is bound, the TtCmr channel can open, allowing the remainder of the substrate to base-pair, thereby propagating a concerted conformational change.
[0144] Example 2 Materials and Methods Cmr46 complex rearrangement First, 3.5 μL crRNA (700 ng) was added to 3.5 μL 1× Cmr buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl). Subsequently, the subunits were added to the reaction mixture in the specified order (Cmr3, Cmr2, Cmr4, Cmr5, Cmr6, Cmr1) to final concentrations of 2.5 μM, 2.5 μM, 10 μM, 7.5 μM, 2.5 μM, and 2.5 μM, respectively, to make up a total reaction volume of 20 μL. The reaction mixture was incubated at 65°C for 30 minutes.
[0145] The target RNA sequence used in the assay is the sequence: [ka] The underlined nucleotides are desoxynucleotides. This target RNA cannot be cleaved by the Cmr complex.
[0146] Pi detection assay In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl2, 2 units of thermostable inorganic pyrophosphatase (NEB#M0296S)) supplemented with Cmr complex (62.5 nM) and RNA substrate (200 nM unless otherwise specified). Reactions were incubated at 65°C for 1 h unless otherwise specified. Signals were visualized using a Malachite Green Phosphate Assay Kit from Sigma-Aldrich (MAK307).
[0147] Csx1 proof-of-principle experiment For the Csx1 proof-of-principle experiment, the cOA detection assay was performed as described in "Pi detection assay" except that after 1 h incubation at 65 °C, samples were heat-inactivated for 10 min at 95 °C. After heat inactivation, samples were centrifuged at 13,000 g for 10 min, after which the supernatant was stored at -20 °C. Two microliters of the supernatant was added to a reaction mixture containing TtCmr activity buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl), 2 units of thermostable inorganic pyrophosphatase (NEB#M0296S), and approximately 1.5 μg of Csx1 (TTHB144), and incubated at 65°C for 10 minutes. After incubation, either RNase alert (IDT#11-04-03-03) or DNase alert (IDT#11-04-03-04) reagent was added according to the provided instructions. The reaction was incubated at 37°C for 30 minutes, after which fluorescence was measured.
[0148] result Sensitivity Experiment The sensitivity of the system was explored by setting the reaction time (A) to 1 hour and the color development time to 30 minutes. As shown in Figure 8A, measurable readouts (approximately 2-fold increase over non-target) were obtained within the range of 500 pM to 1 nM target RNA. The strategy of creating mutant subunits that lack the ability to cleave target RNA and increase effective sensitivity was mimicked by using a target RNA that the complex cannot cleave.
[0149] Time series experiments The experiment was designed to determine the measurable signal (expressed as a fold increase relative to a blank sample) at specific time points. The total reaction time consisted of two parts: A) the Pi-generation reaction upon addition of target RNA, and B) the colorimetric reaction after addition of a color reagent. The final output was the fold increase measured in absorbance at the end of both reaction times combined. The desired measurable threshold (fold increase relative to a blank sample negative control) determined the time span of the total reaction time for end use. In Figure 8B, a data set was chosen with a set color reaction time of 15 minutes (B) and a variable Pi-generation reaction time (A). This was chosen arbitrarily to give an idea of the system.
[0150] Csx1-mediated proof-of-principle experiment To examine target RNA-induced activation of Csx1, we performed the proof-of-principle experiment shown in Figure 8C. A portion of the reaction mixture incubated in the presence of target RNA to generate cOA was added to a new reaction containing Csx1 and either ssRNA or ssDNA quencher-fluorophore sequences. The results, depicted in a bar graph, clearly show ssRNA degradation upon addition of the cOA-containing mixture. This suggests that Csx1 can be indirectly activated by the type III CRISPR Cas system upon target RNA recognition.
[0151] Example 3 Materials and Methods Cas proteins and Cas complexes The Cmr4 D26N cleavage activity-inactivated mutant was generated by targeted mutagenesis. All Cas protein coding sequences were generated as synthetic gBlocks (Integrated DNA Technologies (IDT)) after codon optimization for compatibility with the heterologous expression host Escherichia coli (E. coli). All coding sequences were cloned into expression vectors using standard cloning methods known to those skilled in the art. Furthermore, the Cmr4 D26N cleavage activity-inactivated mutant was generated by targeted mutagenesis of the Cmr4 gBlock. The expression vector contained an N- or C-terminal Strep tag, an optional TEV cleavage site, a bicistronic design element, a T7 promoter sequence, a terminator sequence, a p15A low-copy replication origin, and a kanamycin resistance marker. The expression vector itself was derived from the p15A cloning vector (Addgene Plasmid #41187). All expression vectors were transformed into E. coli BL21(DE3) for protein expression.
[0152] The recombinant strain was cultured in 2 L of lysogeny broth (LB) medium and grown to an OD of approximately 0.6. After placing the culture on ice for 1 hour, isopropyl β-D-1-thiogalactopyranoside was added to a final concentration of 0.2 mM. The culture was then incubated at 18°C for approximately 16 hours (overnight). Cells were harvested and lysed in Buffer A (100 mM Tris-HCl, 150 mM NaCl, pH 8.0) by sonication (5,000 g for 10 minutes), followed by centrifugation at 30,000 g for 45 minutes. The clarified lysate was filtered and loaded onto a pre-equilibrated StrepTrap FPLC column (GE Healthcare, Chicago, IL). After washing the column with Buffer A until no more protein was present in the flow-through, the protein of interest was eluted with Buffer B (100 mM Tris-HCl, 150 mM NaCl, and 2.5 mM D-desthiobiotin). If necessary, the protein was cleaved from the affinity tag by adding TEV protease (Genscript Cat. No. Z03030) and allowed to incubate overnight at 4°C. A HisTrap affinity chromatography step separated the protein of interest from the mixture, and it was collected from the flow-through. If necessary, an additional size-exclusion chromatography step was added to achieve higher purity.
[0153] Cmr46 complex and dCmr46 complex reconstitution First, 3.5 μL crRNA (700 ng) was added to 3.5 μL 1× Cmr buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl). Subsequently, subunits were added to the reaction mixture in the specified order (Cmr3, Cmr2, Cmr4 or Cmr4 D26N, Cmr5, Cmr6, Cmr1) to final concentrations of 2.5 μM, 2.5 μM, 10 μM, 7.5 μM, 2.5 μM, and 2.5 μM, respectively, to make up a total reaction volume of 20 μL. The reaction mixture was incubated at 65°C for 30 minutes.
[0154] Indirect cOA detection assay In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl) supplemented with reconstituted Cmr46 complex (62.5 nM), varying concentrations of RNA substrate (listed in Table 4 or Table 5), Csx1 (1 μM), and 0.5 μL RNaseAlert QC system (Thermo Scientific, prepared according to the manual). Reactions were incubated at 65°C in a qPCR thermocycler, measuring fluorescence output (495 / 520 nm excitation / absorbance) at 2-minute intervals, or at 65°C in a Genie III (Optigene) measuring fluorescence output (495 / 520 nm excitation / absorbance) at 15-second intervals. Measurements with varying concentrations of target RNA were used to determine the sensitivity range of the system.
[0155] result Confirmation of target RNA binding competence for dCmr46 and subsequent Cmr2 / Cas10 activation The Cmr4 D26N mutant was generated under the assumption that it would only affect the cleavage ability of the complex, not the binding ability or subsequent activation of the Cmr2 / Cas10 subunit. To demonstrate this, we measured target binding ability using the indirect cOA visualization method described previously. Indeed, the mutant protein did not abolish target binding of the full-length type IIIB complex (Cmr46) (Figures 9 and 10).
[0156] Additionally, we observed that the full-length catalytically inactive type IIIB complex (dCmr46) increased target RNA sensitivity compared to the wild-type type IIIB complex (Figures 9 and 10). Furthermore, the assay signal output suggested that dCmr46 generated more cOA compared to wild-type Cmr46 over the same time frame (Figure 11). We aim to exploit these properties of Cmr4 D26N for diagnostic purposes by applying this mutation to in vitro assays to achieve higher target sensitivity. This has the advantage of enabling detection of lower concentrations of target material in assay samples and reducing the level of preamplification required to reach the detection limit.
[0157] [Table 7]
[0158] Example 4. Type IIIA system (Csm) from Thermus thermophilus Materials and Methods cOA detection assay In vitro cOA detection assays were performed in TtCmr activity assay buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM DTT, 1 mM ATP, and 0.5 mM MgCl) supplemented with endogenous Csm complex (~2 μg; Staals et al., 2014. Mol Cell 56:518-530) and RNA substrate (200 nM, listed in Table 4). Reactions were incubated at 65°C for 1 h, after which 0.05 units of pyrophosphatase (ThermoFisher EF0221) were added, followed by incubation at 25°C for 30 min. Signals were visualized using a Malachite Green Phosphate Assay Kit from Sigma-Aldrich (MAK307). Experiments were performed according to the layout shown in Table 6.
[0159] [Table 8]
[0160] result Figure 12 shows the results of a type IIIa Csm cOA production assay, in which this type III CRISPR / Cas complex also exhibits cOA production after the addition of complementary target RNA.
[0161] Example 5. One-pot SARS-CoV-2 detection Materials and Methods Design of type IIIB Cmr crRNA and RPA primers According to reports from the World Health Organization (WHO) and the Centers for Disease Control and Prevention (CDC), the N gene has been identified as a suitable target for detecting SARS-CoV-2. We designed a crRNA against a region of the N gene (called N3 by the CDC) that is conserved among multiple SARS-CoV-2-like coronaviruses. crRNA_N3: 5'-AUUGCGACGCAGCATTGTTAGCAGGATTGCGGGTGCCAATGTGATC 3'
[0162] To amplify the N3 region, DNA primers for RPA were designed according to the parameters suggested by the TwistAmp Liquid Basic Kit (TwistDx Ltd, Maidenhead, UK). Additionally, a T7 promoter sequence was added to the 5' end of the forward primer for in vitro transcription. The best-performing primer pair was identified by screening multiple candidates for successful amplification. nCOV_N3_RPA_F1: 5' GGCATAATACGACTCACTATAGGGTCTGATAATGGACCCCAAAATCAGCGAAAT 3' nCOV_N3_RPA_R1: 5' CTCCATTCTGGTTACTGCCAGTTGAATCTG 3'
[0163] The Cmr46 complex was reconstituted using crRNA_N3 as described above. The SARS-CoV-2 detection assay combines RPA and type IIIB Cmr detection in a single reaction. A synthetic SARS-CoV-2 genome was used as the target RNA. This genome was prepared by Twist Biosciences (South San Francisco, CA) using approximately 10 6 The reference genome was generated based on isolate Wuhan-Hu-1 (GenBank ID: MN908947.3), and was provided as six non-overlapping 5 kb RNA fragments at copies / microliter.
[0164] The TwistAmp Liquid Basic Kit (TwistDx) provided the reagents for RPA amplification. To allow for small sample volumes, all RPA reaction mixtures provided by the supplier were divided into four equal parts. These mixtures also contained oligonucleotide primers, components for reverse transcriptase, and T7 in vitro transcription: 1.5 μL primer mix (10 mM, Integrated DNA Technologies), 0.5 μL M-MLV RT (100 U / μL, Invitrogen), 0.5 μL DTT (50 mM, Invitrogen), 0.25 μL murine RNase inhibitor (40 U / μL, New England Biolabs (NEB)), 0.5 μL T7 polymerase (50 U / μL, NEB), 2.25 μL dNTP solution mix (10 mM, NEB), and 2.25 μL NTP mix (20 mM, NEB). Next, the SARS-CoV-2 Cmr mix was created by combining the RPA mix with 0.125 μL RNaseAlert QC system (Thermo Scientific, dried pellet provided by the manufacturer, resuspended in 100 μL instead of 1 mL), 1 μL Csx1 (10 μM), Cmr46 complex to a final reaction mixture concentration of approximately 60 nM, and ATP to a final reaction mixture concentration of 1 mM. After mixing both reactions, 16.5 μL of the RPA mix was combined with 4.25 μL of the SARS-CoV-2 Cmr mix and 1 μL of the SARS-CoV-2 synthetic genomic template. Multiple mixes containing genomic template ranging from 100,000 copies / μL to 10 copies / μL were generated. The reactions were incubated at 37°C for 30 minutes and 65°C for 45 minutes using the Genie III (OptiGene). Fluorescence readout was performed by the instrument at 495 / 520 nm (excitation / emission) starting at 30 min.
[0165] result The SARS-CoV-2 detection assay amplifies and detects target genetic material in a single reaction. This one-pot reaction mixture was incubated at 37°C for 45 minutes (pre-amplification), after which the temperature was increased to 65°C (signal generation). Figure 13 plots the data for the SARS-CoV-2 synthetic genome incubation time. Results showed a significant increase in signal compared to the negative control (NC) within a few minutes of incubation at 65°C. Since signal generation was generally observed after 5 minutes of incubation at 65°C, it is estimated that the pre-amplification time can be further shortened.
[0166] Example 6. Validation of one-pot SARS-CoV-2 detection Materials and Methods In collaboration with Wageningen Bioveterinary Research (WBVR), a small-scale study was conducted to validate a one-pot type III detection assay for SARS-CoV-2 in mink samples. RNA extraction was performed on rectal swab samples from four COVID-positive mink using the Direct Zol RNA Miniprep Kit (Zymo Research) (GenBank IDs MT396266, MT457390, and MT457399). Samples were eluted in 100 μL RNase-free water, and 5 μL of the eluate was used as template in the detection assay. The TwistAmp™ info kit (TwistDx) provided the reagents for RPA amplification. To allow for small sample volumes, all RPA reaction mixtures provided by the supplier were divided into four equal parts. The provided primer-free rehydration buffer was combined with 1.05 μL of primer mix (5 mM forward and reverse, Integrated DNA Technologies) per reaction and subsequently used to rehydrate the provided RPA pellet. Additionally, a type IIIB Cmr46 mixture was made by combining 4.5 μL of reconstituted Cmr46 complex (loaded with N3 gene crRNA to a final reaction mixture concentration of approximately 60 nM), 0.125 μL of RNaseAlert QC system (Thermo Scientific, dried pellet provided by the manufacturer, resuspended in 100 μL instead of 1 mL), 0.25 μL of ATP (80 mM, Sigma-Aldrich), 1 μL of Csx1 (10 μM), 0.5 μL of M-MLV RT (100 U / μL, Invitrogen), 0.5 μL of DTT (50 mM, Invitrogen), 0.25 μL of murine RNase inhibitor (40 U / μL, New England Biolabs (NEB)), 0.5 μL of T7 polymerase (50 U / μL, NEB), and 2 μL of NTP solution mix (20 mM, NEB). For each assay reaction, 8.425 μL RPA mix was combined with 5.625 μL Cmr mix, 0.625 μL MgOAc (280 mM, TwistDx), and 5 μL template or RNase-free MQ for a total volume of 19.675 μL.As a positive control, 5 μL of a 100 copy / μL SARS-CoV-2 synthetic genome (see Example 5) was used. The reaction mixture was incubated at 37°C for 45 minutes, followed by 65°C for 30 minutes in a Genie III (OptiGene) spectrophotometer. Data collection was performed by measuring fluorescence at 495 nm / 520 nm (excitation / emission) at 15-second intervals during the 65°C incubation period.
[0167] result Since the first SARS-CoV-2 outbreak on a Dutch mink farm at the end of April 2020, the WBVR has been involved in all diagnostic testing of mink in the Netherlands. Extracted RNA samples were provided, followed by a diagnostic assay that combines amplification and detection of target genetic material in a single reaction. This one-pot reaction mixture was incubated at 37°C for 45 minutes (pre-amplification), after which the temperature was increased to 65°C (signal generation). Data from the incubation times of mink SARS-CoV-2 samples are shown in Figure 14. These results clearly demonstrate that SARS-CoV-2 detection is possible within 30 minutes after incubation at 65°C, demonstrating the applicability of this technology to real-world complex sample matrices.
Claims
1. a) an effector complex comprising a type III CRISPR-associated effector protein (Cas) and at least one CRISPR RNA (crRNA) that binds to a target nucleic acid molecule; b) a means for directly or indirectly determining the level of cyclic oligoadenylate (cOA); wherein the type III Cas is a type III Cas7 lacking cleavage activity.
2. The detection system of claim 1, wherein the type III Cas is a type IIIB Cas.
3. The detection system of claim 1 or 2, wherein the type III Cas is derived from a thermophilic organism such as Thermus thermophilus.
4. 4. The detection system according to claim 1, wherein the means for directly or indirectly determining the level of cOA comprises means for determining the level of pyrophosphate (PPi).
5. The detection system according to any one of claims 1 to 4, further comprising inorganic pyrophosphatase.
6. 6. The detection system of claim 5, wherein the inorganic pyrophosphatase is derived from a thermophilic organism such as Thermus thermophilus, allowing for isothermal detection.
7. The detection system according to any one of claims 1 to 6, further comprising a cOA-dependent non-specific effector endoribonuclease such as Csx1.
8. The detection system described in claim 7, further comprising a detectable substrate for the endoribonuclease.
9. Providing a sample with a ribonucleic acid detection system according to any one of claims 1 to 8; incubating the sample under conditions that allow the crRNA to bind to its target nucleic acid molecule; and determining, directly or indirectly, the level of cyclic oligoadenylate (cOA); 1. A method for determining the presence or absence of a target nucleic acid molecule in a sample, comprising: An increase in the determined cOA level compared to a control is indicative of the presence of the target molecule in the sample.
10. 10. The method of claim 9, wherein the level of cOA is determined by determining the level of pyrophosphate or the level of inorganic phosphate if inorganic pyrophosphatase is present in the detection system.
11. 11. The method of claim 9 or 10, wherein the level of pyrophosphate or inorganic phosphate is determined by a colorimetric, fluorometric, fluorescent, or bioluminescence-based assay.
12. The method of claim 9, wherein the level of cOA activity is indirectly determined by determining the level of a cOA-dependent non-specific effector endoribonuclease such as Csx1 by detecting a detectable substrate of the effector endoribonuclease using the detection system described in claim 7 or 8.
13. The method according to any one of claims 9 to 12, wherein the sample is incubated in the ribonucleic acid detection system at a temperature between 37°C and 85°C, preferably at about 65°C.
14. A device comprising the ribonucleic acid detection system according to any one of claims 1 to 8.
15. The device according to claim 14, comprising a plurality of arrayed ribonucleic acid detection systems according to any one of claims 1 to 8, each having a different target nucleic acid molecule.
Citation Information
Patent Citations
Method for detecting pyrophosphoric acid using boronic acid group-immobilized support
JP2013116081A
Pyrophosphoric acid detection sensor, method of detecting nucleic acid and method of discriminating base variety
WO2005003750A1