Lentiviral vectors and uses thereof

Abstract

The present invention provides a lentiviral vector, the lentiviral vector comprising a polynucleotide, the polynucleotide comprising a transcription unit comprising a human phosphoglycerate kinase (PGK) promoter, a nucleotide sequence encoding the RPS19 protein, and an optimized Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE). Compositions and uses of the lentiviral vector, particularly for the treatment of Diamond-Blackfan anemia, are also provided herein.

Description

[Technical Field]

[0001] The present invention provides compositions and methods for rescuing RPS19 expression in cells. In particular, provided herein are methods and compositions for gene therapy of Diamond-Blackfan anemia. [Background technology]

[0002] Diamond-Blackfan anemia (DBA) is a rare disease, with an estimated prevalence of 5–7 cases per million live births, indicating the incidence and distribution of patients across various countries. DBA is characterized by macrocytic anemia, which typically appears in the first year of life and often progresses to neutropenia and thrombocytopenia, and occasionally to myelodysplastic syndrome or acute myeloid leukemia (Ruggero & Shimamura, 2014). Thus, although DBA is typically associated with pure red cell aplasia, the systemic hematopoietic disorder defines DBA as a bone marrow failure (BMF) syndrome.

[0003] Mutations in 20 DBA genes plus three "DBA-like" genes account for 70-80% of DBA patients. RPS19, the gene encoding ribosomal protein S19, is most commonly affected in DBA (25% of patients) (Da Costa, Narla, & Mohandas, 2018). These patients are typically haploinsufficient for this gene (one gene is unaffected and the other is inactivated), resulting in a substantial reduction in the production of functional ribosomes.

[0004] Corticosteroids constitute the first treatment option for patients with DBA. Approximately 80% of patients initially respond to corticosteroids, with anemia improving or completely remitting. However, long-term corticosteroid treatment has shown limited efficacy in many patients, resulting in only approximately 40% remaining on corticosteroids long-term. Overall, this implies that at least 40% of DBA patients are transfusion-dependent. To date, allogeneic hematopoietic stem cell transplantation (allo-HSCT) is the only available curative treatment for DBA patients. The consensus is to use a sibling donor or a fully matched (10 / 10) unrelated donor, but only a minority of patients have suitable donors available. Furthermore, clinical outcomes for DBA patients transplanted using alternative donors after the age of 10 are extremely poor. Furthermore, as already demonstrated in patients with Fanconi anemia (FA), DBA has now been identified as a cancer-predisposing disease, and the incidence of cancer in these patients may further increase during myeloablative pre-transplantation therapy and after transplantation. Summary of the Invention

[0005] Gene therapy, which aims to correct genetic mutations in hematopoietic stem cells, is a potential therapeutic strategy for this genetic disorder. Gene therapy via gammaretroviruses, lentiviruses, adenoviruses, and adeno-associated viruses is attractive due to the natural ability of viruses to enter cells and deliver genetic material to them. In particular, lentiviral vectors (LVs) are suitable vehicles for gene delivery because they are considered relatively safe and can stably integrate into the genomic DNA of a wide range of dividing and non-dividing mammalian cell types. Their ability to stably integrate into the genome makes LVs a unique and ideal tool for gene therapy, particularly for correcting and treating genetic disorders such as DBA.

[0006] Therefore, there remains a significant need for effective treatment regimens for DBA, and the present invention provides LVs that can not only restore RPS19 protein expression but also correct alterations in the ribosome biogenesis process. [Brief explanation of the drawings]

[0007] [Figure 1] Schematic diagram of the generated therapeutic vectors: a) PGK.CoRPS19.Wpre* and b) EF1α(s).CoRPS19.Wpre*. 5' LTR: 5' long terminal repeat; PBS: primer binding site; Ψ: psi packaging signal; ΔGAG: truncated Gag sequence; SA: splicing acceptor; RRE: Rev responsive element (RRE); cPPT: DNA flap central polypurine tract; PGK: phosphoglycerate kinase promoter; EF1α(s): elongation factor 1α in its short version; CoRPS19: codon-optimized nucleotide sequence encoding the RPS19 protein; Wpre*: mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element; 3' LTR: 3' long terminal repeat; polyA: polyadenylation signal sequence. [Figure 2] Determination of the number of CD34+ cells in the bone marrow of patients with Diamond-Blackfan anemia (DBA): a) Percentage of CD34+ cells within total bone marrow cells extracted from DBA patients (DBA), Fanconi anemia patients (FA) as controls, and healthy donors (HD). b) Bone marrow cellularity. c) Percentage of CD34+ / CD38- cells within the bone marrow. Significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). Graphs show median and interquartile range along with the 90th and 10th percentiles. [Figure 3] Quantification of the percentages of various hematopoietic progenitor subpopulations in the bone marrow of DBA patients and healthy donors. a) HSC (hematopoietic stem cells: Lin-CD34+CD38-CD90+CD45RA-). b) MPP (multipotent progenitor cells: CD34+CD38-Thy-1-CD45RA-Flt3+CD7-CD10-). c) MLP (multipotent lymphoid progenitor cells: CD34+CD38-Thy-1lowCD45RA-Flt3+CD7- / +CD10-). d) CMP (common myeloid progenitor cells: CD34+CD38+Thy-1-CD45RA-, Flt3+CD7-CD10-). e) MEPs (megakaryocyte and erythroid progenitors: CD34+CD38+Thy-1-CD45RA-Flt3-CD7-CD10-) and f) GMPs (granulocytic and monocytic progenitors: CD34+CD38+Thy-1-CD45RA+Flt3+CD7-CD10-). Significance was determined using the Mann-Whitney test. Graphs show median and interquartile range, along with 90th and 10th percentiles. HD: healthy donors; DBA: DBA patients. [Figure 4] Determination of hematopoietic progenitor colony-forming cell (CFC) numbers within bone marrow: a) Number of colony-forming units of granulocyte-macrophage progenitors (CFU-GM) for each 105 mononuclear cells (MNCs) plated. b) Number of burst-forming units of erythroid progenitors (BFU-E) for each 105 MNCs plated. Significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). Graphs show median and interquartile range along with 90th and 10th percentiles. BM: bone marrow; HD: healthy donors; DBA: DBA patients; FA: Fanconi anemia patients. [Figure 5]Determination of the reconstitution potential of CD34+ cells from healthy donors and DBA patients in immunodeficient NSG mice: a) Percentage of human CD45+ (hCD45+) cells engrafted into mouse bone marrow at three different time points (30, 60, and 90 days post-transplant (dpt)). b) Differentiation into various lineages: CD33+: myeloid, CD19+: lymphoid, and CD34+: hematopoietic stem cells (HSC). Significance was determined by the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). Graphs show median and interquartile range along with 90th and 10th percentiles. HD: healthy donor; DBA: DBA patient. [Figure 6] Examination of endogenous expression of the RPS19 gene in disease model cell lines that were subsequently corrected with the PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre* therapeutic vectors (the RPS19 gene was interfered with in K562 by the vectors LV-THM.shRPS19 and MISSION® pLKO.1-pure TurboGFP™ shRPS19): a) Left panel: Reduction of endogenous expression of RPS19 by the vector LV-THM.shRPS19 (ShRPS19-LV); right panel: Subsequent detection of CoRPS19 sequences present in the therapeutic vectors PGK.CoRPS19.Wpre* (PGK.CoRPS19-LV) and EF1α(s).CoRPS19.Wpre* (EF1α.CoRPS19-LV). b) Left panel: Reduction of endogenous expression of RPS19 by the vector LV-MISSION® pLKO.1-pure TurboGFP™ shRPS19 (ShRPS19-LV); right panel: Subsequent detection of the CoRPS19 sequence present in the therapeutic vectors PGK.CoRPS19.Wpre* (PGK.CoRPS19-LV) and EF1α(s).CoRPS19.Wpre* (PGK.CoRPS19-LV). Significance was determined by a mean P value of *≦0.05; **≦0.01; ***≦0.001; ****≦0.0001. Graphs show the mean and standard deviation. The dashed line in the left panel indicates the basal endogenous expression of RPS19 in undisturbed K562 control cells (mock). [Figure 7]Analysis of ribosome biogenesis in K562 cell lines interfered with for the RPS19 gene and subsequently corrected with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector: a) Left panel: Pre-21S / 21C by Northern blot in cells interfered with the interference vector LV-THM.shRPS19 and subsequently transduced with the therapeutic vectors PGK.CoRPS19.Wpre* (PGK.CoRPS19-LV) or EF1α(s).CoRPS19.Wpre* (EF1α.CoRPS19-LV). Detection of levels of rRNA (asterisk, 21S / 21S-C); right panel: graph showing quantification of the ratio of pre-21S rRNA to 21C rRNA (pre-rRNA 21S / 21S-C) detected by Northern blot in cells interfered with by the interference vector LV-THM.shRPS19 and subsequently transduced with the therapeutic vectors PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre*. b) Left panel: Detection of 21S pre-rRNA and 21C pre-rRNA levels (asterisks) by Northern blot in cells interfered with the interference vector LV-MISSION® pLKO.1-pure TurboGFP™ shRPS19 and subsequently transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*; right panel: Graph showing quantification of the ratio of pre-21S rRNA to pre-21C rRNA (pre-rRNA 21S / 21S-C) detected by Northern blot in cells interfered with the interference vector LV-MISSION® pLKO.1-pure TurboGFP™ shRPS19 and subsequently transduced with the therapeutic vectors PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre*. Significance was determined by ANOVA test and group by group analysis (P value; *≦0.05; **≦0.01; ***≦0.001; ****≦0.0001). Graphs show the mean and standard deviation of three experiments. 1. Mock: untransduced cells; 2. SCRB: cells transduced with LV-THM.sh scramble.Include 1. Mock and 2. SCRB as negative controls. PGK.CoRPS19: condition transduced with PGK.CoRPS19.Wpre* vector; EF1α.CoRPS19: condition transduced with EF1α(s).CoRPS19.Wpre* vector; Sh+PGK.CoRPS19: condition co-transduced with a) LV-THM.shRPS19 and b) MISSION® pLKO.1-pure TurboGFP™ shRPS19 interfering vector and PGK.CoRPS19.Wpre* vector, and Sh+EF1α.CoRPS19: condition co-transduced with a) LV-THM.shRPS19 and b) MISSION® pLKO.1-pure TurboGFP™ shRPS19 interfering vector and EF1α(s).CoRPS19.Wpre* LV. [Figure 8] Determination of the number of hematopoietic progenitor colonies generated by CD34+ cells from DBA patients transduced with the PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre* therapeutic vectors, or with the PGK.EGFP.Wpre* control vector: a) Number of CFU-GM colonies per 105 mononuclear (MNC) cells plated. b) Number of BFU-E colonies per 105 MNC cells plated. N=3 for experiments performed with cells transduced with the PGK.EGFP.Wpre* vector (PGK EGFP), N=5 for experiments performed with cells transduced with the PGK.CoRPS19.Wpre* vector (PGK.CoRPS19), and N=5 for experiments performed with cells transduced with the EF1α(s).CoRPS19.Wpre* vector (EF1α.CoRPS19). [Figure 9]Efficient correction and zero toxicity by the PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre* therapeutic vectors in CD34+ cells from DBA patients: a) Percent transduction of hematopoietic progenitor cells from DBA patients with the PGK.CoRPS19.Wpre* (PGK.CoRPS19) or EF1α(s).CoRPS19.Wpre* (EF1α.CoRPS19) therapeutic vectors or the PGK.EGFP.Wpre* control vector (PGK EGFP). b) Number of vector copies integrated into cells maintained in liquid culture (VCN), and c) Number of vector copies integrated into CFCs (VCN). Significance was determined by the Mann-Whitney test. Number of experiments performed per condition: PGK.EGFP.Wpre* vector: N = 4, PGK.CoRPS19.Wpre vector N = 5, and EF1α(s).CoRPS19.Wpre*: N = 3. Graphs represent the mean values ​​corresponding to transduction of CD34+ cells from 5 different patients with the corresponding standard deviation. [Figure 10] Analysis of the effect of therapeutic vector transduction on ex vivo expansion in liquid culture of hematopoietic progenitor cells from DBA patients. Number of bone marrow hematopoietic progenitor cells from DBA patients successfully transduced with the PGK.CoRPS19.Wpre* (PGK.CoRPS19) therapeutic vector or the EF1α(s).CoRPS19.Wpre* (EF1α.CoRPS19) therapeutic vector. The PGK.EGFP.Wpre* vector (PGK EGFP) was used as a control. Cell numbers were measured on day 0 (D0) before transduction and at two different time points after transduction (D7 and D14, 7 and 14 days later). [Figure 11]Analysis of the erythroid differentiation process in DBA patient-derived cells corrected by therapeutic vectors: Quantification of the percentage of CD71+ / CD235a+ and CD71- / CD235a+ (CD71 / CD235a) cell populations in BM CD34+ DBA cells transduced with the PGK.CoRPS19.Wpre* (PGK.CoRPS19) therapeutic vector or the EF1α(s).CoRPS19.Wpre* (EF1α.CoRPS19) therapeutic vector or the PGK.EGFP.Wpre* control vector (PGK.EGFP). This figure shows a) individual analyses of three patients (DB-31, DB-25, and DB-36) and b) bulk analyses. Significance was determined by the Mann-Whitney test. Graphs show the mean and standard deviation. [Figure 12] Analysis of the reconstitution potential of DBA patient cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector transplanted into NSG immunodeficient mice. The engraftment level (percentage of hCD45+ cells) of DBA patient-derived BM CD34+ cells corrected with the therapeutic vector at three different time points (30 days (D30), 60 days (D60), and 90 days (D90)) after cell transplantation was determined, as well as the multilineage potential of differentiation into myeloid (CD33+), lymphoid (CD19+), and HSC (CD34+) cells. Significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001; ns: not significant). Graphs show the mean and standard deviation. MOCK EGFP: PGK.EGFP.Wpre* control vector; PGK CoRPS19: PGK.CoRPS19.Wpre* vector; EF.CoRPS19, EF1α(s).CoRPS19.Wpre* vector. [Figure 13] Quantification of vector copy number (VCN) at 90 days post-transplant in DBA patient cells transduced with therapeutic vector or EGFP vector control and engrafted into NSG recipient mice. Statistical significance was determined using the Mann-Whitney test (P < 0.05). [Figure 14] Quantification of the number of colonies generated from healthy donor umbilical CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector: a) Number of granulocyte-macrophage progenitor colony-forming units (CFU-GM) per 105 mononuclear cells (MNCs) plated. b) Number of BFU-E per 105 MNCs plated. Significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). Graphs show the mean and standard deviation of five experiments. PGK.EGFP: PGK.EGFP.Wpre* control vector; PGK.CoRPS19: PGK.CoRPS19.Wpre* vector; EF1α.CoRPS19: EF1α(s).CoRPS19.Wpre* vector. [Figure 15] Determination of VCN / cell, transduction percentage, and CoRPS19 transgene expression levels in colonies and liquid cultures of healthy donor CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector: a) Determination of vector copy number (VCN) / cell in colonies and transduction percentage in CD34+ cells. b) Determination of VCN / cell in liquid cultures (LCs). c) CoRPS19 expression normalized to VCN / cell. Statistical significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). The graph in panel a) shows the mean and standard deviation of five experiments, the graph in panel b) shows the mean and standard deviation of four experiments, and the graph in panel c) shows the mean and standard deviation of three experiments. PGK EGFP: PGK.EGFP.Wpre* control vector; PGK CoRPS19: PGK.CoRPS19.Wpre* vector; EF1α CoRPS19: EF1α(s).CoRPS19.Wpre* vector. [Figure 16]Proliferation curves of healthy donor umbilical cord CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector and the PGK.EGFP.Wpre* control vector. Significance was determined by the Mann-Whitney test (P value <0.05). Graphs show the mean and standard deviation of five experiments (N=5). D, days; PGK EGFP:PGK.EGFP.Wpre* control vector; PGK CoRPS19:PGK.CoRPS19.Wpre* vector; EF CoRPS19:EF1α(s).CoRPS19.Wpre* vector. [Figure 17] Analysis of the repopulation and differentiation potential of healthy donor CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector: a) Repopulation potential was determined by quantifying the percentage of hCD45+ cells in primary and secondary recipients. b) Distribution of myeloid (CD33+), lymphoid (CD19+), and HSC (CD34+) cells in primary and secondary recipients. Statistical significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). Graphs show the mean and standard error of the mean for two safety experiments performed after transduction of CD34+ cells derived from healthy donor umbilical cord blood and in vivo hematopoietic repopulation in NSG mice. D, days; PGK EGFP: PGK.EGFP.Wpre* control vector; PGK CoRPS19: PGK.CoRPS19.Wpre* vector; EF CoRPS19: EF1α(s).CoRPS19.Wpre* vector. [Figure 18]VCN quantification in healthy donor CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector and transplanted into NSG mice as primary recipients. Statistical significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.0001). The graph shows the mean and standard error of the mean from two separate experiments performed to analyze the in vivo safety and toxicity of therapeutic vectors after transduction of healthy donor CD34+ cells derived from umbilical cord blood and transplantation into NSG mice. PGK EGFP:PGK.EGFP.Wpre* control vector; PGK CoRPS19:PGK.CoRPS19.Wpre* vector; EF CoRPS19:EF1α(s).CoRPS19.Wpre* vector. [Figure 19] Determination of body weight of NSG mice transplanted with healthy donor CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector and the PGK.EGFP.Wpre* control vector. Statistical significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.000105). The graph shows the mean and standard error of the mean from two separate experiments performed to analyze the in vivo safety and toxicity of therapeutic vectors after transduction of cord blood-derived healthy donor CD34+ cells and transplantation into NSG mice. D, days; PGK EGFP:PGK.EGFP.Wpre* control vector; PGK CoRPS19:PGK.CoRPS19.Wpre* vector; EF CoRPS19:EF1α(s).CoRPS19.Wpre* vector. [Figure 20]Hematological parameters were determined in NSG mice transplanted with healthy donor CD34+ cells transduced with the PGK.CoRPS19.Wpre* therapeutic vector or the EF1α(s).CoRPS19.Wpre* therapeutic vector or the PGK.EGFP.Wpre* control vector: a) red blood cells, b) white blood cells, c) platelets, and d) neutrophils. Statistical significance was determined using the Mann-Whitney test (P values: * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001; **** ≤ 0.000105). The graph shows the mean and standard error of the mean from two separate experiments performed to analyze the in vivo safety and toxic effects of the therapeutic vectors after transduction of healthy donor CD34+ cells derived from umbilical cord blood and transplantation into NSG mice. D, days; PGK EGFP: PGK.EGFP.Wpre* control vector; PGK CoRPS19: PGK.CoRPS19.Wpre* vector; EF CoRPS19: EF1α(s).CoRPS19.Wpre* vector. DETAILED DESCRIPTION OF THE INVENTION

[0008] General definition It should be noted that, as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Further, unless otherwise indicated, the term "at least" preceding a series of elements should be understood to refer to every element of the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0009] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" is used herein to modify numerical values ​​above and below the stated value by a variance of 10% above or below (even higher or lower).

[0010] As used herein, the connective term "and / or" between multiple listed elements is understood to encompass both individual and combined options. For example, when two elements are connected by "and / or," the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of the first and second elements together. Any one of these options is understood to be within the meaning and therefore meets the requirements of the term "and / or" as used herein. The simultaneous applicability of more than one of the options is also understood to be within the meaning and therefore meets the requirements of the term "and / or."

[0011] Throughout this specification and the appended claims, unless the context requires otherwise, the word "comprise," and variations such as "comprises" and "comprising," are understood to mean the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps. As used herein, the term "comprising" can be replaced by the terms "containing" or "including," or, sometimes, when used herein, by the term "having." Any of the foregoing terms (comprising, containing, including, having) may, but is less preferably, replaced by the term "consisting of," whenever used herein in connection with an aspect or embodiment of the invention.

[0012] As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element.

[0013] A protein or nucleotide "consisting essentially of" a protein or nucleotide is a protein or nucleotide that has substantially the same amino acid or nucleotide sequence as the specified protein or nucleotide.

[0014] A protein or nucleotide that has "essentially the same amino acid or nucleotide sequence" as a protein or nucleotide, respectively, typically has greater than 90% amino acid identity or nucleotide identity with the protein or nucleotide. This definition includes conservative amino acid substitutions.

[0015] The term "isolated" for the purposes of the present invention refers to biological material (a cell, a polypeptide, a polynucleotide or a fragment, variant or derivative thereof) that has been removed from its original environment (the environment in which it naturally occurs).

[0016] As used herein, "enriched" refers to CD34 + "Enrichment" means that the purity or proportion of a specific population of cells, such as cells, is increased by at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to the total cells contained in the composition. Methods for enriching a specific population of cells are known in the art, for example, by using specific kits that use negative or positive selection.

[0017] The terms "nucleic acid," "nucleic acid molecule," "oligonucleotide," and "polynucleotide" are used interchangeably and refer to the polymeric phosphate ester forms of ribonucleosides (adenosine, guanosine, uridine, or cytidine; "RNA molecules"), or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any of their phosphoester analogs, such as phosphorothioates and thioesters, in either single-stranded form or double-stranded helices. The term nucleic acid molecule, particularly DNA molecule or RNA molecule, refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary form. Thus, the term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and chromosomes.

[0018] "Codon optimization," as used herein, refers to the replacement of wild-type expressed codons with more conventionally stable codons to maximize the chances of obtaining a functional and active protein, thereby enhancing expression.

[0019] A "coding region" or "coding sequence" is a portion of a polynucleotide consisting of codons translatable into amino acids.

[0020] As used herein, "promoter" refers to a DNA sequence that directs the binding of RNA polymerase, thereby promoting RNA synthesis, i.e., a minimal sequence sufficient to direct transcription. The promoter and the expression of the corresponding protein or polypeptide can be ubiquitous, meaning that they are active in a wide range of cells, tissues, and species, or in a cell-type-, tissue-, or species-specific manner. A promoter sequence can be composed of various promoter fragments (either different or the same fragments) that are closely located in the DNA sequence and can be separated by linkers or spacers. Such promoters are called chimeric promoters.

[0021] As used herein, "enhancer" encompasses cis-acting elements that stimulate or inhibit transcription of adjacent genes. Enhancers that inhibit transcription are also called "silencers." Enhancers can function in either direction (i.e., can be associated with a coding sequence) over distances of up to several kilobase pairs (kb) from the coding sequence and downstream of the transcribed region.

[0022] The term "downstream" refers to a nucleotide sequence located 3' to a reference nucleotide sequence or sequences. In certain embodiments, a downstream nucleotide sequence relates to a sequence that follows the start of transcription.

[0023] The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence. In certain embodiments, an upstream nucleotide sequence relates to a sequence located in the 5' region of a nucleotide region.

[0024] As used herein, the term "gene regulatory region" or "regulatory region" refers to a nucleotide sequence located upstream (5' sequences), within, or downstream (3' sequences) of a coding region that influences the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures. If the coding region is intended for expression in eukaryotic cells, polyadenylation signals and transcription termination sequences are usually located 3' of the coding sequence.

[0025] The term "post-transcriptional regulatory element" refers to a DNA sequence that, when transcribed, creates a tertiary structure that enhances or inhibits protein expression.

[0026] "Transcriptional control sequence" refers to DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that direct the expression of a coding sequence in a host cell.

[0027] The terms "treatment" and "therapy" as used in this application refer to a range of hygienic, pharmacological, surgical, and / or physical measures used with the intention of curing and / or alleviating a disease and / or symptoms to improve a health problem. The terms "treatment" and "therapy" both relate to the maintenance and / or re-establishment of the health of an individual or animal, and therefore include preventative and curative methods. The administration of suitable pharmaceuticals to alleviate and / or cure a health problem, regardless of the cause of the symptoms, diseases, and disorders, should be construed as a form of treatment or therapy within the context of this application.

[0028] The term "therapeutically effective amount" refers to an amount of a substance that has a therapeutic effect and is capable of treating DBA.

[0029] The terms "individual," "patient," or "subject" are used interchangeably in this application and are not meant to be limiting in any way. An "individual," "patient," or "subject" may be of any age, sex, and health status.

[0030] As used herein, the term "host cell" refers to a cell that has been transduced, infected, transfected, or transformed by a vector. The vector may be a plasmid, a viral particle, a phage, etc. Culture conditions, such as temperature, pH, etc., will be those previously used with the host cell selected for expression and will be apparent to one of skill in the art. It is understood that the term "host cell" refers to the original transduced, infected, transfected, or transformed cell and its progeny.

[0031] As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable diluent" refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations used and include, but are not limited to, additional buffering agents; preservatives; cosolvents; antioxidants, including ascorbic acid and methionine; chelating agents, such as EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium; polyhydric sugar alcohols; amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, such as Examples include lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, galactitol, glycerol, cyclitols (e.g., inositol), polyethylene glycol; sulfur-containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, [alpha]-monothioglycerol, and sodium thiosulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone.

[0032] As used herein, the phrase "subject in need thereof" includes a subject, such as a mammalian subject, who would benefit from the administration of a polynucleotide molecule, polypeptide, or vector provided herein, e.g., to correct a genetic defect, to correct defective function of a protein, or to improve homeostasis.

[0033] As used herein, the term "optimized" with respect to a nucleotide sequence refers to a polynucleotide sequence that encodes a polypeptide, wherein the polynucleotide sequence has been mutated to enhance a property of the polynucleotide sequence.

[0034] The term "lentivirus" refers to a genus of retroviruses that can infect and replicate in human cells and cause disease in humans and other mammalian species. A "vector" is any vehicle that can be used to artificially transport foreign genetic material into cells. Thus, a "lentiviral vector" refers to a recombinant lentivirus that transports polynucleotides into cells. The term encompasses all subtypes, as well as both naturally occurring and recombinant forms, unless otherwise required. The term "LV" is an abbreviation for lentivirus and can be used to refer to the virus itself or its derivatives.

[0035] As used herein, the term "gene" or "coding sequence" refers to an in vitro or in vivo nucleotide sequence that encodes a gene product. In some instances, a gene consists of or consists essentially of a coding sequence, i.e., a sequence that encodes a gene product.

[0036] As used herein, "transcription unit" refers to a nucleotide sequence contained in an LV vector of the present invention, comprising, from 5' to 3', a phosphoglycerate kinase (PGK) promoter or a truncated version thereof, elongation factor 1 alpha (EF1α) (EF1α(s)), a codon-optimized nucleotide sequence encoding the RPS19 protein (CoRPS19), a woodchuck hepatitis virus post-transcriptional regulatory element (Wpre), preferably a mutated Wpre, and at least a polyadenylation (polyA) signal sequence, wherein the phosphoglycerate kinase (PGK) promoter or elongation factor 1 alpha (EF1α), Wpre, and polyadenylation (polyA) signal sequence are operably linked to CoRPS19 and regulate expression of CoRPS19.

[0037] overview As mentioned above, DBA patients are typically haploinsufficient for the RPS19 gene, meaning that one allele of the RPS19 gene is unaffected and functional, but the RPS19 protein is not expressed sufficiently, which ultimately leads to dysfunctional ribosomes and the development of disease.

[0038] Previous studies have attempted to modify RPS19 protein expression by using lentiviral vectors (LVs) in which the RPS19 gene is placed under the control of a strong viral promoter, aiming to achieve even higher levels of RPS19 protein expression. However, while human promoters such as PGK or EF1α are known to be safer than strong viral promoters, PGK or EF1α may not be strong enough to drive the expression of the protein in certain diseases (e.g., autosomal dominant disorders, i.e., DBA) in which large amounts of the protein (RPS19) are required.

[0039] We demonstrate herein that lentiviral vectors containing human promoters can express sufficient amounts of RPS19 protein to correct alterations in ribosome biogenesis. Specifically, two self-inactivating lentiviral vectors (SIN-LVs) have been developed, each carrying two different human promoters: the phosphoglycerate kinase (PGK) promoter and its truncated version, the elongation factor 1 alpha (EF1α(s)) promoter. As shown in Figure 7, both LVs express a codon-optimized RPS19 protein (referred to as CoRPS19) and can correct alterations in ribosome biogenesis in the K562 cell line, whose expression of the RPS19 gene was silenced by interfering RNA. CD34 cells derived from the bone marrow of a patient with RPS19 deficiency were also shown to be capable of expressing RPS19 protein. +We also demonstrate that these LV vectors increased the number of granulomacrophagic (CFU-GM) and erythroid (BFU-E) colonies by 1.5-fold and 3.9-fold, respectively, in cells transduced with a non-therapeutic vector carrying the gene for green fluorescent protein (EGFP). Thus, unexpectedly, even though the human PGK promoter was only able to increase RPS19 expression by 1.5-fold, this increase proved sufficient to achieve corrected ribosome biogenesis in a severe model of DBA: the K562 cell line, in which RPS19 expression is almost completely abrogated.

[0040] Furthermore, the therapeutic vector reverses the characteristic erythroid differentiation defect in erythroid progenitor cells from DBA patients, resulting in the expression of mature CD71 - / CD235a + It also increased red blood cell production by 2.5-fold. Similarly, we show that transduction of these progenitor cells in immunodeficient NSG mice preserved their repopulating capacity, suggesting that this capacity of hematopoietic stem cells in DBA patients is not severely affected. Toxicity studies demonstrated that overexpression of an optimized version of the RPS19 gene in cells derived from healthy donors was not toxic.

[0041] In conclusion, these results pave the way for the use of these LV vectors for DBA therapy, as they demonstrate the potential to correct the RPS19 protein expression defect in patients with this disease. In particular, these results demonstrate the feasibility of using lentiviral vectors expressing the RPS19 protein under the control of the PGK promoter for the treatment of DBA.

[0042] Thus, in a first aspect, the present invention provides a lentiviral vector (LV) comprising a polynucleotide, the polynucleotide comprising a transcription unit, defined herein as comprising, from 5' to 3', a promoter selected from the group consisting of the phosphoglycerate kinase (PGK) promoter or the elongation factor 1 alpha (EF1α) promoter or a functional variant thereof, a nucleotide sequence encoding the human RPS19 protein, preferably a codon-optimized nucleotide sequence encoding the human RPS19 protein (CoRPS19) or a functional variant thereof, and a woodchuck hepatitis virus post-transcriptional regulatory element (Wpre), preferably a mutant Wpre or a functional variant thereof, wherein the PGK promoter or EF1α promoter and Wpre are operably linked to RPS19 or CoRPS19 to regulate the expression of RPS19 or CoRPS19. A coding sequence and a gene expression control sequence are said to be operably linked if they are linked in such a way that the expression, transcription, and / or translation of the coding sequence is under the influence or control of the gene expression control sequence. For example, the PGK promoter or EF1α promoter and Wpre are operably linked to a nucleotide sequence encoding a CoRPS19 protein such that the expression level of CoRPS19 is regulated by one of the promoter and Wpre.

[0043] In one embodiment, the polynucleotides comprised in the LV vector according to the first aspect further comprise one or more lentiviral backbone elements, defined as polynucleotides encoding proteins necessary for LV to perform its function (infect cells, integrate into the viral genome and persist within the cell), and polynucleotides encoding regulatory sequences necessary for LV to perform its function.

[0044] Thus, the LV vector of the first aspect comprises a polynucleotide, characterized in that the polynucleotide comprises 1) a transcription unit and 2) one or more LV vector backbone elements or a combination thereof. Each of these two components and their polynucleotides is characterized in detail below:

[0045] 1) Transcription unit As defined above, the term "transcription unit" as used herein refers to a polynucleotide sequence contained in the polynucleotide of the LV vector of the present invention, which comprises, from 5' to 3', a promoter selected from the group consisting of PGK or EF1α, a nucleotide sequence encoding an RPS19 protein, preferably CoRPS19, and a Wpre element, preferably a mutated Wpre, wherein the PGK promoter or EF1α promoter and Wpre are operably linked to RPS19 or CoRPS19 and regulate the expression of RPS19 or CoRPS19.

[0046] ·promoter As described above, the promoter contained in the transcription unit is selected from the group consisting of PGK promoter or EF1α promoter, which drives the expression of RPS19, preferably CoRPS19, after the lentiviral vector genome is integrated into the target cell.

[0047] In some embodiments, the promoter in the lentiviral vector selectively enhances the expression of RPS19, preferably CoRPS19, protein in target cells. In some embodiments, the polynucleotide molecule contained in the lentiviral vector is stably integrated into the genome of the target cell or target tissue, for example, the genome of hematopoietic stem cells and hematopoietic progenitor cells.

[0048] In a preferred embodiment, the promoter included in the polynucleotide of the lentiviral vector provided herein is a PGK promoter. In one embodiment, the PGK promoter is a human PGK promoter. Preferably, the PGK promoter comprises, consists of, or consists essentially of SEQ ID NO: 10 or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 10 over its entire length. In some embodiments, the PGK promoter comprises, consists of, or consists essentially of SEQ ID NO: 10.

[0049] In one embodiment, the promoter comprised in the polynucleotide of the lentiviral vector provided herein is an EF1α promoter. In a preferred embodiment, the EF1α promoter is a shortened version of the EF1α promoter as described in Shubhranshu et al. 2017 (Shubhranshu et al., Lentiviral Vectors with Cellular Promoters Correct Anemia and Lethal Bone Marrow Failure in a Mouse Model for Diamond-Blackfan Anemia, Molecular Therapy, Volume 25, Issue 8, 2017, Pages 1805-1814, ISSN 1525-0016, https: / / doi.org / 10.1016 / j.ymthe.2017.04.002). In one embodiment, the EF1α promoter is a human EF1α promoter. Preferably, the truncated EF1α promoter comprises, consists of, or consists essentially of SEQ ID NO: 11, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO: 11. In some embodiments, the truncated EF1α promoter comprises, consists of, or consists essentially of SEQ ID NO: 11.

[0050] A nucleotide sequence encoding an RPS19 protein, preferably a codon-optimized RPS19 protein (CoRPS19). The lentiviral vectors provided herein comprise a transcription unit containing a nucleotide sequence encoding a human RPS19 protein or a functional fragment thereof. Preferably, the transcription unit contains a codon-optimized version of the human RPS19 gene (hereinafter referred to as CoRPS19). In one embodiment, RPS19 or CoRPS19 is operably linked to at least one, preferably two, expression control sequences comprising a promoter and a post-transcriptional element. In some embodiments, the present invention provides lentiviral vectors comprising an isolated polynucleotide molecule comprising a nucleotide sequence encoding a polypeptide having an activity similar to that of RPS19.

[0051] Preferably, the codon-optimized nucleotide sequence encoding the CoRPS19 protein comprises, consists of, or consists essentially of SEQ ID NO: 12, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 12. In some embodiments, the codon-optimized nucleotide sequence encoding the CoRPS19 protein comprises, consists of, or consists essentially of SEQ ID NO: 12.

[0052] · WHV (woodchuck hepatitis virus) post-transcriptional regulatory element (Wpre) The lentiviral vector provided herein also comprises at least one post-transcriptional regulatory element operably linked to the nucleotide encoding RPS19, preferably CoRPS19 protein, in the transcription unit.In one embodiment, the post-transcriptional regulatory element is WHV (woodchuck hepatitis virus) post-transcriptional regulatory element (Wpre).In one embodiment, to enhance the safety of the vector, the post-transcriptional regulatory element is mutated (also referred to as Wpre*).In a preferred embodiment, the mutated Wpre contains a mutation in the gene X frame.

[0053] In a preferred embodiment, the nucleotide sequence comprising the WHV (woodchuck hepatitis virus) post-transcriptional regulatory element (Wpre) is a mutated Wpre element. Preferably, the nucleotide sequence comprising the mutated Wpre comprises, consists of, or consists essentially of SEQ ID NO: 13, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO: 13. In some embodiments, the nucleotide sequence comprising the mutated Wpre comprises, consists of, or consists essentially of SEQ ID NO: 13.

[0054] It should be understood that all of the embodiments described above for the various elements of the transcription unit (PGK promoter or EF1α promoter, nucleotide sequence encoding RPS19, preferably CoRPS19 protein, and Wpre element, preferably Wpre*) can be combined with each other.

[0055] In a preferred embodiment, the transcription unit contained in the polynucleotide of the lentiviral vector consists of a promoter selected from the group consisting of a phosphoglycerate kinase (PGK) promoter or an elongation factor 1 alpha (EF1α) promoter, a codon-optimized nucleotide sequence encoding the RPS19 protein, and a mutant woodchuck hepatitis virus post-transcriptional regulatory element (Wpre), wherein the promoter and Wpre element are operably linked to the nucleotide sequence encoding the RPS19 protein and regulate the expression of the nucleotide sequence encoding the RPS19 protein.

[0056] In a preferred embodiment, the transcription unit contained in the polynucleotide of the lentiviral vector consists of a phosphoglycerate kinase (PGK) promoter having at least 95% sequence identity over its entire length to SEQ ID NO: 10, a codon-optimized nucleotide sequence encoding the CoRPS19 protein having at least 95%, preferably 98%, sequence identity over its entire length to SEQ ID NO: 12, and a mutant woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) having at least 95%, preferably 98%, sequence identity over its entire length to SEQ ID NO: 13, wherein the PGK promoter and the mutant Wpre element are operably linked to the nucleotide sequence encoding the CoRPS19 protein and regulate the expression of the nucleotide sequence encoding the CoRPS19 protein.

[0057] In a preferred embodiment, the transcription unit contained in the polynucleotide of the lentiviral vector consists of an elongation factor 1 alpha (EF1α) promoter having at least 95% sequence identity over its entire length to SEQ ID NO:11, a codon-optimized nucleotide sequence encoding the CoRPS19 protein having at least 95%, preferably 98%, sequence identity over its entire length to SEQ ID NO:12, and a mutant woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) having at least 95%, preferably 98%, sequence identity over its entire length to SEQ ID NO:13, wherein the EF1α promoter and the mutant Wpre element are operably linked to the nucleotide sequence encoding the CoRPS19 protein and regulate the expression of the nucleotide sequence encoding the CoRPS19 protein.

[0058] 2) Lentiviral vector backbone elements As defined above, lentiviral vector backbone elements are defined as polynucleotide sequences necessary for LV to perform its functions (infect cells, integrate into the viral genome and persist within the cells).

[0059] Lentiviruses include members of the bovine lentivirus group, equine lentivirus group, feline lentivirus group, ovinecaprine lentivirus group, and primate lentivirus group. In some embodiments, the gene delivery vector is a self-limiting LV.

[0060] In some embodiments, the lentiviral vectors provided herein are "third-generation" lentiviral vectors. As used herein, the term "third-generation" lentiviral vector refers to a lentiviral packaging system that has the characteristics of a second-generation vector system and further lacks a functional tat gene, such as one in which the tat gene is deleted or inactivated. Typically, the gene encoding rev is provided on a separate expression construct. As used herein, a "second-generation" lentiviral vector system refers to a lentiviral packaging system that lacks functional accessory genes, such as one in which the accessory genes vif, vpr, vpu, and nef are deleted or inactivated. As used herein, a "packaging system" refers to a set of viral constructs that contain genes encoding viral proteins involved in packaging of recombinant viruses. Typically, the packaging system construct is ultimately integrated into packaging cells.

[0061] In some embodiments, the third generation lentiviral vectors provided herein are self-inactivating lentiviral vectors. In some embodiments, the lentiviral vectors are VSV.G pseudotyped lentiviral vectors.

[0062] In certain embodiments, the lentiviral vector is a recombinant lentiviral vector capable of infecting dividing and non-dividing cells. In certain embodiments, the lentiviral vector is capable of infecting hematopoietic stem cells, long-term hematopoietic stem cells, short-term hematopoietic stem cells, multipotent progenitor cells, hematopoietic CD34+ cells, and any cluster-differentiated subpopulation within the CD34+ population. Lentiviral genomes and proviral DNA typically contain three genes found in retroviruses: gag, pol, and env, flanked by two long terminal repeat (LTR) sequences. The gag gene encodes internal structural (matrix, capsid, and nucleocapsid) proteins. The pol gene encodes RNA-dependent DNA polymerase (reverse transcriptase), protease, and integrase. The env gene encodes viral envelope glycoproteins. The 5' and 3' LTRs function to promote transcription and polyadenylation of virion RNA. The LTRs contain all other cis-acting sequences necessary for viral replication. In some embodiments, the lentivirus has additional genes including (for HIV-1, HIV-2 and / or SIV) vif, vpr, tat, rev, vpu, net and vpx.

[0063] In certain embodiments, the lentiviral vector is deleted for the HIV virulence genes env, vif, vpr, vpu, and nef without compromising the vector's ability to transduce dividing and non-dividing cells.

[0064] In certain embodiments, the gene transfer cassette comprises one or more additional elements, e.g., one or more elements selected from a 5' LTR, a primer binding site, a DNA flap central polypurine tract, a Rev response element, a coding sequence, e.g., a truncated gag sequence, a packaging signal, a 3' LTR, and / or a polyA signal.

[0065] As defined above, the lentiviral vector provided herein comprises a polynucleotide, and the polynucleotide comprises the transcription unit defined above. In one embodiment, the polynucleotide contained in the lentiviral vector further comprises, upstream, i.e., in the 5' region of the transcription unit defined above, at least one of the following polynucleotide sequences in the order from 5' to 3': a) a 5' long terminal repeat (5' LTR) comprising a chimeric cytomegalovirus (CMV) promoter, b) a primer binding site (PBS), c) a psi (Ψ) packaging signal, d) a Rev response element (RRE), and e) a DNA flap central polypurine tract (cPPT), or any combination thereof.

[0066] In another embodiment, the polynucleotide contained in the lentiviral vector further comprises, downstream, i.e., in the 3' region of the transcription unit defined above, i) a 3' long terminal repeat (LTR), and optionally j) a polyadenylation (polyA) signal sequence located after the 3' LTR. In some embodiments, the lentiviral vector comprises a deletion of the U3 region of the 5' LTR and / or 3' LTR. The deletion of the U3 region of the LTR can be a complete or partial deletion. The absence of the U3 sequence of the wild-type LTR means that the lentiviral vector construct is Tat-independent, and therefore, the lentiviral vector construct is produced in the third generation.

[0067] It should be understood that any possible combination of nucleotides a)-e) and i) and j) in combination with the transcription units described in the above sections is encompassed by the present invention. Thus, a lentiviral vector may contain only one, two, three, or more elements selected from a)-e) and i) and j) in combination with the transcription units defined above. Each of nucleotides a)-e), and i) and j), and preferred embodiments thereof, are further defined below.

[0068] The 5' LTR nucleotide sequence is responsible for proviral transcription during lentiviral vector production. In the lentiviral vector constructs provided herein, the 5' LTR comprises or consists of a chimeric form of the CMV promoter. Furthermore, in the lentiviral vector constructs provided herein, the 5' LTR may also comprise a portion of the wild-type HIV-1 5' LTR designated RU5. In a preferred embodiment, the 5' LTR comprises or consists of a chimeric form of the CMV promoter and a portion of the wild-type HIV-1 5' LTR designated RU5 element. The chimeric CMV promoter directs proviral transcription during lentiviral vector production. In one embodiment, the chimeric CMV promoter comprises or consists of a CMV enhancer (hereinafter referred to as the CMV enhancer) and a CMV promoter (hereinafter referred to as the CMV promoter).

[0069] In preferred embodiments, a nucleotide sequence comprising a CMV enhancer comprises, consists of, or consists essentially of SEQ ID NO:3, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO:3. In some embodiments, a nucleotide sequence comprising a CMV enhancer comprises, consists of, or consists essentially of SEQ ID NO:3.

[0070] In preferred embodiments, the nucleotide sequence comprising the CMV promoter comprises, consists of, or consists essentially of SEQ ID NO:4, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 4. In some embodiments, the nucleotide sequence comprising the CMV promoter comprises, consists of, or consists essentially of SEQ ID NO:4.

[0071] In preferred embodiments, the nucleotide sequence comprising the chimeric CMV promoter comprises, consists of, or consists essentially of SEQ ID NO:2 or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 2. In some embodiments, the nucleotide sequence comprising the chimeric CMV promoter comprises, consists of, or consists essentially of SEQ ID NO:2.

[0072] As described above, the 5' LTR nucleotides further comprise a nucleotide sequence comprising an RU5 element. This sequence is necessary for reverse transcription of the proviral genome and integration of the proviral genome into transduced cells. In preferred embodiments, the nucleotide sequence comprising the RU5 element comprises, consists of, or consists essentially of SEQ ID NO:5, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO:5. In some embodiments, the nucleotide sequence comprising the RU5 element comprises, consists of, or consists essentially of SEQ ID NO:5.

[0073] In preferred embodiments, the nucleotide sequence comprising the 5' LTR comprises, consists of, or consists essentially of SEQ ID NO: 1 or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 1. In some embodiments, the nucleotide sequence comprising the 5' LTR comprises, consists of, or consists essentially of SEQ ID NO: 1.

[0074] Adjacent to the 5' LTR may be sequences required for reverse transcription of the genome (tRNA primer binding site) and efficient encapsidation of viral RNA into particles (Psi site). Sequences required for encapsidation (or packaging of retroviral RNA into infectious virions) may be deleted from the viral genome; the cis-deletion prevents encapsidation of genomic RNA; however, the resulting mutant form is still capable of directing the synthesis of all virion proteins.

[0075] In one embodiment, downstream of the 5' LTR is a sequence necessary for reverse transcription of the genome, the tRNA primer binding site (hereinafter referred to as PBS or PBS SL23). Thus, in one embodiment, downstream of the 5' LTR nucleotides are primer binding site SL123 nucleotides. In this PBS element, a tRNA is fused to the PBS element during reverse transcription of the proviral genome after target cell transduction and prior to integration into the cellular genome. In preferred embodiments, the nucleotide sequence comprising PBS SL123 comprises, consists of, or consists essentially of SEQ ID NO:6, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:6 over its entire length. In some embodiments, the nucleotide sequence comprising PBS SL123 comprises, consists of, or consists essentially of SEQ ID NO:6.

[0076] In some embodiments, the lentiviral vectors provided herein contain at least a psi (Ψ) packaging signal, also referred to as a psi site, for efficient encapsulation of viral RNA into particles. The psi (Ψ) packaging signal can be located downstream of PBS SL123. In preferred embodiments, the nucleotide sequence containing the psi (Ψ) packaging signal comprises, consists of, or consists essentially of SEQ ID NO:7, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO:7. In some embodiments, the nucleotide sequence containing the psi (Ψ) packaging signal comprises, consists of, or consists essentially of SEQ ID NO:7.

[0077] The lentiviral vectors provided herein may contain a packaging signal (Ψ), as defined above, which is involved in packaging the retroviral genome into a viral capsid. LV vectors were thought to require approximately 300 bp of the Gag gene in this region. Currently, this Gag sequence has been reduced to only 40 bp. Therefore, in one embodiment, the lentiviral vectors provided herein further comprise a nucleotide sequence encoding a truncated Gag protein located downstream of the psi (Ψ) packaging signal.

[0078] In one embodiment, the lentiviral vector provided herein further comprises a Rev response element (hereinafter referred to as RRE) fused to this sequence in the lentiviral vector transcript to assist in nuclear export of the provirus during lentiviral vector production. In one embodiment, the RRE element is located downstream of the psi (Ψ) packaging signal. In a preferred embodiment, the nucleotide sequence comprising the RRE element comprises, consists of, or consists essentially of SEQ ID NO:8 or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO:8. In some embodiments, the nucleotide sequence comprising the RRE element comprises, consists of, or consists essentially of SEQ ID NO:8.

[0079] In one embodiment, the lentiviral vector provided herein further comprises a central polypurine tract (hereinafter referred to as cPPT), which acts as a primer for positive DNA strand transcription during reverse transcription of the lentiviral vector after transduction of target cells. The cPPT also increases the nuclear uptake of proviral DNA and, therefore, the transduction efficiency of the lentiviral vector. Furthermore, the cPPT increases lentiviral vector title. In one embodiment, the cPPT element is located downstream of the RRE element. In a preferred embodiment, the nucleotide sequence comprising the cPPT element comprises, consists of, or consists essentially of SEQ ID NO:9 or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:9 over its entire length. In some embodiments, the nucleotide sequence comprising the RRE element comprises, consists of, or consists essentially of SEQ ID NO:9.

[0080] The backbone elements defined above can be found upstream of the transcription unit (i.e., toward the 5' region of the polynucleotide contained in the lentiviral vector). However, the lentiviral vectors provided herein can also have other backbone elements downstream of the transcription unit (i.e., toward the 3' region of the polynucleotide contained in the lentiviral vector). In one embodiment, the polynucleotide contained in the lentiviral vector provided herein further comprises a 3' LTR and, optionally, a polyadenylation (polyA) signal sequence. The 3' LTR is involved in mRNA polyadenylation during lentiviral vector production. In one embodiment, the integrated viral genome contains a deletion in the viral promoter region (U3), resulting in transcriptional inactivation of the potentially packageable viral genome in transduced cells.

[0081] In one embodiment, the 3' LTR comprises a truncated U3 element. In one embodiment, the 3' LTR comprises elements R and U5 derived from wild-type HIV-1. In one embodiment, the 3' LTR comprises a polyadenylation signal sequence. In a preferred embodiment, the 3' LTR comprises or consists of a truncated U3 element (hereinafter referred to as a ΔU3 element) and elements R and U5 derived from wild-type HIV-1 (hereinafter referred to as an RU5 element).

[0082] In preferred embodiments, the nucleotide sequence comprising the ΔU3 element contained in the 3' LTR nucleotides comprises, consists of, or consists essentially of SEQ ID NO: 15, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 15. In some embodiments, the nucleotide sequence comprising the ΔU3 element comprises, consists of, or consists essentially of SEQ ID NO: 15.

[0083] In preferred embodiments, the nucleotide sequence comprising the RU5 element contained in the 3' LTR nucleotides comprises, consists of, or consists essentially of SEQ ID NO: 16, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO: 16. In some embodiments, the nucleotide sequence comprising the RU5 element comprises, consists of, or consists essentially of SEQ ID NO: 16.

[0084] In one embodiment, downstream of the 3' LTR is an SV40 polyadenylation signal sequence (hereinafter referred to as polyA). In one embodiment, the polyA signal sequence is derived from simian vacuolating virus 40 virus. Preferably, the polyA-containing nucleotide sequence located downstream of the 3' LTR nucleotides comprises, consists of, or consists essentially of SEQ ID NO:33, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO:33. In some embodiments, the polyA-containing nucleotide sequence comprises, consists of, or consists essentially of SEQ ID NO:33.

[0085] In preferred embodiments, the nucleotide sequence comprising the 3' LTR comprises, consists of, or consists essentially of SEQ ID NO: 14, or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 14. In some embodiments, the nucleotide sequence comprising the 3' LTR comprises, consists of, or consists essentially of SEQ ID NO: 14.

[0086] In a further preferred embodiment, the lentiviral vector provided herein comprises a polynucleotide, wherein the polynucleotide comprises, 5' to 3': a) 5' long terminal repeat (5' LTR) containing a chimeric cytomegalovirus promoter; b) primer binding site (PBS); c) the psi (Ψ) packaging signal; d) Rev response element (RRE), e) DNA flap central polypurine tract (cPPT), f) a promoter selected from the group consisting of phosphoglycerate kinase promoter (PGK) or elongation factor alpha truncated promoter (EF1α(s)); g) a nucleotide sequence encoding the RPS19 protein; h) Mutation-optimized woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) i) characterized in that it contains a 3' long terminal repeat (3' LTR), The 5' LTR region and the 3' LTR region are rendered substantially transcriptionally inactive by complete or partial deletions within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

[0087] In a further preferred embodiment, the lentiviral vector provided herein comprises a polynucleotide, wherein the polynucleotide comprises, 5' to 3': a) 5' long terminal repeat (5' LTR) containing a chimeric cytomegalovirus promoter; b) primer binding site (PBS); c) the psi (Ψ) packaging signal; d) Rev response element (RRE), e) DNA flap central polypurine tract (cPPT), f) human phosphoglycerate kinase (PGK) promoter; g) a nucleotide sequence encoding the RPS19 protein; h) Mutation-optimized woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) i) characterized in that it contains a 3' long terminal repeat (3' LTR), The 5' LTR region and the 3' LTR region are rendered substantially transcriptionally inactive by complete or partial deletions within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

[0088] In a further preferred embodiment, the lentiviral vector provided herein comprises a polynucleotide, wherein the polynucleotide comprises, 5' to 3': a) 5' long terminal repeat (5' LTR) containing a chimeric cytomegalovirus promoter; b) primer binding site (PBS); c) the psi (Ψ) packaging signal; d) Rev response element (RRE), e) DNA flap central polypurine tract (cPPT), f) human phosphoglycerate kinase (PGK) promoter; g) a nucleotide sequence encoding the RPS19 protein; h) Mutation-optimized woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) i) the 3' long terminal repeat (3' LTR), and j) characterized by containing a polyadenylation (polyA) signal sequence; The 5' LTR region and the 3' LTR region are rendered substantially transcriptionally inactive by complete or partial deletions within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

[0089] In a further preferred embodiment, the lentiviral vector provided herein comprises a polynucleotide, wherein the polynucleotide comprises, 5' to 3': a) a 5' long terminal repeat (5' LTR) comprising a chimeric cytomegalovirus promoter, wherein the 5' LTR has at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 1; b) a primer binding site (PBS) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 6; c) a psi (Ψ) packaging signal having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 7; d) a Rev response element (RRE) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 8; e) a DNA flap central polypurine tract (cPPT) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 9; f) a human phosphoglycerate kinase (PGK) promoter having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 10; g) a nucleotide sequence encoding an RPS19 protein, preferably a codon-optimized nucleotide sequence encoding a CoRPS19 protein, having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 12. h) a mutation-optimized woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 13; and i) comprising a 3' long terminal repeat (3' LTR) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 14; The 5' LTR region and the 3' LTR region are rendered substantially transcriptionally inactive by complete or partial deletions within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

[0090] In a further preferred embodiment, the lentiviral vector provided herein comprises a polynucleotide, wherein the polynucleotide comprises, 5' to 3': a) a 5' long terminal repeat (5' LTR) comprising a chimeric cytomegalovirus promoter, wherein the 5' LTR has at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 1; b) a primer binding site (PBS) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 6; c) a psi packaging signal having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 7; d) a Rev response element (RRE) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 8; e) a DNA flap central polypurine tract (cPPT) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 9; f) a human phosphoglycerate kinase (PGK) promoter having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 10; g) a nucleotide sequence encoding an RPS19 protein, preferably a codon-optimized nucleotide sequence encoding a CoRPS19 protein, having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 12. h) a mutation-optimized woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 13; i) a 3' long terminal repeat (3' LTR) having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length to SEQ ID NO: 14; and j) comprising a polyadenylation (polyA) signal sequence having at least 95%, preferably 98%, and most preferably 100% sequence identity over its entire length with SEQ ID NO: 33; The 5' LTR region and the 3' LTR region are rendered substantially transcriptionally inactive by complete or partial deletions within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

[0091] Additionally, as will be appreciated by those skilled in the art, the polynucleotide cassette may optionally contain other elements, including, but not limited to, restriction sites to facilitate cloning of a particular gene expression vector, and regulatory elements of a particular gene expression vector.

[0092] In preferred embodiments, the full-length polynucleotide comprised in the lentiviral vectors provided herein comprises, consists of, or consists essentially of SEQ ID NO: 17 (also referred to herein as the PGK.CoRPS19.Wpre*-LV sequence), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 17. In preferred embodiments, the full-length polynucleotide comprised in the lentiviral vectors provided herein comprises, consists of, or consists essentially of SEQ ID NO: 17.

[0093] In preferred embodiments, the full-length polynucleotide comprised in the lentiviral vectors provided herein comprises, consists of, or consists essentially of SEQ ID NO: 18 (herein, the EF1α(s).CoRPS19.Wpre*-LV sequence), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length to SEQ ID NO: 18. In preferred embodiments, the full-length polynucleotide comprised in the lentiviral vectors provided herein comprises, consists of, or consists essentially of SEQ ID NO: 18.

[0094] In one embodiment, the lipid coat of the viral particle can comprise membrane-associated polypeptides that were previously present on the surface of the host cell.

[0095] In one embodiment, a lentiviral vector according to the invention, or any of its embodiments, is used to transduce human hematopoietic stem cells (HSCs) that can be subsequently transplanted into a human with DBA. Thus, in a second aspect, the present invention provides a method for the transduction of host cells (e.g., CD34 HSCs) comprising a lentiviral vector as defined in the first aspect, or any of its embodiments. + hematopoietic cells) or populations of cells (e.g., transduced).

[0096] In other embodiments, the cells are cells delivered to a subject to provide the subject with a gene product encoded by the lentiviral vector of the first aspect, or any of its embodiments. In one embodiment, the genome of one or more host cells comprises, in whole or in part, the polynucleotide contained in the lentiviral vector of the first aspect, or any of its embodiments. In one embodiment, the genome of one or more host cells comprises at least a transcription unit as defined above. In one embodiment, one or more host cells comprise, in their genome, in whole or in part, the polynucleotide of the lentiviral vector according to the first aspect, or any of its embodiments. In certain embodiments, the cells are autologous to the subject to be treated or obtained from the subject to be treated. In other embodiments, the cells are allogeneic to the subject to be treated or obtained from a donor other than the subject to be treated. In certain embodiments, the cells are mammalian cells, e.g., human cells. In certain embodiments, the cells are CD34 cells obtained from the subject to be treated with the cells after the cells have been transduced with a gene delivery vector disclosed herein. + In certain embodiments, the cells are CD34 cells obtained from a subject diagnosed with DBA. + It is a cell.

[0097] In a preferred embodiment, the cells are CD34 + Hematopoietic stem cells and CD34 + In a preferred embodiment, the cells are enriched in hematopoietic progenitor cells. + Hematopoietic stem cells and CD34 + Hematopoietic progenitor cell-enriched means that at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 92%, 94%, 96%, 98% or 100% of the cells are CD34 + In one embodiment of the second aspect, the host cell or cell population is CD34 + Contains hematopoietic cell-enriched populations or CD34 + In one embodiment, the hematopoietic cell-enriched population comprises CD34 + Hematopoietic stem cells and CD34+ The population enriched for hematopoietic progenitor cells comprises within their genome a lentiviral vector according to the first aspect, or any of its embodiments.

[0098] In another embodiment, the host cell can also be a packaging cell in which the LV rep gene and the LV cap gene are stably maintained in the host cell or producer cell in which the LV vector genome is stably maintained and packaged. Exemplary packaging and producer cells are derived from SF-9 cells, 293 cells, A549 cells, or HeLa cells. LV vectors are purified and formulated using standard techniques known in the art. In another embodiment, one or more host cells are used to produce viral gene delivery vectors.

[0099] In certain embodiments, the cell is a mammalian cell, e.g., a human cell. In some embodiments, the cell is a blood cell. In some embodiments, the cell is an erythroid cell. In some embodiments, the cell is a bone marrow cell, e.g., a lineage-depleted bone marrow cell. In certain embodiments, the cell is a hematopoietic stem cell or a CD34 + In some embodiments, the cells are hematopoietic stem cells. In some embodiments, the preferred cells are CD34 + In some embodiments, the preferred cells are committed hematopoietic erythroid progenitor cells. In one embodiment of the second aspect, the host cell or cell population is CD34 + Hematopoietic stem cells and CD34 + In some embodiments, the cells are hematopoietic stem cells, long-term hematopoietic stem cells, short-term hematopoietic stem cells, multipotent progenitor cells, hematopoietic CD34 + cells, and CD34 + In one embodiment, the CD34 +The cells are obtained or harvested from a bone marrow sample. In some embodiments, the bone marrow sample is CD16 + In another embodiment, the HSCs are obtained from peripheral blood. In one embodiment, the peripheral blood sample is depleted of red blood cells. In some embodiments, the blood sample is depleted of CD16 + Depletes white blood cells. CD34 + The method of cell selection can be positive selection, negative selection, or any combination thereof. In some embodiments, selection is performed using these markers, separately or in combination, i.e., CD34 + , CD59 + , CD90 / Thy1 + , CD38 low / - , c-Kit - / low , CD16 + and Lin - In certain embodiments, preferred cells are those derived from a subject to be treated with cells after the cells have been transduced with a gene delivery vector disclosed herein. + In certain embodiments, the cells are CD34 cells obtained from a subject diagnosed with DBA. + In another embodiment, the host cell or cells may be derived from an established cell line or may be primary cells, and "primary cells," "primary cell line," and "primary culture" are used interchangeably herein to refer to cells and cell cultures derived from a subject and grown in vitro for a limited or unlimited number of passages, i.e., culture division. For example, a primary culture may have been passaged 0, 1, 2, 4, 5, 10, or 15 times, but does not undergo a crisis stage a sufficient number of times. Typically, the primary cell line of the present invention is maintained in vitro for less than 10 passages. Embodiments of the present invention involve mammalian cells (e.g., CD34) transduced with a viral delivery vector, e.g., an LV vector containing the human RPS19 gene, preferably CoRPS19, preferably under the control of the human PGK promoter. + cells).

[0100] In certain embodiments, when cells are transduced with a vector disclosed herein, the cells are contacted with the vector for about 30 minutes, about 1 hour, about 1.5 hours, about 2 hours, about 2.5 hours, about 3 hours, about 3.5 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 2 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 8 hours, or about 60 hours. In some embodiments, the cells are transduced for less than 60 hours, less than 48 hours, less than 36 hours, or less than 24 hours.

[0101] In a third aspect, the present invention relates to an isolated nucleic acid comprising a polynucleotide comprised in a lentiviral vector as defined in the first aspect, or any of its embodiments.

[0102] Pharmaceutical Composition In a fourth aspect, the present invention provides a pharmaceutical composition comprising a lentiviral vector as defined in the first aspect or any of its embodiments, a host cell or cell population according to the second aspect or any of its embodiments, and / or a polynucleotide as defined in the third aspect or any of its embodiments, and a pharmaceutically acceptable carrier or diluent. Preferably, the pharmaceutical composition comprises a CD34 transduced by a lentiviral vector according to the first aspect or any of its embodiments. + Hematopoietic stem cells and CD34 + It comprises or consists of a population of cells enriched for hematopoietic progenitor cells and a pharmaceutically acceptable carrier or diluent.

[0103] In some embodiments, the host cell or cell population according to the second aspect, or any of its embodiments, or the pharmaceutical composition of the fourth aspect, or any of its embodiments, is contacted with or transduced by a lentiviral vector according to the first aspect, or any of its embodiments, either in vivo, in vitro or ex vivo. Preferably, administration of the lentiviral vector is ex vivo.

[0104] The pharmaceutical compositions described herein may also contain other substances. These substances include, but are not limited to, cryoprotectants, lyoprotectants, surfactants, bulking agents, antioxidants, and stabilizers. In some embodiments, the pharmaceutical compositions may be lyophilized. In a preferred embodiment, the pharmaceutical composition comprises saline.

[0105] The term "cryoprotectant" as used herein includes agents that provide lentiviral vector stability against freezing-induced stress by being preferentially excluded from the surface of the lentiviral vector. Cryoprotectants can also provide protection during primary and secondary drying and long-term product storage. Non-limiting examples of cryoprotectants include sugars such as sucrose, glucose, trehalose, mannitol, mannose, and lactose; polymers such as dextran, hydroxyethyl starch, and polyethylene glycol; surfactants such as polysorbates (e.g., PS-20 or PS-80); and amino acids such as glycine, arginine, leucine, and serine. Cryoprotectants that exhibit low toxicity in biological systems are generally used.

[0106] In one embodiment, a lyoprotectant is added to the pharmaceutical composition described herein. As used herein, the term "lyoprotectant" includes an agent that provides stability to the lentiviral vector during the lyophilization or dehydration process (primary and secondary lyophilization cycles) by providing an amorphous glassy matrix, binding to the surface of the lentiviral vector through hydrogen bonds, and replacing the water molecules removed during the drying process. This helps minimize product degradation during the lyophilization cycle and improve long-term product stability. Non-limiting examples of lyoprotectants include sugars such as sucrose or trehalose; amino acids such as monosodium glutamate, amorphous glycine or amorphous histidine; methylamines such as betaine; lyotropic salts such as magnesium sulfate; polyols such as trihydric or higher sugar alcohols, for example, glycerin, erythritol, glycerol, arabitol, xylitol, sorbitol, and mannitol; propylene glycol; polyethylene glycol; Pluronic®; and combinations thereof. The amount of lyoprotectant added to a pharmaceutical composition is generally an amount that does not result in an unacceptable amount of system degradation when the pharmaceutical composition is lyophilized.

[0107] In some embodiments, a bulking agent is included in the pharmaceutical composition. As used herein, the term "bulking agent" includes agents that provide structure to the lyophilized product without directly interacting with the pharmaceutical agent. In addition to providing a pharmaceutically refined cake, bulking agents can also impart useful qualities such as modifying the collapse temperature, providing freeze-thaw protection, and improving system stability over long-term storage. Non-limiting examples of bulking agents include mannitol, glycine, lactose, and sucrose. Bulking agents can be crystalline (such as glycine, mannitol, or sodium chloride) or amorphous (such as dextran, hydroxyethyl starch), and are generally used in formulations in amounts of 0.5% to 10%.

[0108] Other pharmaceutically acceptable carriers, excipients, or stabilizers, such as those described in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980), may be included in the pharmaceutical compositions described herein, as long as they do not adversely affect the desired properties of the pharmaceutical composition. As used herein, "pharmaceutically acceptable carrier" refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and may include additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents, e.g., EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, e.g., polyesters; salt-forming counterions, e.g., sodium; polyhydric sugar alcohols; amino acids, e.g., alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, e.g., lauryl glucosides; These include sucrose, stachyose, mannose, sorbose, xylose, ribose, ribitol, myo-initose, myo-inititol, galactose, galactitol, glycerol, cyclitols (e.g., inositol), polyethylene glycol; sulfur-containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, [alpha]-monothioglycerol, and sodium thiosulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone.

[0109] The pharmaceutical composition may be prepared for oral, sublingual, buccal, intravenous, intramuscular, subcutaneous, intraperitoneal, conjunctival, rectal, transdermal, intrathecal, topical, and / or inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be a solution suitable for intravenous, intramuscular, conjunctival, transdermal, intraperitoneal, and / or subcutaneous administration. In another embodiment, the pharmaceutical composition may be a solution suitable for sublingual, buccal, and / or inhalation-mediated administration routes. In an alternative embodiment, the pharmaceutical composition may be a gel or solution suitable for intrathecal administration. In an alternative embodiment, the pharmaceutical composition may be an aerosol suitable for inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be prepared for intrathecal administration.

[0110] Pharmaceutical compositions may further contain common excipients and carriers known in the art. For solid pharmaceutical compositions, conventional non-toxic solid carriers may be used, including, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like. For injectable solutions, pharmaceutical compositions may further contain cryoprotectants, lyoprotectants, surfactants, bulking agents, antioxidants, stabilizers, and pharmaceutically acceptable carriers. For aerosol administration, pharmaceutical compositions are generally supplied in finely divided form along with surfactants and propellants. The surfactants must, of course, be non-toxic and generally soluble in the propellant. Representative of such agents are esters or partial esters of fatty acids containing 6 to 22 carbon atoms, such as caproic acid, octanoic acid, lauric acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, olesteric acid, and oleic acid, with aliphatic polyhydric alcohols or their cyclic anhydrides. Mixed esters, such as mixed glycerides or natural glycerides, can also be used.If desired, carriers can also be included, such as lecithin for intranasal delivery.For suppositories, conventional binders and carriers can include, for example, polyalkalene glycol or triglycerides.In a preferred embodiment, the carrier is nanoparticles.In a more preferred embodiment, nanoparticles act as a vehicle for introducing the polynucleotide contained in the lentiviral vector of the present invention into cells.

[0111] Thus, pharmaceutical compositions suitable for injection may include buffers (e.g., acetate, phosphate, or citrate buffers), surfactants (e.g., polysorbate), and optionally stabilizers (e.g., human albumin), although in other embodiments consistent with the teachings herein, lentiviral vectors may be delivered directly to the site of harmful cell populations, i.e., hepatocytes, thereby increasing the exposure of diseased tissue to the therapeutic agent.

[0112] The lentiviral vectors provided herein can optionally be administered in combination with other agents (e.g., prophylactic or therapeutic) effective to treat the disorder or condition in need of treatment. Administration of the lentiviral vectors provided herein in conjunction with or in combination with adjunctive therapy refers to sequential, simultaneous, coextensive, concurrent, concomitant, or simultaneous administration or application of the therapy and the disclosed polypeptide.

[0113] Medical Use and Schedule, Route and Dosage of Administration In a fifth aspect, the present invention provides a lentiviral vector according to the first aspect or any of its embodiments, a host cell or cell population according to the second aspect or any of its embodiments, an isolated nucleic acid according to the third aspect or any of its embodiments, or a pharmaceutical composition according to the fourth aspect or any of its embodiments, for use as a medicament. In a sixth aspect, the present invention provides a lentiviral vector according to the first aspect or any of its embodiments, a host cell or cell population according to the second aspect or any of its embodiments, an isolated nucleic acid according to the third aspect or any of its embodiments, or a pharmaceutical composition according to the fourth aspect or any of its embodiments, for use in the treatment of Diamond-Blackfan anemia (DBA), the use comprising administering said lentiviral vector, said host cell or cell population, or said composition to a subject. In a preferred embodiment, a lentiviral vector containing a nucleotide sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity over its entire length to SEQ ID NO: 17 is used to treat Diamond-Blackfan anemia (DBA). Accordingly, the methods and compositions of the present disclosure are used, for example, to treat Diamond-Blackfan anemia.

[0114] The present invention also provides a method for treating, preventing, or ameliorating DBA disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a lentiviral vector according to the first aspect or any of its embodiments, a host cell or cell population according to the second aspect or any of its embodiments, an isolated nucleic acid according to the third aspect or any of its embodiments, or a pharmaceutical composition according to the fourth aspect or any of its embodiments. In certain embodiments, the method is used to treat DBA, and the viral vector is an LV comprising an expression construct disclosed herein comprising a human PGK promoter operably linked to an RPS19 gene cDNA or coding sequence, and a mutant Wpre as disclosed herein.

[0115] In another embodiment, administration of a lentiviral vector, host cell or cell population, or composition provided herein does not induce an immune response in the subject, or induces a very low immune response in said subject.

[0116] In some embodiments, the lentiviral vector, host cell or cell population or composition of the present invention is administered as a single dose or multiple doses.In some embodiments, the dose of the lentiviral vector, host cell or cell population or composition of the present invention is administered at once or divided into multiple subdoses, for example, 2 subdoses, 3 subdoses, 4 subdoses, 5 subdoses, 6 subdoses or more than 6 subdoses.In some embodiments, multiple lentiviral vectors are administered.Most preferably, the lentiviral vector, host cell or cell population or composition of the present invention is administered as a single dose.

[0117] In some embodiments, the dose of the lentiviral vector of the invention, the host cell or cell population of the invention, or the pharmaceutical composition is administered repeatedly at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times.

[0118] The lentiviral vector, the host cell or cell population, or the pharmaceutical composition of the present invention can be administered locally or systemically. In one embodiment, the administration route of the lentiviral vector is parenteral. As used herein, the term parenteral includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, or intravaginal administration. In one embodiment, the lentiviral vector can be administered intravenously, subcutaneously, intramuscularly, or via any mucosal surface, for example, orally, sublingually, bucally, nasally, rectally, or intravaginally, or via the pulmonary route. Intravenous parenteral administration is preferred. In one embodiment, the administration form is a solution for injection, particularly intravenous or intraarterial injection, or infusion.

[0119] The effective dose of the compositions provided herein for treating DBA varies depending on many different factors, including the means of administration, the target site, the physiological condition of the subject, whether the subject is human or animal, other drugs administered, and whether the treatment is prophylactic or therapeutic. Typically, the subject is human, but non-human mammals, including transgenic mammals, can also be treated. Treatment dosages can be titrated using routine methods known to those skilled in the art to optimize safety and efficacy. In one embodiment, the subject includes, but is not limited to, an individual with DBA. In some embodiments, the subject is a pediatric subject, while in other aspects, the subject is an adult subject.

[0120] The lentiviral vector, host cell or cell population, or pharmaceutical composition of the present invention can be administered continuously or at specific time intervals. The interval between single administrations can be daily, weekly, monthly, or yearly. The interval can also be irregular depending on the onset of disease or the therapeutic effect of the lentiviral vector. The transduced cells can be infused immediately after the transduction process is completed. Effective doses and / or dose regimens can be easily determined empirically from preclinical assays, safety studies, escalation and dose-ranging studies, and the relationship between individual clinicians and patients. In vitro or in vivo assays can be used to determine optimal dose ranges and / or schedules for administration. Furthermore, effective doses can be extrapolated from dose-response curves obtained from animal models.

[0121] In a preferred embodiment, the lentiviral vector of the invention, the host cell or cell population of the invention, or the pharmaceutical composition contains at least 1 x 10 9 Vector genomes / kg body weight, preferably 1 x 10 10 , 1×10 11 or 1×10 12 More preferably, the dose is at least about 4.6 x 10 vector genomes / Kg body weight. 12 Vector genomes / Kg body weight administered.

[0122] Typically, an effective dose to achieve change in DBA patients is about 1 x 10 8 vector genome or more, possibly 1 × 10 9 , 1×10 10 , 1×10 11 , 1×10 12 or 1×10 13 vector genome or more, in certain cases 1 × 10 14 In some cases, the amount of vector genome delivered is up to about 1 x 10 15 Vector genome, e.g., 1 x 10 14 Vector genome or less, e.g., 1 x 10 13 , 1×10 12 , 1×10 11 , 1×1010 or 1×10 9 vector genome, in certain cases 1 × 10 8 Vector genome, typically 1 x 10 8 In some cases, the amount of vector genome delivered is 1×10 or more. 10 ~1×10 11 In some cases, the amount of vector genome delivered is 1×10 10 ~3×10 12 In some cases, the amount of vector genome delivered is 1×10 9 ~3×10 13 In some cases, the amount of vector genome delivered is 1×10 8 ~3×10 14 It is a vector genome.

[0123] In one embodiment, the lentiviral vector is 8 Vector genomes / ml or more, e.g., 5 x 10 8 Vector genomes / mL: 10 9 Vector genomes / mL: 5 × 10 9 Vector genomes / mL, 10 10 Vector genomes / mL, 5 × 10 10 Vector genomes / mL: 10 11 Vector genomes / mL: 5 × 10 11 Vector genomes / mL: 10 12 Vector genomes / mL: 5 × 10 12 Vector genomes / mL: 10 13 Vector genomes / mL: 1.5 × 10 13 Vector genomes / mL: 3 × 10 13 Vector genomes / mL: 5 × 10 13 Vector genomes / mL: 7.5 × 10 13 Vector genomes / mL: 9 × 10 13 Vector genomes / mL: 1 × 10 14 Vector genomes / mL, 5 × 10 14 vector genomes / mL or more, but typically 1 x 10 15It can be administered at a concentration of 0.01 vector genomes / mL or less.

[0124] In some cases, the lentiviral vector of the present invention, the host cell or cell population of the present invention, or the pharmaceutical composition to be administered can be measured using the multiplicity of infection (MOI).In some cases, MOI can refer to the ratio or multiple of the vector or viral genome to the cells to which the nucleic acid can be delivered.In some cases, MOI is 1 x 10 6 In some cases, the MOI can be 1 x 10 5 ~1×10 7 In some cases, the MOI can be 1 x 10 4 ~1×10 8 In some cases, the recombinant virus of the present disclosure may be at least about 1 x 10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 15 , 1×10 16 , 1×10 17 and 1 × 10 18 In some embodiments, the range is from about 20 to about 400 MOI. In some cases, the recombinant viruses of the present disclosure are administered at a dose of 1 x 10 8 ~3×10 14 In some cases, the recombinant viruses of the present disclosure are administered at an MOI of up to about 1 x 10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×1011 , 1×10 12 , 1×10 13 In some embodiments, the dose of cells that a patient receives by infusion is the dose resulting from the transduction process. In various preferred embodiments, the dose is at least about 1 x 10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 or more CD34 + In some embodiments, 1 x 10 cells / kg patient weight are infused into the patient. 6 ~4×10 6 CD34 + In another embodiment, 3 x 10 cells / kg patient weight are infused into the patient. 5 and 4 × 10 6 CD34 + Cells / KG patient weight are infused into the patient.

[0125] In some embodiments, the amount of the pharmaceutical composition is about 1×10 8 ~Approx. 1×10 15 recombinant virus, approximately 1 x 10 9 ~Approx. 1×10 14 recombinant virus, approximately 1 x 10 10 ~Approx. 1×10 13 recombinant virus, or approximately 1 x 10 11 ~Approx. 3×10 12 The recombinant virus comprises:

[0126] Doses intermediate to the above ranges are also intended to be within the scope of the present invention.

[0127] To achieve successful gene therapy for DBA, it is beneficial to harvest a "sufficient" number of hematopoietic stem cells (HSCs) from a subject. In some embodiments of the present invention, HSCs are obtained from a subject after mobilization. Mobilization can be achieved by treating the subject with a drug or compound that causes stem cells to migrate from the bone marrow to the blood. The stem cells can be harvested and stored. In some embodiments, mobilization is achieved by treating the subject with G-CSF (filgrastin). In other embodiments, mobilization is achieved by treating the subject with plerixafor. In yet other embodiments, mobilization is achieved by treating the subject with a combination of filgrastim and plerixafor.

[0128] The dosage and frequency of administration of the lentiviral vector of the present invention, the host cell or cell population of the present invention, or pharmaceutical composition can vary depending on whether treatment is preventive or therapeutic.In preventive application, the composition containing the lentiviral vector provided herein is administered to a subject who is not yet in a disease state, in order to enhance the subject's resistance or minimize the impact of disease.This amount is defined as a "prophylactically effective dose".A relatively low dosage is administered at relatively infrequent intervals over a long period of time.Some subjects can continue to receive treatment for the rest of their lives.

[0129] In some embodiments, methods are provided for contacting cells with a lentivirus, polynucleotide, or composition according to the present invention. As described above, contacting can be performed in vitro, in vivo, or ex vivo. Furthermore, the present invention includes methods for transducing mammalian cells, such as human hematopoietic stem cells, or other cells described herein, comprising contacting the cells with a gene delivery vector, e.g., an LV vector comprising a transcription unit disclosed or described herein. In certain embodiments, the cells are previously obtained from the subject to be treated or from another donor. In certain embodiments, the subject is diagnosed with DBA, and the cells are transduced with an LV comprising an expression cassette encoding the human RPS19 gene or human RPS19 cDNA. It is understood that the disclosed methods, e.g., methods used to deliver an RPS19 gene product to a subject using an RPS19 cDNA sequence, can also be used to treat DBA. In certain embodiments, the transduced cells are a population of cells obtained from a subject with DBA that are transduced and then treated with the cells. The cells may be obtained from bone marrow or blood. In certain embodiments, a subject with DBA is treated with an agent to mobilize stem cells, and then blood is drawn from the subject, red blood cells are removed, and CD34 + The cells are selected. After selection, the cells are transduced. In certain embodiments, the transduced cells are stored or frozen before use, but in certain embodiments, they are provided to a subject immediately after transduction or shortly thereafter, for example, within 1 hour, 2 hours, or 4 hours.

[0130] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered exemplary only, with a true scope and spirit of the invention being indicated by the appended claims.

[0131] example Example 1 - Materials and Methods 1. Lentiviral Vector Construction Two therapeutic lentiviral vectors suitable for clinical use in patients with RPS19 haploinsufficiency have been developed. These two vectors contain codon-optimized versions of the human RPS19 gene (mutated in 25% of DBA patients). In these LVs, RPS19 expression is driven by the human phosphoglycerate kinase promoter (PGK) in PGK.CoRPS19.Wpre* LVs or by a truncated version of the human elongation factor-1 alpha promoter (EF-1 alpha truncated or EF1α(s)) in EF1α(s).CoRPS19.Wpre* LVs. Furthermore, both vectors contain a mutated Wpre sequence (Wpre*) that increases production of the protein of interest by stabilizing its mRNA (see Figure 1).

[0132] The reason for choosing two different promoters was the strength with which they could drive the expression of the transgene of interest. On the one hand, we have the PGK promoter, which shows stable expression of the gene of interest. Second, we chose the EF1α promoter because of its greater activity.

[0133] These vectors are self-inactivating lentiviral vectors. They were created from a lentiviral vector developed in our laboratory that contained a codon-optimized version of the PKLR gene. They were developed from the vector pCCL.sin.ppt.hPGK.EGFPY.Wpre*, constructed and provided by Dr. Naldini's laboratory (HSRTIGET, San Raffaele Telethon Institute or Gene Therapy and Vita Salute San Raffaele University Medical School, Milano, Italy). This vector contained a phosphoglycerate kinase (PGK) promoter. The first step in developing the PGK.CoRPS19.Wpre* therapeutic vector consisted of extracting the PKLR gene and introducing an optimized version of the RPS19 gene into the target transgene sequence using the restriction targets XbaI and SalI, which were introduced by chemical synthesis during the design process.

[0134] The second therapeutic lentiviral vector (EF1α(s).CoRPS19.Wpre*LV) carries the human elongation factor alpha (EF1α for elongation factor 1 alpha) promoter in its shortened version (EF1α(s)) as its distinct element. To replace the PGK promoter with EF1α(s), the EF1α(s) sequence was amplified by PCR using p'HR.EF1αS.eGFP.Wpre (provided by Dr. Adrian Trasher's laboratory; UCL Great Ormond Street Institute of Child Health) as the template vector. To introduce EcoRV and SalI restriction enzyme sequence targets into the sequence obtained using the EF1α(s) promoter, the oligos used included these sequence targets along with two nucleotide bases (EcoRV-AT and -TC-SalI) at the 3' and 5' ends. The resulting fragments were isolated and cloned using the Zero Blunt® TOPO® Cloning Kit system. After cloning the EF1α(s) promoter, it was isolated using EcoRV and SalI restriction enzyme targets and cloned by pre-extracting the PGK promoter from the backbone of the first therapeutic vector, thus generating the second therapeutic lentiviral vector EF1α(s).CoRPS19.Wpre*.

[0135] Thus, in one aspect of the present invention, autologous CD34 transduced by a self-inactivating lentiviral vector containing the codon-optimized RPS19 gene (CoRPS19) is used. + A gene therapy approach to treat DBA consisting of α-enriched cells is proposed.

[0136] 1) Self-inactivating lentiviral vectors (SIN-LVs) provide more robust expression and are less susceptible to transcriptional silencing than gammaretroviral vectors (Pfeifer et al. 2002). They also exhibit a much safer integration profile (Mitchell et al. 2004; Schroder et al. 2002; Wu et al. 2003). Due to a 400-base pair (bp) deletion in their 3' LTR sequence (Miyoshi et al. 1998), transgene expression is regulated by an internal promoter, enhancing the safety of LV-based gene modification.

[0137] 2) The vector sequence also contains several modifications to improve transgene expression and safety in target cells: Use of the human phosphoglycerate kinase (PGK) promoter, already characterized by its stable, long-term expression in vivo after reinfusion of gene-corrected HSCs into patients and an improved safety profile compared to other promoters used in gene therapy (Biffi et al. 2013; Modlich et al. 2009; Montini et al. 2006). PGK results in more physiological expression of the transgene and a lower susceptibility to transcriptional silencing (Garcon et al. 2013; Zychlinski et al. 2008).

[0138] A codon-optimized version of the nucleotide sequence encoding the RPS19 protein (CoRPS19) to increase mRNA stability during transcription. For optimization, GeneScript® software was used to increase the GC content and remove cryptic splice sites to avoid transcriptional silencing and thus increase transgene expression. The CoRPS19-optimized sequence showed 81% homology with the human RPS19 gene, with no changes in the amino acid sequence of the protein. To improve the expression level and stability of the therapeutic gene, a mutated post-transcriptional regulatory element of woodchuck hepatitis virus (Wpre*) that lacks any residual open reading frame is also included.

[0139] 1.1 Arrays: 1.1.1 Element array 5' LTR or long terminal repeat (SEQ ID NO: 1): Responsible for proviral transcription during lentiviral vector production. In this lentiviral vector construct, the 5' LTR is composed of a chimeric form of the CMV promoter and a portion of the wild-type HIV-1 5' LTR, RU5. The absence of the U3 sequence in the wild-type 5' LTR means that this lentiviral vector construct is Tat-independent and therefore produced at the third generation.

number

[0140] Chimeric CMV promoter (SEQ ID NO: 2): This sequence drives proviral transcription during lentiviral vector production. It consists of two distinct sequences, one with enhancer activity and the other with promoter activity.

number

number

number

number

[0141] PBS SL123 (primer binding site) (SEQ ID NO: 6): tRNA is fused to the PBS element during reverse transcription of the proviral genome after target cell transduction and before integration into the cellular genome.

number

[0142] Ψ (packaging signal) (SEQ ID NO: 7): This element is responsible for dimerization and packaging of the lentiviral vector particle.

number

[0143] RRE (Rev response element) (SEQ ID NO: 8): Rev is fused to this sequence within the lentiviral vector transcript to aid in the nuclear export of the provirus during lentiviral vector production.

number

[0144] cPPT (central polypurine tract) (SEQ ID NO: 9): This element acts as a primer for the transcription of the positive DNA strand during reverse transcription of the lentiviral vector after transduction of the target cell. This also increases the nuclear uptake of proviral DNA and therefore the transduction efficiency of the lentiviral vector. Furthermore, cPPT increases the lentiviral vector title.

number

[0145] 1.1.2. Eukaryotic internal promoters (either one or another): Phosphoglycerate kinase promoter (PGK) (SEQ ID NO: 10):

number

[0146] The elongation factor 1 alpha promoter (EF1α(s)) in its shortened version (SEQ ID NO: 11):

number

[0147] Codon-optimized version of RPS19 (CoRPS19) (SEQ ID NO: 12):

number

[0148] Mutant Wpre (WHV (woodchuck hepatitis virus) post-transcriptional regulatory element) (Wpre*) (SEQ ID NO: 13): Increases transgene expression in transduced cells by improving polyadenylation, RNA export from the nucleus, and protein synthesis. It contains a mutation in the gene X frame for increased safety.

number

[0149] 3' LTR: DR3RU5 (SEQ ID NO: 14): The 3' LTR is involved in mRNA polyadenylation during lentiviral vector production. In this case, the 3' LTR is composed of a truncated U3 element and elements R and U5 from wild-type HIV-1, resulting in a self-inactivating lentiviral vector. The integrated viral genome contains a deletion in the viral promoter region (U3), resulting in transcriptional inactivation of the potentially packageable viral genome in transduced cells.

number

number

number

[0150] SV40 polyadenylation (polyA) signal sequence (SEQ ID NO: 33):

number

[0151] 1.1.3 All FASTA vector sequences A) PGK.CoRPS19.Wpre*-LV sequence (SEQ ID NO: 17):

number

number

number

number

number

number

number

number

number

[0152] 2. Lentivirus production Lentiviruses were produced using third-generation HEK293T packaging cells. Production was performed in 150 mm dishes (p150, Corning) at 60-70% cell confluence, transfected with the required plasmids using CaCl2 DNA precipitation.

[0153] The plasmids used were kindly provided by Dr. L. Naldini (HSR-TIGET, Milan, Italy) and produced by the Plasmid Factory. The plasmids used were the transfer plasmid (transgene of interest; 37 μg / p150), the rev plasmid (pRSV-REV; 9 μg / p150), the gag and pol plasmids (pMDLg / pRRE; 23.5 μg / p150), and the VSV envelope plasmid (pMD2-VSVG; 12.3 μg / p150). The plasmids were mixed with 457 μl / p150 of 2.5 M CaCl2 and 3.2 ml / p150 of water. Afterwards, 3.6 ml / p150 of HBS 2x (281 mM NaCl, 100 mM HEPES, 1.5 mM Na2HPO4, pH 7) was added dropwise to the mixture to generate a Ca2+ / DNA-precipitate, and this solution was added to the HEK293T cell culture.

[0154] After 5–6 hours, the medium was removed and fresh recovery medium (IMDM supplemented with 5% HyClone) was added. The supernatant was collected 48 hours posttransfection, centrifuged (450 g, 7 min), and filtered (0.22 μm, PES, Merck) to remove cellular debris. The supernatant was concentrated by ultracentrifugation (70,000 g, 2 h, 20°C; Optima L-100 XP Ultracentrifuge, Beckman-Coulter) using Ultra-clear tubes (Beckman-Coulter). The virus pellet was reconstituted with 100–300 μL of saline (NaCl 0.9%). Virus was titrated by serial dilutions (10–2–10–6) of the vector on HEK293T cells (150–180,000 cells / well in a 24-well plate; FALCON). For GFP-labeled vectors, transducing units (TU) were calculated based on flow cytometry measurements 48–72 h post-transduction by applying the following formula:

[0155] 3. Lentiviral Vector Titration PGK-CoRPS19 LV titration was performed on HEK293T cells. For LV titration, 5 × 10 4 Cells were seeded in 24-well plates. 24 hours after seeding, cells were transduced with serial dilutions of LV in culture medium, and cell numbers on day 0 were determined. 14 days after transduction, cells were harvested, and genomic DNA (gDNA) was extracted using a NucleoSpin® Tissue Kit (Macherey Nagel®) according to the manufacturer's instructions.

[0156] The number of lentiviral vector genomes (VCN) integrated into transduced cells was determined by qPCR. To analyze the copies of the lentiviral vector genome, primers ((SEQ ID NO: 19) Fw: 5'-CAGGACTCGGCTTGCTGAAG-3'; (SEQ ID NO: 20) Rv: 5'-TCCCCCGCTTAATACTGACG-3') and probe ((SEQ ID NO: 21) 5'-CGCACGGCAAGAGGCGAGG-3') (Taqman®, Thermo Fisher Scientific) designed against the ψ sequence of the lentiviral vector were used. To determine the amount of endogenous DNA, primers ((SEQ ID NO: 22) Fw: 5'-GCTGTCATCTCTTGTGGGCTG-3'; (SEQ ID NO: 23) Rv: 5'-ACTCATGGGAGCTGCTGGTTC-3') and probe ((SEQ ID NO: 24) 5'-CCTGTCATGCCCACACAAATCTCTCC-3') for the human albumin gene (Taqman®, Thermo Fisher Scientific) were used. A standard curve was also used to determine the copy number of the ψ LV-specific sequence per sample and the diploid genome number, allowing the calculation of the LV copy number per cell (VCN = ψ copies / diploid genome number). Finally, based on this parameter, the LV title, defined as the number of transducing units per milliliter, was calculated using the following formula:

number

[0157] Serial dilutions of DNA fragments containing ψ and human albumin sequences were used to generate standard curves for extrapolating qPCR data. All reactions were performed in duplicate on a 7500 Fast Real-Time PCR System (Applied Biosystems®).

[0158] 4. Experimental Animals Non-obese diabetic (NOD) immunodeficient Cg-Prkdcscid Il2rgtm1Wjl / SzJ mice (NSG) were transfected with human CD34+ This strain harbors two mutations on the NOD / ShiLtJ genetic background: one causing severe combined immunodeficiency (scid) and the other causing a complete absence of the IL2 receptor common gamma chain (IL2rgnull). The scid mutation occurs in the Prkdc gene, which encodes a DNA repair complex, and causes B and T cell deficiencies. The IL2rgnull mutation prevents cytokine signaling through multiple receptors, leading to NK cell dysfunction. The severe immunodeficiency is caused by the human CD34 + It allows mice to be humanized by engraftment of cells, patient-derived xenografts, or adult stem cells and tissues.

[0159] All experimental procedures were performed in accordance with relevant European and Spanish regulations, the European Convention ETS 123 on the Use and Protection of Vertebrate Mammals Used for Experimental and Other Scientific Purposes, Directive 2010 / 63 / UE, and the Spanish Law 6 / 2013 and Real Decreto (RD) 53 / 2013 on the Protection and Use of Animals in Scientific Research.

[0160] 5. Animal Procedures Procedures involving genetically modified organisms were performed in accordance with the appropriate European and Spanish regulations: Directive 2009 / 41 / CE, and Spanish Laws 9 / 2003 and RD178 / 2004. Procedures were approved by the CIEMAT Animal Experimentation Ethical Committee in accordance with all external and internal biosafety and bioethical guidelines and were previously authorized by the Spanish government (Code PROEX #070-15# Cell and Gene Therapy for Rare Diseases with Chromosomal Instability).

[0161] Mice were housed and maintained at the CIEMAT Laboratory Animals Facility (registration number ES280790000183) and routinely screened for pathogens according to the recommendations of the Spanish Society for the Laboratory Animal Science (SECAL) and the Federation of European Laboratory Animal Science Associations (FELASA, Tomworth, United Kingdom), but no pathogens were found.

[0162] Under controlled environmental conditions, mice were provided with food (TEKLAD Global Diet 2918 gamma-irradiated to 25 KGy) and water (acidified and autoclaved) ad libitum. During the experimental protocol, mice were housed in individually ventilated cages in IIL-type microinsulators, with air cage changes 25 times per hour. Up to six mice were housed per cage. Room lighting was controlled with a 13 / 11-hour light / dark cycle, and temperature and humidity were regulated at 20 ± 2°C and 55 ± 10%, respectively. HEPA air filters were present in all rooms.

[0163] Mice were maintained under a standard diet (water and food available ad libitum) and the entire protocol was carried out in accordance with European and Spanish laws and regulations (European Convention ETS 123 on the Use and Protection of Vertebrate Mammals Used for Experimental and Other Scientific Purposes, and Spanish Law RD 53 / 2013).

[0164] 6. Human samples from healthy donors and DBA patients The human samples used for the results presented were peripheral blood and bone marrow obtained from both healthy donors and DBA patients, as well as umbilical cord blood from healthy donors collected under informed consent.

[0165] All samples were used in connection with the project "Preclinical study to demonstrate the efficacy and safety of an ex vivo gene therapy approach for Diamond-Blackfan anemia using lentiviral vectors," funded by the CIBERER-ISCIII-Centro de Investigacion Biomédica en Red of Rare Diseases and approved by the Ethics Committee of the Jiménez Díaz Foundation on May 8, 2018. This evaluation includes the following: The test meets the requirements set out in current legislation (Royal Decree 1090 / 2015 and Decree 39 / 94 of the CAM). Meets standard institutional ethical standards for this type of study. Comply with the ethical standards set out in SAS Order 3470 / 2009 and the Declaration of Helsinki of the World Medical Association.

[0166] Hematological analyses from samples from DBA patients and healthy donors were performed using a Sysmex XN-1000™ hematology analyzer (Sysmex, Kobe, Japan) from 120 μl of peripheral blood or bone marrow in predilution mode.

[0167] 7. Determination of VCN in LV-injected mice After the animals were sacrificed, various tissues were collected (liver, spleen, lung, bone marrow, lymph nodes, brain, testes, pancreas, and kidney) and stored at −80° C. To determine the LV genome integrated in these tissues, genomic DNA was extracted using the NucleoSpin® Tissue Kit (Macherey Nagel) according to the manufacturer's instructions.

[0168] The number of integrated lentiviral vector genomes (VCN) in the tissues of injected mice was determined by qPCR. To analyze the copy number of the integrated provirus, primers ((SEQ ID NO: 25) Fw: 5' CAGGACTCGGCTTGCTGAAG 3'; (SEQ ID NO: 26) Rv: 5' TCCCCCGCTTAATACTGACG 3') and a probe ((SEQ ID NO: 27) 5'-CGCACGGCAAGAGGCGAGG-3') (Taqman®, Thermo Fisher Scientific) designed against the ψ sequence of the lentiviral vector were used. To determine the amount of endogenous DNA, primers ((SEQ ID NO: 28) Fw: 5' AAAACGAGCAGTGACGTGAGC 3'; (SEQ ID NO: 29) Rv: 5' TTCAGTCATGCTGCTAGCGC 3') and a probe ((SEQ ID NO: 30) 5'-TGCACGGAAGCGTCTCGTCTCAGTC-3') against the mouse titin gene were used. After determining the LV copy number and diploid genome number per sample, VCN was calculated (VCN = copy number of ψ / diploid genome number).

[0169] Standard curves were performed using serial dilutions of DNA fragments containing the ψ and titin sequences. All reactions were performed in duplicate on a 7500 Fast Real-Time PCR System (Applied Biosystems®).

[0170] 8. Determination of CoRPS19 Expression Q-PCR was used to determine the expression of the CoRPS19 transgene integrated by the therapeutic vector and its non-optimized physiological version, RPS19. RNA was extracted from cells using the RNeasy Tissue Kit (Qiagen GmbH), and reverse transcription was performed using the Superscript Vilo Kit (Invitrogen SuperScript IV VILO Master Mix, ThermoFisher). After obtaining cDNA, expression analysis was performed using a 7500 Real-Time PCR System (ThermoFisher Scientific). To calculate the expression of the endogenous RPS19 gene and the optimized version, CoRPS19, a modified version of the Livak (2ΔCt)209 relative quantification method was used. To do this, the amplification efficiencies of the genes of interest (hRPS19 and CoRPS19) and the reference gene, hGAPDH, were first calculated. After assuming 100% efficiency in amplification, the relative expression of the gene of interest was normalized using the reference gene, in this case, GAPDH, using the following formula: Relative expression of RPS19 = 2 (CT GAPDH)-(CT RPS19) Relative expression of CoRPS19 = 2 (CT GAPDH)-(CT CoRPS19) [Table 1]

[0171] 9. Northern blotting and primer extension analysis of pre-rRNA processing. Five micrograms of total RNA extracted using TRI Reagent (Invitrogen) was resolved on a denaturing agarose gel and processed for Northern blotting. Northern blots were exposed to Fuji Imaging Plates (Fujifilm), and quantification was performed using a phosphorimager (FLA-7000; Fujifilm) with MultiGauge software (Fujifilm, v 3.1).

[0172] 10. Flow Cytometry 10.1 Hematopoietic Characterization of DBA Patients The immunophenotypes of DBA patients and healthy donors were analyzed by flow cytometry using six different panels, as shown in Table 2. Antibodies were added (as indicated in Table 2), incubated for 30 minutes at 4°C, and then washed with PBA (PBS containing 0.2% sodium azide, Merck, and 1% BSA, Sigma). For panels 1 and 2, peripheral blood samples were prediluted in PBA at a ratio of 1:400 and 1:10, respectively. After antibody incubation, a lysis step using ammonium chloride buffer (0.155 M NH4Cl, 0.01 M KHCO3, 0.1 mM EDTA; 10-minute incubation at room temperature) was performed for panels 3, 4, 5, and 6 to remove the red blood cell fraction. DAPI (4',6-diamidino-2-phenylindole) was added to a final concentration of 1 μg / ml to identify dead cells. Events were acquired and recorded using a Fortessa LSR (BD Biosciences), and cytometry data were analyzed by FlowJo software (BD, Becton, Dickinson & Company). [Table 2]

[0173] 10.2 Multistem Analysis The various hematopoietic progenitor cells in the bone marrow of DBA patients and healthy donors were determined by flow cytometry using the antibody combinations reflected in Table 3. The labeling protocol was similar to that used for immunophenotyping of patient and healthy donor samples obtained using Fortessa RSL (BD Biosciences). To properly evaluate the various analyses, the minimum number of cells analyzed was 1 × 10 6 The cell count results were analyzed using FlowJo software (BD, Becton, Dickinson & Company). [Table 3]

[0174] 10.3 Immunophenotyping of erythroid differentiation The antibody combinations set forth in Table 4 were used to analyze the immunophenotype of hematopoietic progenitor cells differentiated into the erythroid lineage by flow cytometry. [Table 4]

[0175] Cells were diluted to a final volume of 100 μl, labeled for 30 minutes at 4°C, and washed with PBA. DAPI (final concentration 1 μg / ml) was added, and events were recorded using a Fortessa LSR (BD Biosciences). Results were analyzed using FlowJo software (BD Biosciences).

[0176] 11. Cell line culture K562 cell line (chronic myeloid leukemia; ATCC: CCL-243) was grown in Iscove's modified Dulbecco's medium (IMDM; Gibco), HyClone (10%; GE Healthcare), and penicillin / streptomycin (1%; Gibco). Cells were grown at 1 × 10 5 ~1×10 6 The cells were maintained at a concentration of 1000 cells / ml.

[0177] The HEK293T cell line (human embryonic kidney cells suitable for replicating vectors carrying the SV40 T antigen; ATCC: CRL-3219) was grown in Iscove's modified Dulbecco's medium (IMDM; Gibco), HyClone (10%; GE Healthcare), and penicillin / streptomycin (1%; Gibco). 5 × 10 cells were cultured at 4°C. 5 The cells were maintained at a concentration of 1000 cells / ml.

[0178] Incubation conditions were the same for all cell lines used: 37°C, 5% CO2 and 95% relative humidity.

[0179] 12. Hematopoietic Progenitor and Stem Cell Functional Assays CD34 was isolated from peripheral blood and bone marrow samples from DBA patients and healthy donors for characterization and lentiviral correction studies, and from umbilical cord blood from healthy donors for safety studies. + Cells were obtained. First, either whole blood or bone marrow was subjected to a density gradient using Ficoll-Paque PLUS (GE Healthcare) according to the manufacturer's instructions. The mononuclear cell band was then collected and washed with PBS (Dulbecco's Phosphate Buffered Saline, Sigma); Hyclone 2% (GE Healthcare); and 2 mM EDTA, herein referred to as PBE. After obtaining the mononuclear cell band, the CD34 magnetic separator was used with a commercially available column and QuadroMACS and OctoMACS magnetic separators (Miltenyi Biotech). + CD34 was detected using a microbead kit (MACS, Miltenyi Biotec, Bergisch Gladbach, Germany). + The cell fraction was separated. + After cell harvesting, flow cytometry analysis was performed to determine the purity of the samples. For this, aliquots were collected, labeled with anti-CD34 PE antibody for 30 min at 4°C, washed with PBA, and analyzed for CD34 using a Fortessa LSR (BD Biosciences). + Cell percentages were analyzed and cytometric data were analyzed by FlowJo software (BD, Becton, Dickinson & Company).

[0180] Cells were cultured under hypoxic conditions (37°C, 5% O, 5% CO, and 95% relative humidity) in StemSpam medium (StemCell Technologies) or X-VIVO 20 medium (Lonza, Basel, Switzerland) supplemented with 1% GlutaMAX™ (Gibco), 1% P / S (Gibco), 100 ng / ml hSCF and hFlt3, and 20 ng / ml hTPO and hIL3 (both from EuroBioSciences GmbH).

[0181] Human hematopoietic progenitor cells were differentiated into the erythroid lineage using three different approaches (Figure 11). The first medium (days 1–7) was based on StemSpan SFEM I (Stem Cell Technologies) supplemented with hSCF (50 ng / ml; EuroBioSciences), hFlt3-ligand (16.7 ng / ml; EuroBioSciences), bone morphogenetic protein 4 (BMP-4, 6.7 ng / ml; Peprotech), human interleukin 3 (hIL-3, 6.7 ng / ml; EuroBioSciences), human interleukin 11 (hIL-11, 6.7 ng / ml; EuroBioSciences), and human erythropoietin (h-EPO, 1.3 U / ml; Amgen). On day 7 of expansion, cells were cultured in IMDM supplemented with glutamine (IMDM GlutaMAX; Gibco), BSA (1%; Sigma), insulin (0.01 mg / ml; Sigma), human transferrin (0.2 mg / ml; Sigma), β-mercaptoethanol (91 μM; Gibco), penicillin / streptomycin (1%; Gibco), lipid mix (1%; Gibco), and PBS. The cells were then transferred to a second medium consisting of Iscove's modified Dulbecco's medium (IMDM) enriched with 1 (1x; Sigma), ethanolamine (0.004%, Sigma), hSCF (5 ng / ml; EuroBioSciences), hIL-3 (6.7 ng / ml; EuroBioSciences), hIL-11 (6.7 ng / ml; EuroBioSciences), hEPO (1.3 U / ml; Amgen), insulin-like growth factor 1 (IGF-1, 20 ng / ml; PeproTech), and hydrocortisone (1 μM; Sigma) and cultured for up to 14 days.After day 14, cells were transferred for 2 days to a third medium based on IMDM GlutaMAX medium (Gibco) supplemented with BSA (1%; Sigma), insulin (0.01 mg / mL; Sigma), transferrin human (0.2 mg / mL; Sigma), β-mercaptoethanol (91 μM; Gibco), penicillin / streptomycin (1%; Gibco), lipid mix 1 (1x; Sigma), ethanolamine (0.004%; Sigma), and hEPO (10 U / mL Amgen).

[0182] All media were filtered through a 0.22 μm filter before use. Cell counts and flow cytometry analysis were performed on days 3, 5, 7, 10, and 14. During erythroid differentiation, cells were cultured at 4 × 10 5 ~4×10 6 The cells were maintained at a concentration of 1000 cells / ml. Incubation conditions were 37°C, 5% CO2, and 95% relative humidity.

[0183] The number of hematopoietic progenitor cells in the peripheral blood and bone marrow of DBA patients was assessed according to the following protocol: mononuclear hematopoietic cells and / or CD34 + Cells were resuspended in X-vivo medium and plated in 25 mm culture plates at 3 x 10 for peripheral blood. 5 Nucleated cells / ml, 5 × 10 for bone marrow 4 Nucleated cells / ml were seeded into semi-solid methylcellulose medium (StemMACS™ HSC-CFU supplemented with 30% fetal bovine serum, 1% BSA, 2 mM glutamine, 0.1 nM 2-mercaptoethanol, 50 ng / ml SCF, 20 ng / ml GM-CSF, 20 ng / ml G-CSF, 20 ng / ml IL-3, 20 ng / ml IL-6, 3 U / ml EPO; Miltenyi). Each sample was run in triplicate, with 1 ml for each replicate. After 14 days of incubation in hypoxia (37°C, 5% O2 and 5% CO2, 98% relative humidity), the colonies formed were counted using a phase-contrast Nikon ELWD 0.3 inverted microscope. Results were compared with 10 seeded cells. 5 The results were expressed as the average of the total number of colonies per cell.

[0184] 13. Transplantation of human hematopoietic cells into NSG mice Mononuclear cell fractions were obtained from the bone marrow of DBA patients and healthy donors and separated by density gradient using Ficoll-Paque PLUS (GE Healthcare) according to the manufacturer's instructions. For safety studies, MNCs were obtained from umbilical cord blood using the same process. Commercially available CD34 columns and QuadroMACS and OctoMACS magnetic separation devices (Miltenyi Biotech) were used. + CD34 was isolated by immunomagnetic separation using a microbead kit (MACS, Miltenyi Biotec, Bergisch Gladbach, Germany). + Before engraftment, NSG mice were irradiated with a submyeloablative dose (1.5 Gy) and 2 × 10 5 Mouse purified CD34 +Hematopoietic grafts in the peripheral blood and bone marrow of NSG mice were analyzed by flow cytometry at days 30, 60, and 90, and up to day 120 after injection in the safety study. To assess the level of human hematopoietic grafts, cells were collected by femoral bone marrow aspiration at weeks 4, 8, and 12 after transplantation and labeled with hCD45 APC-Cy7 antibody (eBioscience) according to the manufacturer's instructions. Multilineage graft analysis was performed using D45 APC-Cy7 (BioLegend), CD34 APC (BD Biosciences), CD33 PE (BD Biosciences), CD19 PE-Cy7, and CD3 FITC (BioLegend) according to the manufacturer's instructions. Paired fluorochrome isotypes were used as controls. Positive 4'6-diamidino-2-phenylindole (DAPI) cells were excluded from the analysis. All flow cytometry analyses were performed using a Fortessa LSR (BD Biosciences) and analyzed using FlowJo v7.6.5 software. To perform secondary transplants, primary NSG recipients were anesthetized, and blood was collected for hematological results. After anesthesia, they were sacrificed by cervical dislocation, and the femur and tibia were removed from each mouse's hind limb. Bone marrow from the femur and tibia was obtained by perfusion of each bone. After obtaining bone marrow cells, human CD45+ cells were selected by flow cytometric cell separation. After purification, the cells were transplanted back into immunodeficient 1.5 Gy-irradiated NSG mice. Analysis was performed at 30, 60, 90, and 120 days after transplantation.

[0185] 14. Integration Site Analysis (ISA) These integrations were analyzed in cells expanded in vitro for 14 days and in cells transplanted into primary and secondary NSG recipients in both experiments. Genewerk performed the analysis. The technology used by Genewerk is based on S-EPTS / LM-PCR (shearing extension first tag selection ligation-mediated PCR), which amplifies and sequences unknown regions flanking the integrated vector DNA. DNA samples are fragmented into 500-base-pair fragments by sonication and then amplified by PCR using biotinylated primers specific to the integrated vector's LTR sequence. After amplification, the biotinylated products are purified and subjected to a second step of PCR amplification with primers that ligate the products into cassettes containing molecular tags (barcodes) and allow sequencing using MiSeq technology (Illumina, Thermofisher). The 10 most frequent integration sites were used for IS analysis.

[0186] 15. statistical analysis Statistical analysis was performed using GraphPad Prism, version 7.0 for Windows. Using column statistical analysis, preliminary statistical tests were performed to confirm whether the data followed a normal distribution by applying the D'Agostino and Pearson normality test, the Shapiro-Wilk normality test, and the KS normality test. After examining the distribution in various analyses, the most appropriate test was applied: the Mann-Whitney statistical test, the Student's t-test, and the ANOVA test. Differences were considered significant when P<0.05.

[0187] The results are described in Examples 2-4 below.

[0188] Example 2: Characterization of bone marrow CMH populations from bone marrow DBA patients Because it remained uncertain to what extent the number of HSCs in DBA may limit the harvest of these cells, as already observed in some Fanconi anemia (FA) patients, we first characterized bone marrow (BM) samples from DBA patients compared with healthy donors and FA patients.

[0189] 2.1 Determining the population of bone marrow HSCs from DBA patients The results of this study showed that CD34 + levels of cells, and CD34 + / CD38 - These results (see Figure 2) demonstrate that the more primitive population of progenitor cells is not depleted in bone marrow samples from DBA patients. + In contrast to what occurs in other diseases such as FA, which show a significant reduction in cell numbers, obtaining these cells in DBA patients indicates that this does not constitute a limitation to the collection of clinically relevant numbers of HSCs in DBA patients to be used in gene therapy trials.

[0190] 2.2 Multistem CD34 in the bone marrow of DBA patients + Analysis of hematopoietic progenitor cells Although MHC populations did not appear to be affected, several studies have described a decrease in the number of erythroid progenitors in DBA patients, and in some cases neutropenia and thrombocytopenia during the course of the disease (Giri et al. 2000; Santucci et al. 1999; Tsai, Arkin, and Lipton 1989). To further examine hematopoietic progenitors in DBA patients, we analyzed populations of intermediate hematopoietic precursors (Doulatov et al. 2012). Our results showed no significant decrease in any of these populations (see Figure 3: a) HSCs (hematopoietic stem cells: Lin-CD34+CD38-CD90+CD45RA-), b) MPPs (multipotent progenitors: CD34 + CD38 - Thy-1 - CD45RA - Flt3+ CD7 - CD10 - ), c) MLP (multipotent lymphoid progenitor cells: CD34 + CD38 - Thy1 low CD45RA - Flt3 + CD7 - / + CD10 - ), d) CMP (common myeloid progenitor cells: CD34 + CD38 + Thy-1 - CD45RA - Flt3 + CD7 - CD10 - ), e) MEP (erythroid and megakaryocytic progenitor cells: CD34 + CD38 + Thy - 1 - CD45RA - Flt3 - CD7 - CD10 - ) and f) GMP (granulocytic-monocytic progenitor cells: CD34 + CD38 + Thy-1 - CD45RA + Flt3 + CD7 - CD10 - )).

[0191] 2.3 Analysis of committed hematopoietic progenitor cells in the bone marrow of DBA patients CD34 + After confirming that the number of cells was not significantly affected in the bone marrow of DBA patients, the next step to evaluate was their functionality in an in vitro clonogenic assay. +It has been observed that the ability of cells to generate erythroid progenitors is reduced (Hamaguchi et al. 2003; Iskander et al. 2015; Ruggero and Shimamura 2014). Our results are consistent with this observation, as there was a highly significant decrease in the number of erythroid progenitors (BFU-E, burst-forming units-erythroid progenitors) (Figure 4b). Regarding myeloid lineage progenitors (CFU-GM, granulocyte-macrophage progenitor colony-forming units) (Figure 4a), the results showed a decrease compared to healthy donors, but it was much less pronounced than that observed for BFU-E.

[0192] 2.4 Analysis of engraftment and differentiation potential of HSCs derived from DBA patients It is important to consider that a successful gene therapy protocol for treating DBA patients requires the engraftment of corrected cells. Therefore, we first evaluated the population potential of these cells in immunodeficient NSG mice, as detailed in the Materials and Methods section. Our results showed that there was no significant difference between bone marrow-derived cells from DBA patients and healthy donors during the first 60 days after transplantation. However, upon reaching the end of the experiment at day 90, a significant decrease in the engraftment level of cells from DBA patients was observed (Figure 5a), which may indicate a lower long-term repopulation potential of MHC in these patients. While repopulation potential showed a decline 90 days after transplantation, the same did not occur for differentiation potential. Figure 5b shows that human CD45 + The percentages of various lineages generated within the cells are shown, demonstrating no significant differences between cells from DBA patients and healthy donors. These results demonstrate that CD34 cells from transplanted DBA patients + It was shown that the differentiation potential of the population remained similar to that observed in healthy donors.

[0193] In conclusion, the results obtained in this section make it possible to predict that the collection of HSCs should not constitute a significant limitation in DBA patients. In principle, in the samples tested, CD34 + CD38 -There is no reduction in the erythropoietic content of hematopoietic progenitors or the content of lineage-committed immature progenitors. However, despite the lack of a reduction in the number of hematopoietic progenitors, a reduction in the erythropoietic potential of this population is evident, primarily at the level of CFU-GM and BFU-E. It should be noted that, unlike cells from FA patients, where a highly poor repopulation capacity has been observed, cells from untransduced DBA patients maintain a high repopulation capacity in immunodeficient mice (Rio et al. 2019).

[0194] Example 3: Generation of therapeutically clinically applicable lentiviral vectors (LV): K562 cell line and RPS19-haploinsufficient CD34 from DBA patients + Efficacy testing on cells Supported by the realistic feasibility of harvesting functional HSCs from DBA patients that could be corrected using gene therapy protocols, we decided to develop two clinically applicable lentiviral vectors (LVs) using a codon-optimized version of the RPS19 gene under the control of the phosphoglycerate kinase promoter (PGK) or its truncated version, elongation factor alpha (EF1α(s)).

[0195] 3.1 Analysis of the functionality of therapeutic vectors in the RPS19-interfered K562 cell line First, we confirmed the ability to express a transgene of interest using a therapeutic vector consisting of a codon-optimized version of the RPS19 gene (CoRPS19; codon-optimized RPS19). To do this, we first transduced K562 cells with two lentiviral vectors (LV-THM.shRPS19 and LV-MISSION® pLKO.1-pure TurboGFP™ TurboGFP™ shRPS19) carrying two specific shRNA sequences that interfere with RPS19 expression, thus creating a DBA model. These cells, in which RPS19 expression was affected, were then corrected with the therapeutic vector.

[0196] Interference with the LV-THM.shRPS19 vector demonstrated the ability to attenuate the mRNA level of the RPS19 gene by 50-60%, as shown in Figure 6a. In conjunction with this result, expression of the therapeutic vector (transgene CoRPS19) was confirmed in the interfered cells both in the control condition, which was not interfered with but transduced with the therapeutic vector, and in the condition interfered with by the therapeutic vector and then corrected (Figure 6a).

[0197] This same experiment was performed with a second vector, LV-MISSION® pLKO.1-pure TurboGFP™ shRPS19, and an even higher interference potential was observed, demonstrating 95% mRNA silencing of the RPS19 gene (Figure 6b). However, even with this ability to interfere with the gene of interest, analysis of the optimized version of CoRPS19 showed the same results as in the previous experiment, with only expression of the CoRPS19 sequence observed under conditions transduced with the therapeutic vector (Figure 6b).

[0198] 3.1.1 Analysis of the ribosome biogenesis process in the K562 strain interfered with in the RPS19 gene and corrected by the therapeutic vector Because cells from Blackfan-Diamond anemia patients are characterized by defects in the ribosome biogenesis process, we first examined the extent of involvement of this process in K562 cells in which RPS19 expression was interfered with. To this end, we proceeded to test K562 cells transduced with the two interference vectors we created. In parallel, we analyzed the possibility of reversing the effect when K562 interference cells were corrected with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*.

[0199] Analysis of these samples revealed an accumulation of 21S pre-rRNA in the interfered cells. The interference vector LV-THM.shRPS19, transduced with a nonspecific hairpin (scrambled) or without interference, produced a significantly greater accumulation of 21S pre-rRNA than that observed in control K562 cells. When K562 cells were transduced with either of the two therapeutic vectors, whether interfered or not, the levels of pre-21S rRNA were similar to those observed in the control condition (Figure 7a).

[0200] When cells were interfering with the LV-MISSION® pLKO.1-pure TurboGFP™ shRPS19 interference vector, the accumulation of 21S / 21C pre-rRNA in the interfering cells was more than twice that observed when cells were interfering with the vector LV-THM.shRPS19. Even under these conditions, when cells were transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*, 21S pre-rRNA levels were similar to those of the conditioned control (Figure 7b). It is noteworthy that the vector PGK.CoRPS19.Wpre* always showed a more pronounced recovery than the vector EF1α(s).CoRPS19.Wpre*.

[0201] 3.2 Efficacy testing of lentiviral gene therapy on DBA patient cells After determining the functionality of the PGK therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* in cell lines, the next step was to continue these studies in primary DBA patient cells. These studies were performed on bone marrow cells from various DBA patients. The objectives of these experiments were: 1) to evaluate the feasibility of transducing DBA patient hematopoietic progenitor cells, 2) to determine whether the therapeutic vectors were toxic in hematopoietic progenitor cells, 3) to assess the degree of phenotypic reversal of these cells, and 4) to evaluate whether the corrected cells were able to engraft in an in vivo xenograft model.

[0202] 3.2.1 Analysis of the clonogenic potential of hematopoietic progenitor cells (CFC) from DBA patients transduced with therapeutic vectors To evaluate the effect of transduction on hematopoietic progenitor cells in DBA patients, we transduced BM CD34 cells from DBA patients with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and the control vector PGK.EGFP.Wpre*. + Clonogenic assays were then performed to determine whether transduction with different therapeutic vectors resulted in CD34 + We examined whether the CD34 expression of DBA patients altered their clonogenic potential. + The fact that the number of colonies generated by cells transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* was not reduced indicated the absence of toxicity mediated by these vectors (Figure 8). Determination of the total number of colonies formed revealed that transduction with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* increased the number of colonies compared to cells transduced with the control vector PGK.EGFP.Wpre*, with a significant difference in the number of BFU-E colonies in samples transduced with the vector EF1α(s).CoRPS19.Wpre* (Figure 8b).

[0203] 3.2.2 Determination of proviral copy number (VCN) and transduction rate in hematopoietic progenitor cells of DBA patients after transduction with therapeutic vectors First generation CD34 +Our laboratory's experience in transducing cells, particularly those from patients with bone marrow failure, has allowed us to use an optimized protocol for transducing these cells from DBA patients. To determine the efficiency of this protocol in hematopoietic progenitor cells from DBA patients, we determined the integrated vector copy number (VCN) in transduced cells by Q-PCR to detect the proviral packaging signal (Ψ). These analyses were performed on CD34 cells in liquid culture over 14 days. + Transduction + This was performed on both the expanded cell set and on individual colonies obtained in the clonogenic assay, from which the transduction rate was determined and the number of colonies positive for provirus was quantified relative to the total number.

[0204] Determination of transduction efficiency revealed that 77.93% of CFCs were transduced by the PGK vector CoRPS19.Wpre*, 57.79% by the vector EF1α(s).CoRPS19.Wpre*, and 48.85% by the PGK vector control EGFP.Wpre* (Figure 9a). Detection of lentiviral vector copy numbers in both liquid culture (Figure 9b) and harvested colonies (Figure 9c) indicated the presence of approximately two copies of provirus per cell under all conditions. Individual CD34 cells from each patient were transduced. + The cell transduction results are listed in Table 5. [Table 5]

[0205] 3.2.3 Analysis of the effect of transduction on hematopoietic progenitor cell proliferation in DBA patients In these experiments, we analyzed whether complementation with the therapeutic vectors conferred an in vitro growth advantage for corrected hematopoietic progenitor cells over uncorrected ones. Both the PGK therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*, as well as the vector control PGK.EGFP.Wpre*, upregulated CD34 + After transduction, cells were maintained in liquid culture for 14 days. Growth curve analysis revealed no significant differences over time in cell proliferation of hematopoietic progenitor cells transduced with the PGK therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and the vector control PGK.EGFP.Wpre* (Figure 10).

[0206] 3.2.4 Analysis of erythroid differentiation in hematopoietic progenitor cells from DBA patients corrected by therapeutic vectors The process of erythroid differentiation of cells from DBA patients shows a blockage in the maturation stage of erythroid progenitors, which generate a relatively small number of red blood cells. Therefore, we analyzed whether therapeutic vectors could reverse the blockage in erythroid differentiation compared to uncorrected cells.

[0207] To determine this process, we investigated the effects of therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and control vector PGK.EGFP.Wpre* on bone marrow-derived CD34 cells from DBA patients. + After transduction, cells were grown in a medium that promotes erythroid differentiation, and different stages of the erythroid differentiation process were analyzed using flow cytometry with previously described markers characteristic of the erythroid differentiation process: CD45, CD36, CD71 (transferrin receptor), and CD235a (glycophorin A; GPA).

[0208] The following strategies were used: first, selection of C36 cells, which are differentiated into the erythroid lineage; + / CD45 - Cytometric analysis was performed using cell population C36+ / CD45 - Within this window, the first window corresponds to the event CD71 + / CD235a + The second window collects CD71 events corresponding to reticulocytes and mature erythrocytes. - / CD235a + Select two windows to collect data (Figure 11).

[0209] Determination of the erythroid differentiation process in hematopoietic progenitor cells from DBA patients revealed two observations: samples transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* showed a higher percentage of mature erythrocytes (windowed CD71) than conditions transduced with the control vector PGK.EGFP.Wpre*. - / CD235a + ) (Figure 11). This fact suggests that CD71 + / CD235 + Phase and CD71 - / CD235 + This suggests that the blockage of erythroid progenitor maturation during the a phase can be reversed by transduction with a therapeutic vector.

[0210] 3.3. Analysis of the hematologic phenotype of hematopoietic progenitor cells from DBA patients transduced with therapeutic vectors and transplanted into immunodeficient NSG mice. To test whether the process of transduction with the therapeutic vectors PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre* affected the repopulation capacity of CMH in patients with haploinsufficiency for RPS19, we performed transduced cell transplantation into NSG immunodeficient mice.

[0211] 3.3.1 CD34 in DBA patients transduced with therapeutic vectors + Analysis of bone marrow cell reconstitution potential For these experiments, CD34 from DBA patients +Cells were transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and the control vector PGK.EGFP.Wpre* and transplanted into NSG immunodeficient mice. Bone marrow samples were obtained by femoral puncture on days 30 and 60, and mice were sacrificed on day 90.

[0212] Percentage of human CD45+ cells in the bone marrow of transplanted mice + This study demonstrated the repopulating capacity of these corrected cells, with no significant differences observed between samples supplemented with therapeutic vectors and those transduced with PGK.EGFP.Wpre* up to 90 days post-transplant (see Figure 12). The ability of hematopoietic progenitor cells corrected with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and the vector control PGK.EGFP.Wpre* to generate different lineages was also investigated. Figure 12 shows that CD34 + and myeloid cells (CD33 + ) or B lymphocytic (CD19 + ) was similar in all groups of transduced cells.

[0213] 3.3.2 Vector copy number analysis of transduced cells and transplanted DBA patient cells in NSG mice The following process confirmed that the grafts obtained in the previous section corresponded to our therapeutically transduced cells: After sacrificing the mice 90 days after transplantation, the transplanted mice were screened for human bone marrow CD45 markers by sorting (selection of the desired population by flow cytometry). +Populations were selected. After obtaining the transplanted human cells, VCN was determined by Q-PCR (Figure 13). Measurement of VCN in patient cells transduced with the therapeutic vectors and transplanted into NSG mice revealed that at 90 days post-transplant, integration of the therapeutic vectors was observed at an average level of approximately 2 copies per cell for the vector PGK.CoRPS19.Wpre* and 1 copy per cell for the vector EF1α(s).CoRPS19.Wpre*.

[0214] Example 4: Safety study related to HCM gene therapy for DBA patients 4.1 In vitro safety testing To perform a study that allowed us to evaluate the safety of transduction of MHC from DBA patients with the lentiviral vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*, CD34 cells obtained from umbilical cord blood from healthy donors were used. + Cell transduction experiments were performed first.

[0215] 4.1.1 Clonogenic analysis of hematopoietic progenitor cells from healthy and transduced donors with therapeutic vectors To analyze whether transduction with both therapeutic vectors had a toxic effect on hematopoietic progenitor cells from healthy donors, we investigated the CD34 expression levels of the two therapeutic vectors PGK.CoRPS19.Wpre* or EF1α(s).CoRPS19.Wpre* or the control vector PGK.EGFP.Wpre*. + The cells were transduced.

[0216] Determination of the number of colonies generated from transduced cells showed that the number of CFU-GM (Figure 14a) was similar to that of all vectors, except for a significant 20.32% decrease in the number of BFU-E observed in cells transduced with vector EF1α(s).CoRPS19.Wpre* compared to cells transduced with vector PGK.EGFP.Wpre* (Figure 14b).

[0217] 4.1.2. CD34 from healthy donors + Analysis of proviral copy number and CoRPS19 expression levels in cell colonies and post-transduction liquid cultures. To verify that transduction levels were comparable across different conditions, colonies and liquid cultures were analyzed for vector per cell copy number. Determination of VCN per cell from individual colonies harvested from previous experiments, taking those with values ​​above 0.3 copies per cell as positive, showed that the transduction efficiency of colonies using vector PGK.EGFP.Wpre* was 85.9%, while the efficacy of vector PGK.CoRPS19.Wpre* was 77.03%. For vector EF1α(s).CoRPS19.Wpre*, its transduction efficiency was 67.83%, which was significantly lower than that shown by the control vector PGK.EGFP.Wpre* and the therapeutic vector PGK.CoRPS19.Wpre* (Figure 15a).

[0218] Analysis of liquid cultures revealed average copy numbers of 3.40 ± 0.91 copies per cell for PGK.EGFP.Wpre*, 5.80 ± 1.80 copies for PGK.CoRPS19.Wpre*, and 2.00 ± 0.49 copies for EFα(s).CoRPS19.Wpre*, which were significantly lower than those observed for the previous two vectors (Figure ​(Figure15b).15b).

[0219] In the following three experiments, we determined the expression of the CoRPS19 transgene after transduction with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*, using the control PGK.EGFP.Wpre* as a reference. As can be seen in Figure 15c, expression of mRNA corresponding to the optimized version of the RPS19 gene was observed only in cells transduced with the therapeutic vector. Furthermore, we determined the expression of the CoRPS19 transgene for each vector as a function of integrated copy number. Figure 15c shows that the CoRPS19 expression levels induced by the therapeutic vectors were similar.

[0220] 4.1.3. CD34 from healthy donors transduced with therapeutic and control vectors + Analysis of cell proliferation of cells In these experiments, we demonstrated that CD34 + The proliferation of cells was investigated. For this purpose, transduced CD34 + Cells were cultured and cell numbers were quantified in liquid cultures once a week for three weeks.

[0221] As shown in Figure 16, the proliferation of cells transduced with the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre* and the control PGK.EGFP.Wpre* showed no significant difference.

[0222] 4.2 In vivo safety testing 4.2.1. CD34 from healthy donors transduced with therapeutic vectors + Analysis of cell repopulation potential To analyze the repopulation potential of the transduced healthy donor MHC, these cells were transplanted into immunodeficient NSG mice. At 30, 60, 90, and 120 days post-transplant, the primary recipients were transfected with human CD45 cells. + Similarly, bone marrow cells from these primary recipients were transplanted back into secondary recipients to test their long-term repopulation potential (30 and 120 days after secondary transplantation).

[0223] As shown in Figure 17a, no significant differences were observed in the engraftment levels of primary recipients between the different experimental groups. Secondary receptor analysis revealed significantly lower engraftment levels at 120 days after secondary transplantation in cells transduced with the control vector PGK.EGFP.Wpre* compared to cells transduced with the vector PGK.CoRPS19.Wpre*. Presumably, the significant difference observed is due to the uniformity of the results in the cell population transduced with the vector PGK.CoRPS19.Wpre* compared to the high heterogeneity obtained with the vector PGK.EGFP.Wpre*.

[0224] In conjunction with previous analyses, we quantified the various lineages generated by the transplanted cells and observed no significant differences in differentiation potential between either the primary or secondary receptors (Figure 17b).

[0225] 4.2.2. CD34 from healthy donors transduced with therapeutic vectors + Proviral copy number analysis in cell-transplanted NSG mice After sacrificing NSG mice from previous experiments, bone marrow was obtained and the VCN per cell was determined to confirm that the transplanted cells carried the proviral sequences of the therapeutic vectors PGK.CoRPS19.Wpre* and EF1α(s).CoRPS19.Wpre*.

[0226] As can be seen in Figure 18, determination of VCNVCN / cell showed a significant difference between the proviral copy number detected in cells transduced with the control vector PGK.EGFP.Wpre* (2.6 ± 1.87 copies) and the proviral copy number detected in cells transduced with the vector PGK.CoRPS19.Wpre* (5.9 ± 1.8 copies), whereas these differences were not observed with the vector EF1α(s).CoRPS19.Wpre* (5.65 ± 3.67) (Figure 18).

[0227] 4.2.3. CD34 derived from umbilical cords of healthy donors and transduced with therapeutic vectors+ Analysis of body weight and hematology variations in cell-transplanted NSG mice. To assess the health status of transplanted animals, body weight and hematology of transplanted NSG mice were assessed every 30 days until the day of sacrifice in primary recipients and at days 30 and 120 in secondary recipients.

[0228] Determination of the body weight of NSG mice transplanted with transduced cells revealed no significant difference between the different conditions, as shown in FIG.

[0229] Hematological parameters determined with primary and secondary NSG receptors showed no significant differences in primary receptors for erythrocytes, platelets, leukocytes, or neutrophils (Figure 20). However, analysis of secondary receptors showed a significant slight increase in erythrocyte count and hemoglobin concentration between the control group PGK.EGFP.Wpre* and the group corresponding to vector PGK.CoRPS19.Wpre*. Despite this, none of the other parameters corresponding to the erythroid lineage (HCT, MCV) showed significant differences between the groups.

[0230] 4.3 Genotoxicity studies: Analysis of proviral integration into the genome of hematopoietic cells from healthy donors transduced with the vector PGK.CoRPS19.Wpre*. CD34 from a healthy donor transduced with the therapeutic vector PGK.CoRPS19.Wpre* and transplanted into NSG mice as described in the previous section. + Genewerk performed an analysis of vector integration sites in two sample types: cells maintained in liquid culture before transplantation, and human CD45 expression vectors present in the transplanted mice. + For analysis, the 10 most common integration sites for each sample (a list of 114 genes used to determine the top 10 for each) were referenced.

[0231] Initial integration site analysis studies were performed using liquid culture samples obtained from pretransplant safety studies in NSG mice. In these liquid culture samples, the highest integration site contribution represented 4.37% of the total, showing no signs of clonal dominance. A second analysis was performed on human cells present in transplanted primary and secondary recipients. For primary recipients, integration site analysis revealed that the highest contribution accounted for 5.009% of the total. For secondary recipients, the highest contribution was 32.33%.

[0232] Analysis of common integration sites (CIS) revealed a diverse composition of 10 major cis-regions, none of which were associated with adverse events such as clonal expansion or oncogenic processes. Accordingly, there was no specific integration into nearby genes, nor was there any specific integration involved in adverse effects described in other gene therapy trials (CCND2, LMO2, MDS1 / EVI1 (MECOM), MN1).

[0233] In summary, samples transduced with PGK.CoRPS19.Wpre* (both those maintained in liquid culture and those transplanted into NSG mice) showed a polyclonal integration pattern, with even stronger clonal expansion observed in two of the samples transplanted into secondary recipients in safety experiment 3, with the relative contribution of IS top 1 reaching 32.336%. [Sequence List Free Text]

[0234] Sequence Listing 2 <223> Chimeric CMV promoter Sequence Listing 3 <223> CMV Enhancer Sequence Listing 4 <223> CMV promoter Sequence Listing 5 <223> RU5 without RU3. Truncated 5' LTR Sequence Listing 6 <223> PBS SL123 (primer binding site) Sequence Listing 7 <223> Packaging Signal Sequence Listing 10 <223> phosphoglycerate kinase promoter PGK Sequence Listing 11 <223> Elongation factor alpha truncated promoter (EF1α(s)) Sequence Listing 12 <223> Codon-optimized version of RPS19 (CoRPS19) Sequence Listing 13 <223> Mutation Wpre (Wpre*) Sequence Listing 17 <223> PGK.CoRPS19.Wpre*-LV sequence Sequence Listing 18 <223> EF1α(s).CoRPS19.Wpre*-LV sequence Sequence Listing 19 <223> forward Sequence Listing 20 <223> Reverse Sequence Listing 21 <223> probe Sequence Listing 22 <223> forward Sequence Listing 23 <223> Reverse Sequence Listing 24 <223> probe Sequence Listing 25 <223> forward Sequence Listing 26 <223> Reverse Sequence Listing 27 <223> probe Sequence Listing 28 <223> forward Sequence Listing 29 <223> Reverse Sequence Listing 30 <223> probe Sequence Listing 33 <223> SV40 polyadenylation (poly A) signal sequence JPEG0007766110000033.jpg232164JPEG0007766110000034.jpg232164JPEG0007766110000035.jpg232164JPEG0007766110000036.jpg232164JPEG0007766110000037.jpg232164JPEG0007766110000038.jpg232164JPEG0007766110000039.jpg232164JPEG0007766110000040.jpg232164JPEG0007766110000041.jpg232164JPEG0007766110000042.jpg232164JPEG0007766110000043.jpg232164JPEG0007766110000044.jpg232164JPEG0007766110000045.jpg232164JPEG0007766110000046.jpg232164JPEG0007766110000047.jpg232164JPEG0007766110000048.jpg232164JPEG0007766110000049.jpg232164JPEG0007766110000050.jpg232164JPEG0007766110000051.jpg232164JPEG0007766110000052.jpg232164JPEG0007766110000053.jpg232164JPEG0007766110000054.jpg232164JPEG0007766110000055.jpg232164JPEG0007766110000056.jpg232164

Claims

1. 1. A lentiviral vector, said lentiviral vector comprising a polynucleotide, said polynucleotide comprising, from 5′ to 3′, the following nucleotides: a) a 5' long terminal repeat (5'LTR) containing a chimeric cytomegalovirus promoter; b) primer binding site (PBS); c) the psi packaging signal; d) Rev response element (RRE); e) DNA flap central polypurine tract (cPPT); f) the human phosphoglycerate kinase (PGK) promoter or the elongation factor 1 alpha truncated promoter (EF1α); g) a nucleotide sequence encoding an RPS19 protein having at least 95% sequence identity over its entire length with the sequence of SEQ ID NO: 12; h) a woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) having at least 95% sequence identity over its entire length to the sequence of SEQ ID NO: 13; and i) characterized in that it contains a 3' long terminal repeat (3' LTR); A lentiviral vector in which the 5'LTR region and the 3'LTR region are rendered substantially transcriptionally inactive by a complete or partial deletion within the U3 region of the LTR, and f) and h) are operably linked to g) and regulate the expression of g).

2. 2. The lentiviral vector of claim 1, wherein the human PGK promoter has at least 95% sequence identity over its entire length with the sequence of SEQ ID NO: 10, and the elongation factor 1 alpha truncated promoter (EF1α) has at least 95% sequence identity over its entire length with the sequence of SEQ ID NO:

11.

3. 3. The lentiviral vector of claim 1, wherein the nucleotide sequence encoding the RPS19 protein has at least 98% sequence identity over its entire length with the sequence of SEQ ID NO:

12.

4. The lentiviral vector of any one of claims 1 to 3, wherein the Woodchuck Hepatitis Virus post-transcriptional regulatory element (Wpre) has at least 98% sequence identity over its entire length with the sequence of SEQ ID NO:

13.

5. The lentiviral vector according to any one of claims 1 to 4, wherein the polynucleotide contained in the lentiviral vector further comprises a polyadenylation (polyA) signal sequence located after the 3'LTR.

6. The lentiviral vector according to any one of claims 1 to 5, wherein the full-length polynucleotide of the lentiviral vector has at least 98% sequence identity with the sequence of SEQ ID NO:

17.

7. The lentiviral vector of claim 6, which has 100% sequence identity with SEQ ID NO:

17.

8. A population of cells transduced with a lentiviral vector as defined in any one of claims 1 to 7.

9. The cells are CD34 ＋ Hematopoietic stem cells and CD34 ＋ The population of cells of claim 8 that is enriched in hematopoietic progenitor cells.

10. 10. The population of cells of any one of claims 8 and 9, wherein the cells are autologous.

11. A pharmaceutical composition comprising a lentiviral vector as defined in any one of claims 1 to 7 or a population of cells as defined in any one of claims 8 to 10, and a pharmaceutically acceptable carrier or diluent.

12. A lentiviral vector according to any one of claims 1 to 7, a population of cells according to any one of claims 8 to 10, or a pharmaceutical composition according to claim 11, for use as a medicament.

13. 12. The lentiviral vector of any one of claims 1 to 7, the population of cells of any one of claims 8 to 10, or the pharmaceutical composition of claim 11, for use in treating Diamond-Blackfan anemia in a subject in need thereof.

14. 8. The lentiviral vector of any one of claims 6 and 7 for use in treating Diamond-Blackfan anemia in a subject in need thereof.

15. 15. The lentiviral vector for use according to any one of claims 13 and 14, wherein the subject in need thereof is a human.

Images