Methods and compositions for DNA profiling

Abstract

To provide methods for constructing a DNA profile.SOLUTION: Methods for constructing a DNA profile comprise: preparing a nucleic acid sample; amplifying the nucleic acid sample with a plurality of primers that specifically hybridize to at least one target sequence comprising a single nucleotide polymorphism (SNP) and at least one target sequence comprising a tandem repeat sequence in a multiplex reaction so as to generate amplification products; and determining the genotypes of the at least one SNP and the at least one tandem repeat sequence in the amplification products, thereby constructing the DNA profile of the nucleic acid sample.SELECTED DRAWING: Figure 1

Description

Related Applications

[0001] This application is based on Patent Document 1 filed on January 14, 2015, and Patent Document 2 filed on August 28, 2014. 2 and patent document 3 filed on February 18, 2014, the contents of which are The entirety of which is incorporated herein by reference.

[0002] (Cross-reference to sequence listing, table, or computer program listing) This application has been submitted electronically along with a sequence listing. The sequence listing was created on February 13, 2015. The resulting file is provided as a file titled ILLINC276WO_Sequence_Listing.TXT and is of size The information in the electronic sequence listing is incorporated herein by reference in its entirety. can be. [Technical Field]

[0003] Embodiments provided herein relate to methods and compositions for DNA profiling. Some embodiments relate to a method for amplifying target sequences of varying sizes in a single reaction, for subsequent sequencing of the library. [Background technology]

[0004] Historically, the use of a subset of markers in the human genome has been used to identify individuals, or DNA. These markers are used to determine a fingerprint or profile. Short tandem repeats (STRs) that in combination are useful for distinguishing one person from another at the genetic level. The location or locus of these markers includes the positions of the intermediate tandem repeats (ITRs) and the intermediate tandem repeats (ITRs). DNA analysis is standardized in the analysis of DNA found at crime scenes. The number of repeat sequences is determined by the integrated DNA index, which is the standard for DNA profiling in criminal cases. These have been combined to create the Code of Inheritance and Discrimination Indicators (CODIS). These systems also include patrilineal and familial relationships. However, all current systems are electrophoretic systems. The separation of these repetitive loci is based on size segregation, so the separation in such a system For example, DNA profiling for forensic purposes is limited by the number of loci that can be detected. Some current commercial systems for ELISA are limited in their detection methods due to limitations of electrophoretic detection methods. Only 16 markers are sorted. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] U.S. Provisional Patent Application No. 62 / 103524 [Patent Document 2] U.S. Provisional Patent Application No. 62 / 043060 [Patent Document 3] U.S. Provisional Patent Application No. 61 / 940,942 [Patent Document 4] U.S. Patent No. 7,985,565 [Patent Document 5] U.S. Patent No. 7,115,400 [Patent Document 6] U.S. Patent No. 6,210,891 [Patent Document 7] U.S. Patent No. 6,258,568 [Patent Document 8] U.S. Patent No. 6,274,320 [Patent Document 9] International Publication No. 04 / 018497 [Patent Document 10] U.S. Patent No. 7,057,026 [Patent Document 11] International Publication No. 91 / 06678 [Patent Document 12] WO 07 / 123,744 [Patent Document 13] US Patent Application Publication No. 2007 / 0166705 [Patent Document 14] US Patent Application Publication No. 2006 / 0188901 [Patent Document 15] U.S. Patent No. 7,057,026 [Patent Document 16] US Patent Application Publication No. 2006 / 0240439 [Patent Document 17] US Patent Application Publication No. 2006 / 0281109 [Patent Document 18] International Publication No. 05 / 065814 Brochure [Patent Document 19] US Patent Application Publication No. 2005 / 0100900 [Patent Document 20] International Publication No. 06 / 064199 Brochure [Patent Document 21] International Publication No. 07 / 010251 Brochure [Patent Document 22] US Patent Application Publication No. 2012 / 0270305 [Patent Document 23] US Patent Application Publication No. 2013 / 0260372 [Patent Document 24] US Patent Application Publication No. 2013 / 0079232 [Patent Document 25] U.S. Patent No. 6,969,488 [Patent Document 26] U.S. Patent No. 6,172,218 [Patent Document 27] U.S. Patent No. 6,306,597 [Patent Document 28] U.S. Patent No. 7,001,792 [Patent Document 29] U.S. Patent No. 7,329,492 [Patent Document 30] U.S. Patent No. 7,211,414 [Patent Document 31] U.S. Patent No. 7,315,019 [Patent Document 32] U.S. Patent No. 7,405,281 [Patent Document 33] US Patent Application Publication No. 2008 / 0108082 [Patent Document 34] US Patent Application Publication No. 2009 / 0026082 A1 [Patent Document 35] US Patent Application Publication No. 2009 / 0127589 A1 [Patent Document 36] US Patent Application Publication No. 2010 / 0137143 A1 [Patent Document 37] US Patent Application Publication No. 2010 / 0282617 A1 [Patent Document 38] PCT / US2013 / 30867 [Non-patent literature]

[0006] [Non-Patent Document 1] Kivioja et al., Nat. Meth.9, 72-74 (2012) [Non-patent document 2] Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M. and Nyren, P. (1996) "Real-time DNA sequencing using detection of pyrophosphate release." Analytical Biochemistry 242(1), 84-9 [Non-patent document 3] Ronaghi, M. (2001) "Pyrosequencing sheds light on DNA sequencing." Genome Res. 11(1), 3-11 [Non-patent document 4] Ronaghi, M., Uhlen, M. and Nyren, P. (1998) "A sequencing method based on real-time pyrophosphate." Science 281(5375), 363 [Non-Patent Document 5] Deamer, DW & Akeson, M. "Nanopores and nucleic acids: prospects for ultrarapid sequencing." Trends Biotechnol. 18, 147-151 (2000) [Non-patent document 6] Deamer, D. and D. Branton, "Characterization of nucleic acids by nanopore analysis". Acc. Chem. Res. 35:817-825 (2002) [Non-Patent Document 7] Li, J., M. Gershow, D. Stein, E. Brandin, and JA Golovchenko, "DNA molecules and configurations in a solid-state nanopore microscope" Nat. Mater. 2:611-615 (2003) [Non-patent document 8] Soni, GV & Meller, "A. Progress toward ultrafast DNA sequencing using solid-state nanopores." Clin. Chem. 53, 1996-2001 (2007) [Non-Patent Document 9] Healy, K. "Nanopore-based single-molecule DNA analysis." Nanomed. 2, 459-481 (2007) [Non-Patent Document 10] Cockroft, SL, Chu, J., Amorin, M. & Ghadiri, MR "A single-molecule nanopore device detects DNA polymerase activity with single-nucleotide resolution." J. Am. Chem. Soc. 130, 818-820 (2008) [Non-Patent Document 11] Levene, MJ et al. "Zero-mode waveguides for single-molecule analysis at high concentrations." Science 299, 682-686 (2003) [Non-Patent Document 12] Lundquist, PM et al. "Parallel confocal detection of single molecules in real time." Opt. Lett. 33, 1026-1028 (2008) [Non-Patent Document 13] Korlach, J. et al. "Selective aluminum passivation for targeted immobilization of single DNA polymerase molecules in zero-mode waveguide nano structures." Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008) Summary of the Invention

[0007] The embodiment is not limited to the contents, but rather includes various genetic information about an individual. The present invention relates to a system and method for providing a more complete personal DNA profile. The identification of individuals allows for this profiling, which in turn allows for the development of personal and forensic genomics. Field-advancing methods and compositions are described.

[0008] DNA profiling is currently the biological technique of choice to determine the identity of a DNA sample. For example, the most common assay for determining a DNA profile is To determine the profile of the number of short tandem repeats (STRs) found in the genome of an organism. Analysis can be performed by size on electrophoresis gels or by capillary electrophoresis (CE). The method consists of amplifying defined STR sequences of up to 400 bp in length that can be differentiated by using Electrophoresis allows for size variations due to differences in the number of repeat STRs at a given locus, and therefore The CE system is used to detect PCR amplicon lengths between 50 and 500 bp. The limitations imposed by size fractionation methodologies (i.e., STs of overlapping amplicon sizes) To overcome this problem (the inability to differentiate R), current methods of DNA profiling Amplicons of overlapping size are labeled with different fluorescent dyes and have different emission spectra upon excitation. Different sets of labeled primers are utilized to generate overlapping amplicons. These labeling methods allow the dyes to be differentiated using differences in their excitation and emission spectra. Using profiling, current methods allow for the detection of six different probes in one DNA profiling run. It allows for the multiplexing of 24 different STR loci while using detectable dyes.

[0009] Current DNA profiling methodologies have many limitations. As mentioned above, size fractionation The system limits the number of loci that can be discretely determined at a given time. Another limitation of established methods for sequencing is that the DNA being analyzed is often degraded and The size range of some markers does not correspond to degraded DNA, e.g., The amplicons may be larger than the size of the degraded DNA fragments. Amplicons are likely to be very long, which may lead to loss of amplification of those long loci. When DNA analysts amplify degraded DNA samples to identify their STR profiles, e.g. Often, they are unable to detect all loci, for example in samples found at crime scenes. defects that make it difficult or impossible to match crime scene suspects to crime samples By default, for such samples, the DNA analyst selects If there is little choice and a voluntary sample is left, it may provide clues as to the identity of the individual. To identify other markers that may be useful, we are using single nucleotide polymorphisms (SNPs), miniSTRs, or Additional assays, such as mitochondrial DNA (mtDNA) analysis, must be performed. Precious samples must be spent on each assay without any certainty of ultimately succeeding in identifying individuals. Figure 1A shows the various possible routes to DNA testing, all of which are separate domains. workflow, requiring a precious sample aliquot. One or more simple workflows If rows need to be combined and potentially iterated multiple times, the resulting process is no longer It is not a simple or efficient use of precious samples.

[0010] The embodiments described in this application involve the generation of DNA profiles of individuals or organisms by next generation sequencing (NGS). The present invention provides methods, compositions and systems for determining DNA profiles. Figure 1B provides a solution to the problems and limitations of current methodologies for filing. 1 shows an exemplary workflow of the disclosed method in one embodiment. The sequences include short tandem repeats (STRs), medium tandem repeats (ITRs), and identity information. Informative Single Nucleotide Polymorphisms (iSNPs), Ancestry Informative Single Nucleotide Polymorphisms (aSNPs) and Phenotypes Numerous forensic-related mutations, including but not limited to informative single nucleotide polymorphisms (pSNPs), are Methods and compositions for combining related markers into one assay.

[0011] The present disclosure describes assays that overcome the limitations of current methodologies for DNA profiling. The disclosed embodiments are directed to multiplex amplification, library generation, and synthesis from a single nucleic acid sample. Method for sequencing isolated STRs, ITRs, iSNPs, aSNPs, and pSNPs in a single multiplex reaction The disclosed method provides a method for extracting sample D containing degraded DNA with minimal sample processing. Using low amounts of NA, multiple markers are analyzed in one experimental assay. Some embodiments may involve data banking of DNA profiles and / or criminal investigations. It can be used to generate DNA profiles that can be used for scanning. This embodiment has been developed to be sensitive enough to detect sub-nanogram amounts of DNA. The present invention provides methods and compositions for PCR that utilize non-conventional primer design parameters. Enables highly multiplexed PCR for the discrimination of STRs, ITRs and SNPs in one multiplexed reaction. In criminal casework, the methods and compositions of the invention can be used to, for example, reduce PCR and sequencing errors. - Includes a unique molecular identifier (UMI) that helps remove stutter from sequencing results See Non-Patent Document 1. Similarly, the compounds obtained from the methods and compositions disclosed herein The results are compatible with existing databases.

[0012] Thus, embodiments disclosed herein include providing a nucleic acid sample, detecting single nucleotide polymorphisms, At least one target sequence containing a single nucleotide polymorphism (SNP) and at least one target sequence containing a tandem repeat sequence. The nucleic acid sample is subjected to a multiplex reaction using a plurality of primers that specifically hybridize to the sequence. amplifying the nucleic acid sequence of ... and determining the genotype of at least one tandem repeat sequence, thereby determining the DNA profile of the nucleic acid sample. A method for constructing a DNA profile is provided, including constructing a file.

[0013] In some embodiments, the method includes generating a nucleic acid library from the amplification products. In some embodiments, the method includes sequencing the nucleic acid library. In some embodiments, the nucleic acid sample is from a human. The sample is from an environmental sample, a plant, a non-human animal, a bacterium, an archaea, a fungus, or a virus In some embodiments, the DNA profile is used to diagnose or prognose disease, cancer biomarkers, or other diagnostic or prognostic information. These are used for one or more of the following: identification of markers, identification of genetic abnormalities, or genetic diversity analysis. In some embodiments, DNA profiles are used in data banking, forensics, criminal investigations, In some embodiments, at least one of the following is used for paternity or personal identification: The SNPs are indicative of ancestry or phenotypic characteristics of the source of the nucleic acid sample. Each of the plurality of primers has a low melting temperature and / or has at least 24 primers. In some embodiments, each of the plurality of primers has a length of: In some embodiments, each of the plurality of primers has a melting temperature of less than 60° C. In some embodiments, the melting temperature of the plurality of primers is about 50° C. to about 60° C. Each has a length of at least 24 nucleotides. Each of the primers has a length of about 24 nucleotides to about 38 nucleotides. In some embodiments, each of the plurality of primers comprises a homopolymeric nucleotide sequence. In some embodiments, the nucleic acid sample is amplified by polymerase chain reaction (PCR). In some embodiments, the nucleic acid sample is used with conventionally designed primers. The amplification is carried out in an amplification buffer having an increased salt concentration relative to the salt concentration of the amplification buffer in which the nucleic acid is amplified. In some embodiments, the salt comprises KCl, LiCl, NaCl, or a combination thereof. In some embodiments, the salt comprises KCl. In some embodiments, the concentration of KCl in the amplification buffer is In some embodiments, the KCl concentration in the amplification buffer is less than about 150 mM. In some embodiments, the concentration of KCl in the amplification buffer is about 145 mM. In this embodiment, the SNPs are ancestral SNPs, phenotypic SNPs, identity SNPs, or combinations thereof. In some embodiments, the plurality of primers is specific for at least 30 SNPs. In some embodiments, the plurality of primers hybridizes to at least 50 SN In some embodiments, the tandem repeat sequence is a short tandem repeat sequence. The repeats are short strand repeats (STRs), medium tandem repeats (ITRs), or their mutations. In an embodiment, the plurality of primers specifically hybridizes to at least 24 tandem repeat sequences. In some embodiments, the plurality of primers is sized to fit at least 60 tandem repeat sequences. In some embodiments, the nucleic acid sample contains about 100 pg to about 100 ng of In some embodiments, the nucleic acid sample contains about 10 pg to about 100 pg of DNA. In some embodiments, the nucleic acid sample contains about 5 pg to about 10 pg of DNA. The acid sample comprises genomic DNA. In some embodiments, the genomic DNA is from a forensic sample. In some embodiments, the genomic DNA comprises degraded DNA. At least 50% of the genotypes for at least one SNP and at least one tandem repeat sequence are determined. In some embodiments, at least one SNP and at least one tandem repeat sequence are present. At least 80% of the genotypes in the array are determined. In some embodiments, at least one At least 90% of the genotypes of the SNPs and at least one tandem repeat sequence are determined. In some embodiments, at least one SNP and at least one tandem repeat gene In some embodiments, at least 95% of the types of each of the plurality of primers are determined. In some embodiments, the one or more tag sequences are including Murtags, capture tags, sequencing tags, unique molecular identifier tags, or combinations thereof. In some embodiments, the one or more tag sequences comprise a primer tag. In an embodiment, the one or more tag sequences comprise a unique molecular identifier tag.

[0014] The embodiments disclosed herein include providing a nucleic acid sample and detecting single nucleotide polymorphisms (SN P) and at least one target sequence comprising a tandem repeat sequence. The nucleic acid sample is subjected to a multiplex reaction using a plurality of primers that specifically hybridize to the and generating an amplification product. .

[0015] In some embodiments, the nucleic acid sample is not fragmented prior to amplification. In some embodiments, the target sequence is not enriched prior to amplification. The NP is characteristic of the ancestry or phenotype of the source of the nucleic acid sample. Each of the plurality of primers comprises one or more tag sequences. The above tag sequences may be used as primer tags, capture tags, sequencing tags, or unique molecular identifiers. In some embodiments, the method comprises: In some embodiments, the amplification product is amplified using a second primer. Each of the primers has a portion corresponding to the primer tag of the plurality of primers and In some embodiments, one or more of the second plurality of primers comprises one or more tag sequences. The tag sequence of includes a capture tag, or a sequence tag, or a combination thereof. In embodiments, the method includes adding a single-stranded binding protein (SSB) to the amplification product. In some embodiments, the nucleic acid sample and / or amplification products are subjected to polymerase chain reaction (PCR). In some embodiments, the nucleic acid sample and / or the amplified product is amplified by PCR. The salt concentration of the amplification buffer used with conventionally designed primers is increased. In some embodiments, the amplification is performed in an amplification buffer having a salt concentration of KCl. , LiCl, NaCl, or a combination thereof. In some embodiments, the salt comprises KCl. In some embodiments, the concentration of KCl in the amplification buffer is about 100 mM to about 200 mM. In some embodiments, the concentration of KCl in the amplification buffer is less than about 150 mM. The concentration of KCl in the amplification buffer is approximately 145 mM.

[0016] Embodiments disclosed herein provide a nucleic acid library comprising a plurality of nucleic acid molecules, The plurality of nucleic acid molecules comprises at least one tandem repeat sequence flanking a first pair of tag sequences and a tag The second pair of sequences includes at least one single nucleotide polymorphism (SNP) sequence adjacent to the second pair of sequences. Nucleic acid libraries constructed using the methods and compositions disclosed herein are provided. In some embodiments, at least one SNP is present in a gene that is a nucleotide sequence of a gene of interest that is a nucleotide sequence of interest. or phenotypic characteristics.

[0017] The embodiments disclosed herein involve the detection of at least one short target sequence and a small number of target sequences from a nucleic acid sample. providing a plurality of primers that specifically hybridize to at least one long target sequence; By amplifying nucleic acid samples using multiple primers in a single multiplex reaction, at least Each amplification product is a short amplification product and at least one long amplification product. Each of the comprises one or more tag sequences.

[0018] In some embodiments, the short target sequence comprises a single nucleotide polymorphism (SNP) and the long target sequence comprises a In some embodiments, the one or more tag sequences comprise a primer tag. , capture tags, sequencing tags, unique molecular identifier tags, or combinations thereof. In some embodiments, each of the plurality of primers has a low melting temperature and / or In some embodiments, the primers have a length of at least 24 nucleotides. Each of the polymers has a melting temperature of less than 60° C. In some embodiments, multiple polymers Each of the dimers has a melting temperature of about 50° C. to about 60° C. In some embodiments, Each of the primers has a length of at least 24 nucleotides. In an embodiment, each of the plurality of primers is between about 24 nucleotides and about 38 nucleotides in length. In some embodiments, each of the plurality of primers has a homopolymer nucleic acid sequence. In some embodiments, the nucleic acid sample comprises a polymerase chain reaction (PCR) sequence. In some embodiments, the SNPs are ancestral SNPs, phenotypic SNPs, identity SNPs, or phenotypic SNPs. In some embodiments, the plurality of primers is a single nucleotide polynucleotide (SNP), ... or a combination thereof. , specifically hybridizes to at least 30 SNPs. The primers specifically hybridize to at least 50 SNPs. In this study, the tandem repeats may be short tandem repeats (STRs), medium tandem repeats (ITRs), or other In some embodiments, the plurality of primers comprises at least 24 tandem In some embodiments, the plurality of primers specifically hybridize to the repeat sequence. , which specifically hybridizes to at least 60 tandem repeat sequences.

[0019] Embodiments disclosed herein provide kits comprising at least one container means; At least one container means contains a plurality of the primers disclosed herein.

[0020] In some embodiments, the kit further comprises reagents for an amplification reaction. In some embodiments, the reagent is a polymerase chain reaction (PCR) amplification buffer. In this embodiment, the amplification buffer is a buffer similar to that used with conventionally designed primers. In some embodiments, the salt is KCl, LiCl, N In some embodiments, the salt comprises KCl. In some embodiments, the concentration of KCl in the amplification buffer is about 100 mM to about 200 mM. In some embodiments, the concentration of KCl in the amplification buffer is less than about 150 mM. The concentration of KCl in the buffer solution is approximately 145 mM. [Brief explanation of the drawings]

[0021] [Figure 1] 1A and 1B are diagrams illustrating the differences between A) the current workflow of DNA profiling versus B) that of an exemplary embodiment of the present disclosure. [Figure 2] FIG. 1 shows an exemplary embodiment of a method for generating a library useful for DNA profiling. [Figure 3] FIG. 1 shows another exemplary embodiment of a method for generating a library useful for DNA profiling. [Figure 4]4A-D are line graphs showing electrophoresis results of how primer pairs designed by conventional methods and subsequently established PCR primer design protocols and limitations, when combined with primers designed according to the disclosed methods, can cause nonspecific amplification of genomic targets and obscure detection of desired amplicons; A) 10 primer pairs designed according to the disclosed methods to SNP loci; B) and D) 10 primers plus an additional primer pair designed according to conventional methods, demonstrating that the additional primer pair interferes with the 10 primer pairs during amplification; and C) 10 primer pairs plus an additional primer pair, also designed according to the disclosed methods below, which successfully amplified all target SNPs. The X-axis is library fragment size (bp), and the Y-axis is fluorescence units (FU) of the amplification peak of the amplified fragments. [Figure 5] Figures 5A-E show boxplots illustrating exemplary results of an experiment following the workflow outlined in Figure 2, in which a panel of 56 STRs and a combination of 75 identity-informative SNPs (iSNPs), ancestry-informative SNPs (aSNPs), and phenotype-informative SNPs (pSNPs) were used to identify samples in a multiplex amplification and sequencing reaction. Replicated results demonstrating successful amplification and sequencing of STR loci from the panel were reported; A) boxplots demonstrating intralocus balance for 25 heterozygous STRs from the panel, B) boxplots demonstrating low stutter for the majority of the 56 STR loci, C) boxplots demonstrating sequence coverage for STR loci, D) boxplots demonstrating sequence coverage for SNPs, and E) boxplots demonstrating balance for 22 heterozygous SNPs from the panel. The lower error bar indicates the minimum value, the upper error bar indicates the maximum value, the lower box reports the 25th percentile, the upper box reports the 75th percentile, and the mean value is the intersection of the lower and upper boxes. [Figure 6]FIG. 6 shows a series of bar graphs showing plots of exemplary STR loci from the experiment of FIG. 5. The plots show different allele calls for the STRs in the panel of FIG. 5. [Figure 7] Figures 7A-E show box plots illustrating exemplary results of an experiment following the workflow outlined in Figure 3, in which a panel of 26 STRs and a combination of 94 iSNPs, aSNPs, and pSNPs were used to identify samples in a multiplex amplification and sequencing reaction. Replicated results demonstrating successful amplification and sequencing of STRs from the panel were reported: A) box plots demonstrating intralocus balance for 21 heterozygous STRs from the panel, B) box plots demonstrating low stutter for 26 STR loci (39 of 47 alleles at the 26 loci showed no stutter), C) box plots demonstrating sequence coverage for STR loci (read numbers normalized using UMI), D) box plots demonstrating sequence coverage for SNPs, and E) box plots demonstrating balance for 21 heterozygous iSNPs from the panel. The lower error bar indicates the minimum value, the upper error bar indicates the maximum value, the lower box reports the 25th percentile, the upper box reports the 75th percentile, and the mean value is the intersection of the lower and upper boxes. [Figure 8] FIG. 8 is a series of bar graphs showing plots of exemplary STR loci from the experiment of FIG. 7. The plots show different allele calls for the STRs in the panel of FIG. 7. [Figure 9] Figure 1 shows bar graphs of samples analyzed without UMIs and with UMIs. The left panel of each set represents samples analyzed without UMIs, and the right panel of each set represents samples analyzed with UMIs. The X-axis designates the number of STR repeats, and the Y-axis designates the counts of a particular allele. Error lines within the bars separate sequencing errors (top of the bar) from correct sequences within the STR sequence (bottom of the bar). [Figure 10]10A-B show exemplary results from an experiment in which the DNA ratio was 90:10 = male:female. A) Results of a subset of STR locus calls for STR loci using the current capillary electrophoresis DNA profiling method, and B) Results of some STR locus calls for multiple STR loci using the method of the present application. Both the CE method and the method of the present application detected low levels of male DNA contamination. [Figure 11] FIG. 10 is a bar graph showing that specific STR loci were detected on the Y chromosome in the experiment of FIG. 9, and further demonstrates that while two experiments would need to be performed with current CE methodology to do so, the present application is able to detect contaminating male DNA and specific STR loci from that male's DNA. [Figure 12] 1 is a table showing exemplary high-level sequencing results from an experiment with 12 sample and reference individuals, demonstrating the consistency of STR and SNP calls between the two replicates. [Figure 13] 13 is a table showing exemplary population statistics from the experiment shown in FIG. 12. [Figure 14] 13 is a table showing exemplary phenotypic predictions based on pSNP genotypes from the experiment shown in FIG. 12. [Figure 15] 13 is a graph showing exemplary ancestral type mapping based on aSNP genotypes from the experiment shown in FIG. 12. [Figure 16] 16A-E are bar graphs showing exemplary STR locus plots from the experiment of FIG. [Figure 17] 17A-B are bar graphs showing exemplary SNP plots from the experiment of FIG. [Figure 18] 18A-B show showbox plots illustrating the intralocus balance of exemplary STR and SNP loci from the experiment of FIG. 12. [Figure 19] 19A-B are graphs showing stutter analysis of exemplary STR loci from the experiment of FIG. [Figure 20]FIG. 13 is a table showing exemplary isometric heterozygotes within STR loci from the experiment of FIG. 12. [Figure 21] FIG. 13 is a block diagram showing an exemplary genetic plot based on mutations at STR D8S1179 from the experiment in FIG. 12. [Figure 22] FIG. 13 is a block diagram showing an exemplary genetic plot based on mutations at STR D13S317 from the experiment in FIG. 12. [Figure 23] 1 is a table showing exemplary genotyping results using degraded DNA. [Figure 24] 24A-B show exemplary STR genotyping results and intralocus balance with differential DNA input. [Figure 25] 25A-B show exemplary SNP genotyping results and intralocus balance with differential DNA input.

[0022] (definition) All patents, applications, published applications and other publications referenced herein are hereby incorporated by reference. The material is incorporated by reference in its entirety. Contrary to any definition set forth in any patent, application, published application, or other publication incorporated by reference. If any of the following terms are used herein in a manner that is inconsistent with the terms used herein, the same shall apply to all such terms. The usage takes precedence over the definitions incorporated herein by reference.

[0023] As used herein, unless otherwise expressly or by context, the singular The forms "a," "an," and "the" include plural references, e.g., otherwise, clearly, or Unless the context dictates otherwise, a dimer includes one or more dimers.

[0024] As used herein, the terms "DNA profile," "genetic fingerprint," and "genetic "Genotype profile" is used interchangeably and includes tandem repeats, single nucleotide polymorphisms (SNPs), etc. A DNA profile refers to allelic variation within a collection of polymorphic loci. As used herein, DNs are useful in forensic science to identify individuals based on their The A profile is aimed at the diagnosis and prognosis of diseases including cancer, the identification of cancer biomarkers, and genetic Analysis, genetic diversity analysis, identification of genetic abnormalities, data banking, forensic science, criminal investigation , and other applications such as paternity or personal identification.

[0025] The terms "polynucleotide," "oligonucleotide," "nucleic acid," and "nucleic acid molecule" are used interchangeably. and are used interchangeably herein to refer to polymeric forms of nucleotides of any length. , ribonucleotides, deoxyribonucleotides, their analogs, or mixtures thereof This term refers only to the primary structure of the molecule. Thus, the term may include triple-stranded structures. , double-stranded and single-stranded deoxyribonucleic acid ("DNA"), and triple-stranded, double-stranded and single-stranded Contains single-stranded ribonucleic acid ("RNA").

[0026] As used herein, "sequence identity" or "identity" in the context of two nucleotide sequences "Identity" or "homology" is the maximum match over a specified comparison window. It includes references to residues in the two sequences that are the same when aligned as in the comparison window. The portion of the nucleotide sequence in the cDNA is compared to a reference sequence for optimal alignment of the two sequences. If the number of identical nucleotides is less than 1, the percentage may contain additions or deletions (i.e., gaps). The number of matched positions was determined by determining the number of positions where acid-base residues were present in both sequences. The number of matched positions is obtained, and the number of matched positions is divided by the total number of positions in the comparison window. It is calculated by multiplying by 100 to get the percentage of sequence identity.

[0027] As used herein, "substantially complementary or substantially identical" refers to two It means that the nucleic acid sequences have at least 90% sequence identity. Preferably, two nucleic acids The sequences have at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity; or "Substantially complementary or substantially identical" means that two nucleic acid sequences are identical to each other with high stringency. This means that the nucleic acid is capable of hybridizing under certain conditions or conditions.

[0028] The aspects and embodiments of the invention described herein "consist of" and "comprise" aspects and embodiments. It is understood that "consisting essentially of" includes and / or "consisting essentially of."

[0029] Other objects, advantages and features of the present invention will become apparent from the following specification taken in conjunction with the accompanying drawings. It will be something like that.

[0030] (How to build a DNA profile) Established methodologies for determining DNA profiles are limited in a number of ways. For example, current methods produce different results due to the variation in the length of tandem repeat sequences found in DNA samples. Detect size changes in amplified loci. Multiplex STR amplification for visualization. In addition, amplification can be performed to identify a variety of amplicon sizes within the size separation limits of the electrophoresis system. The stem must be designed to have an interval of approximately 50 to 500 bp. Thus, a limited number of repeat sequences can be visualized in a single assay. The LOBALFILER PCR Amplification Kit (Applied Biosystems) reportedly By using six different dyes, 24 STR loci can be differentiated. Furthermore, if the sample DNA is degraded, as is common with crime scene DNA samples, such The method has problems that make longer amplification products impossible, resulting in an incomplete DNA profile. Current methods are also often not sensitive enough to detect small amounts of contaminating DNA. Therefore, mixed samples may go undetected and unreported, This can be problematic in criminal casework. Thus, current methods lead to incomplete results. This can lead to inconclusive results and be detrimental to DNA profiling. This can result.

[0031] Additionally, current targets include determining the ancestry of the sample, possible eye color, and other individual sample information. Some sequencing methods do not include information on phenotypic traits such as STR and S. For example, we have attempted to incorporate both STR and SNP detection into our library followed by custom enrichment of STRs and SNPs. Library construction has been attempted, but library construction methods have the potential to eliminate target sequences. Not all STRs are fully covered, as some sample shear is commonly involved. Furthermore, established primer design methods and protocols are available for the synthesis of long sequences (e.g., STs). Primer sets for amplifying DNA fragments (e.g., SNPs) or short sequences (e.g., SNPs) can be provided. It is possible, but the combination of both has not been successful in one reaction.

[0032] This disclosure describes solutions to the problems and limitations of current DNA profiling systems. The methods and compositions described herein involve the use of PCR to detect a combination of STRs and SNPs. This allows for a single assay to amplify the target and prepare a library for sequencing. An unexpected discovery during the development of the assay of the present invention was that For example, when using non-traditional and counter-intuitive primer designs, Amplifying both STRs and SNPs in one reaction allows the sequence of each gene to be determined. Surprisingly, the current situation surrounding primer design is When designing amplification primers using parameters contrary to the tenets of The amplification of the short SNP region and the amplification of the large SNP region were more or less balanced. Primers were created that allow for the multiplex amplification of both STRs and SNPs together. This made it possible for

[0033] A set of amplicons of different sizes can be generated from a single amplification reaction for DNA profiling as well. Determining the DNA profile of the organisms disclosed herein whenever desired For example, methods and compositions for PCR can be used to It contains both large gene regions and short SNP regions, each ranging in size from hundreds to thousands of base pairs. If a different amplicon of different size, less than 100 base pairs, can be generated, the present invention will be described. The methods and compositions described herein provide inventions that would not be possible without the practice of the disclosed methods. It may be possible to successfully simultaneously amplify gene and SNP targets. The methods and compositions disclosed herein can be used to treat, for example, humans, non-human primates, animals, plants, viruses, The methods and compositions of the present invention can be applied to any organism, including bacteria, fungi, etc. The target genome is used for DNA profiling (e.g., forensic science, paternity testing, personal identification, etc.). It is not only useful for animals and humans, but also as a marker for cancer and disease, a marker for genetic abnormalities, etc. It can also be used for other targets, such as those where the target genome is not human-based. It can be used.

[0034] Thus, embodiments disclosed herein include providing a nucleic acid sample, At least one target sequence containing a single nucleotide polymorphism (SNP) and at least one target sequence containing a tandem repeat sequence The nucleic acid sample is amplified using a plurality of primers that specifically hybridize to one target sequence. and detecting at least one SNP and at least one tandem repeat in the amplification product. determining the genotype of the repeat sequences, thereby constructing a DNA profile of the nucleic acid sample; The present invention provides a method for constructing a DNA profile, comprising:

[0035] These include, but are not limited to, array-based hybridization and sequencing. It should be understood that any suitable technique not disclosed herein can be used to determine the genotype of the target sequence. As will be appreciated by those skilled in the art, in some embodiments, the methods disclosed herein may be The method involves generating a nucleic acid library, such as a sequencing library, from the amplification products. , as well as sequencing the nucleic acid library.

[0036] In some embodiments, the present disclosure provides a method for the detection of malaria, for example for use in collective or individual data banking. and compositions for DNA profiling, including simultaneous identification of STRs and iSNPs for the detection of HIV-1-associated ... In such data banks, individuals are typically known and therefore personal data Not necessarily. However, if additional information is desired, simultaneous identification of the target of the additional information is required. Short tandem repeat sequences are well known in the art and can be added for other purposes. They consist of repeated di- or trinucleotide sequences. Typically, SNPs are considered to be repeat sequences of 4 to 7 nucleotides. It can be in any form that can provide insight into a person's physical characteristics. The examples shown are SNPs (aSNPs) and phenotypes that provide clues to ancestry or genetic traits. These are phenotypically informative SNPs that provide clues to phenotypic characteristics. In the method described in, DNA profile assays are combined with STR and ITR locus determination. , any number of these SNPs can be included.

[0037] For example, the present disclosure provides additional methods and methods that include additional targets along with STRs and iSNPS. When more detailed information about an individual is desired, e.g., in a criminal case, If the sample is from an unknown individual or group of individuals, as in the case of a work Informative markers were identified as STRs, as well as SNPs associated with ancestry (aSNPs) and phenotypic variation (Table Additional iSNPs, such as SNPs related to the current informative SNPs, can be added. The information may provide insight into, for example, an unknown individual's genetic traits, eye color, hair color, etc. This can be used to assist researchers in The additional information was previously unknown using current methods of DNA profiling. This can provide a more complete DNA profile of the individual.

[0038] The methods and compositions disclosed herein are suitable for detecting subnanogram amounts of nucleic acid molecules. Furthermore, the methods and methods disclosed herein are designed to be sensitive enough to detect The composition contains low quality nucleic acids, such as degraded and / or fragmented genomic DNA from forensic samples. It may be useful to amplify nucleic acid samples consisting of molecules. The nucleic acid sample may be a purified sample or Or, for example, oral swabs that can be impregnated with saliva, blood, or other bodily fluids. It may be crude DNA containing lysates from plastic, paper, cloth or other substrates. Thus, in some embodiments, the nucleic acid sample contains small amounts of DNA, such as genomic DNA, or DNA. For example, the nucleic acid sample may contain fragmented portions of A. , 8pg, 9pg, 10pg, 11pg, 12pg, 13pg, 14pg, 15pg, 16pg, 17pg, 18pg, 19pg, 20pg, 30 pg, 40pg, 50pg, 60pg, 70pg, 80pg, 90pg, 100pg, 200pg, 300pg, 400pg, 500pg, 600pg , 700pg, 800pg, 900pg, 1ng, 10ng, 100ng, or less than these, Within a range defined by any two of the values, for example, 10pg to 100pg, 10pg to 1ng, 100pg to 1n The amount of nucleic acid (for example, genomic DNA) may be 1 g, 1 ng to 10 ng, or 10 ng to 100 ng. In some embodiments, the nucleic acid sample contains between about 100 pg and about 1 ng of nucleic acid (e.g., genomic DNA). In some embodiments, the nucleic acid sample may contain more than about 62.5 pg of nucleic acid ( For example, the amount of genomic DNA may be included. In some embodiments, sonication or No additional fragmentation steps, such as endonuclease digestion, are included in the fragmentation procedure.

[0039] In some embodiments, the methods and compositions disclosed herein are directed to, for example, SNPs, S Genotype one or more target sequences, such as TR, in sub-nanogram quantities and / or degraded For example, the methods disclosed herein can be used to successfully determine the presence of nucleotides in even poorly defined nucleic acid samples. and the composition is about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, 26 %, 97%, 98%, 99%, 100%, or more, or any two of the above values In some embodiments, the genotypes disclosed herein can be determined in a range between The methods and compositions described herein may be used to identify approximately 50%, 80%, 90%, 95%, 98% or more of the target sequence. In some embodiments, the methods disclosed herein can be used to determine genotypes. The methods and compositions may be used to identify approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, Intralocus balance of 96%, 97%, 98%, 99%, 100%, or a range between any two of the above values can be achieved.

[0040] In forensic investigations, multiple primers are useful to prevent, for example, PCR and sequencing errors, sequence It may include a unique molecular identifier (UMI) that helps remove stutter and the like from the results of the determination. See the aforementioned Non-Patent Document 1. As discussed in more detail elsewhere in this disclosure, The inclusion of UMIs in the markers also allows for the identification of mutations within tandem repeat loci and, further, for the identification of mutations within the DNA profile. The present invention also enhances the utility of the present methods and compositions for other purposes, such as filtering and eigenanalysis. Meru.

[0041] Thus, in some embodiments, the genotype of the tandem repeat sequences disclosed herein may contain sequence variations within the tandem repeat locus. Homozygotes for the tandem repeat (e.g., 13, 13 for D9S1122) have a sequence within the tandem repeat. It can be identified as an isometric heterozygote based on a mutation in the chromosome. Thus, consideration of intralocus sequence variation is useful in, for example, the methods disclosed herein for genetic analysis. This would greatly enhance the usefulness of the method presented. Methods for constructing nucleic acid libraries

[0042] The embodiments disclosed herein include providing a nucleic acid sample and detecting single nucleotide polymorphisms (SN P) and at least one target sequence comprising a tandem repeat sequence. and amplifying the nucleic acid sample using a plurality of primers that specifically hybridize to the The present invention provides a method for constructing a nucleic acid library, comprising:

[0043] The methods and compositions disclosed herein are suitable for detecting subnanogram amounts of nucleic acid molecules. Furthermore, the methods and methods disclosed herein are designed to be sensitive enough to detect The composition contains low quality nucleic acids, such as degraded and / or fragmented genomic DNA from forensic samples. It may be useful to amplify nucleic acid samples consisting of molecules. The nucleic acid sample may be a purified sample or Or, for example, oral swabs that can be impregnated with saliva, blood, or other bodily fluids. The DNA may be either crude DNA containing lysates from plastic, paper, cloth, or other substrates. Thus, in some embodiments, the nucleic acid sample contains small amounts of DNA, such as genomic DNA, For example, the nucleic acid sample may contain about 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, or fragmented DNA. pg, 8pg, 9pg, 10pg, 11pg, 12pg, 13pg, 14pg, 15pg, 16pg, 17pg, 18pg, 19pg, 20pg, 30pg, 40pg, 50pg, 60pg, 70pg, 80pg, 90pg, 100pg, 200pg, 300pg, 400pg, 500pg, 600 pg, 700pg, 800pg, 900pg, 1ng, 10ng, 100ng, or less than these, Within a range defined by any two of the values, for example, 10pg to 100pg, 10pg to 1ng, 100pg to It may contain an amount of nucleic acid (e.g., genomic DNA) of 1 ng, 1 ng to 10 ng, 10 ng to 100 ng, etc. In some embodiments, the nucleic acid sample contains between about 100 pg and about 1 ng of nucleic acid (e.g., genomic DNA). In some embodiments, the nucleic acid sample may comprise an amount of A) greater than about 62.5 pg of nucleic acid. In some embodiments, the amount of DNA extracted from the sample may be sonicated or extracted using a sonicator. does not include an additional fragmentation step such as endonuclease digestion.

[0044] In some embodiments, the methods disclosed herein allow for downstream parallel sequencing. The assay includes amplification and library preparation of two PCR master mixes, two Contains a thermostable polymerase, two primer mixes, and library adapters In some embodiments, the sample of DNA is isolated from target-specific regions and non-target-specific tags. Using a first set of amplification primers containing the region as well as a first PCR master mix, The tag region may be amplified over several cycles. It may be any sequence such as an amplification tag region, a sequencing tag region, or a UMI tag region. For example, the tag region may be used in a second or subsequent round of amplification, e.g., for library generation. In some embodiments, the method may be a template for amplification primers utilized in The method includes adding a single-stranded binding protein (SSB) to the first amplification product. The recoat is removed and used in one or more downstream sequencing workflows, and in the same or a second The PCR master mix may contain one or more additional tag sequences, such as sequence tags specific to the PCR master mix. a tag region of the first amplification primer, such as a universal tag region or an amplification tag region The DNA can be amplified a second time using a second set of amplification primers specific for the DNA. The library of the original DNA sample is now ready for sequencing.

[0045] An alternative method may involve performing the first amplification in a small volume (e.g., 15 ul), Instead of transferring the recoat to a new location for the second round of amplification, Additional reagents for the run can be added to the tube.

[0046] Once the library is generated, it can be purified and quantified. In the example, purification is performed using AMPURE XP beads, which serve to purify the DNA fragments from the reaction components. This can be done by processing the sample through a substrate such as a PET film (Coleman Coulter). Another method involves the binding of a purification moiety, such as a hapten moiety, to a second set of amplification primers. For example, biotin is incorporated into the primers of the second set of amplification primers. If the sample is entrapped, the library can be cleaved using, for example, streptavidin moieties on beads. Using a capture strategy, the library can be captured using a bead-based standard. However, multiplexing can also be used to standardize and quantify the results. If the reaction is performed without BBN, purify and quantify the library or For example, libraries can be prepared by methods known in the art. As mentioned above, various methods are available for analysis, including gel electrophoresis, bioanalyzers, qPCR, spectrophotometry, and quantification kits (e.g., For example, PicoGreen can be used for quantification. After quantification, the library can be sequenced by parallel sequencing.

[0047] In some embodiments, the first amplification primer used to amplify the target DNA Because the set is provided at such limited concentrations, an aliquot of the first amplification reaction If a new tube is added and reagents from the second amplification reaction are added, There was minimal to undetectable carryover amplification from the first and second sets of timers. No washing steps are required between reactions. In some embodiments, the amplification primers for the initial PCR are The concentrations of mers were approximately 0.5nM, 0.6nM, 0.7nM, 0.8nM, 0.9nM, 1.0nM, 1.5nM, 2.0nM, 3.0nM, 4 0nM, 5.0nM, 6.0nM, 7.0nM, 8.0nM, 9.0nM, 10.0nM, 11.0nM, 12.0nM, or less or within a range between any of these values, e.g., 0.5 nM to 1.0 nM, 1.0 nM to 12 nM, 0 In some embodiments, the concentration of amplification primers for the initial PCR is between 0.8 nM and 1.5 nM. is about 0.9 nM to about 10 nM.

[0048] Figure 2 shows an exemplary workflow for one embodiment of the disclosed method. The DNA sequence contains the target sequence and the region flanking the amplification tag region (which may be the same or different). A first primer set containing the target sequence and a tag at both ends is used to amplify the first primer set containing the target sequence and a tag at both ends. An aliquot of the amplicon from the first PCR is then purified using a primer set specific for the first tag sequence. It was further amplified using a second set of primers, with primer sequences (i5 and i7 adapters) and sequencing the target sequences (target sequences), thereby obtaining sequences used for parallel sequencing. A library containing target DNA sequences flanked by i5 and i7 sequences is generated, where i5 and i7 sequences are It is used in the synthetic sequence popularized by Lumina.

[0049] An example of an alternative workflow for determining the DNA profile from a sample is described in Figure 3. In this example, the DNA target is composed of a target sequence, a non-target tag sequence (same or different), and a label. A first primer containing an additional unique molecular identifier sequence or sequence adjacent to the UMI, which sequence contains randomized bases. Amplified using primer pairs. UMI is used, for example, during the library construction process. Errors that occur during the PCR (e.g., PCR artifacts or misincorporation) are detected by bioinformatics. The use of UMIs in DNA profiling can be used to reduce or eliminate Eliminating errors, which can be important if samples are sequenced for criminal casework In this example, the first round of amplification is performed in two cycles. This was followed by the addition of single-stranded binding protein (SSB) and incubation at 37°C for 15 minutes. Incubation follows, and during the second round of amplification, This is followed by inactivation at 95°C for 5 min, which effectively quenches further amplification. The mechanism is unknown. However, the addition of SSB irreversibly binds to the single-stranded first amplification primer, preventing them from being subsequently This is thought to prevent the nucleotides from participating in the amplification reaction. A second primer set containing sequence tags and a second PCR mix are then added to perform sequencing. Get the fixed library.

[0050] (nucleic acid library) The embodiments disclosed herein provide nucleic acid libraries that can be used for sequencing. In some embodiments, the nucleic acid libraries disclosed herein comprise a plurality of nucleic acid molecules. The plurality of nucleic acid molecules may comprise at least one tandem sequence flanking the first pair of tag sequences. at least one single nucleotide polymorphism (SNP) sequence adjacent to the second pair of tandem repeat sequences and tag sequences; Includes.

[0051] As outlined herein, the size of the nucleic acid molecule can be varied in accordance with the methods and compositions disclosed herein. The use of tandem repeats (e.g., STRs) can vary significantly from target sequences containing tandem repeats. Amplified nucleic acid molecules may have large sizes, while those amplified from target sequences containing SNPs may be It will be understood by those skilled in the art that the widened nucleic acid molecule may have a small size. For example, nucleic acid molecules can contain from fewer than 100 nucleotides to hundreds or thousands of nucleotides. Therefore, the size of the nucleic acid molecule may be about 50 bp, about 60 bp, about 70 bp, about 80 bp, about 90 bp, or , approximately 100bp, approximately 110bp, approximately 120bp, approximately 130bp, approximately 140bp, approximately 150bp, approximately 200bp, approximately 300bp, approximately 4 00bp, approximately 500bp, approximately 600bp, approximately 700bp, approximately 800bp, approximately 900bp, approximately 1kb, or any length greater than 1kb In some embodiments, the minimum size of a nucleic acid molecule may range between It may be about or less than 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, or 100 bp in length. In some embodiments, the maximum size of the nucleic acid molecule is about, or 100 bp, 150 bp, 200 bp, 2 It may be 50 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, or greater than 1 kb in length.

[0052] In cluster generation, library fragments are generated by capturing DNA library fragments, e.g. Immobilized on a substrate such as a slide containing homologous oligonucleotide sequences for immobilization. The immobilized DNA library fragments are disclosed in Patent Documents 4 and 5. The cluster amplification method is used to amplify the contents of each fragment, and the entire contents of each fragment are used to The incorporated materials of U.S. Patent Nos. 5,999,292 and 5,999,292 are incorporated herein by reference. To form an array consisting of clusters or "colonies" of immobilized nucleic acid molecules, A method of solid-phase nucleic acid amplification is described that allows the amplification product to be immobilized on a solid support. Each cluster or colony on such an array contains multiple identical immobilized polymers. a nucleotide strand and a plurality of identical immobilized complementary polynucleotide strands. Arrays so formed are commonly called "clustered arrays." The products of solid-phase amplification reactions such as those described in Patent Documents 4 and 5 are generated by immobilizing poly(2-methyl-2-propanol). The so-called annealing of a pair of nucleotide strands with immobilized complementary strands A "bridged" structure in which both strands are immobilized at their 5' ends onto a solid support, preferably via a covalent bond. Cluster amplification methods use immobilized nucleic acid templates to generate immobilized amplicons. 1 is an example of a method for producing the conjugates provided herein. Other suitable methods may be used. Immobilized amplicons can also be generated from immobilized DNA fragments generated according to the method. For example, one or more clusters or colonies may be identified by one or more of each pair of amplification primers. can be generated via solid-phase PCR if both primers are immobilized. However, the methods described herein do not necessarily involve the use of any particular sequencing preparation method or sequencing assay. The platform is not limited to other parallel sequencing platforms. It may be suitable for manufacturing methods and associated sequencing platforms.

[0053] (Primer) The embodiments disclosed herein involve the detection of at least one short target sequence and a small number of target sequences from a nucleic acid sample. providing a plurality of primers that specifically hybridize to at least one long target sequence; By amplifying nucleic acid samples using multiple primers in a single multiplex reaction, at least Each amplification product is a short amplification product and at least one long amplification product. Each of the following contains one or more tag sequences. 1 to 2.

[0054] Multiplex amplification of large target sequences (e.g., STRs, ITRs) and small target sequences (e.g., SNPs) In width, primers are spaced apart to allow balanced amplification across all target types. The methods and compositions disclosed herein allow for multiple longitudinal assays to be performed in a single multiplex reaction. For example, multiple primers can be used to amplify a repeating target sequence. 4, 6, 8, 10, 12, 14, 16, 18, 24, 30, 40, 50, 60, 70, 80, 90, 100 or more, Or, a number of vertical columns in a range between any two values, such as 4-12, 10-24, or 30-100. In some embodiments, the primers can specifically hybridize to the repeat sequence. In some embodiments, the tandem repeat sequence may be specifically hybridized to at least 24 tandem repeat sequences. The plurality of primers can specifically hybridize to at least 60 tandem repeat sequences. The methods and compositions disclosed herein amplify multiple SNP target sequences in a single reaction. For example, multiple primers can be used, such as about 4, 6, 8, 10, 12, 14, or , 16, 18, 24, 30, 40, 50, 60, 70, 80, 90, 100 or more, or, 4 to 12, 10 to 24, It specifically hybridizes to a number of SNP sequences within a range between any two values, such as 30 and 100. In some embodiments, the plurality of primers may be specific for at least 30 SNP sequences. In some embodiments, the primers may hybridize differentially. can specifically hybridize to 50 SNP sequences.

[0055] Design primers following established criteria and wisdom for successful primer design. When using , short SNP target sequences are preferentially amplified over long STR target sequences. Furthermore, at least the clusters are generated and the clusters themselves In an array by synthesis workflow, where the entire body is sequenced (e.g., Illumina Seq The following synthetic sequences (SBS, disclosed elsewhere herein) related to the sensor: ), and preferential cluster amplification of short library SNP fragments also occurred. To overcome this, a new strategy is to balance the short SNP target sequence with the long STR target sequence. This was required to design primers that would allow for successful amplification.

[0056] One strategy involved designing primers for STR amplification, which amplifies repeat sequences. STRs are often embedded within larger repeat regions; therefore, STR amplification Designing specific primers for STRs and their flanking sequences can be problematic. The region is often AT-rich. In one example, the design criteria for conventional and well-established PCR Primers were designed to the region of interest using a standard anti-sense design strategy. Established criteria for primer design include, among other criteria: 1) the shortest possible primer length; The optimal length is 18-22 nucleotides; 2) the Tm should be in the range of 55-58°C; 3) GC content should be approximately 40-60%, and 4) repetitive AT dinucleotide regions should be avoided. and states that <4 dinucleotide AT repeats are the maximum. longer than typical PCR primers, such as 23–35 nucleotides in length, rather than a single primer Primers are designed so that they have a low melting temperature (Tm), e.g., about 54°C instead of about 58°C. ), and the primers are AT-rich, and conventional, established PCR conditions are used. Three parameters that should be avoided for optimal primer design. Surprisingly, these long, AT-rich, low-Tm primers Indeed, primers with high Tm and few ATs multiplexed STRs better than short primers with high Tm. Without being bound by any theory, it was discovered that, according to established PCR design criteria, Short primers designed with this in mind may form dimers with high melting temperatures, Therefore, they efficiently form dimers under normal PCR conditions, while long, low-Tm primers can form dimers at a fairly low Tm and are therefore not stable to dimer formation. As a result, under normal amplification conditions, short, high Tm primers (e.g., 18–22 Increased involvement of long, low-Tm primers compared to nucleotides (60°C Tm, 50% GC content) It is conceivable that this was possible.

[0057] Long, low-Tm, AT-rich primers for STR amplification were then used to target SNPs using conventional designs. Multiplexing was performed using short primers with high Tm. However, the multiplex amplification reaction was not performed using a single multiplex. Again failed to provide balanced amplification of both STRs and SNPs in the reaction Apply non-conventional primer designs to amplify non-problematic targets, e.g., SNP targets It was thought that amplifying the above might lead to successful multiplex amplification. The same criteria used to design non-optimal primers for STRs were applied to SNPs (long This was applied to primer design for the newly designed The modified primers provide a better balance between STR and SNP amplification in multiplex reactions. Ta.

[0058] Figure 4 shows an example of the interaction between conventionally and non-conventionally designed primers in a multiplex reaction. In Figure 4A, a multiplex reaction of 10 SNP targets yielded approximately 200–350 nucleotides for the library. Figure 1 shows the expected amplification for the desired range of 0 bp. The primers used were selected as recommended by established PCR primer design standards. Primer 11 was designed to be longer, have a lower Tm, and be more AT-rich. When primers are designed using established PCR design criteria, they are short and have high Tm. , but not AT-rich, resulting in non-specific amplification of target DNA when 10 pairs were added to the multiplex. As can be seen in Figures 4B and 4D, the addition of the conventionally designed 11th primer pair resulted in a 10 This interferes with the non-conventional primer pairs in the multiplex, resulting in failure of multiplex amplification of the target SNPs. However, they are also non-conventional designed according to the same criteria as 10-plex primer pairs. Addition of the 11th primer pair results in successful amplification of the SNP target (Figure 4C).

[0059] Thus, in some embodiments, each of the plurality of primers is have a low melting temperature, such as less than about 50°C to about 60°C, and / or a melting point of at least 24 The length of the nucleic acid is, for example, about 24 to about 38 nucleotides. In some embodiments, each of the plurality of primers comprises a homopolymeric nucleotide sequence. include.

[0060] In some embodiments, primers of non-conventional design are designed to align sequences flanking the target STR and SNP. The additional sequences may be used, for example, for generating a library or It can be a tag sequence that serves a purpose during sequencing methodology. For example, the tag sequence can be To purify the library fragments, a hapten moiety is captured by an immobilized partner moiety. Examples of hapten moieties include a capture sequence that can be separated from the reaction components, etc. It is biotin that can be captured by streptavidin for the library fragments. The tag sequence may be complementary to, for example, an amplification primer and used in one or more amplification reactions. 2 and 3 show the amplification sequences used in the second round of amplification following the first round of amplification. An example of a tag sequence used in a round is shown. The tag sequence may also be a sequence tag. 2 and 3 also illustrate that example sequence tags, i5 and i7 adapters, are used in the methods described herein. The sequence by synthesis reaction described in The sequence of the primers used in sequencing is shown in Figure 3. Thus, another example of a tag sequence is a unique molecular identifier, or UMI.

[0061] UMI can be used to correct PCR and sequencing errors during sequencing Contains random stretches of nucleotides, which allows for error correction in the sequencing results. Add an additional layer. UMIs can be from, for example, 3 to 10 nucleotides in length, but the number depends on the input. It depends on the amount of DNA. For example, if you use 1 ng of DNA and target approximately 250 sites, you will need approximately 350 It is expected that 250 copies x 250 targets, or approximately 90,000 different UMIs, will be required. If a large amount of DNA is utilized, say 10 ng, then approximately 1 million different UMIs may be required. All PCR replicates from one PCR reaction should have the same UMI sequence and therefore be redundant. can be compared for single base substitutions, deletions, and insertions (i.e., stutters in PCR). Any errors in the sequence, such as The unique molecular identifiers can also be used to analyze mixed samples. For example, Deconvolute mixed samples, such as female DNA samples contaminated with male DNA, to identify UMI distributions. The sequence can be used to reveal both female and male DNA contributions. For example, There can be a total of four different repeat numbers for the combined DNA; however, the number of repeats for the two samples is There may be fewer than four cases where individuals share an allele at a particular locus. These shared alleles are identified and the number of different alleles in the initial population of DNA molecules is calculated. The UMI can be used to determine the percentages determined, for example: , the first numerator can be counted, and if there is an insignificant contributor, say 5%, Therefore, 5% of UMIs will identify one genotype and 95% will identify a second genotype. If one (or more) of the alleles is biased during amplification, the ratio is 5:95. However, if PCR overlaps are condensed using UMI detection and correction, The biased ratio can then be corrected using UMI. This is important when trying to distinguish between hazards and truly insignificant contributors.

[0062] The primers of this method can include one or more tag sequences. The tag sequences can be used to identify target sequences. The primer sequence may be one or more sequences that are not homologous to the sequence, but may be used to The tag sequence can be used, for example, to isolate the amplicon from the reaction components. A capture sequence, such as a hapten sequence, such as biotin, that can be used to purify the The tag sequence may be a sequence that has been predicted, for example, by synthetic techniques such as those described herein. It is advantageous to capture library amplicons on a substrate for subsequent cross-link amplification. Furthermore, the tag sequence can typically be, for example, For example, it can be used for error correction during library construction and / or sequencing. A unique sequence between 3 and 10 nucleotides consisting of a randomized stretch of nucleotides that can be It can be a molecular identifier tag.

[0063] Additionally, for multiplex PCR reactions, virtually all of the PCR products pooled together in one mixture can be used. It is advantageous to include an oligonucleotide primer for the target. As disclosed herein, oligonucleotides are designed using conventional parameters. The primers are unusually long. The addition of further primer sequences to the primer creates even longer primer sequences. In some embodiments, glycine betaine (about 1.5 M) can be added to multiple primers. For example, in some embodiments, non-conventional primers as disclosed herein are used. The amplification buffer used in the amplification reaction was about 100 mM, 200 mM, 300 mM, 400 mM, or mM, 500mM, 600mM, 700mM, 800mM, 900mM, 1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1 Greater than 0.8M, 1.9M, 2M, 3M, 4M, 5M, 6M, 7M, 8M, 9M, 10M or any of these values The betaine concentration ranges between any two of these, for example, 500 mM to 2 M, 1 M to 1.5 M, etc. Therefore, when practicing the methods of the present disclosure, betaine, as disclosed herein, can be added at a concentration of, for example, about Such a primer mix supplemented to 1.5M may be advantageous. Serol may be added to multiple primers. For example, in some embodiments, The amplification buffer used in the amplification reaction using non-conventional primers as disclosed herein. The buffer solution may be about 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM M, 1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2M, 3M, 4M, 5M, 6M, 7M, 8 greater than 100 mM, 90 mM, or 100 mM, or within a range between any two of these values, e.g., 500 mM The glycerol concentration includes 2M, 1M to 1.5M, etc. Therefore, when carrying out the method of the present disclosure, In this case, as disclosed herein, a primer such as that supplemented with glycerol at, for example, about 1.5M may be used. A mixture of mers may be advantageous.

[0064] In some embodiments, the non-conventional primer designs used in the amplification methods of the present disclosure include The buffers associated with the assay may be varied. For example, in some embodiments, the amplification buffer The concentration of salts such as KCl, LiCl, NaCl, or a combination of these in the solution is The salt concentration is increased relative to the amplification buffer used with the primer. In some embodiments, the primers may be used in amplification reactions using non-conventional primers as disclosed herein. The amplification buffer used may be about 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, or mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 250mM, 300mM, 400mM, 500mM Greater than or within a range between any two of these values, e.g., 60 mM to 200 mM, 100 mM In some embodiments, the KCl concentration may be between 100 mM and 250 mM. The amplification buffer used in the amplification reaction with non-conventional primers contains a KCl concentration of approximately 145 mM. In some embodiments, non-conventional primers as disclosed herein are used The amplification buffer used in the amplification reaction used was approximately 60 mM, 70 mM, 80 mM, 90 mM , 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 2 Greater than 50 mM, 300 mM, 400 mM, 500 mM, or within a range between any two of these values In some embodiments, the LiCl concentration may be between 60 mM and 200 mM, for example, between 100 mM and 250 mM, etc. Amplification reactions using non-conventional primers as disclosed herein The width buffer comprises a LiCl concentration of about 145 mM. The amplification buffer used in amplification reactions using such non-conventional primers contains approximately or 60mM, 70mM, 80mM, 90mM, 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 1 70mM, 180mM, 190mM, 200mM, 250mM, 300mM, 400mM, 500mM or greater The NaCl concentration ranges between any two of the above values, for example, 60 mM to 200 mM, 100 mM to 250 mM, etc. In some embodiments, non-conventional primers as disclosed herein are used. The amplification buffer used in the amplification reaction contains a NaCl concentration of about 145 mM.

[0065] In some embodiments, amplification using non-conventional primers as disclosed herein The amplification buffer used in the amplification reaction may contain MgSO4, MgCl2, or a combination thereof. This can be done.

[0066] (kit) Embodiments disclosed herein provide kits comprising at least one container means; At least one container means contains a plurality of primers as disclosed herein. In some embodiments, the container means may be a tube, well, microtiter plate, or the like. In some embodiments, the plurality of primers may be about 4, 6, 8, or , 10, 12, 14, 16, 18, 24, 30, 40, 50, 60, 70, 80, 90, 100 or more, or, 4~ Specific for tandem repeats within a range of two values, such as 12, 10-24, or 30-100. In some embodiments, the plurality of primers may hybridize to at least In some embodiments, multiple primers can be used to specifically hybridize to a tandem repeat sequence of 24 primers. The primer is capable of specifically hybridizing to at least 60 tandem repeat sequences. The disclosed methods and compositions can be used to amplify multiple SNP target sequences in a single reaction. For example, the plurality of primers may be about, or 4, 6, 8, 10, 12, 14, 16, 18, 24 , 30, 40, 50, 60, 70, 80, 90, 100 or more, or 4 to 12, 10 to 24, 30 to 100, etc. It can specifically hybridize to as many SNP sequences as possible within the range between any two of the values ​​above. In some embodiments, the plurality of primers hybridizes specifically to at least 30 SNP sequences. In some embodiments, the plurality of primers may be a sequence of at least 50 SNP sequences. It can hybridize specifically to the array.

[0067] In some embodiments, at least one container means contains an amplification buffer. In this embodiment, the non-conventional primer design used in the disclosed amplification methods is The buffer used may be varied. For example, in some embodiments, the KCl, L The concentration of salts, such as iCl, NaCl, or a combination thereof, is different from that of conventionally designed primers. In some embodiments, the salt concentration of the amplification buffer is increased relative to that of the amplification buffer used with the amplification buffer. Amplification reactions using non-conventional primers as disclosed herein The buffer may be at or near 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 140 mM , 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 250mM, 300mM, 400mM, 500mM or greater or within a range between any two of these values, e.g., 60 mM to 200 mM, 100 mM to 250 mM, etc. In some embodiments, the present invention provides a method for preparing a solution containing a soluble ... The amplification buffer used in amplification reactions using such non-conventional primers is approximately 145 mM Contains KCl, NaCl or LiCl concentrations.

[0068] In some embodiments, amplification using non-conventional primers as disclosed herein The amplification buffer used in the amplification reaction may contain MgSO4, MgCl2, or a combination thereof. This can be done.

[0069] (Sequencing) The method is not limited to any particular sequencing platform, but may be used in conjunction with SBS For the types of sequencing, or sequencing by synthesis, parallel sequencing, etc., exemplified herein A particularly applicable technique is to align nucleic acids at fixed positions within the array so that their relative positions do not change. The array is mounted in a fixed position and the array is imaged repeatedly. , which corresponds to the various labels used to distinguish one nucleotide base type from another. Embodiments in which images are obtained in different color channels are particularly applicable.

[0070] SBS techniques generally involve the synthesis of a nascent nucleic acid strand through the repetitive addition of nucleotides to a template strand. In the traditional method of SBS, a single nucleotide monomer is In the delivery of the target nucleotide, the target nucleotide can be provided in the presence of a polymerase. However, in the methods described herein, the multiple types of nucleotide monomers are Upon delivery, the target nucleic acid can be provided in the presence of a polymerase.

[0071] SBS techniques involve the use of nucleotide monomers bearing a labeling moiety or those lacking a labeling moiety. Thus, the incorporation event can be determined by a property of the label, such as the fluorescence of the label; properties of nucleotide monomers, such as molecular weight or charge; Detection can be based on the by-products of incorporation of two or more different nucleosides. In some embodiments, different nucleotides are present in the sequencing reagents, and the different nucleotides are not recognizable from one another. or the two or more different labels are indistinguishable under the detection technique used. For example, different nucleotides present in the sequencing reagents may These can carry various markers, which are used in sequencing developed by Solexa (now Illumina). Identification can be achieved using appropriate optical systems as exemplified by conventional methods.

[0072] Some examples include pyrosequencing techniques. Pyrosequencing is the process of determining the identity of a specific nucleotide. The release of inorganic pyrophosphate (PPI) is detected when the nascent chain is incorporated into the ribosomal protein (Non-Patent Document 2, Non-Patent Document 3, Non-Patent Document 4, Patent Document 6, Patent Document 7 and Patent Document 8, the disclosures of which (The text is hereby incorporated by reference in its entirety.) Pyrosequencing allows the released PP i is readily converted to adenosine triphosphate (ATP) by ATP sulfurylase. The level of ATP produced can be detected by the light produced by luciferase. The nucleic acid to be sequenced is then bound to the features of the array. The array can then be imaged to determine the incorporation of nucleotides in the features of the array. The chemiluminescent signal generated due to the binding of specific nucleosides can be captured. After treatment with a nucleotide species (e.g., A, T, C, or G), an image can be obtained. The images obtained after the addition of nucleotide species reveal which features in the array were detected. These differences in the images reflect different sequence contents of the features on the array. However, the relative positions of the features are unchanged. The images can be stored, processed and analyzed using the methods described herein, for example. For reversible terminator-based sequencing, the data obtained from different detection channels with different nucleotide species in the same manner as exemplified herein for the images obtained. The image obtained after processing the array can be processed.

[0073] Another example of SBS is disclosed in, for example, U.S. Patent No. 5,929,999, the disclosure of which is incorporated herein by reference. and U.S. Patent No. 5,999,999, for example, cleavable or photobleachable dyes, as described in U.S. Patent No. 5,9 .... Stepwise addition of label-containing reversible terminator nucleotides allows cycle sequencing. This method is commercialized by Solexa (now Illumina), and each are described in U.S. Pat. Nos. 5,829,992 and 5,829,992, which are incorporated herein by reference. Fluorescently labeled terminators that can reverse both termination and cleavage The availability of fluorescent labels facilitates efficient circular reversible terminator (CRT) sequencing. Co-engineered polymerases efficiently incorporate and extend from these modified nucleotides. Additional examples that can be utilized with the methods and systems described herein include: Exemplary SBS systems and methods are described in Patent Documents 13 to 23. The disclosure of which is incorporated herein by reference in its entirety.

[0074] Some examples use fewer than four different labels to detect four different nucleotides. For example, the following is described in the incorporated documents of US Pat. No. 5,949,491: Methods and systems can be used to perform SBS. Although the chido species can be detected at the same wavelength as the pair, one member of the pair may be more sensitive than the other. based on the difference in intensity between the two members of the pair, or the signal detected for the other member of the pair. A change to one member of a pair (e.g., For example, through chemical, photochemical, or physical modification A second example is the detection of three of four different nucleotide species under specific conditions. while the fourth nucleotide species lacks a detectable label under those conditions. are present or barely detectable under these conditions (e.g., background fluorescence) The incorporation of the first three nucleotide species into nucleic acids is and incorporation of the fourth nucleotide species into the nucleic acid can be determined based on the presence of a signal The determination can be based on the absence or minimal detection of any signal. The nucleotide species contains a label or labels that are detected in two different channels. While other nucleotide species are detected in only one channel, The three example configurations are not considered mutually exclusive and can be used in various combinations. An exemplary embodiment that combines all three examples is a first nucleus detected in a first channel. A nucleotide species (e.g., a label detected in a first channel when excited by a first excitation wavelength) dATP with a second excitation wavelength), a second nucleotide species to be detected in a second channel (e.g., (dCTP with a label that is detected in the second channel when excited by more A third nucleotide species detected at both the first and / or second excitation wavelengths (e.g., dTTP having at least one label that is detected in both channels when excited by The fourth nucleoside lacks a label that is not detected or is barely detected in either channel. This is a fluorescence-based SBS method that uses a nucleotide species (e.g., label-free dGTP).

[0075] Furthermore, as described in the incorporated documents of U.S. Patent No. 5,929,999, the sequencing data In such so-called one-dye sequencing techniques, wherein the first nucleotide species is labeled, but the label is removed after the first image is generated; The second nucleotide species is labeled only after the first image is generated. , retaining the label in both the first and second images, and the fourth nucleotide species remaining unlabeled in both images. The sign remains.

[0076] Some embodiments may utilize sequencing by ligation techniques. Such techniques utilize DNA ligase to incorporate oligonucleotides, The oligonucleotide is typically a nucleotide. Various sequences that correlate with the identity of a particular nucleotide in the sequence to which the nucleotide hybridizes. As with other SBS methods, images are taken of nucleic acid fields with labeled sequencing reagents. After processing, an array of images can be obtained. Each image incorporates a specific type of The nucleic acid features are labeled. Different features are labeled with different Depending on the sequence content, features may or may not be present in different images, but The relative positions do not change the image. The images obtained from the ligation-based sequencing method are The data can be stored, processed and analyzed as described herein. An exemplary SBS system and method that can be utilized in the system is described in U.S. Pat. No. 6,275,625. to U.S. Patent No. 5,929,999, the disclosures of which are incorporated herein by reference in their entirety. be absorbed.

[0077] Some embodiments may utilize nanopore sequencing (Non-Patent Document 5 to Non-Patent Document 6). 7, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the target nucleic acid passes through a nanopore. The nanopore may be a synthetic pore or an α When the target nucleic acid passes through the nanopore, it can be a biological membrane protein such as hemolysin. By measuring the change in electrical conductivity of the pore, each base pair can be identified (Patent The disclosures of Reference 28, Non-Patent Documents 8 to 10 are incorporated herein by reference in their entirety. The data obtained from nanopore sequencing can be used as described herein. In particular, the data can be stored, processed and analyzed in the optical images and the It can be treated as an image according to the exemplary processing of other images described.

[0078] Some embodiments involve methods involving real-time monitoring of DNA polymerase activity. Nucleotide incorporation can be utilized, for example, as described in Patent Documents 29 and 3. 0, each of which is incorporated herein by reference, Fluorescence resonance energy transfer (FRET) between a phosphate-containing polymerase and γ-phosphate-labeled nucleotides T) interaction, or nucleotide incorporation can be detected, e.g., by Zero-mode waveguiding, as described in US Pat. No. 3,999,499 (incorporated herein by reference), and, for example, U.S. Patent Nos. 5,929,999 and 5,929,999, each of which is incorporated herein by reference. Fluorescent nucleotide analogs and genetically engineered polymers are used as described in the literature. Irradiation induces incorporation of fluorescently labeled nucleotides, which can be detected using a ribosomal enzyme. Zeptolites around surface-tethered polymerase for low background observation The volume of the scale can be limited (Non-Patent Documents 11 to 13, these developments The images obtained from such a method are The images can be stored, processed and analyzed as described herein.

[0079] Some SBS embodiments are released upon incorporation of a nucleotide into an extension product. For example, sequencing based on the detection of emitted protons can be performed using electrical detectors and and Ion Torrent (Guilford, Connecticut, a subsidiary of Life Technologies, Inc.). or related art commercially available from EP 0 666 523 B1, or patents each of which is incorporated herein by reference. The sequencing methods and systems described in Patent Documents 34 to 37 can be used. The method described herein for amplifying a target nucleic acid using equilibrium exclusion binding methods involves the use of proton More specifically, the present invention can be easily applied to substrates used for detecting The amplicon fragments used to detect protons were analyzed using the methods described in the specification. It can be used to produce loan populations.

[0080] The SBS methods described above can be advantageously performed in a multiplexed format to simultaneously manipulate multiple different target nucleic acids. In certain embodiments, different target nucleic acids can be mixed in a common reaction vessel. or can be treated on the surface of a particular substrate. This allows for convenient delivery of sequencing reagents. This allows for multiplexed detection of incorporation events, removal of unreacted reagents, and detection of surface-bound targets. In embodiments using target nucleic acids, the target nucleic acids can be in an array format. In this format, the target nucleic acid is typically bound to the surface in a spatially distinguishable manner. The target nucleic acid can be directly covalently bound, attached to beads or other particles, or attached to a surface. It can be attached by binding to an attached polymerase or other molecule. The array can contain a single copy of a target nucleic acid at each site (also called a feature). Alternatively, multiple copies of the same sequence may be present at each site or feature. Multiple copies can be obtained by bridge amplification or enzyme amplification, as described in more detail below. It can be produced by an amplification method such as multiplication PCR.

[0081] The methods of the present disclosure include the use of DNA profiles generated by performing the methods described herein. To sequence the library, we use Illumina technology. MiSeq sequencing The instrument was used for clustering and sequencing in the examples described herein. As previously mentioned and as will be appreciated by those skilled in the art, the present method is The present invention is not limited by the type of platform. [Example]

[0082] The following examples disclose several methods and materials for DNA profiling. Modifications to these methods and materials may be made while remaining within the spirit and scope of the invention. Such modifications may occur to those skilled in the art from consideration of this disclosure or practice of the methods disclosed herein. It will be apparent to those skilled in the art that these methods or materials are not intended to be limiting. It is not intended to be limited to the specific embodiments disclosed herein, but it is within the scope of this disclosure. This document covers all modifications and alternatives that come within the scope and spirit of the present invention.

[0083] Example 1: Non-conventional primer design computer design programs from Illumina (San Diego, CA). Design Studio was modified and used for primer design. Primer 3, etc. Alternative primer design programs may be used, resetting the default parameters. Therefore, it is possible for one skilled in the art to replicate the purpose of the modified parameters for primer design. Of course, you will understand that the configuration is typically stored in the config.xml file that comes with the software. However, different software may be used and each software may have different It is common practice to consult specific documentation to access default parameters. This may vary if the primer is reset in the primer design software. You can: 1) Reset the desired minimum amplicon length to >60 2) Reset the desired maximum amplicon length to >120 3) Reset tight candidate interval to >3< (default is 30bp) 4) Reset the %GC max probe to >60< to allow for an increased number of AT-rich repeat stretches to 5) Reset the average Tm to >57°C (default is 59°C) to lower the average Tm 6) Reset Max Tm to >60< (default is 71) 7) Reset the minimum Tm to >51< (default is 55) 8) Reset average probe length to >28< (default is 27) 9) Reset maximum probe length to >38< (default is 30) 10) Reset minimum probe length to >25< (default is 22)

[0084] To design SNP primers, set the targeting range for the 3' end of the primer to "small." Set the primers approximately 1 bp apart for the target SNP. All parameters are reset. Then, the primer design program is run on the sequence, and the primers corresponding to the new parameters are selected. For example, the software user can set up primers and determine candidate primer pairs. Generate a target list that tells the software where to search in the genome to measure In this example, the target area can be determined by the orientation and priority of the design studio software. Copy the image into the graphic user interface application used for the design. After entering the target area into the program, the program creates Go to the design file, launch the tool, and create the primer design. The main output is a .txt file containing the primer sequences and / or some This was a region that was "undesignable" at the time the target sequence had to be redefined and re-executed. The software used in this experiment maps the target region onto the designated sequence. The designed primers were provided. Following the reset parameters, the primers for amplification were A primer was designed that did not follow conventional standards for primer design; however, it This resulted in multiplex amplification of small STRs and short SNPs.

[0085] Examples of designed STR targeting primers that are advantageous in the methods disclosed herein include those listed in Table 1. Examples of SNP-targeting primers that are advantageous in the methods disclosed herein include: , including those listed in Table 2. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0086] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12]

[0087] Example 2: DNA profiling for data banking This example describes an experiment following the workflow in Figure 2. The obtained sample was This example demonstrates that UMIs are not a scam because the identity of the individual could be inferred to be from a known individual. Not in use.

[0088] In this experiment, STRs are multiplexed with iSNPs, as can be seen in Table 3. [Table 3]

[0089] Additional SNPs and STRs can of course be added to the above list. Examples of suitable targets include, but are not limited to, the markers found in Table 4. [Table 4]

[0090] The primers were designed to contain a gene-specific PCR primer sequence at the 3' end and an adapter tag at the 5' end. In this experiment, the forward primer was designed to contain the sequence The amplicon contained the tag sequence of the i5 adapter, and the reverse primer was the TruSeq Small RNA The tag contains the tag sequence of the A kit i7 adapter. The tag is used for amplification, as well as for sequencing primer sites. It can be used as a wide primer site. Adapter i5 tag sequence 5'TACACGACGCTCTTCCGATCT3' (SEQ ID NO: 403) Adapter i7 tag sequence 5'CTTGGCACCCGAGAATTCCA3' (SEQ ID NO: 404)

[0091] To balance the amplification between STRs and SNPs in multiplexing, the primers were prepared as described in Example 1. The primer design parameters were changed for SNPs using Illumina Design Studio. The original set of SNP primers designed using classical PCR primers: high melting temperature It was a short sequence with little to no secondary structure. Designing TruSeq custom amplicon probes and creating reverse PCR primers for downstream processing However, these primers were not fully multiplexed. One bad primer can change an assay from good to bad (e.g., all primers (primer dimer, no product) (Figure 4). In an attempt to create a library, primer 3 containing a mispriming feature was used. (shareware) was used. Primers designed by Primer 3 were used for multiplex assays. It was found to work even less well than the Design Studio primer. Surprisingly, while the data show that STR primers multiplex well, The poorly designed primer pairs directed to STR targets were generated using SNP primers. It was observed that the STR primers did not cause any problems with multiplexing, as was the case with the - Unlike what is known as a "good" primer, it is long and AT-rich. , has a low melting temperature.

[0092] SNP primers were redesigned according to the parameters in Example 1. Primers were mixed together. In this example, primer pairs for 56 STRs and 75 iSNPs were used. The primer pairs were mixed with primer pairs for phenotypically informative SNPs. The enzyme (in this example, Hot Start Phusion II) is used as a master mix for all the components required for PCR. Add the primers to the mix and pipette the mixture into the wells of a PCR plate. However, amplification can also be performed in tubes. and added to the plate in a volume of 15 microliters, but not from a swab or untreated filter paper. Dissolved extracts of blood or oral samples, or blood or oral samples on FTA cards, etc. A lysed extract obtained directly from the 2800M DN purified control was also used in this experiment. A was used at 1 ng and 100 pg. The reaction mixture was cycled a specified number of times according to the protocol. In this example, the PCR was performed using 25 cycles: JPEG0007770437000019.jpg68146

[0093] After cycling, the plate was removed from the thermocycler. The reaction mixture was diluted with polymerase (Ka pa HiFi (Kapa Biosystems), a PCR master mix containing all the components necessary for PCR. 50 microliters for each adapter pair (one i7 and one i5 adapter) The second round of PCR was carried out for a specified number of cycles (10 cycles in this example). The sequencing library was generated according to the protocol. JPEG0007770437000020.jpg56166

[0094] After cycling, the plate containing the completed library was removed from the thermal cycler. At this point, samples can be pooled by volume and analyzed as a single sample, e.g., using magnetic beads (SPRI). The samples can be purified individually or pooled. Alternatively, individual libraries can be analyzed using a fragment analyzer or qPCR-based method. For example, by using a bioanalyzer or PicoGreen and a plate reader ( As in this example, the amount of the library can be determined by using the You will know the many options for quantification. If the libraries are individually purified, , they can be normalized to 2 nM each concentration and pooled by volume.

[0095] The purified library pool is denatured, diluted, clustered, and sequenced on a MiSeq sequencing machine. The instrument sequenced a 350-cycle sequencing run and two index reads. After sequencing, samples are demultiplexed according to adapter sequences and used for forensic genomics piplining. The STR reads were separated from the SNP reads and analyzed independently. The STR was developed in accordance with a prior patent application (Patent Document 1, which is incorporated herein by reference in its entirety). The analysis was performed using the algorithm described in [reference 38]. Number of replicates and any sequence variations were reported along with the read number. SNPs were manifested using The relative balance between alleles (min / max) was calculated by the following formula: %, interlocus balance (%CV), error rate, and stutter rate were calculated for STR loci. The STR results for the initial data banking multiplexing are shown in Figures 5A-C. Average equilibrium (80%), stutter (~3%) and error rate (less than 5%) were observed in this example. The %CV (~142%) was calculated using all 56 loci. Although the primers used show intralocus equilibrium, further primer optimization is needed. This is expected to improve intralocus equilibrium. Calls for known loci are based on published The results for SNPs are shown in Figures 5D-E. Coverage, allele calling, stutter and variance for 56 STR loci in the multiplexed sequence were measured. The graphs generated by the CE technique are shown in Figure 6. The electropherogram is reproduced. The bars correspond to the defined allele peaks (X-axis) and The coverage for SNPs ranges from 10 to 25, depending on the SNP. 00X range, however, all multiplexed SNPs were counted and accurate calls were made. was provided.

[0096] Example 3: DNA Profiling for Criminal Casework This example describes an experiment following the workflow in Figure 3. The obtained sample was In this example, the identity of the UMIs are incorporated into the primers.

[0097] In this experiment, STRs were identified as iSNPs, aSNPs, and phenotypic informants, as seen in Table 5. It is multiplexed with active SNPs. [Table 5-1] [Table 5-2]

[0098] The examples include UMIs for STR primers. If only the primer contains a UMI, but both the STR and SNP primers contain a UMI, as needed However, in this example, the STR Only the primers incorporate the demonstration UMI. First, as in Example 2, the PCR primers were introduced at the 3' end. The i5 and i7 primers contain gene-specific PCR primer sequences and an adapter tag sequence at the 5' end. The sequence is the same as the tag sequence used in Example 2. In this experiment, the UMI was It is placed between the specific primer sequence and the tag sequence. There were five randomized bases used for the UMI of both the forward and reverse primers. Primers for all targets were mixed together. The primer mix consisted of 26 autosomal It consisted of STR primer pairs and 86 SNP primer pairs (92 SNPs covered). The polymerase (in this example, Hot Start Phusion II) is mixed with a matrix of all the components required for PCR. Add the mixture to the Star Mix and add the primers. Pipet the mixture into the wells of a PCR plate. DNA was added to the plate as purified DNA, optimally at 1 ng. As in 2, purified DNA from the 2800M control was tested at 1 ng. The PCR product was subjected to two cycles of PCR according to the following rules: JPEG0007770437000023.jpg52149

[0099] After cycling, the sample was removed from the thermal cycler and incubated with E. coli single-stranded DNA binding protein (S SSB) was added to the reaction. SSB was used to reverse the degradation of the unused tagged gene-specific primers. This is thought to reduce primer dimers and prevent further amplification from these primers. SSB was incubated with the sample on ice or in an incubator at room temperature or 37°C. After this incubation, the polymerase (in this example) Add Hot Start Phusion II to a master mix of all the components required for PCR. The master mix was then added to the sample along with a pair of adapters (i7 and i5 adapters). and cycled for the specified number of cycles (34 cycles in this experiment) according to the protocol: JPEG0007770437000024.jpg55166

[0100] Samples were purified with SPRI beads, and individual libraries were analyzed using a qPCR-based method. fragment analyzers (as in this example) or bioanalyzers. This could be quantified using either PicoGreen or a plate reader. Libraries were normalized to 2 nM each concentration and pooled by volume.

[0101] The purified library pool was denatured, diluted, clustered, and analyzed using MiSeq. Sequenced in 50x100-cycle sequencing runs and two index reads. The data were then measured as described in Example 2. However, the primers did not contain UMIs. The use of PCR duplicates reduces the risk of sequencing and PCR errors and artifacts. Data were collapsed using UMI to remove artifacts. SNPs were used to manifest. The relative balance between alleles (minimum / maximum) was calculated. The %max, interlocus balance (%CV), error rate, and stutter rate were calculated. The results of the large-scale multiplexing are shown in Figures 7A-E. Locus coverage, allele calling, stutter and other artifacts , shown in Figure 8. These graphs reproduce the electropherograms generated by CE. The bars represent peaks. The coverage for SNPs is similar to the coverage for SNPs, and the read count is similar to the RFU. Depending on the assay, the range is 10-5500X, however, all multiplexed SNPs are counted. Useful results were provided.

[0102] One result of these studies is that stutter is a PCR artifact. This has been assumed by many researchers (and and polymerase slippage have been demonstrated in human colon cancer), which may be useful in forensic medicine. It has not been demonstrated by analytical analysis. Using UMI, it was found that stuttering is in fact a PCR artifact. It can be shown that a product with n+1 or n-1 repeats is a product with the exact number of repeats. In Figure 9A, each locus has the same UMI as the final product (Figure 9). Unlike B, the results are shown without UMI correction. As shown, the uncorrected alleles The balance between the children is not as good as with UMI correction. There are quite a few stutters. The upper bar between the bar lines represents a sequencing error. The error is significantly reduced by UMI correction, whereas the area below the line represents the correct sequence in the STR sequence. For example, the SE33 locus has an error that is removed with UMI correction. Swark uses error correction to provide the most accurate DNA profiling possible. can be very important.

[0103] Example 4: DNA profiling using 12 sample individuals Methods and Materials DNA from 12 sample individuals (samples #1, 3, 4, 5, 6, 7, 10, 13, 14, 15, 16, 17) and 1 One reference genome (2800M) was tested according to the workflow in Figure 3. This experiment was carried out UMIs are incorporated into STR primers as described in Example 3. Two replicates of each sample are analyzed using Illumina MiSeq sequencing was performed using the ForenSeq® DNA Signature Library Prep Kit. The DNA primer mix B (61 STR primers plus AME) was used for analysis on a sequencer. Logenin, 95 identity informative SNPs, 56 ancestry informative SNPs, 22 tables Contains modern informative SNPs (two ancestral SNPs are also used to predict phenotype) , a mixture of collected samples) was used for each replicate.

[0104] [Default Settings] STR: analytical threshold = 6.5%; interpretation threshold = 15%. SNP: analytical threshold = 3%; interpretation threshold = 15%.

[0105] DNA profiling of 12 sample individuals was performed using the coverage and locus calls. High level sequencing calls are shown in Figure 12. As can be seen, all loci are bimodal. In the preparation, all samples were covered by at least 100,000 reads. Only two samples failed. All 173 SNPs resulted in a STR call (1 out of 61). The sample STR calls for the two sample individuals are shown in Figure 16. The SNP calls for all samples are shown in Figure 17. Figure 13 shows the National Institute of Standards and Technology (NIST) AutoSTR Random match probability (RMP) of NIST Y-STR, 95% confidence haplotype frequency of NIST Y-STR, RM of dbSNP iSNP Population statistics such as P and RMP of STRs from the US Y-STR database are shown.

[0106] Phenotypes such as eye color and hair color of the 12 sample individuals and the reference individuals were compared to determine the genetic significance of the pSNPs in the experiment. Predictions were made based on the phenotype and compared with self-reported phenotypes (Figure 14). A high correlation between the phenotypes was observed.

[0107] The ancestry of the 12 sample individuals was predicted using the genotypes of the 56 aSNPs in the experiment. PCA1 and PCA3 scores were calculated and plotted on an ancestry plot against the reference sample. As shown in Figure 15, the ancestral type of the sample individual was predicted based on its position on the ancestral type plot. 14 centroids were included in the ancestral type plot (circle). Based on this, the ancestral type of each sample individual was predicted.

[0108] DNA profiling experiments also identified STR and SNP loci, as seen in Figure 18. Both loci show high levels of intralocus equilibrium, as can be seen in Figure 19. As such, they exhibited a low level of stutter.

[0109] In addition, 6 of the 12 individuals, 2800M, had at least one isometric heterozygous gene. The isometric heterozygous locus is shown in Figure 20. Defined as an STR with two distinct sequences that are equally balanced, with the same number of repeats. Using the mutation information at D8S1179, 13 alleles in sample 15 were traced to the grandmother of sample 17 ( (Figure 21). Similar mutation information in STR D13S317 was used to track the alleles in sample 15. However, in this case, it is not possible to determine the origin of either allele ( Figure 22).

[0110] Example 5: DNA Profiling for Research, Forensic, or Paternity Use In this example, the ForenSeq™ DNA Signature Prep Guide (Illumina, Inc.) was used. This is based on the workflow described in the San Diego, CA, No. 6,239,999, which is incorporated herein by reference in its entirety.

[0111] Either purified DNA or crude lysate can be used in this example. For prepared DNA, 1 ng of each sample was diluted to 0.2 ng / μl with nuclease-free water. For crude lysates, add 2 μl of each sample to 3 μl of nuclease-free Dilute with cold water. The master mix is ​​set up for 8 or more reactions. 5.4 μl ForenSeq PCR1 Reaction Mix, 0.4 μl ForenSeq Enzyme Mix and 5.8 μl Add 10 μl of DNA primer mix (A or B) to a 1.5 ml microtube. Transfer the termix to each well of the PCR plate and add DNA or lysate. The mixture is subjected to PCR according to the protocol: 98°C for 3 minutes Eight cycles of: 96°C for 45 seconds 80°C for 30 seconds 54°C for 2 minutes in a specific ramping mode 68°C for 2 minutes in a specific ramping mode 10 cycles of: 96°C for 30 seconds 68°C for 3 minutes in a specific ramping mode 68°C for 10 minutes Hold at 10°C.

[0112] After cycling, the samples were removed from the thermal cycler. The ForenSeq PCR2 reaction mix was The sample was added with a pair of adapters (i7 and i5 adapters) and 15 samples were analyzed according to the protocol. Cycled with: 98°C for 30 seconds 15 cycles of: 98°C for 20 seconds 66°C for 30 seconds 68°C for 90 seconds 68°C for 10 minutes Hold at 10°C.

[0113] Samples were purified with sample purification beads, and libraries were normalized and pooled by volume. The pooled library was diluted in hybridization buffer (HT1) and subjected to hybridization with human sequences. A decision control (HSC) was added and heat denatured in preparation for sequencing.

[0114] Example 6: Genotyping with degraded DNA Figure 23 shows the degraded DNA using sheared and / or DNase treated DNA. Genotyping results are shown. As shown, more than 50% of STR and SNP genotypes were The locus was correctly called in sheared DNA. -19 The random match probability (RMP) of , was achieved with less than 100 bp of DNA. Correct ancestral types were also predicted using degraded DNA.

[0115] Example 7: Genotyping Sensitivity Figures 24 and 25 show the genotyping sensitivity at subnanogram DNA input levels of 7.82 pg to 1 ng. As shown, 100% of the alleles were detected with 125 ng of DNA for both STR and SNP. More than 50% of alleles were correctly called with input DNA as low as 7.82 pg. Intralocus equilibrium was consistently called for most loci with 1 ng of input DNA. It was over 70%.

[0116] All numbers used herein expressing amounts of ingredients, reaction conditions, etc. are in all cases In this context, the above expressions should be understood as modified by the term "about." Unless otherwise indicated, the numerical parameters set forth herein are indicative of the desired characteristics sought to be obtained. These are approximations that may vary depending on the nature of the material. not as an attempt to limit the application of the doctrine of equivalents to the scope of any claim in the application, Numerical parameters should be construed in light of the number of significant digits and ordinary rounding approaches. .

[0117] This disclosure includes, but is not limited to, published and unpublished applications, patents, and literature references. All references cited herein are incorporated by reference in their entirety. and are hereby incorporated by reference. To the extent that a patent application conflicts with the disclosure contained herein, this specification supersedes any such disclosure. It is intended to supersede and / or supersede any such conflicting material.

[0118] Citation of any of the above publications or documents does not constitute an admission that any of the foregoing is relevant prior art. does not constitute or imply any endorsement as to the contents or dates of these publications or documents. It is not intended to constitute

[0119] Although the present invention has been described in relation to embodiments thereof with reference to the accompanying drawings, various modifications and variations are possible. It should be noted that modifications and variations will be apparent to those skilled in the art. It is to be understood that changes and modifications are included within the scope of the present invention. It should be understood that the various embodiments are presented by way of example only and not by way of limitation. Similarly, it should be understood that the various diagrams are not intended to be structural examples or representations of the invention. Other configurations may be shown to aid in understanding the features and functionality that may be included in the present invention. The present invention is not limited to the illustrated structure or configuration, but various alternatives are possible. Further, the present invention may be implemented using various exemplary structures and configurations. Although described above with respect to embodiments and implementations, in one or more of the individual embodiments The various features and functionality described herein may vary depending on the specific embodiment in which they are described. It should be understood that the present invention is not limited to the application of the present invention. other embodiments, alone or in some combination, such embodiments whether or not features are described and whether or not such features are provided as part of the described embodiment. Therefore, the breadth and scope of the present invention The scope should not be limited by any of the above-described exemplary embodiments.

[0120] Terms and phrases used herein, and their embodiments, unless otherwise specified, It should be interpreted as the opposite of restrictive, meaning without restrictions. The term "including" means "including, without limitation" The term "example" should be read as "example" or "example of an item under discussion." are used to provide illustrative examples and are not intended to be an all-inclusive or limiting list; Furthermore, such "conventional," "traditional," and "common" Adjectives such as "normal," "standard," and "known" Terms and similar meanings refer to the availability of a described item for a period of time or at a given time. However, these terms should not be construed as limiting the scope of the invention. Available and known now or at any time in the future; conventional, traditional, usual; or standard techniques. A collection of items connected with " requires that each of those items exist within the collection. rather, it should not be read as a requirement that Unless otherwise specified, it should be read as "and / or." Groups of items connected with the conjunction "or" require mutual exclusivity among the groups. rather, here too, it should not be read as a statement that is clear from the context or Unless otherwise specified, it should be read as "and / or"; and Although items, elements or components of the invention may be described or claimed in the singular, limitation to the singular is not intended. Unless a definition is expressly stated, plurals are intended within the scope. For example: "At least one" can refer to either the singular or the plural, and is not limited to either Terms such as "one or more," "at least," and "without limitation" are not intended to be limiting. The presence of broadening words or phrases, or other such words in some instances, may be more restrictive than narrower that a broader example is intended or is required in cases where no such broader phrase exists. should not be read as meaning that

Claims

1. 1. A method for constructing a nucleic acid library, comprising: providing a nucleic acid sample; amplifying the nucleic acid sample in a multiplex reaction using a primer set comprising a first plurality of primers that specifically hybridize to at least one target sequence comprising a single nucleotide polymorphism (SNP) and at least one target sequence comprising a tandem repeat sequence to generate amplification products, wherein all of the primers of the first plurality of primers included in the primer set have a melting temperature of less than 60°C, have a length of at least 24 nucleotides that hybridize to the target sequence, and are AT-rich with an AT content of at least 60%; adding single-stranded binding protein (SSB) to the amplification product; and amplifying the amplification products using a second plurality of primers. A method comprising:

2. The method described in claim 1, wherein at least one primer of the second plurality of primers comprises (i) a portion corresponding to the primer tags of all of the primers of the first plurality of primers and (ii) one or more tag sequences.

3. The method of claim 1 or 2, wherein the SSB is added to the amplification product prior to amplification of the amplification product.

4. The method of any one of claims 1 to 3, wherein the nucleic acid sample is not fragmented prior to amplification of the nucleic acid sample.

5. The method of any one of claims 1 to 4, wherein the target sequence is not enriched prior to amplification of the nucleic acid sample.

6. The method of any one of claims 1 to 5, wherein at least one of said SNPs is ancestral or phenotypic characteristic of the source of said nucleic acid sample.

7. A method described in any one of claims 1 to 6, wherein all of the primers of the first plurality of primers contain one or more tag sequences that are not homologous to the target sequence.

8. The method according to any one of claims 1 to 7, wherein the nucleic acid sample and / or the amplification product are amplified by polymerase chain reaction (PCR).

9. 9. The method of claim 8, wherein the nucleic acid sample and / or the amplification product is amplified in an amplification buffer having an increased salt concentration relative to the salt concentration of an amplification buffer used with conventionally designed primers, and wherein the conventionally designed primers are characterized by having a length of 18-22 nucleotides, a melting temperature in the range of 55-58°C, a GC content of 40-60%, and fewer than four dinucleotide AT repeats.

10. 10. The method of claim 9, wherein the salt comprises KCl, LiCl, NaCl, or a combination thereof.

11. A method according to any one of claims 1 to 10, wherein all of the primers of the first plurality of primers comprise a homopolymer nucleotide sequence.

Images