Energy production promoter

Abstract

To provide excellent energy production promoters, muscle fatigue improvers, and asthenopia improvers.SOLUTION: Phyllanthus emblica has excellent energy production promoting action, muscle fatigue improving action, and asthenopia improving action, so that it can be used as food, quasi drugs, or pharmaceuticals having these actions. A combination of Phyllanthus emblica with bilberry shows very good asthenopia improving action, so that it can be used as food, quasi drugs, or pharmaceuticals having these actions.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to an energy production promoter containing amla. More specifically, the present invention relates to an agent for improving muscle fatigue and eyestrain containing amla. The present invention also relates to an agent for improving eyestrain containing amla and bilberry. [Background technology]

[0002] Energy is essential for cells to grow, metabolize, repair, and maintain normal functions of living organisms. Living cells must constantly generate energy to maintain their functions, synthesizing ATP (adenosine triphosphate) from sugars and fatty acids and using it as energy. ATP is obtained through various processes. ATP is produced when sugars such as glucose are transported into cells and produced via glucose-6-phosphate in the glycolytic enzyme reaction to generate pyruvate. ATP is also produced through a series of metabolic processes in which fatty acids are converted into citric acid, oxaloacetate, and other compounds in the TCA cycle within the mitochondria of cells. Furthermore, ATP is also produced when fatty acids undergo beta-oxidation to form acetyl-CoA, and are then metabolized in the TCA cycle in a similar manner (Patent Document 1, Non-Patent Document 1).

[0003] These energy metabolic functions decline with age, leading to a decline in overall bodily function. Furthermore, when the energy consumed by overactive tissues exceeds the energy produced, energy deficiency occurs, leading to muscle fatigue, for example. While promoting energy production during rest is important to prevent the decline in bodily function, increasing energy production is also crucial when fatigued, as more energy is required.

[0004] Fatigue can be caused by a variety of factors, including energy insufficiency, impaired cellular energy production due to intense and prolonged stress, impaired brain coordination, and central fatigue caused by serotonin. However, the primary cause is thought to be energy insufficiency and impaired energy production. Therefore, to prevent or improve fatigue, it is important to activate enzymes involved in cellular energy production and enhance energy production capacity. Enzymes involved in energy production include PYGM (glycogen phosphorylase), which breaks down glycogen into glucose; COX7RP (cytochrome c oxidase subunit 7a-related polypeptide), which is involved in the formation of the mitochondrial electron transport chain supercomplex; AMPK (AMP-activated protein kinase), which activates the energy production system; and CPT1 (carnitine palmitoyltransferase), an enzyme involved in the uptake of fatty acids into mitochondria that binds fatty acids to carnitine. Activating these enzymes and increasing ATP production can alleviate energy insufficiency and impaired energy production, thereby achieving anti-fatigue effects.

[0005] Visual fatigue is thought to occur during visual tasks due to fatigue of the ciliary muscles, extraocular muscles, iris muscles, and cerebral cortex. Severe eye fatigue, often accompanied by symptoms such as decreased vision, diplopia, eye pain, headache, stiff shoulders, and sometimes nausea and vomiting, is called asthenopia. It is particularly caused by abnormalities in various factors related to close work (Non-Patent Documents 2 and 3). With the recent widespread use of personal computers and smartphones, people are spending more time working on visual display terminals (VDTs), which are screen-based tasks. The displays viewed during VDT work have insufficient resolution compared to photographs or printed materials, and can cause flickering due to flashing light stimuli. Furthermore, bright windows or lighting within the worker's field of vision, or reflections of these objects on the screen, further hinder vision and increase eye strain, making eye strain more likely. Furthermore, work requires three-dimensional gaze movement, including between the display, keyboard, and documents. This is said to increase eye movement two to three times more than in traditional office work. Furthermore, because the gaze distances are different for each person, frequent adjustment is required, which also causes eye strain (Non-Patent Document 4).

[0006] Amla, scientifically known as Phyllanthus emblica, is also known as amalaki, emblica, malacca, or emmalok. It grows on mountain slopes at altitudes of 1,500 meters or more in India, Southeast Asia, Taiwan, and southern China. It is one of the three major fruits in Indian Ayurvedic medicine, and in India, not only the fruit but also the seeds, leaves, trunk, and root are all used as medicine. It is known to be effective against peptic ulcers and indigestion, as well as for its lipid-lowering and anti-arteriosclerotic effects (Non-Patent Document 5).

[0007] The scientific name for bilberry is Vaccinium myrtillus, a wild blueberry native to Northern Europe. Standardized bilberry extract, which has been specified for 15 types of anthocyanins, is included in the European Pharmacopoeia, and has long been used as a medicine in Europe and elsewhere to treat eye disorders, vascular disorders, and dermatitis. Its virus-inactivating effects (Patent Document 2), blood flow improvement effects, capillary protection effects, antitumor effects, and antiulcer effects (Non-Patent Document 6) have been demonstrated.

[0008] However, no energy production promoter, muscle fatigue improver, or eye strain improver characterized by containing amla, no eye strain improver characterized by containing amla and bilberry, and no food composition containing them are known. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] Japanese Patent Application Laid-Open No. 2007-131609 [Patent Document 2] Japanese Patent Application Publication No. 2018-197205 [Non-patent literature]

[0010] [Non-Patent Document 1] Kunio Tagawa, Biochemistry of the Body (2nd edition), 111-116 (1993) [Non-patent document 2] Journal of the Illuminating Engineering Institute of Japan, Vol. 98, No. 2, 79-86 (2014) [Non-patent document 3] Supervised by Michiyuki Tani Ophthalmology (4th edition), 87-88 (1999) [Non-patent document 4] Shikoku Medical Journal, Vol. 62, No. 3, 4, AUGUST25, 120-122 (2006) [Non-Patent Document 5] Pharmacia Vol.45 No.10,1015-1016(2009) [Non-patent document 6] Bulletin of Gifu Pharmaceutical University Vol.65,20-27(2016) Summary of the Invention [Problem to be solved by the invention]

[0011] The present invention relates to an energy production promoter containing amla. More specifically, the present invention relates to an agent for improving muscle fatigue and eyestrain containing amla. The present invention also relates to an agent for improving eyestrain containing amla and bilberry. [Means for solving the problem]

[0012] As a result of extensive research, the present inventors have found that amla has excellent effects in promoting energy production, alleviating muscle fatigue, and alleviating eye fatigue. Furthermore, they have found that combining amla with bilberry has a more effective effect in alleviating eye fatigue than using either amla or bilberry alone.

[0013] The amla used in the present invention may be amla (Phyllanthus emblica), a plant of the Phyllanthaceae family. The parts of amla used in the present invention are not particularly limited, but include the fruit, seeds, trunk, roots, leaves, etc., and it is particularly preferred to use the fruit.

[0014] The bilberry used in the present invention may be Vaccinium myrtillus, a plant of the Ericaceae family. The part of the bilberry used in the present invention is not particularly limited, but may include the fruit and leaves, and it is particularly preferable to use the fruit.

[0015] The amla and bilberry used in the present invention can be used as is, or can be dried, crushed, shredded, or otherwise treated as necessary. Furthermore, amla and bilberry can be used as is, or can be treated with an enzyme after the above treatment. Examples of enzymes used in the enzyme treatment include pectinase, xylase, protease, cellulase, and hemicellulase. These enzymes may be used alone or in combination. It is preferable that the amla used in the present invention be treated with an enzyme, particularly with pectinase.

[0016] The amla and bilberry used in the present invention can be extracted either directly or after drying, crushing, or shredding. Examples of solvents used for extraction include water, lower alcohols (e.g., methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol), liquid polyhydric alcohols (e.g., 1,3-butylene glycol, propylene glycol, glycerin), ketones (e.g., acetone, methyl ethyl ketone), acetonitrile, esters (e.g., ethyl acetate, butyl acetate), hydrocarbons (e.g., hexane, heptane, petroleum ether), and ethers (e.g., ethyl ether, tetrahydrofuran, propyl ether). These solvents may be used alone or in combination. The bilberry of the present invention is preferably extracted with polar solvents such as water or lower alcohols, particularly with aqueous ethanol.

[0017] The enzyme-treated product or extract may be used as is, or, if necessary, may be subjected to treatment such as concentration, dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, or freeze drying, and used as a dried product.

[0018] The intake amount of amla and bilberry used in the present invention can be adjusted appropriately depending on the dosage form, purpose of use, age, body weight, etc. The daily intake amount of amla for adults is 0.05 to 500 mg, preferably 0.5 to 150 mg, as an enzyme-treated amla fruit product, and can be taken orally once or several times a day. The daily intake amount of bilberry for adults is 0.1 to 1000 mg, preferably 10 to 500 mg, as a hydroethanolic extract of bilberry fruit, and can be taken orally once or several times a day. In some cases, an amount less than the above intake range is sufficient, while in other cases, an amount exceeding the range is necessary. Furthermore, the method of adding the active ingredients in the formulation can be selected appropriately based on workability, either by adding them in advance or during production.

[0019] The energy production promoter, muscle fatigue improver, and eye fatigue improver of the present invention can be used as a food, quasi-drug, or pharmaceutical. As a food, it can be used in the form of soft capsules, hard capsules, granules, tablets, gummies, beverages, jellies, etc. Furthermore, as a quasi-drug or pharmaceutical, it can be used in the form of oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids, emulsions, etc., or parenteral eye drops, injections, suppositories, topical skin preparations, etc. To achieve the objectives of the present invention, oral preparations are preferred.

[0020] The energy production promoter, muscle fatigue improver, and eye fatigue improver of the present invention may optionally contain ingredients used in ordinary foods, quasi-drugs, and pharmaceuticals, such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, antiseptics, and flavorings, within limits that do not impair the effects. Furthermore, they may contain ingredients such as plant materials, polyphenols, vitamins, sugars, proteins, and oils and fats. [Effects of the Invention]

[0021] The energy production promoter, muscle fatigue improver, and eye strain improver of the present invention, which contain amla, have the effects of promoting energy production, improving muscle fatigue, and improving eye strain.Furthermore, the eye strain improver, which contains amla and bilberry, has an extremely excellent effect of improving eye strain. DETAILED DESCRIPTION OF THE INVENTION

[0022] The following examples are given for illustrative purposes only, and the scope of the present invention is not limited to these examples. The percentages of the contents shown in the examples represent percentages by weight. [Example]

[0023] Production Example 1: Enzyme-treated amla fruit 40 mg of pectinase was added to 100 g of amla fruit and treated with stirring at 50°C for 4 hours. The filtrate was then concentrated and spray-dried to obtain 10.2 g of enzyme-treated amla fruit.

[0024] Production Example 2 Amla fruit hot water extract 2 L of purified water was added to 100 g of amla fruit, and the mixture was extracted at 95-100°C for 2 hours. The filtrate was then concentrated and freeze-dried to obtain 8.4 g of amla fruit hot water extract.

[0025] Production Example 3: 30% ethanol extract of bilberry fruit 1.4 L of purified water and 0.6 L of ethanol were added to 100 g of bilberry fruit, and the mixture was extracted at room temperature for 5 days. The filtrate was then concentrated to dryness to obtain 3.0 g of a 30% ethanol extract of bilberry fruit.

[0026] Production Example 4 Bilberry fruit 50% ethanol extract 100 g of bilberry fruit was added with 1 L of purified water and 1 L of ethanol, and the mixture was extracted at room temperature for 5 days. The filtrate was then concentrated to dryness to obtain 2.1 g of a 50% ethanol extract of bilberry fruit.

[0027] Next, examples of formulations using the amla of the present invention, amla and bilberry will be given, but the present invention is not limited thereto. [Example]

[0028] Prescription example 1: Soft capsule <Prescription> Component Content (%) 1. Amla fruit enzyme-treated product (Production Example 1) 20.0 2. Add linseed oil so that the total amount becomes 100 3. Beeswax 5.0 4. Glycerin fatty acid ester 5.0 5. Vitamin E 3.0 <Manufacturing method> Components 1 to 5 were mixed, and 250 mg of the mixture was filled into a coating composed of starch, carrageenan, reduced starch syrup, and glycerin. After drying, soft capsules were obtained. <Usage> Take 3 tablets per day.

[0029] Prescription example 2: Soft capsule <Prescription> Component Content (%) 1. Amla fruit enzyme-treated product (Production Example 1) 10.0 2. 30% ethanol extract of bilberry fruit (Production Example 3) 10.0 3. Add linseed oil so that the total amount becomes 100 4. Beeswax 5.0 5. Glycerin fatty acid ester 5.0 6. Vitamin E 3.0 <Manufacturing method> Components 1 to 6 were mixed, and 250 mg of the mixture was filled into a coating composed of starch, carrageenan, reduced starch syrup, and glycerin. After drying, soft capsules were obtained. <Usage> Take 3 tablets per day.

[0030] Prescription Example 3: Tablets <Prescription> Component Content (%) 1. Amla fruit enzyme-treated product (Production Example 1) 0.02 2. Bilberry fruit 50% ethanol extract (Production Example 4) 2.0 3. Lutein 0.2 4. Zeaxanthin 0.04 5. Erythritol 52.4 6. Add maltitol so that the total amount is 100 7. Citric Acid 5.0 8. Sucrose fatty acid ester 3.0 9.Fragrance 0.1 <Manufacturing method> Ingredients 1 to 7 were mixed, and 10% water was added as a binder, followed by fluidized bed granulation. Ingredients 8 and 9 were added to the compacted granules, mixed, and compressed to obtain tablets weighing 2 g each. <Usage> Take 3 tablets per day.

[0031] Prescription Example 4: Hard capsule <Prescription> Component Content (%) 1. Amla fruit hot water extract (Production Example 2) 0.2 2. Bilberry fruit 50% ethanol extract (Production Example 4) 24.0 3. Add cornstarch so that the total amount is 100 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1 to 4 were mixed and filled into No. 2 hard capsules in an amount of 250 mg to obtain hard capsules. <Usage> Take 2 tablets per day.

[0032] Comparative Example 1: Conventional bilberry-containing soft capsule Conventional bilberry-containing soft capsules were prepared by replacing the enzyme-treated amla fruit (Production Example 1) in the soft capsules of Formulation Example 1 with a 30% ethanol extract of bilberry fruit (Production Example 3).

[0033] Comparative Example 2: Conventional soft capsule Conventional soft capsules were prepared by replacing the enzyme-treated amla fruit product (Production Example 1) in the soft capsules of Formulation Example 1 with linseed oil. [Example]

[0034] Test Example 1: Amla's effect in promoting the expression of energy-producing genes C2C12 myoblast cells were cultured in DMEM containing 10% fetal bovine serum at 37°C under 5% CO2 conditions. The medium was then replaced with DMEM containing 2% horse serum, and the cells were cultured to form myotubes. The medium was replaced with DMEM containing 10% fetal bovine serum containing 10% amla fruit enzyme-treated product (Production Example 1) at 100 μg / mL, and the cells were cultured for 24 hours, after which gene expression analysis was performed. For gene expression analysis, changes in the gene expression of PYGM, COX7RP, AMPK, and CPT1b, which are genes related to energy production, were evaluated using real-time PCR. The gene expression ratio was calculated by setting the value for the value without the addition of amla fruit enzyme-treated product as 1.

[0035] Primer set for PYGM GCATCAAAAGGGAGCCCAAT (SEQ ID NO: 1) GCCTTGCCTCCAATCATGA (SEQ ID NO: 2) Primer set for COX7RP GCTGTGCTTCTGCTCCTGATT (SEQ ID NO: 3) TGAGCTGGAGAGCAACTTTCC (SEQ ID NO: 4) Primer set for AMPK GTCTGGAGGTGAATTGTTCGACTA (SEQ ID NO: 5) GCGCGCTTCCACCTCTT (SEQ ID NO: 6) Primer set for CPT1b GACCCAAAACAGTATCCCAATCA (SEQ ID NO: 7) CGCCACGGGACCAAAG (SEQ ID NO: 8)

[0036] The results of Test Example 1 are shown in Table 1. The gene expression of PYGM, COX7RP, AMPK, and CPT1b was enhanced by the enzyme-treated amla fruit (Production Example 1).

[0037] Furthermore, the amla fruit hot water extract (Production Example 2) also enhanced the gene expression of PYGM, COX7RP, AMPK, and CPT1b.

[0038] These results demonstrate that amla has the effect of promoting energy production, which means that it has the effect of improving muscle fatigue by promoting energy production in muscle cells.

[0039] [Table 1]

[0040] Test Example 2: Improvement of eyestrain by drinking in humans Forty men and women (aged 25-65) who worked with visual display terminals (VDTs) and regularly complained of eye fatigue were divided into four groups of 10 participants each. Test Group 1 received soft capsules containing amla (Formulation Example 1), Test Group 2 received soft capsules containing amla and bilberry (Formulation Example 2), Test Group 3 received conventional soft capsules containing bilberry (Comparative Example 1), and Test Group 4 received conventional soft capsules (Comparative Example 2). Each group took three soft capsules per day, and a questionnaire regarding eye fatigue was administered in the evening three months after ingestion. The questionnaire asked subjects to select one of four levels for eye fatigue compared to before ingestion: "very improved," "improved," "slightly improved," or "no change or worsening."

[0041] The results of Test Example 2 are shown in Table 2. Compared with Test Group 4 (Comparative Example 2), Test Group 1 (Formulation Example 1), Test Group 2 (Formulation Example 2), and Test Group 3 (Comparative Example 1) had a higher number of people who answered "much improved," "improved," or "slightly improved," demonstrating an improvement in eye strain. Furthermore, Test Group 2 (Formulation Example 2) had the highest number of people who answered "much improved," demonstrating an extremely excellent improvement in eye strain. Therefore, amla was shown to have an effect of improving eye strain. Furthermore, the combination of amla and bilberry was shown to have an extremely excellent effect of improving eye strain.

[0042] [Table 2] [Industrial Applicability]

[0043] As described above, the present invention can be used as an energy production promoter, a muscle fatigue improver, or an eye strain improver containing amla, or as an eye strain improver containing amla and bilberry.The present invention can also be used in foods, quasi-drugs, and pharmaceuticals containing these.

Claims

1. An eye strain relief agent characterized by containing amla and bilberry.

2. A food composition for improving eyestrain, comprising the agent according to claim 1.

Images