ARC Capsid Compositions and Methods of Use

A vector encoding Arc protein forms recombinant capsids to deliver mRNA, addressing the molecular function and evolutionary origin of Arc, enhancing synaptic plasticity and treating neurodevelopmental disorders.

JP7774319B2Active Publication Date: 2025-11-21UNIV OF UTAH RES FOUND
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023076834
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-08-09
Filing Date
2023-05-08
Publication Date
2025-11-21
Estimated Expiration
2038-05-10

AI Technical Summary

Technical Problem

There is limited understanding of the molecular function and evolutionary origin of the neuron-associated gene Arc, which is essential for persistent information storage and synaptic plasticity, and its potential role in neurodevelopmental disorders.

Method used

Development of a vector comprising a nucleic acid sequence capable of encoding an Arc protein, leading to the formation of recombinant Arc capsids that can be conjugated with labeling or targeting moieties, and methods for delivering mRNA to cells using these capsids.

Benefits of technology

The recombinant Arc capsids effectively deliver mRNA to cells and subjects, enhancing synaptic plasticity and potentially treating neurodevelopmental disorders by importing Arc mRNA into neurons.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007774319000001
    Figure 0007774319000001
  • Figure 0007774319000002
    Figure 0007774319000002
  • Figure 0007774319000003
    Figure 0007774319000003
Patent Text Reader

Abstract

To provide compositions and methods of use of ARC capsids.SOLUTION: The specification discloses a human Arc capsid composed of Arc protein comprising CA domain, with heterologous nucleic acids encapsulated therein. The specification also discloses an extracellular vesicle or exosome comprising the human Arc capsid. The specification also discloses a host cell comprising the human Arc capsid. The specification also discloses a method for making the human Arc capsid or the extracellular vesicle or exosome.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing Reference The sequence listing submitted on August 9, 2017 as a text file entitled "21101_0352U2_Sequence_Listing.txt," created on August 9, 2017 and measuring 71,200 bytes, is hereby incorporated by reference pursuant to 37 CFR §1.52(e)(5). [Background technology]

[0002] The neuron-associated gene Arc is essential for persistent information storage in the mammalian brain, mediates various types of synaptic plasticity, and has been implicated in neurodevelopmental disorders. However, little is known about Arc's molecular function and evolutionary origin. New research suggests that Arc originates from a retrotransposon with homology to the Gag polyprotein shared by retroviruses. The biochemistry of Arc exhibits molecular characteristics similar to those of retroviruses. Summary of the Invention

[0003] Disclosed is a vector comprising a nucleic acid sequence capable of encoding an Arc protein.

[0004] Recombinant Arc capsids are disclosed. Arc capsids are disclosed that are conjugated to a labeling moiety or a targeting moiety or both.

[0005] Disclosed are cells comprising a vector that includes a nucleic acid sequence capable of encoding an Arc protein.

[0006] A composition comprising an Arc capsid and a pharmaceutically acceptable carrier is disclosed.

[0007] Disclosed is a method for delivering mRNA to a cell, comprising administering an Arc capsid to the cell, wherein the Arc capsid contains an mRNA of interest.

[0008] Disclosed is a method of delivering mRNA to a cell, comprising administering to the cell any one of the disclosed vectors and administering to the cell an mRNA of interest, wherein the nucleic acid sequence encodes an Arc protein within the cell, an Arc capsid is formed, and the Arc capsid encapsulates the mRNA of interest therein.

[0009] Disclosed are methods for delivering mRNA to a subject, comprising administering one or more of any one of the disclosed cells to a subject in need thereof.

[0010] Disclosed is a method for forming Arc capsids, comprising administering to a solution containing cells a vector comprising a nucleic acid sequence capable of encoding an Arc protein, wherein the nucleic acid sequence encodes the Arc protein within the cells and Arc capsids are formed.

[0011] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed methods and compositions and together with the description serve to explain the principles of the disclosed methods and compositions. [Brief explanation of the drawings]

[0012] [Figure 1A]A–D. Arc forms a virus-like capsid via the conserved retroviral Gag CA domain. (A) Maximum likelihood phylogenetic tree based on amino acid alignment of Gag sequences from tetrapod Arc, fly dArc1, and related Ty3 / gypsy retrotransposons. A schematic representation of the Gag-only Arc gene and Ty3 / gypsy elements is included to the right of the tree. Excluding the Arc gene, the sequence most closely related to Arc is a Gag-pol polyprotein flanked by long terminal repeats (LTRs), as expected for authentic Ty3 / gypsy retrotransposons. (B) (Top) Representative negative-stain EM image of full-length purified rat Arc (prArc) protein (1 mg / mL, 42,000x magnification). (i–iv) Magnification of boxed particles. Scale bar = 30 nm. Representative cryo-EM image of prArc (2 mg / mL, 62,000x magnification). (v-vii) Magnified images of Arc capsids showing the double-layered capsid shell. Scale bar = 30 nm. (Bottom) Dynamic light scattering analysis of prArc capsids. Weighted particle size distribution profiles are presented as histograms of particle counts. (C) Schematic representation of the Arc protein with the prediction matrix (MA) (orange), CA-NTD (green), and CA-CTD (blue) domains. The ΔCTD deletion mutant and CA domain constructs are also depicted. Representative negative-stain EM images of purified GST, prArc, the Drosophila Arc homolog dArc1, prArc-ΔCTD, and CA-prArc (all at 1 mg / mL, 20,000x). Inset scale bar = 50 nm. (Bottom) Quantification of encapsidation. Fully formed capsids comprise 20-60 nm spherical particles with a clear double shell, whereas partially formed capsids lack a clear double shell (scale bar = 100 nm). Data are means ± standard error of the mean from three independent experiments using three different prArc preparations. ***p<0.001, two-way ANOVA with post-hoc t-test. (D) (Top) To characterize Arc capsid stability, prArc was substituted into buffers with increasing salt molarity and examined by negative-stain EM. Arc capsids were manually counted and quantified in each buffer condition at a protein concentration of 1.5 mg / mL.Data are means ± standard errors of the mean values ​​from three independent experiments using different prArc preparations. **p<0.01, Student's t-test. (Bottom) Representative EM images of prArc under 0 M NaCl and 0.5 M NaPO conditions. [Figure 1B] Same as above [Figure 1C] Same as above [Figure 1D] Same as above [Figure 2A-B]A–E show that Arc protein interacts with mRNA. (A) (Left) qRT-PCR of Arc mRNA from prArc and bacterial asnA mRNA. (Right) qRT-PCR of Arc and asnA mRNA from total bacterial lysates. Data are presented as mean ± standard error normalized to the mean of the asnA group (Student's t-test, n = 3 independent protein preparations, *p < 0.05). (B) Protein preparations were treated with or without RNase A for 15 min, and qRT-PCR was performed. RNase treatment did not affect Arc and asnA mRNA levels (paired t-test, n = 5 independent protein samples), but significantly degraded exogenous / free GFP mRNA (paired t-test, n = 3 independent samples, *p < 0.05). Data are presented as mean ± standard error normalized to the mean of the untreated group. (C) (Top) Representative Western blot of Arc protein immunoprecipitated (IP) from WT mouse cortical tissue using Arc or IgG antibodies. Input (I) = 10% total lysate. (Bottom, left) Quantification of Arc protein IP, showing significant enrichment of Arc protein using Arc antibodies. (Bottom, right) qRT-PCR was performed on elution fractions from IP. Arc mRNA was specifically precipitated in IP (two-way ANOVA with repeated measures and Sidak's multiple comparison: Arc + Arc vs. Arc + IgG, p = 0.01; Arc + Arc vs. GAPDH + Arc, p = 0.013; Arc + Arc vs. GAPDH + IgG, p = 0.011). Data are presented as mean ± standard error normalized to the mean of the IgG group. (D) qRT-PCR of Arc mRNA from prArc and prArc(RNA-). Arc mRNA was significantly less in prArc(RNA-) preparations. Values ​​are expressed as the mean ± standard error normalized to the mean of the prArc group (Student's t test, n = 3 independent samples, *p = 0.05). (E) (Left) Representative negative-stain EM images of prArc, prArc(RNA-), and prArc(RNA-) incubated with 7.3% (w / w) GFP mRNA for 2 h at room temperature (0.25 mg / mL, 15,000x).Fully formed capsids are indicated by red arrows (scale bar = 100 nm). (Right) Capsids were quantified as in Fig. 1C. Data are presented as the mean ± standard error of six images from each condition. ***p<0.001, unpaired t-test. [Figure 2C-D] Same as above [Figure 2E] Same as above [Figure 3A-C]A–F show that Arc is released from cells in extracellular vesicles. (A) HEK cells in 10 cm dishes were transfected with full-length rat WT myc-Arc, and the medium was collected 24 h later. Representative Western blots (n = 3 independent experiments) show Arc protein in the whole cell lysate (cells) and in the EV fraction purified from the cell medium in Arc-transfected (+) and untransfected (-) cells. ALIX was used as an EV fraction marker. Ponceau stain was used to visualize the total amount of protein in each lane. (B) HEK293 cells were transfected with myc-Arc-WT or myc-Arc-ΔCTD, and the medium was collected 24 h later. Representative Western blots (n = 3 independent experiments) show Arc protein in the whole cell lysate (cells) and in the EV fraction purified from the cell medium. In each experiment, Arc levels in the EV fraction were normalized to Arc protein levels in cell lysates, and data are presented normalized to WT levels (n = 3). *p < 0.05, Student's t-test. (C) HEK EV fractions were untreated (control) or treated with RNase (n = 6 independent cultures) prior to RNA extraction. Arc mRNA levels were measured using qRT-PCR, and data are presented as mean ± standard error normalized to the mean of the untreated group. Paired t-test. (D) Media from DIV15 cultured cortical neurons obtained from WT and Arc KO mice was collected after 24 h of incubation, and EV fractions were purified from the collected media. Blots show Arc, ALIX, and actin levels from the supernatant (S) / soluble fraction and pellet (P) / insoluble fraction of total cell lysates (cells). (S) / final wash of the centrifugation purification protocol, and pellet (P) / EV fraction as purified EV fraction (EV). 2.5% of S and P were loaded for cell lysates. 5% of S and P were loaded for EV fractions. (E) RT-PCR using Arc and GAPDH primers was performed on EVs purified from WT or KO mouse cortical tissue, WT or KO mouse cortical neurons at DIV15, and medium collected from WT or KO cultured neurons.Arc mRNA was present in all three preparations, but GAPDH mRNA was absent in EVs. (F) (Top) Immunogold labeling for Arc in EVs obtained from cultured Arc KO or WT neurons as described in (D) above. Red arrows indicate 10 nm immunogold particles (20,000x magnification). (Bottom) Quantification of EVs (vesicular structures smaller than 100 nm) that were Arc positive ± standard error using immunogold labeling (n = 3 independent experiments / EV preparation). ***p < 0.001, Student's t-test. [Figure 3D-F] Same as above [Figure 4A]Arc extracellular vesicles mediate the intercellular movement of proteins and mRNA in HEK293 cells. (A) Donor HEK cells in 10 cm dishes were transfected with GFP-Arc, myc-Arc, or nuclear GFP (nucGFP) for 6 hours. The culture medium containing the plasmid DNA and transfection reagent was then removed and replaced with fresh culture medium. After 18 hours, this medium was removed and used to replace the medium of naive recipient HEK cells on coverslips in 12-well plates. After 24 hours, these cells were fixed and subjected to combined FISH for Arc mRNA and ICC for Arc protein. (Left) Representative images of HEK cells grown on coverslips and transfected using the same protocol as in 10 cm dishes, showing Arc protein (ICC) and Arc mRNA (FISH). (Right) Representative images of recipient HEK cells showing the presence of Arc mRNA and protein in cells receiving medium from cells transfected with GFP-Arc and myc-Arc, but not nucGFP. Scale bar = 20 μm. Representative of seven independent experiments and cultures. (B) Donor HEK cells in 10 cm dishes were transfected with membrane GFP (mGFP), myc-Arc, or both constructs as in (A). After 6 and 18 hours, the medium was changed and transferred to naive recipient HEK cells in 12-well plates. After 24 hours, cells were fixed and subjected to combined FISH / ICC for GFP mRNA and Arc protein. (Left) Representative images of transfected HEK cells grown on coverslips showing mGFP fluorescence, Arc protein, and GFP mRNA. (Right) Representative images of recipient HEK cells showing co-transfection of GFP protein and mRNA with Arc protein. No GFP transfection was observed in the mGFP-only group. Scale bar = 20 μm. Representative of three independent experiments and cultures. [Figure 4B] Same as above [Figure 5A-B]A–D show that Arc capsids import Arc mRNA into neurons. (A) Representative images of Arc ICCs from DIV15 cultured hippocampal Arc KO neurons or WT control neurons treated with 4 mg of prArc for 1 or 4 hours. prArc-treated neurons exhibited enhanced dendritic Arc levels compared to untreated KO neurons. (B) Neurons were treated as in (A). Representative images of Arc mRNA (FISH) are shown. 4 hours of prArc treatment significantly enhanced dendritic Arc mRNA levels in KO neurons. (C) Representative images of Arc ICCs from DIV15 cultured hippocampal KO neurons treated with 4 mg of prArc, prArc-ΔCTD, or CA-prArc for 4 hours. KO neurons treated with prArc-ΔCTD and CA-prArc exhibited lower Arc protein levels compared to prArc-treated neurons. (D) Neurons were treated as in (C). Representative images of Arc mRNA are shown. Neurons treated with prArc-ΔCTD and CA-prArc showed lower Arc mRNA levels than prArc-treated neurons. Magnified sections of dendritic sections enclosed by white boxes are shown below each corresponding image. In all groups (n = 10 neurons), two 30 mm sections of dendrites / neurons were analyzed for comprehensive density measurements. Arc mRNA and Arc protein levels were normalized to untreated KO neurons and presented as fold change ± standard error. Student's t-test: *p < 0.05, **p < 0.01, and ***p < 0.001. Scale bar, 10 mm. Images are pseudocolored using Smart LUT from ImageJ. All data are representative of three to seven independent experiments and cultures using different protein preparations. See also Figure 12. [Figure 5C-D] Same as above [Figure 6A]A and B show that endogenous Arc in neuronal extracellular vesicles imports Arc mRNA into neurons. (A) Representative images of Arc ICCs from DIV15 cultured hippocampal Arc KO neurons treated for 1 or 4 hours with 10 mg of EV fraction prepared from a 10 cm dish of DIV15 high-density cortical WT or Arc KO neurons. Treatment with KO EV for 1 hour and 4 hours did not improve dendritic Arc levels, whereas treatment with WT EV for 1 hour and 4 hours significantly improved dendritic Arc protein levels. (B) Neurons were treated as in (A). Representative images of Arc mRNA (FISH) are shown. Treatment with KO EV for 1 hour and 4 hours did not improve dendritic Arc mRNA levels. Treatment with WT EV for 1 hour did not significantly improve dendritic Arc levels, whereas treatment for 4 hours improved dendritic Arc mRNA levels. In all groups (n=10 neurons), two 30 mm sections of dendrites / neurons were analyzed for comprehensive density measurements. Arc mRNA and Arc protein levels were normalized to untreated KO neurons and presented as fold change ± standard error. Student's t-test: *p<0.05. **p<0.01. ***p<0.001. Scale bar, 10 mm. Representative of six independent experiments and cultures using different EV preparations. See also Figure 14. [Figure 6B] Same as above [Figure 7A]Panels A and B show that Arc mRNA delivered by EVs is available for activity-dependent translation via Arc capsids. A) Representative images of Arc ICCs from DIV15 cultured hippocampal Arc KO neurons treated with 4 mg of prArc for 4 hours. To induce Arc mRNA translation, neurons were treated with the mGluR1 / 5 agonist DHPG (100 mM) for 5 minutes 30 minutes before fixation, followed by washout. One hour before fixation, a subset of neurons was pretreated with cycloheximide (CHX; 180 mM) to block protein translation. prArc significantly increased dendritic Arc expression in KO neurons, and DHPG treatment further enhanced dendritic Arc levels, which was blocked by pretreatment with CHX. DHPG had no effect on untreated KO neurons. (B) Representative images of Arc ICCs from DIV15 hippocampal Arc KO neurons treated for 4 hours with 10 mg of EV fraction prepared from a 10 cm dish of DIV15 high-density cortical WT or Arc KO neurons. A subset of neurons was treated with DHPG and CHX as in (A). WT EV significantly increased dendritic Arc expression in KO neurons, whereas KO EV had no effect. DHPG treatment had no effect on dendritic Arc expression in untreated or KO EV-treated KO neurons. On the other hand, DHPG treatment significantly increased dendritic Arc levels in WT EV-treated KO neurons, but this was blocked by pretreatment with CHX. In all groups (n = 10 neurons), two 30 mm sections of dendrites / neuron were analyzed for comprehensive density measurements. Arc mRNA and Arc protein levels were normalized to untreated KO neurons and presented as fold change ± standard error. Student's t-test: *p<0.05, **p<0.01, and ***p<0.001. Scale bar, 10 mm. Representative of three independent experiments and cultures using different EV / protein preparations. [Figure 7B] Same as above [Figure 8A-1]A and B show primary amino acid sequence alignments of the Ty3 / Gag element with the origin of the dipteran Arc gene. (A) Alignment of translated genomic DNA sequences corresponding to the Arc or gypsy Gag protein was performed using MUSCLE (www.ebi.ac.uk / Tools / msa / muscle / ). Aligned sequences were shaded using the boxshade plot server (www.ch.embnet.org / software / BOX_form.html) with default parameters (shading 50% of sequences sharing amino acid identity). Note: The alignment does not contain the full-length sequence with the start site, but only a fragment of the Arc gene. The species included Mm-Mus musculus (house mouse), Hs-Homo sapiens (human), Ac-Anolis carolinensis (green anole), Lc-Latimeria chalumnae (West Indian Ocean coelacanth), Dr-Danio rerio (zebrafish), Cc-Cyprinus carpio (carp), Dm-Drosophila melanogaster (Drosophila melanogaster), Ds-Drosophila suzukii (Drosophila suzukii), Sc-Stomoxys calcitrans (stable fly), Lh-Linepithema humile (Argentine ant), Bm-Bombyx mori (silkworm), and Tc-tribolium castaneum (red flour beetle). (B) (Left) Maximum likelihood phylogenetic analysis of Arc homologs in Drosophilidae, Muscidae, and Tephritidae flies. Multiple copies of darc1 were found throughout fruit flies and in the house fly, Musca domestica. Each sequence is given a GenBank accession number based on the abbreviated species name. Tephritidae: RZ - Rhagoletis zephyria, CC - Ceratitis capitata, BD - Bactrocera dorsalis. Muscidae: MD - Musca domestica, SC - Stomoxys calcitrans. (Right) Putative duplication history of dArc in antler flies, inferred from the phylogenetic analysis in (A).Because all flies of the antler sac segment examined possess homologs of darc1 and darc2, an ancestral duplication of dArc must have occurred prior to the divergence of these species (blue triangles). This ancestral duplication event was followed by multiple duplications of darc1 in several lineages (green triangles): two duplication events in the common ancestor of the Tephritidae, one further duplication in the Ceratitis capitata lineage, and one further duplication in the Bactrocera dorsalis lineage. Independently, darc1 underwent three duplications in the Musca domestica lineage. In contrast, darc2 remained an apparently single-copy gene in the species examined. [Figure 8A-2] Same as above [Figure 8A-3] Same as above [Figure 8B-1] Same as above [Figure 8B-2] Same as above [Figure 9A-D]Figures A–D show recombinant protein purification and experiments related to Figure 2. A) Representative Coomassie gels of affinity purification of (from left to right) full-length rat Arc (prArc), prArc-ΔCTD, CA-prArc, GST, and Endo3A, showing similar expression levels as prArc. prArc-ΔCTD and Endo3A were prepared in a similar manner to prArc. GST was immediately eluted from the affinity resin using 15 mM L-glutathione. His-tagged CA-prArc was eluted from the Ni2+ affinity resin using 250 mM imidazole. After GST tag cleavage with Precision Protease or elution, all proteins were buffer-switched to 150 mM NaCl, 50 mM Tris, pH 7.4. For each experiment, buffer conditions for all proteins were adjusted to 500 mM NaPO4, 50 mM Tris, pH 7.4 for capsid stability. Analysis showing fractionation of bacterially expressed proteins into soluble (supernatant) and insoluble (pellet) fractions (lanes 1 and 2) and their capture on GST or Ni2+ affinity matrices (lanes 3–5 show flow-through (FT), wash, and captured protein, respectively). This panel demonstrates the protein expression levels and the effectiveness and efficiency of affinity capture. (B) Representative Coomassie gel of peak fractions of prArc, prArc-ΔCTD, and Endo3A eluted from an S200 size-exclusion column. Peak fractions were pooled and concentrated to a final stock concentration of 1 mg / mL. Unless otherwise noted, prArc was concentrated to 1 mg / mL after each purification for use in all biochemistry / EM experiments. For cell biology experiments, prArc was diluted to 0.4 mg / mL, and 4 μg of total protein was used per condition. (C) Representative Coomassie gel of affinity purification of Drosophila dArc1 from BL21 bacterial lysate, demonstrating expression levels similar to rat prArc. (D) HEK293 cells in 12-well plates were transfected with full-length rat WT Arc or GFP plasmids at equal DNA concentrations using Lipofectamine and subjected to in situ formaldehyde crosslinking. Cell lysates were blotted with anti-GFP or anti-Arc antibodies.Note that the high molecular weight species correspond to Arc dimers, and trimers are likely observed in the cross-linked Arc sample, but not in the GFP sample. [Figure 10A]Figures A–D show RNA binding experiments and characterization of Arc EVs related to Figures 2 and 3. (A) Representative Coomassie gel of nucleotide removal from prArc. (Left) Cells were lysed in 20 mM NaCl, 50 mM Tris, 2 mM MgCl2, 5% glycerol, 1 mM DTT, pH 8.0. Fractions shown are the supernatant and pellet fractions after pelleting at 21,000 x g for 45 minutes. The supernatant from this step was treated with 0.1% PEI to precipitate nucleic acids. This treatment resulted in a shift in the A260 / 280 ratio from 1.71 ± 0.018 to 1.29 ± 0.023, suggesting a reduction in nucleic acid content. The sample was pelleted at 27,000 x g for 20 min, and the resulting supernatant was treated with ammonium sulfate (AmSulf) precipitation to concentrate Arc and pelleted at 10,000 x g for 10 min. The AmSulf pellet containing Arc was then subjected to affinity purification as described above. (Right) Representative Coomassie gel of the peak fraction of cleaved, affinity-purified, PEI-treated Arc from the anion exchange column. This chromatography step further removed bound nucleic acids from Arc. The peak fractions were concentrated to 1 mg / mL, and the final measured A260 / A280 ratio of these fractions was 0.68 ± 0.03 (n = 3), suggesting that PEI-treated prArc contained little nucleic acid. (B) (Left) Representative negative-stain EM image of purified EVs from Arc-transfected HEK293 cell culture media harvested at 24 h, used for Western blot analysis. (Right) Representative negative-stain EM image of purified EVs from WT cultured neuron media harvested at 24 hours used for Western blot analysis. Red arrows indicate purified EVs. (C) (Left) Western blot of Arc in untreated EVs or EVs treated with trypsin (0.05 mg / mL) for 30 minutes. prArc was used as a positive control for trypsin activity. (Right) Quantification of Arc Western blot normalized to total protein. Trypsin degraded prArc but had no effect on Arc protein present in neuronal EVs. (D) Activity dependence of Arc secretion. Purified EV fractions from media harvested from DIV15 cortical neurons in 10 cm dishes from untreated WT neurons were compared with treatment with KCl.Fresh medium was replaced with basal medium or medium supplemented with KCl to a final concentration of 50 mM. Following the medium change, cells were incubated for 1 hour, and the medium was collected to purify the EV fraction. (Left) Western blot of Arc and total protein from the purified EV fraction from cultured neuron medium. (Right) Quantification of Arc protein levels normalized to total protein. KCl treatment resulted in slightly more Arc being released into the medium (n=2, p<0.05). [Figure 10B-D] Same as above [Figure 11A-C]Panels A–C show HEK cell experiments related to Figure 4 and custom Arc antibody control experiments. (A) HEK293 cells in 10-cm dishes were transfected with GFP-Arc as described in Figure 4. After 18 hours, medium from GFP-Arc-transfected HEK cells in 10-cm dishes was transferred to naive HEK cells in 12-well plates. One group was simultaneously treated with 80 mM Dynasore to block endocytosis. Six hours later, the Dynasore-treated medium was replaced with fresh HEK medium. After 18 hours, cells were fixed, and the number of GFP-Arc-expressing cell clumps across an 18-mm coverslip was manually counted using a 20X objective (n = 3 coverslips / group). (Left) Representative image of one 20X field. (Right) Dynasore significantly reduced the number of GFP-Arc-positive cell clumps across the coverslip. Student's t-test: *p < 0.05. Scale bar = 50 mm. Representative of three independent experiments and cultures with similar results. (B) Cultured hippocampal Arc KO and WT neurons at DIV15 were immunostained for the dendritic protein MAP2 with Alexa Fluor 555 alone (top row) or both MAP2 (Alexa 555) and Arc (Alexa 488; bottom two rows). The imaging settings for Arc were determined based on the Arc immunostaining of WT neurons (bottom row). Under these imaging conditions, GFP fluorescence from GFP knocked into the Arc locus in KO neurons was not visible. (C) Cultured hippocampal Arc KO and WT neurons at DIV15 were fixed and immunostained for the dendritic protein MAP2 with either a custom-made rabbit polyclonal Arc antibody (ProteinTech) or a commercially available rabbit polyclonal Arc antibody from Synaptic Systems. All groups were imaged using the same acquisition settings. In all groups (n = 10 neurons), 30 mm sections of two dendrites / neurons were analyzed and selected using MAP2 staining. Both antibodies were able to detect differences between Arc KO and WT neurons, but the signal:noise ratio was better with the custom antibody. Under basal conditions, Arc in the soma / nucleus varied greatly between neurons using either antibody.Student's t-test: **Arc KO vs. WT with custom antibody, p<0.01. #Arc KO vs. WT with Synaptic Systems ("SySy") antibody, p<0.05. Arc images are pseudocolored with a Smart LUT in ImageJ to better visualize differences in Arc expression. Examples of two independent experiments. [Figure 12A-B]A–D show experiments related to Figure 5. (A) To test whether Arc mRNA is protected within prArc capsids, samples were treated with RNase A for 15 minutes, then inactivated with RNase inhibitor (1 U / mL), and then incubated with neurons. (Left) Representative images of Arc mRNA in DIV15 cultured hippocampal Arc KO neurons incubated with treated or untreated prArc samples for 4 hours. (Right) prArc treatment resulted in increased dendritic Arc mRNA levels in Arc KO neurons. RNase-treated prArc did not affect Arc mRNA import. (B) DIV15 cultured hippocampal Arc KO neurons were treated with 4 mg of prArc for 4 hours. In one group, neurons were pretreated with 80 mM Dynasore 30 minutes before prArc addition to prevent endocytosis. (Left) Representative images of Arc protein and mRNA levels. (Right) Pretreatment with Dynasore significantly blocked the uptake / import of prArc protein and Arc mRNA. Student's t-test: *p<0.05. ***p<0.001. Examples of three independent experiments (A, B). Scale bars for all panels = 10 mm. (C) Cultured hippocampal Arc KO neurons at DIV15 were treated with 4 mg of prArc for 4 hours. Either combined FISH / ICC for Arc mRNA and Rab5 protein or ICC for Arc and Rab5 protein was performed. (Left) Representative images of dendrites showing Arc mRNA and Rab5 protein, or Arc and Rab5 protein. (Right) Arc protein and mRNA showed approximately 50% colocalization with Rab5 in dendrites. White arrowheads indicate Arc alone, and yellow arrowheads indicate Arc / Rab5 colocalization. Examples of two independent experiments. Scale bars = 10 mm. (D) Purified protein samples of prArc, prArc(RNA-), prArc-ΔCTD, and CA-prArc were separated by SDS-PAGE, and the resulting Western blots were immunostained for Arc using our custom-made Arc antibody.The antibody successfully detected all mutant constructs, suggesting that the lack of Arc immunostaining observed in the transfection experiments was not due to the antibody's inability to detect the mutants. "Total" is Ponceau staining of total protein in each sample. [Figure 12C-D] Same as above [Figure 13] This shows that purified, nucleic acid-depleted Arc binds to the outside of neurons and is not internalized. Cultured hippocampal Arc KO neurons at DIV15 were treated with 4 mg of prArc or prArc(RNA-) for 4 hours and then fixed. One group from each treatment was not permeabilized during immunocytochemistry for Arc and MAP2. Non-permeabilized prArc-treated neurons showed little to no MAP2 or Arc immunostaining. On the other hand, prArc(RNA-)-treated neurons showed no difference in Arc immunostaining between permeabilized and non-permeabilized conditions, while MAP2 immunostaining remained absent in non-permeabilized conditions, suggesting that prArc(RNA-) accumulates on the outside of neurons. Magnified dendritic sections enclosed by white boxes are shown below each corresponding image. Scale bar = 10 mm. Example of three independent experiments. Arc images are pseudocolored using a Smart LUT from ImageJ to highlight differences in Arc expression. The merged image shows MAP2 immunostaining in magenta and Arc in green. [Figure 14A-B]Panels A, B, C, and D show RNase and uptake experiments related to Figure 6. (A) To test whether Arc mRNA is protected within neuronal EVs, EVs prepared from a 10-cm dish of cultured WT cortical neurons at DIV15 were treated with RNase A for 15 minutes, then inactivated with RNase inhibitor (1 U / mL), and then incubated with the neurons. Cultured hippocampal Arc KO neurons at DIV15 were incubated with 10 mg of treated or untreated WT EV samples for 4 hours. (Left) Representative images of neuronal Arc mRNA levels. (Right) WT EV treatment resulted in increased dendritic Arc mRNA levels in Arc KO neurons. RNase-treated WT EVs did not affect Arc mRNA import. (B) DIV15 cultured hippocampal Arc KO neurons were treated for 4 hours with 10 mg of EV fraction collected from the medium of a 10 cm dish containing high-density cultured cortical WT or Arc KO neurons at DIV15. In one group, neurons were pretreated with 80 mM Dynasore 30 min before EV addition to block endocytosis. (Top) Representative images of Arc protein levels (left) or Arc mRNA levels (right). (Bottom) Pretreatment with Dynasore significantly blocked the uptake of Arc protein and mRNA from WT EVs. Arc protein and mRNA expression were normalized to Arc KO and shown as fold change ± standard error. Enlarged sections of dendritic sections marked in white are shown below each corresponding image. In all groups (n = 10 neurons), 30 mm sections of two dendrites / neurons were analyzed and selected using MAP2 staining. Student's t-test: ***p < 0.001. Scale bar = 10 mm. Examples of three independent experiments. Images are pseudocolored using a Smart LUT from ImageJ to highlight differences in Arc expression. (C) Cultured hippocampal Arc KO neurons at DIV15 were treated with 10 mg of WT EV for 4 hours and then fixed. Either combined FISH / ICC for Arc mRNA and Rab5 protein or ICC for Arc and Rab5 protein was performed.(Left) Representative images of dendrites showing Arc mRNA and Rab5 protein, or Arc and Rab5 protein. (Right) Arc mRNA and protein showed 30-40% colocalization with Rab5 in dendrites. White arrowheads indicate Arc alone, and yellow arrowheads indicate Arc / Rab5 colocalization. Examples of two independent experiments. Scale bar = 10 mm. (D) Model: Comparison of the life cycle of HIV Gag and Arc capsids. (Top) HIV Gag protein self-assembles in the cytosol (via the CA domain) and on the plasma membrane (via myristoylation of the MA domain), while the capsid encapsulates viral RNA (via the NC domain). Immature HIV capsids, along with membranes containing the viral envelope protein (Env), are released from cells in an ESCRT-dependent manner (via the p6 domain). Mature viral particles bind to host cells via surface receptors (e.g., CD4), resulting in membrane fusion. Alternatively, in some cell types, viral particles first undergo endocytosis and then fuse; complete fusion occurs within endosomes before the particles are released intracellularly. Viral RNA is released and then reverse-transcribed into viral DNA that integrates into the host genome. (Bottom) Arc mRNA is delivered into dendrites within RNA granules containing a variety of selected mRNAs. Local translation of Arc mRNA occurs within dendrites in response to neuronal activity. High concentrations of Arc protein self-assemble to form Arc capsids containing Arc mRNA and spatially nearby selected mRNAs. Arc capsids are released from dendrites within Arc Capsids Bearing Any RNA (ACBAR), allowing the transfer of mRNA and other putative cargo to neighboring dendrites. [Figure 14C] Same as above [Figure 14D] Same as above [Figure 15A]A and B show that RNA co-transferred with Arc protein is translated in recipient cells. (A) HEK293T "donor" cells were co-transfected with WT myc-Arc and GFP. Media from the transfected cells was placed on naive "recipient" cells with or without the translation inhibitor cycloheximide (CHX). Six hours later, cells were fixed and subjected to fluorescent in situ hybridization for GFP RNA and immunocytochemistry for Arc protein. (B) As indicated by a leftward shift in the integrated frequency distribution and a decrease in the average GFP and Arc protein levels per cell, CHX treatment significantly reduced the amount of GFP protein expressed in recipient cells without affecting GFP RNA levels. This suggests that Arc protein is co-transferred with GFP RNA, which can be newly translated in recipient cells. *p<0.05; **p<0.01; ***p<0.001. Scale bar = 10 μm. [Figure 15B] Same as above DETAILED DESCRIPTION OF THE INVENTION

[0013] Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.

[0014] The disclosed methods and compositions may be understood more readily by reference to the following detailed description of specific embodiments and the examples contained therein, as well as the figures and preceding and following description thereof.

[0015] It is to be understood that, unless otherwise specified, the disclosed methods and compositions are not limited to particular synthetic methods, specific analytical techniques, or particular reagents, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0016] Disclosed are materials, compositions, and components that can be used for, used in conjunction with, used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are disclosed, it is understood that the various individual and collective combinations and permutations of these compounds are specifically contemplated and described herein, even though they may not each be explicitly disclosed. For example, when a nucleic acid sequence capable of encoding an Arc protein is disclosed and described, and multiple modifications that can be made to multiple molecules containing that nucleic acid sequence are described, each and every possible combination and permutation of the nucleic acid sequence and modifications is specifically contemplated, unless specifically indicated otherwise. Thus, when classes of molecules A, B, and C are disclosed, as well as classes of molecules D, E, and F, and an example combined molecule AD, each is individually and collectively contemplated, even if each is not individually listed. Thus, in this example, each of the combinations AE, AF, BD, BE, BF, CD, CE, and CF is specifically contemplated and should be considered disclosed based on the disclosure of A, B, and C; D, E, and F; and combination AD. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the subset of AE, BF, and CE is specifically contemplated and should be considered disclosed based on the disclosure of A, B, and C; D, E, and F; and combination AD. This concept applies to all aspects of this application, including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, where there are various additional steps that may be performed, it is understood that each of these additional steps can be performed with any particular embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.

[0017] A.Definition It is understood that the disclosed methods and compositions are not limited to the particular methodology, protocols, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is limited only by the appended claims.

[0018] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include the plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "an Arc capsid" includes a plurality of such Arc capsids; a reference to "the Arc capsid" is a reference to one or more Arc capsids and equivalents thereof known to those skilled in the art; and so forth.

[0019] "Optional" or "optionally" means that the subsequently described event, circumstance, or material may occur or be present, or may not occur or be present, and the description includes instances in which the event, circumstance, or material occurs or is present as well as instances in which it does not occur or is not present.

[0020] Ranges may be expressed herein as from "about" one particular value, and / or to "about" another particular value. When such ranges are expressed, ranges from the one particular value and / or to the other particular value are also specifically contemplated and considered to be disclosed, unless the context specifically dictates otherwise. Similarly, when values ​​are expressed as approximations by use of the antecedent "about," it is understood that the particular value forms another embodiment that is specifically contemplated and should be considered disclosed, unless the context specifically dictates otherwise. Moreover, the endpoints of each range are understood to be significant both in relation to the other endpoint, and independently of the other endpoint, unless the context specifically dictates otherwise. Finally, it should be understood that all individual values ​​and subranges of values ​​falling within an explicitly disclosed range are also to be considered specifically contemplated and disclosed, unless the context specifically dictates otherwise. The foregoing applies regardless of whether some or all of these embodiments are explicitly disclosed in a particular instance.

[0021] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one skilled in the art to which the disclosed methods and compositions belong. Although any methods and materials similar or equivalent to those disclosed herein can be used in the practice or testing of the methods and compositions of this invention, particularly useful methods, devices, and materials are as described. Publications cited herein, and the materials for which they are cited, are hereby specifically incorporated by reference. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The statements about references state what their authors assert, and applicants reserve the right to challenge the accuracy and relevance of the cited documents. Although several publications are referred to herein, it is expressly understood that such reference does not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0022] Throughout the description and claims of this application, the word "comprise" and variations of that word, such as "comprising" and "comprises," mean "including but not limited to" and are not intended to exclude, for example, other additives, ingredients, integers, or steps. Specifically, in methods that are specified to include one or more steps or operations (unless that step includes a limiting term such as "consisting of"), it is specifically intended that each step includes what is recited, in the sense that each step is not intended to exclude, for example, other additives, ingredients, integers, or steps not recited in the step.

[0023] As used herein, the term "mutation" includes additions, deletions or substitutions of amino acids or nucleic acids.

[0024] B.Arc capsid Arc capsids are disclosed. The Arc capsid can be comprised of one or more Arc proteins. The one or more Arc proteins can all be from the same species or from more than one species. In some embodiments, the Arc capsid can include a recombinant Arc capsid containing Arc proteins from two or more species. The disclosed Arc capsids are recombinant in that they are not naturally occurring. The recombinant Arc capsid can include an Arc capsid containing Arc proteins from two or more species, or can include an Arc capsid carrying a nucleic acid sequence not naturally found in Arc capsids. In some embodiments, the Arc capsids disclosed herein can include a combination of naturally occurring and non-naturally occurring Arc proteins. For example, an Arc capsid can include a naturally occurring Arc protein and a non-naturally occurring recombinant Arc protein sequence. In some embodiments, an Arc capsid may comprise 1 to 50, 1 to 100, 1 to 150, 1 to 200, 1 to 250, 1 to 300, 1 to 350, 1 to 400, 1 to 450, 1 to 500, 1 to 550, 1 to 600, 1 to 650, 1 to 700, 1 to 750, 1 to 800, 1 to 850, 1 to 900, 1 to 950, or 1 to 1000 Arc proteins.

[0025] Disclosed is an Arc capsid conjugated with a labeling moiety. The labeling moiety can be, but is not limited to, a fluorescent molecule, a phosphorescent molecule, an enzyme, an antibody, a ligand, a protein, and a radioisotope. Examples of labeling moieties include, but are not limited to, GFP, myc, XFP, HALO, His, RFP, biotin, and FITC. In some embodiments, the labeling moiety can be used to detect the Arc capsid. In some embodiments, the labeling moiety can be used to purify the Arc capsid. In some embodiments, the labeling moiety can be used to target specific protein interactions.

[0026] Disclosed is an Arc capsid complexed with a targeting moiety. A targeting moiety refers to a portion of a complex that specifically binds to a selected target. The targeting moiety can be, for example, a polysaccharide, a peptide, a peptide ligand, an oligonucleotide, an aptamer, an antibody or fragment thereof, a single-chain variable fragment (scFv) of an antibody, or a Fab fragment, or a nanobody. As used herein, a "targeting moiety" can be specific for a recognition molecule on the surface of a cell or cell population, such as, for example, a B cell, a T cell, or a neuron. Thus, disclosed is an Arc capsid complexed with a targeting moiety, wherein the targeting moiety is a cell-specific targeting moiety.

[0027] Disclosed is an Arc capsid complexed with a targeting moiety, which further comprises a labeling moiety.

[0028] In some embodiments, the nucleic acid sequence carried by Arc capsid can be DNA or RNA. In some embodiments, DNA can be single-stranded or double-stranded. In some embodiments, RNA sequence can be, but is not limited to, mRNA, RNAi or microRNA.

[0029] The present invention discloses the Arc capsid that comprises heterologous nucleic acid sequence.For example, the heterologous nucleic acid sequence can be any nucleic acid sequence that is not derived from the same cell as Arc capsid.In some embodiments, the heterologous nucleic acid sequence is a non-Arc mRNA sequence.

[0030] In some embodiments, the Arc capsid can carry a nucleic acid sequence that can be transferred from the Arc capsid into a cell, hi some embodiments, the transferred mRNA sequence can be translated once within the cell.

[0031] In some embodiments, the disclosed Arc capsid can be mammalian. In some embodiments, the Arc capsid can be a Drosophila-derived Arc capsid. In some embodiments, the Arc capsid can be an Arc capsid homolog. In some embodiments, the Arc capsid homolog can be from any species.

[0032] In some embodiments, the disclosed Arc capsids can be 10-200 nm. In some embodiments, the disclosed Arc capsids can be 10-80 nm. In some embodiments, the disclosed Arc capsids can be 30-40 nm. In some embodiments, the disclosed Arc capsids can be 10-100 nm. In some embodiments, the disclosed Arc capsids can be 100-200 nm.

[0033] 1.Arc protein Arc proteins are disclosed that include the amino acid sequence of any known Arc protein. In some embodiments, the amino acid sequence can be the amino acid sequence of SEQ ID NO: 1, rat Arc protein: meldhmttgg lhaypaprgg paakpnvilq igkcraemle hvrrthrhll tevskqvere lkglhrsvgk lennldgyvp tgdsqrwkks ikaclcrcqe tianlerwvk remhvwrevf yrlerwadrl esmggkypvg separhtvsv gvggpepycq eadgydytvs pyaitpppaa gelpeqesvg aqqyqswvpg edgqpspgld tqifedpref lshleeylrq vggseeywls qiqnhmngpa kkwwefkqgs vknwvefkke flqysegtls reaiqreldl pqkqgepldq flwrkrdlyq tlyvdaeeee iiqyvvgtlq pkfkrflrhp lpktleqliq rgmevqdgle qaaepsvtpl ptedetealt paltsesvas drtqpe(SEQ ID NO:1).

[0034] In some embodiments, the amino acid sequence can be the amino acid sequence of SEQ ID NO:2, human Arc protein: meldhrtsgg lhaypgprgg qvakpnvilq igkcraemle hvrrthrhll aevskqvere lkglhrsvgk lesnldgyvp tsdsqrwkks ikaclcrcqe tianlerwvk remhvwrevf yrlerwadrl estggkypvg sesarhtvsv gvggpesych eadgydytvs pyaitpppaa gelpgqepae aqqyqpwvpg edgqpspgvd tqifedpref lshleeylrq vggseeywls qiqnhmngpa kkwwefkqgs vknwvefkke flqysegtls reaiqreldl pqkqgepldq flwrkrdlyq tlyvdadeee iiqyvvgtlq pklkrflrhp lpktleqliq rgmevqddle qaaepagphl pvedeaetlt papnsesvas drtqpe(SEQ ID NO:2).

[0035] Arc proteins are disclosed that comprise at least one mutation in the CA domain (amino acids 207-370). In some embodiments, Arc proteins are disclosed that comprise at least one mutation in the C-terminal domain (amino acids 278-370) of the CA domain. Arc proteins are disclosed that comprise at least one mutation in amino acids 278-370 of SEQ ID NO: 1 or SEQ ID NO: 2. Arc proteins are disclosed that comprise at least one mutation in amino acids corresponding to amino acids 278-370 of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, Arc proteins are disclosed herein that comprise a deletion of amino acids 278-370 of the CA domain (the CA domain comprises amino acids 207-370 of SEQ ID NO: 1 or SEQ ID NO: 2).

[0036] Disclosed are Arc proteins that comprise at least 60, 65, 70, 75, 80, 85, 90, 95, or 99.9% identity to any of the known or disclosed Arc amino acid sequences. For example, disclosed are Arc proteins that comprise at least 60, 65, 70, 75, 80, 85, 90, 95, or 99.9% identity to SEQ ID NO: 1. Also disclosed are Arc proteins that comprise at least 60, 65, 70, 75, 80, 85, 90, 95, or 99.9% identity to SEQ ID NO: 2.

[0037] 2.Arc nucleic acid Nucleic acid sequences capable of encoding any known Arc protein are disclosed. Nucleic acid sequences capable of encoding an Arc protein comprising the sequence of SEQ ID NO: 1 are disclosed. Nucleic acid sequences capable of encoding an Arc protein comprising the sequence of SEQ ID NO: 2 are disclosed. For example, a nucleic acid sequence comprising the sequence of SEQ ID NO: 3, the nucleic acid sequence of the rat Arc gene, is disclosed. agtgctctgg cgagtagtcc tccctcagcc gcagtctctg ggcctcttca gcttgagcgg cggcgagcct gccacactcg ctaagctcct ccggcaccgc gcacttgcca ctgccactgc cgcttcgcgc ccgctgcagc cgccggctct gaatccttct ggcttccgcc tcagaggagt tcttagcctg tcccgaaccg taaccccggc gagcagatgg agctggacca tatgacgacc ggcggcctcc acgcctaccc tgccccgcgg ggtgggccgg ccgccaaacc caatgtgatc ctgcagattg gtaagtgccg agctgagatg ctggagcacg tacggaggac ccaccggcat ctgttgaccg aagtgtccaa gcaggtggag cgagagctga aagggttgca caggtcggtg ggcaagctgg agaacaactt ggacggctat gtgcccacgg gcgactcaca gcgctggaag aagtccatca aggcctgtct ctgccgctgc caggagacca tcgccaacct ggagcgctgg gtcaagcgtg agatgcacgt gtggagggag gtcttctacc gtctggagag gtgggccgac cgcctggagt ccatgggcgg caagtaccca gtgggcagcg agccggcccg ccacactgtc tctgtaggtg tggggggtcc agagccctac tgccaggaag ctgatggcta cgactacact gttagcccct atgccatcac cccgccacct gccgcaggag agctgcctga gcaggagtca gttggggctc agcaatacca gtcttgggtg ccaggtgagg atgggcaacc aagcccaggt ctggataccc agatctttga ggacccacgg gagttcctga gccacctgga agagtacctg cggcaggtgggtggctctga agaatattgg ctgtcccaga tccagaacca catgaatggg ccagccaaga agtggtggga gttcaaacag ggctcggtga agaactgggt ggagttcaag aaaggtttc tgcaagtacag tgagggtacg ctctcccgc aagccattca gcgggagctg gacctgccac agaagcaggg tgagccaactt gaccagttcc tctggcgtaa gcgggacctg taccagacac tgtatgtgga cgctgaggag gaggagatca ttcagtatgt ggtgggcacc ctgcagccca agttcaagcg ctttctgcgc cacccacttc ccaagaccct ggagcagctc atccagaggg gcatggaagt tcaggacgg ctggagcagg cagctgagcc ttctgtcacc cctctgccca cagaggatga gactgaggca ctcacgcctg ctcttaccag cgagtcagta gccagtgaca ggacccagcc tgaatagagg ggccagccca gggtccccagcc cctgcctgcc acacccagtc tgtggcttt gtcaactagg acttgattga gctggggctg acacccaagg ggatgccctg tccagccaga caccttctca cccactggcc tgactcacaa ctgccacaca accatgattc atggacatca agaagcccct ctcccatagg gctcccacct gccacctacc cctcacctgt ctgccctagt cctggccctg tctccagtgg cctcaccctc tacactctca gaccatcaca gaacaccttt ggcttcctca ttctgcatca gtgtccaggg ccctttgggt agtcaagaaa tcaagtgtct gaaaggcaat gaaaagtagg caccaaaccc aaggggcatc ccagggcaga tgctaaagca gaatcagaga tggccgaagg aacctctact tccggggatg cagcccgctcctacagacac agcagatcca gctggtgccc tacctgcctc ccagagcaac tggccagtct tgggcagcat agctcccctc tcagggtgag ctgaagcagc agacctgacg cgctggcgcc tcctggcccc cagcagtgat tcataccagt gaaaaaagc agacttcgg tccatgact agccatgcca ggcggagggt cccagagggg ctgagtcctc agccccagct gaggcagcag ctggagtctt cagagccagg tgaatgacac caggtctcaa gctgctgaga agtctttccg gccatgtctg gaaggggtac caccccagca ccagcaccgt cccctcctct cttgaagctg cctgcacaga ggttccaaga cactttcaag gcagagaaaa taggattaca aagaggaggt gccttggcag aggggcagcac ccagctcagc ctcagagctg aaggtgaaga caagccagc tgaaaccccg ggtctgccac gaatgcccgc tccgctggcc actcaccagc tgcctgccac aagccactgc agcttgagca gggtctgtgc cctctcagca cagagcccag ttcgctgcgt ggcctttggc ccccgccaga accttgcagg agccttaagg ttcgggccct agcccagcct gaccttacct gctgtgccct gcctgctggt caattccagt cccaggagac cccatgcctt ggctcctagg ctgttccagg cacttccctg acctgccggg tgattgccca gctggaacct catccacacc ccagcaccaa ccacctcgtg ttggtaactg ctcgtgtctg tagtctgagt aggccatgtt gaggttcctc catctgcctg gtccattggt gttctgagac cagttccact gctgttctgacagatccccc accctgtgcc cctgccagcc cccacaggtt tatttttgca cataaaccat gacccatact aatttggcta gctctgggga ctagggagac cctggagatc tcaagagtgt ggctatcccc tattttcacc aagccttcaa tatccagcca ggccatctgg cccacaccat cttacctcaa agacagacat atatatatat atacatatat atgattttgt taataaaact atgaaattta aa (SEQ ID NO: 3)

[0038] Also disclosed is a nucleic acid sequence comprising the sequence of SEQ ID NO: 4, the nucleic acid sequence of the human Arc gene. cgcgtgggcc gcagcagccg agccggacct gcctccccgg gcgtgctccg cggccccgc cgccggcccg cagcgacaga caggcgctcc ccgcagctcc gcacgggacc caggccgccg tgcgcacaga tggagctgga ccaccggacc agcggcgggc tccacgccta ccccgggccg cggggcgggc aggtggccaa gcccaacgtg atcctgcaga tcgggaagtg ccgggccgag atgctggagc acgtgcggcg gacgcaccgg caccctgcgcgc gagcgcgagc tgaaggggcg gtcgggaagc tggagagcaa cctggacggc tacgtgccca cgagcgactc gcagcgctgg aagaagtcca tcaaggcctg cctgtgccgc tgccaggaga ccatcgccaa cctgggcgc tgggcgcgcgcgcgc gaggtgttct accgcctgga gcgctgggcc gaccgcctgg agtccacggg cggcaagtac ccggtgggca gcgagtcagc ccgccacacc gtttccgtgg gcgtgggggg tcccgagagc tactgccacg aggcagatgg ctacgactac acctcagc ccagccgctg gcgagctgcc cgggcaggag cccgccgagg cccagcagta ccagccgtgg gtccccggcg aggacgggca gcccagcccc ggcgtggaca cgcagatctt cgaggaccct cgagagttcc tgagccacct agaggagtc ttgcggcagg tgggcggc tggggcagatccagaa tcacatgaac gggccggcca agaagtggtg ggagttcaag cagggctccg tgaagaactg ggtggagttc aagaaggagt tcctgcagta cagcgagggc acgctgtccc gagaggccat ccagcgcgag ctggacctgc cgcagaagca gggcgagccg ctggaccagt tcctgtggcg caagcgggac ctgtaccaga cgctctacgt ggacgcggac gaggaggaga tcatccagta cgtggtgggc accctgcagc ccaagctcaa gcgtttcctg cgccaccccc tgcccaagac cctggagcag ctcatccaga ggggcatgga ggtgcaggat gacctggagc aggcggccga gccggccggc ccccacctcc cggtggagga tgaggcggag accctcacgc ccgcccccaa cagcgagtcc gtggccagtg accggaccca gcccgagtag agggcatccc ggagccccca gcctgcccac tacatccagc ctgtggcttt gcccaccagg acttttgagc tggggctgac tcctgcaggg gaagccctgg tccagctggg tgccccctcg agctccgggc ggactcgcac acactcgtgt catccagatg tgagcaccgc acccagcggc aaagagccct cccccctgca gggctccacc catcaccctc cctccgtctg tctttccggc ctggacccca ccctccacac tctcaggcca tcacagaaca ccccagcttc ctcattctgc tacaacaccc aggccctctg gacatccaga aaaccaagtg tccggatggc aggggccagc ggccaccaag ctcatgggac acccagagca gaagctaggg cagagccaat gctgagggag cctcgacttc cggcgccgccgccctctccc ggcatccgca gagccagctg acgccctccc tgcctcccag ggcagctggc cagcctcggg cagcgcggcc ccctcctccc aggggagagt agaagtcgca cacgcagcag agcagacctg atgtcccggt gcttcctggc ccctcagctc cagtgattca cgcccgcctg gagaagaatc agagctcagc tcatgactca cccatggcag gcggagggtc ccagaggggc tgagtcctca aatccggctg aggcagcagc tggcaccatc agagccagga gagtgacaac aggtctcaag gttcccacaa agtctttgct gctgtgctgg gcaccaccca cccctcacct tgcaggctgc ctgcgtggga ggcgaagtcc caggacagcc cagagggggg ctacagagag gagtcggctg cagcagaggg caggagcccc agcttagccc tgagcgccag cgcgaggacc agggcctgcc actaagcccg ccccgctggc cgccagctgc ccgtccccag agccactgca gcaggagtcg ggccctgcct ccctcccagc agggaaaccc cgcccgctgc caggccatcc tctctgccag aggctttcat gagccccaag gctggggcca cagctcctac ccctgcccag cagccctgag ctcagctgca ggaaggacat cccagaagcc atggctcctg gggcgcttcc aggcattctg ccctgccccg acaccagaac cctggtgctg gtgggccact agcgtctgca gcctaagcag gtgctggctc agggttcatc attctgcctt gtccactggg ggaccagccc tgcagaccac tctgacaagt cttcagccca caccttgcca gccccacaga ttttattttt gcacataagccataaccaat cctcaaggct ggcacaggct ttggggaagc cctggagcct gtgaagaccc tggaaacctc atgaggctgt ggccaacccc tgccccttgc cccacacaga ccaggcctta aatgtcggtc caggccctgt gcaccttacc ccagagacag actctttttg taagattttg ttaataaaac actgaaactt c (SEQ ID NO: 4)

[0039] Disclosed are nucleic acid sequences that comprise at least 60, 65, 70, 75, 80, 85, 90, 95 or 99.9% sequence identity to SEQ ID NO: 3. Disclosed are nucleic acid sequences that comprise at least 60, 65, 70, 75, 80, 85, 90, 95 or 99.9% sequence identity to SEQ ID NO: 4.

[0040] Disclosed are nucleic acid sequences containing at least one mutation in a sequence capable of encoding amino acids 278-370 of SEQ ID NO: 1 or SEQ ID NO: 2. In other words, disclosed are nucleic acid sequences containing at least one mutation in nucleic acids 832-1110 of SEQ ID NO: 3 or SEQ ID NO: 4. Also disclosed are nucleic acid sequences containing at least one mutation in a sequence capable of encoding amino acids 207-370 of SEQ ID NO: 1 or SEQ ID NO: 2. In other words, disclosed are nucleic acid sequences containing at least one mutation in nucleic acids 619-1110 of SEQ ID NO: 3 or SEQ ID NO: 4.

[0041] Also disclosed are nucleic acid sequences capable of encoding proteins that share secondary or tertiary structure with the Arc proteins described herein.

[0042] C. Vector Disclosed are vectors comprising a nucleic acid sequence capable of encoding an Arc protein. In some embodiments, the Arc protein can be any of the Arc proteins disclosed herein.

[0043] Disclosed are vectors containing nucleic acid sequences capable of encoding proteins that share a secondary or tertiary structure with the Arc proteins described herein.

[0044] In some embodiments, the disclosed vectors may further comprise a nucleic acid sequence capable of encoding a labeling moiety. In some embodiments, the labeling moiety may be any peptide or protein encoded by a nucleic acid. For example, the labeling moiety may be, but is not limited to, GST, myc, His, or GFP.

[0045] In some embodiments, the labeling moiety can be operably linked to a nucleic acid sequence capable of encoding an Arc protein, such that the labeling moiety and the Arc protein can be transcribed together.

[0046] In some embodiments, the disclosed vectors can further comprise a nucleic acid sequence capable of encoding a targeting moiety. In some embodiments, the targeting moiety can be operably linked to a nucleic acid sequence capable of encoding an Arc protein. Thus, the targeting moiety and the Arc protein can be transcribed together. In some embodiments, the targeting moiety can be, but is not limited to, a polysaccharide, a peptide, a peptide ligand, an oligonucleotide, an aptamer, an antibody or fragment thereof, a single-chain variable fragment (scFv) of an antibody, or a Fab fragment, or a nanobody.

[0047] In addition to a nucleic acid sequence capable of encoding an Arc protein, the disclosed vectors can carry regulatory sequences that control expression of the Arc protein in a host cell. Those skilled in the art will recognize that vector design, including the selection of regulatory sequences, can depend on factors such as the choice of host cell to be transformed and the desired protein expression level. Preferred regulatory sequences for mammalian host cell expression include viral elements that promote high-level protein expression in mammalian cells, such as retroviral long terminal repeats (LTRs), cytomegalovirus (CMV) (e.g., the CMV promoter / enhancer), simian virus 40 (SV40) (e.g., the SV40 promoter / enhancer), adenovirus (e.g., the adenovirus major late promoter (AdMLP)), polyoma-derived promoters and / or enhancers, as well as strong mammalian promoters such as naive immunoglobulin and actin promoters. For further description of viral regulatory elements and sequences thereof, see, e.g., U.S. Patent Nos. 5,168,062, 4,510,245, and 4,968,615. Methods for expressing polypeptides in bacterial or fungal cells, such as yeast cells, are also well known in the art.

[0048] In some embodiments, the disclosed vectors further comprise a promoter operably linked to the nucleic acid sequence capable of encoding an Arc protein. In some embodiments, the promoter can be an inducible promoter. In some embodiments, the promoter can be a cell-specific promoter. The nucleic acid sequence capable of encoding an Arc protein can be operably linked to the promoter. "Operably linked" means that the promoter is capable of promoting expression of the nucleic acid sequence, and thus has the appropriate orientation of the promoter relative to the nucleic acid sequence.

[0049] D. Cell Disclosed are cells comprising any of the disclosed vectors.Disclosed are cells comprising any of the disclosed Arc proteins.Disclosed are cells comprising any of the disclosed Arc capsids.

[0050] In some aspects, the disclosed cells can be mammalian cells.

[0051] In some cases, cells can be cultured using culture techniques well known in the art. Any known cell line can be used. In some cases, cells can be derived from any host. For example, cells can be derived from, but are not limited to, human, rat, mouse, dog, cat, horse, bacterial, or fungal hosts.

[0052] E. Pharmaceutical Compositions Disclosed is a composition comprising an Arc capsid and a pharmaceutically acceptable carrier. The Arc capsid can be any of the disclosed Arc capsids.

[0053] In some embodiments, the disclosed Arc capsids can be formulated and / or administered in or with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions immediately prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (e.g., olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. It may be desirable to include isotonic agents, such as sugars or sodium chloride. Prolonged absorption of injectable pharmaceutical dosage forms can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin. Injectable depot dosage forms are made by forming microencapsule matrices of drugs in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). The rate of drug release can be controlled depending on the drug-to-polymer ratio and the nature of the particular polymer employed. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium immediately before use. Suitable inert carriers can include sugars such as lactose.Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.

[0054] Thus, the compositions disclosed herein can include lipids, such as liposomes, for example, cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can optionally further include proteins that facilitate targeting to specific cells. Compositions comprising peptides and cationic liposomes can be administered to the blood, to a target organ, or by inhalation into the respiratory tract to target respiratory cells. For example, a composition comprising a peptide or nucleic acid sequence described herein and cationic liposomes can be administered to lung cells of a subject. For more information on liposomes, see, for example, Brigham et al., Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Felgner et al., Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); and U.S. Patent No. 4,897,355. Additionally, the compound can be administered as a component of a microcapsule that can be directed to a specific cell type, such as a macrophage, or to a location where diffusion of the compound or delivery of the compound from the microcapsule is intended for a specific rate or dosage.

[0055] In one embodiment, disclosed is a pharmaceutical composition comprising any of the Arc capsid or protein disclosed herein or its pharmaceutically acceptable salt or solvate and pharmaceutically acceptable carrier, buffer or diluent.In various embodiments, the Arc capsid or protein of the pharmaceutical composition is encapsulated in a delivery vehicle.In further embodiments, the delivery vehicle is a liposome, a microcapsule or a nanoparticle.In yet another embodiment, the delivery vehicle is PEGylated.

[0056] In the methods described herein, delivery of the composition to a cell can be via various mechanisms. As defined above, compositions comprising any one or more of the Arc capsids or proteins described herein are disclosed herein, which can further comprise a carrier, e.g., a pharmaceutically acceptable carrier. For example, pharmaceutical compositions comprising the Arc capsids and proteins disclosed herein and a pharmaceutically acceptable carrier are disclosed. In one aspect, pharmaceutical compositions comprising the disclosed Arc capsids and proteins are disclosed. That is, the pharmaceutical composition can be provided comprising a therapeutically effective amount of at least one disclosed Arc capsid or at least one product of the disclosed methods and a pharmaceutically acceptable carrier.

[0057] In certain embodiments, the disclosed pharmaceutical compositions comprise the disclosed Arc capsid or protein (including pharmaceutically acceptable salt(s) thereof) as an active ingredient, a pharmaceutically acceptable carrier, and optionally other therapeutic ingredients or adjuvants. Present compositions include those suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host and the nature and severity of the condition for which the active ingredient is being administered. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.

[0058] In practice, the Arc capsids and proteins of the present invention, or pharmaceutically acceptable salts thereof, described herein, can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier can take a wide variety of forms depending on the form of preparation desired, e.g., for oral or parenteral (including intravenous) administration. Thus, pharmaceutical compositions of the present invention can be provided as discrete units suitable for oral administration, such as capsules, cachets, or tablets, each containing a predetermined amount of the active ingredient. Furthermore, compositions can be provided as a powder, granules, solution, suspension in an aqueous liquid, non-aqueous liquid, oil-in-water emulsion, or water-in-oil liquid emulsion. In addition to the common dosage forms listed above, the compounds of the present invention and / or pharmaceutically acceptable salt(s) thereof can also be administered by controlled release means and / or delivery devices. The compositions can be prepared by any of the methods of pharmacy. Such methods often include the step of bringing into association the active ingredient with the carrier, which constitutes one or more necessary ingredients. The compositions are usually prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, after which the product can be conveniently shaped into the desired presentation.

[0059] As would be well known to one of ordinary skill in the art, "pharmaceutically acceptable" means a material or carrier that would be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject. The Arc capsid or protein described herein, or a pharmaceutically acceptable salt thereof, can also be included in a pharmaceutical composition in combination with one or more other therapeutically active compounds.

[0060] The pharmaceutical carrier employed can be, for example, solid, liquid, or gas. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, gum arabic, magnesium stearate, and stearic acid. Examples of liquid carriers include sugar syrup, peanut oil, olive oil, and water. Examples of gaseous carriers include carbon dioxide and nitrogen. Other examples of carriers include dimyristoyl phosphatidylcholine (DMPC), phosphate-buffered saline, or multivesicular liposomes. For example, PG:PC:cholesterol:peptide or PC:peptide can be used as a carrier in the present invention. Other suitable pharmaceutically acceptable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically acceptable salt is used in the formulation to make the formulation isotonic. Other examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution. The pH of the solution can be about 5 to about 8, or about 7 to about 7.5. Additional carriers include sustained-release preparations, such as semipermeable matrices of solid hydrophobic polymers containing the composition, which matrices are in the form of shaped articles, e.g., films, stents (implanted in blood vessels during angioplasty), liposomes, or microparticles. It will be apparent to those skilled in the art that certain carriers may be more preferable depending, for example, on the route of administration and concentration of the composition being administered. These will most typically be standard carriers for drug administration to humans, including water, saline, and buffered solutions at physiological pH.

[0061] To enhance the solubility and / or stability of the disclosed Arc capsid or protein in pharmaceutical compositions, it may be beneficial to employ α-, β-, or γ-cyclodextrin or derivatives thereof, particularly hydroxyalkyl-substituted cyclodextrins, such as 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-β-cyclodextrin. Cosolvents, such as alcohols, may also enhance the solubility and / or stability of the compounds of the present invention in pharmaceutical compositions.

[0062] Pharmaceutical compositions can also contain carriers, thickeners, diluents, buffers, preservatives, and the like, so long as the intended activity of the polypeptides, peptides, nucleic acids, and vectors of the invention is not impaired. Pharmaceutical compositions may also contain one or more active ingredients (in addition to the compositions of the invention), such as antibacterial agents, anti-inflammatory agents, anesthetics, and the like. Pharmaceutical compositions may be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated.

[0063] Due to the ease of administration, oral administration can be used, and tablets and capsules represent the most advantageous oral dosage unit forms, which naturally employ solid pharmaceutical carriers. When preparing compositions for oral dosage forms, any convenient pharmaceutical medium can be used. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, etc. can be used to form oral liquid preparations, such as suspensions, elixirs, and solutions, while carriers such as starch, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrants, etc. can be used to form oral solid preparations, such as powders, capsules, and tablets. Due to the ease of administration, tablets and capsules are preferred oral dosage units that employ solid pharmaceutical carriers. Optionally, tablets can be coated by standard aqueous or non-aqueous techniques.

[0064] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids, or binders may be desirable. Some compositions may be administered as pharmaceutically acceptable acid or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl, and arylamines and substituted ethanolamines.

[0065] The tablet containing the composition of the present invention can be prepared by compression or molding, optionally with one or more auxiliary ingredients or adjuvants.Compressed tablets can be prepared by using a suitable machine to compress the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surfactant or dispersant.Molded tablets can be made by using a suitable machine to mold a mixture of powdered compounds moistened with an inert diluent.

[0066] Pharmaceutical compositions of the present invention comprise a protein, e.g., Arc protein or capsid (or a pharmaceutically acceptable salt thereof), as an active ingredient, a pharmaceutically acceptable carrier, and, optionally, one or more additional therapeutic ingredients or adjuvants. Present compositions include those suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host and the nature and severity of the condition for which the active ingredient is being administered. Pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.

[0067] The pharmaceutical composition of the present invention suitable for parenteral administration can be prepared as an aqueous solution or suspension of the active compound.A suitable surfactant, such as hydroxypropyl cellulose, can be included.Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof in oil.In addition, preservatives can be included to prevent the growth of harmful microorganisms.

[0068] Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions may be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. Typically, the final injectable form must be sterile and have effective fluidity to facilitate syringability. Pharmaceutical compositions must be stable under the conditions of manufacture and storage, and thus preferably must be protected against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof.

[0069] Injectable solutions, for example, can be prepared wherein the carrier comprises saline solution, glucose solution, or a mixture of saline and glucose solution. Injectable suspensions can also be prepared, in which case appropriate liquid carriers, suspending agents and the like can be employed. Also included are solid form preparations which are intended to be converted shortly before use into liquid form preparations.

[0070] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., those based on Ringer's dextrose), and the like. Preservatives and other additives may be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases and the like.

[0071] The pharmaceutical compositions of the present invention can be in a form suitable for topical use, such as an aerosol, cream, ointment, lotion, dusting powder, mouthwash, gargle, etc. Furthermore, the compositions can be in a form suitable for use in transdermal devices. These formulations can be prepared by conventional processing methods using the compounds of the present invention or pharmaceutically acceptable salts thereof. For example, a cream or ointment can be prepared by mixing a hydrophilic material and water together with about 5 wt% to about 10 wt% of the compound to produce a cream or ointment having the desired consistency.

[0072] In compositions suitable for transdermal administration, the carrier may contain a penetration enhancer and / or a suitable wetting agent, optionally in combination with a small amount of any suitable additive of any nature, which additive does not cause significant adverse effects on the skin.These additives may facilitate application to the skin and / or may be useful in preparing the desired composition.These compositions may be administered in various ways, for example, as a transdermal patch, as a spot-on, or as an ointment.

[0073] The pharmaceutical composition of the present invention can be in a form suitable for rectal administration, with the carrier being solid.Preferably, the mixture forms a single-dose suppository.Suitable carriers include cocoa butter and other materials commonly used in the art.Suppositories can be conveniently formed by first mixing the composition with softened or melted carrier(s), followed by cooling and shaping in molds.

[0074] Formulations for optimal administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be desirable.

[0075] In addition to the carrier components described above, the pharmaceutical formulations may optionally contain one or more additional carrier components, such as diluents, buffers, flavoring agents, binders, surfactants, thickeners, lubricants, preservatives (including antioxidants), etc. Additionally, other adjuvants may be included to render the formulation isotonic with the blood of the intended recipient. Compositions containing the disclosed peptides and / or pharmaceutically acceptable salts thereof may also be prepared in powder or liquid concentrate form.

[0076] The exact dosage and frequency of administration, as is well known to those skilled in the art, will depend on the particular disclosed Arc capsid or protein, product of the disclosed production method, its pharmaceutically acceptable salt, solvate or polymorph, hydrate, solvate, polymorph, or stereochemically isomeric form; the particular condition being treated and the severity of the condition being treated; various factors specific to the medical history of the subject to be administered, such as age; the weight, sex, extent of disability and general health of the particular subject, and other medications the individual may be taking. Furthermore, it will be apparent that the effective daily amount may be increased or decreased depending on the response in the treated subject and / or depending on the evaluation of the physician prescribing the composition.

[0077] Depending on the mode of administration, the pharmaceutical composition will contain 0.05 to 99% by weight, preferably 0.1 to 70% by weight, more preferably 0.1 to 50% by weight of the active ingredient, and 1 to 99.95% by weight, preferably 30 to 99.9% by weight, more preferably 50 to 99.9% by weight of the pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition.

[0078] F. Methods for delivering mRNA A method for delivering mRNA to a cell is disclosed, comprising administering an Arc capsid to the cell, wherein the Arc capsid comprises an mRNA of interest. The term "mRNA sequence of interest" or "mRNA of interest" can refer to an mRNA nucleic acid sequence (e.g., a therapeutic gene) that is partially or entirely heterologous or foreign to the cell into which it is introduced. The term "mRNA sequence of interest" or "mRNA of interest" can also refer to an mRNA nucleic acid sequence that is partially or entirely homologous to an endogenous gene of the cell into which it is introduced but that is designed to be introduced into the cell. The term "mRNA sequence of interest" or "mRNA of interest" can also refer to an mRNA nucleic acid sequence that is partially or entirely complementary to an endogenous gene of the cell into which it is introduced. For example, the mRNA sequence of interest can be a microRNA, shRNA, or siRNA. The "mRNA sequence of interest" or "mRNA of interest" can also include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be required for optimal expression of the selected nucleic acid.

[0079] Any of the disclosed Arc capsids can be used in the methods described herein.

[0080] In some embodiments, the Arc capsid can be heterologous to the cell. In some embodiments, an Arc capsid that is heterologous to the cell is any Arc capsid that does not originate from the cell to which it is delivered.

[0081] Disclosed are methods for delivering mRNA to a cell, comprising administering to the cell any one or more of the disclosed vectors and administering to the cell an mRNA of interest, wherein the nucleic acid sequence in the vector encodes an Arc protein, which is subsequently translated within the cell to form an Arc capsid, and the Arc capsid encapsulates the mRNA of interest therein.

[0082] In some embodiments of the disclosed delivery method, the cell can be a neuron. In some embodiments, the cell can be a mammalian cell, for example, but not limited to, a human cell. In some embodiments, the cell can be, but not limited to, a nerve cell, a muscle cell, a bone cell, a glandular cell, a blood cell, or a germ cell. For example, the cell can be a T cell, a B cell, a macrophage, an epithelial cell, a chondrocyte, or a stem cell.

[0083] In some embodiments, the mRNA of interest is a therapeutic agent. For example, the therapeutic agent can be, but is not limited to, an immunomodulator such as a cytokine encoded by mRNA, siRNA, or an inhibitor encoded by mRNA. Thus, in some embodiments, Arc capsid is used to deliver a therapeutic agent to cells, and the therapeutic agent can treat any symptom of the cell. For example, the symptom of the cell can be any caused by a disease or disorder diagnosed in a subject, and the cell is from the subject. In some embodiments, the mRNA of interest is not Arc mRNA.

[0084] In some embodiments, the vector comprises the mRNA of interest.For example, in some embodiments, the vector that comprises the nucleic acid sequence that can encode Arc protein can further comprise the mRNA of interest.In some embodiments, the mRNA of interest can be administered in a second vector that is separate from the vector that comprises the nucleic acid sequence that can encode Arc protein.

[0085] Disclosed is a method for delivering mRNA to a subject, comprising administering one or more of any one of the disclosed cells to a subject in need thereof. In some embodiments, the cells can be xenogeneic. In some embodiments, the cells can be autologous.

[0086] The present disclosure provides a method for delivering mRNA of interest to a subject, comprising: exposing cells obtained from a subject to any one of the disclosed Arc capsids comprising mRNA sequence of interest; wherein the cells exposed to Arc capsid incorporate Arc capsid to form cells comprising Arc capsids comprising mRNA of interest; and further comprising administering the cells comprising Arc capsids comprising mRNA of interest to the subject from whom the cells were obtained. In some embodiments, the Arc capsid comprises a heterologous mRNA sequence. The heterologous mRNA sequence can be any mRNA sequence that is not derived from the same cell as Arc capsid. In some embodiments, the heterologous mRNA sequence is a non-Arc mRNA sequence.

[0087] Disclosed herein is a method for delivering an mRNA of interest to a subject, comprising exposing cells obtained from the subject to any one of the disclosed Arc capsids comprising an mRNA sequence of interest, wherein the cells exposed to the Arc capsid take up the Arc capsid to form cells comprising Arc capsids comprising the mRNA of interest; and further comprising administering the cells comprising Arc capsids comprising the mRNA of interest to a subject different from the subject from which the cells were obtained.

[0088] How G.Arc capsids are formed Disclosed is a method for forming Arc capsids, comprising administering any of the disclosed vectors to a solution containing cells, wherein the nucleic acid sequence encodes the Arc protein within the cells and Arc capsids are formed.

[0089] Disclosed is a method for forming Arc capsids, comprising administering any of the disclosed vectors to a solution containing cells, wherein the nucleic acid sequence encodes an Arc protein within the cells, and Arc capsids are formed, and further comprising administering an mRNA of interest, wherein the mRNA is packaged within the Arc capsid during Arc formation.

[0090] In some embodiments, the disclosed methods of forming Arc capsids further include increasing the salt concentration of the solution to a range of 100-300 mM. In some embodiments, the salt can be, but is not limited to, NaCl or NaPO.

[0091] In some embodiments, the formed Arc capsid is released from the cell by an extracellular vesicle. In some embodiments, the cell is a recombinant cell that contains a cell membrane involved in the formation of the extracellular vesicle, and the extracellular vesicle provides cell specificity for targeting the Arc capsid. In some embodiments, the Arc capsid can be formed in the presence of an exogenous nucleic acid that can control Arc capsid assembly.

[0092] In some embodiments, Arc capsids can be produced or delivered by exosomes or extracellular vesicles produced within cells, e.g., exosomes or extracellular vesicles can be used as potential vectors for the production and spread of Arc capsids.

[0093] H. How to prevent Arc coupling A method for inhibiting Arc capsid binding to lipids, comprising administering a blocking agent, wherein the blocking agent prevents Arc capsid from binding to lipids. In some embodiments, the blocking agent can be any molecule that binds to Arc capsid and blocks the lipid-binding site, or binds to lipid and blocks the Arc capsid-binding site. In some embodiments, the blocking agent can be Arc protein or a fragment thereof.

[0094] I. Kit These and other materials can be packaged together in any suitable combination as a kit useful for practicing or aiding in the practice of the disclosed methods. A given kit is useful if the kit components are designed and adapted for use in conjunction with the disclosed methods. For example, disclosed are kits for producing Arc capsids, including any of the disclosed Arc proteins, Arc nucleic acids, vectors, or cells. [Example]

[0095] The brain has evolved to process and store information from the external world through synaptic connections between interconnected neuronal networks. Despite the fundamental importance of information storage in the brain, a detailed molecular and cellular understanding of the processes involved and its evolutionary origins remains lacking. Research over the past several decades has demonstrated that eukaryotic genomes are interspersed with DNA of viral or transposon origin, comprising approximately half of most mammalian genomes (Smit, 1999). It is increasingly recognized that sequences encoded by these elements can provide the raw material for the development of novel functional and regulatory elements (Chuong et al., 2017; Levin and Moran, 2011). In vertebrates, these include numerous protein-coding genes derived from sequences previously encoded by transposons (Feschotte and Pritham, 2007; Naville et al., 2016) or retroviruses (Kaneko-Ishino and Ishino, 2012). Interestingly, many of these transposon-derived genes are expressed in the brain, but their molecular functions remain unknown.

[0096] The neuronal gene Arc contains structural elements found in the virus group-specific antigen (Gag) polyprotein, which may have originated from the Ty3 / gypsy retrotransposon family (Campillos et al., 2006; Day and Shepherd, 2015; Zhang et al., 2015). However, the role of these Gag elements in Arc function has not been explored. Arc is a master regulator of mammalian synaptic plasticity and is required for protein synthesis-dependent forms of long-term potentiation (LTP) and long-term depression (LTD) (Bramham et al., 2010; Shepherd and Bear, 2011). Arc can regulate synaptic plasticity by trafficking AMPA-type glutamate receptors (AMPARs) via endocytic mechanisms (Chowdhury et al., 2006). This endocytic pathway maintains surface AMPAR levels in response to long-term changes due to synaptic scaling of neuronal activity, thus contributing to the homeostasis of neuronal strength (Shepherd et al., 2006). Arc expression in the brain is highly dynamic, and its transcription is closely linked to the encoding of information in neuronal circuits in vivo (Guzowski et al., 1999). Arc mRNA is transported to dendrites, enriched at sites of local synaptic activity, and translated into protein there (Steward et al., 1998; Waung et al., 2008). Interestingly, the mode of Arc mRNA regulation resembles that of some viral RNAs, as Arc contains an internal ribosomal entry site (IRES) that allows cap-independent translation (Balvay et al., 2007; Pinkstaff et al., 2001). In vivo, Arc is required for the translation of experience into long-lasting changes in visual cortical plasticity ( McCurry et al., 2010 ) and for long-term memory ( Guzowski et al., 2000 ; Plath et al., 2006 ).Additionally, Arc has been implicated in various neurological disorders, including Alzheimer's disease (Wu et al., 2011), monogenic forms of intellectual disability such as Angelman syndrome (Greer et al., 2010; Pastuzyn and Shepherd, 2017) and fragile X syndrome (Park et al., 2008), and schizophrenia (Fromer et al., 2014; Manago et al., 2016; Purcell et al., 2014). Thus, precise regulation of Arc expression and activity in the nervous system appears essential for normal cognition.

[0097] Despite its importance, little is known about the biochemistry and molecular function of Arc proteins. One role of Arc is to mediate intercellular communication via extracellular vesicles (EVs). Synaptic transmission is complemented or regulated by many other pathways, including glial-neuronal interactions, and emerging evidence suggests that EVs mediate intercellular signaling in the nervous system (Budnik et al., 2016; Zappulli et al., 2016). EVs can be broadly divided into two groups: microvesicles and exosomes, both of which are defined by their size and intracellular origin. Microvesicles are constricted directly from the plasma membrane and typically range from 100 to 300 nm in diameter, whereas exosomes are derived from intraluminal vesicles arising from multivesicular bodies (MVBs) and typically have a diameter of less than 100 nm. EVs can transport cargo that does not readily cross the plasma membrane, such as membrane proteins and various forms of RNA. The observation that EVs can function in the intercellular transport of these molecules within the nervous system opens up entirely new perspectives on intercellular communication in the brain.

[0098] Arc proteins self-assemble into oligomers similar to viral capsids and exhibit several other biochemical properties seen in retroviral Gag proteins, such as lipid and RNA binding. Furthermore, Arc can be released from neurons within EVs and transfer its own mRNA into neurons. The Drosophila Arc homolog dArc1, despite originating from a distinct retrotransposon lineage, also forms capsids and mediates the intercellular transfer of its own mRNA at the fly neuromuscular junction. These data suggest that the co-optation of retrovirus-like Gag elements may have provided an evolutionary pathway for novel mechanisms mediating intercellular signaling and may have been intricately involved in the evolution of synaptic plasticity and animal cognition.

[0099] 1.Results i. Fly and tetrapod Arc genes arose independently from distinct lineages of Ty3 / gypsy retrotransposons Phylogenetic analyses were performed to address the evolutionary origin of Arc (Figures 1A and 8A). Highly conserved and unique orthologs of the mouse Arc gene were identified throughout tetrapods (mammals, birds, reptiles, and amphibians), but were conspicuously absent from the fish lineage. Other deuterostomes were examined (94 species). The closest relatives of Arc in the genomes of coelacanth, zebrafish, and carp are encoded by the prototypic Ty3 / gypsy retrotransposon, suggesting recent transposition activity. Similarly, orthologs and paralogs of Drosophila Arc (darc1, darc2) were identified in all anthocephalic (euploid) flies represented in the database, but were not detected in any other dipterans (e.g., mosquitoes) or protostomes (286 species, Figure 8B). The closest retrotransposon relatives of the fly Arc gene were found in the genomes of the silkworm and the Argentine ant. Interestingly, although Arc appears to be a single-copy gene in all tetrapods examined, the gene has undergone multiple duplications during dipteran evolution (Figure 8B). Phylogenetically, tetrapod Arc genes cluster with Ty3 / gypsy retrotransposons from fish, whereas fly Arc homologs cluster with a lineage of Ty3 / gypsy retrotransposons distinct from insects (Figure 1A). These results suggest that, as previously speculated (Abrusan et al., 2013), the tetrapod and fly Arc genes originated independently from distinct lineages of Ty3 / gypsy retrotransposons, yet share considerable homology in the retroviral Gag domain.

[0100] ii. Arc protein self-assembles into virus-like capsids Ty3 retrotransposons can form oligomeric particles similar to retroviral capsids (Hansen et al., 1992), and Arc also possesses oligomerization properties (Myrum et al., 2005). Retroviral encapsidation is essential for infectivity and is primarily mediated by the Gag polyprotein, which in HIV contains four major functional domains: matrix / MA, capsid / CA, nucleocapsid / NC, and p6 (Freed, 2015). Arc shares primary sequence similarity (Campillos et al., 2006) as well as structural similarity (Taylor et al., 2017; Zhang et al., 2015) with the HIV CA and foamy virus Gag polyproteins, suggesting that Arc may share functional similarity with the Gag protein. To evaluate the biochemical properties of the Arc protein, rat Arc was expressed in bacteria as a glutathione S-transferase (GST) fusion protein. The expressed protein was purified by affinity and size-exclusion chromatography, and the GST tag was removed by proteolysis (Figure 9A and B). A purified preparation of rat Arc (prArc) was analyzed using negative-stain electron microscopy (EM) and cryo-EM. These experiments revealed that prArc spontaneously forms oligomeric structures resembling virus-like capsids (Figure 1B). prArc capsids exhibit a double-shell structure with an average diameter of 32 ± 0.2 nm. Similarly, the bacterially expressed and purified Drosophila Arc homolog, dArc1 (Figure 9C), also self-assembles into capsid-like structures (Figure 1C). Purified Arc protein expressed in an insect cell expression system also assembled into similar virus-like capsids (data not shown), indicating that oligomerization is not an artifact of bacterial expression. The immature retroviral capsid is formed by the uncleaved Gag polyprotein, and the major stabilizing interaction is made by the C-terminal domain (CTD) of the CA region ( Mattei et al., 2016 ).To test whether the putative Arc CA CTD is also required for self-assembly, we expressed and purified a rat Arc mutant protein lacking this domain (prArc-ΔCTD, lacking amino acids [aa] 277–374; Figure 1C, Figure 9A and B) (Zhang et al., 2015). EM analysis revealed that prArc-ΔCTD was unable to form double-shelled capsids, although irregular intermediate structures were occasionally observed (Figure 1C).

[0101] To test whether the Arc CA domain is sufficient for capsid assembly, we generated a mutant Arc protein containing aa 195–364 (CA-prArc; Figures 1C and 9A). CA-prArc was not sufficient to form capsid-like structures. Arc capsids exhibit other properties similar to HIV capsids, such as sensitivity to salt and phosphate levels (Purdy et al., 2008); increasing the NaCl concentration from 0 to 300 mM resulted in stable prArc capsids, and high NaPO4 further stabilized capsid formation (Figure 1D). To test whether Arc forms oligomers intracellularly, we expressed Arc in HEK293 cells lacking endogenous Arc and performed chemical cross-linking to test for the presence of oligomeric species. Arc protein cross-linked in the system, forming higher molecular weight species with the expected SDS-PAGE mobility of dimeric and trimeric subunits (Fig. 9D), reminiscent of HIV Gag subunits using a similar cross-linking assay (Campbell and Rein, 1999). In contrast, transfected GFP did not form higher molecular weight cross-links under the same conditions.

[0102] iii. Arc binds to RNA and encapsulates it The packaging of viral genomic RNA into retroviruses is a complex process mediated by a network of interactions between Gag, RNA, and lipid membranes (Mailler et al., 2016). Although HIV Gag contains a zinc finger knuckle motif within the NC domain that mediates viral RNA binding and selection (Carlson et al., 2016), in the absence of viral RNA, Gag can also bind cellular mRNAs, which may reflect nonspecific RNA interactions with the basal MA and NC domains (Comas-Garcia et al., 2016). Interestingly, foamy virus Gag does not contain a zinc finger domain but binds RNA through a C-terminal glycine-arginine-rich region (Hamann and Lindermann, 2016), suggesting that distinct Gag domains from different virus families have evolved to carry out similar biochemical processes. Similar to foamy virus Gag, Arc does not appear to contain a zinc finger domain but may bind RNA through ionic interactions at its N-terminus. prArc appeared to copurify with RNA or other nucleic acids, because the preparations had higher A260 / A280 spectrophotometric ratios than expected for pure recombinant protein (prArc 1.04 ± 0.024; endophilin 3A 0.55 ± 0.006, n = 3, p < 0.01, Figure 9B). It was possible that Arc could bind to and encapsulate RNA. To confirm whether prArc capsids house mRNA, we measured the levels of Arc mRNA and asnA, a highly abundant bacterial mRNA (Zhou et al., 2011), using qRT-PCR. Both Arc and asnA mRNA (Figure 2A) were measured; however, Arc mRNA levels were 10-fold higher than asnA. Bacterial cell lysates contained 15-fold higher levels of Arc mRNA than asnA (Fig. 2A), indicating that prArc capsids exhibit little specificity for particular mRNAs but encapsulate abundant RNAs stoichiometrically.When mRNA is encapsidated, it must be resistant to ribonuclease (RNase) treatment. RNase did not degrade either Arc or asnA mRNA, but it significantly degraded the exogenous free GFP mRNA (Fig. 2B), indicating that Arc and asnA mRNAs were protected from RNase degradation.

[0103] iv. Whether Arc protein associates with Arc mRNA was examined in vivo by immunoprecipitation of Arc protein from mouse cortical lysates and subsequent qRT-PCR (Figure 2C). Arc mRNA was found to be selectively co-immunoprecipitated (IP) with Arc protein, whereas GAPDH was not enriched in IP. These results indicate that Arc protein and its mRNA form a complex in neurons in vivo. Arc capsid assembly requires RNA. HIV Gag must bind to RNA to form immature viral capsids (Mailler et al., 2016). To test whether Arc encapsidation requires RNA, we purified full-length Arc protein as described above and then removed bound nucleic acid ("prArc(RNA)"; Figure S3A) as previously performed for HIV Gag (Ganser et al., 1999). This procedure significantly reduced the A260 / 280 ratio (prArc(RNA) 0.68 ± 0.03, prArc 1.04 ± 0.024; n = 3, p < 0.05), and qRT-PCR failed to detect Arc mRNA association (Figure 2D). Removal of RNA resulted in significantly fewer fully formed capsids (Figure 2E), suggesting that Arc capsids require RNA for successful assembly. To demonstrate that RNA directly promoted Arc capsid assembly, prArc(RNA) was exogenously supplemented with GFP mRNA (7.3% w / w), which resulted in significantly more fully formed Arc capsids.

[0104] v. Arc protein and Arc mRNA are released by neurons in extracellular vesicles Retroviral capsids and EVs are released from cells using similar cellular mechanisms, such as the MVB pathway (Nolte't Hoenet et al., 2016). Because Arc exhibits many of the biochemical properties of viral Gag proteins, we tested whether Arc protein could be similarly released from cells. We collected media from Arc-transfected HEK293 cells and purified the EV fraction. This fraction contained sub-100 nm vesicular structures resembling exosomes (Figure S3B). Arc protein was detected in the EV fraction, which was also positive for the EV marker ALIX but lacked actin (Figure 3A). Conversely, Arc-ΔCTD-transfected HEK cells showed little expression in the EV fraction (Figure 3B), indicating that proper Arc capsid assembly may be required for EV-mediated Arc release. qRT-PCR was performed on the EV fraction from HEK cell medium and detected Arc mRNA, which was resistant to RNase treatment (Fig. 3C).

[0105] Native Arc protein was also found in EV fractions prepared from medium collected from cultured mouse cortical neurons at IV15 (Figure 3D). Because Arc mRNA associates with Arc protein in brain lysates, we used RT-PCR to demonstrate the presence of Arc mRNA in EVs purified from neurons (Figure 3E). Arc protein in EVs was resistant to trypsin digestion (Figure S10C), suggesting that Arc protein and RNA are protected or bound in a complex within EVs. To directly determine whether Arc protein is present within EVs, we performed immunogold labeling of endogenous Arc in EV fractions from cultured neurons and found that Arc was present in a subpopulation of EVs (Figure 3F). To test whether the release of Arc from EVs is activity-dependent, we purified EV fractions from medium collected from untreated or KCl-treated wild-type (WT) cultured cortical neurons (Figure S10D). KCl treatment, which increases neuronal activity, resulted in significantly more Arc being released into the medium.

[0106] vi. Arc mediates intercellular movement of its own mRNA in extracellular vesicles While viral particles can infect cells through complex interactions between the viral envelope and the host cell membrane, EVs can also transfer cargoes such as RNA between cells (Valadiet et al., 2007). Arc can transfer mRNA either directly via mRNA packaged in prArc or within Arc-containing EVs. GFP / myc-Arc or nuclear-GFP were transfected into HEK (donor) cells. 18 hours later, media was collected from these cells and then incubated with untransfected naive HEK (recipient / "transferred") cells for 24 hours. High Arc expression was observed in a sparse population of naive HEK cells (Figure 4A), whereas cells incubated with media from cells transfected with only nuclear-GFP did not express nuclear-GFP. Fluorescence in situ hybridization (FISH) of Arc mRNA revealed high levels of Arc mRNA in recipient cells. The uptake of Arc protein and mRNA was endocytosis-dependent, since application of Dynasore (a potent inhibitor of clathrin-dependent endocytosis [Macia et al., 2006]) significantly blocked the transfer of Arc protein (Figure 11A). Because RNA encapsulation by Arc capsids is nonspecific in vitro, we tested whether Arc could be transferred along with highly abundant mRNA. Donor HEK cells were transfected with myc-Arc and / or membrane-bound GFP (mGFP), and the medium was collected 24 hours later. When donor cells contained Arc, recipient HEK cells showed clear transfer of both GFP protein and mRNA (Figure 4B). No transfer was observed in cells transfected with mGFP alone. These data indicate that Arc EVs released from HEK cells can transfer highly abundant mRNA between cells.

[0107] To test whether Arc capsids can import Arc mRNA into neurons, cultured hippocampal neurons from Arc knockout (KO) mice were incubated with prArc. Because the Arc KO strain contains GFP knocked into the Arc locus (Wang et al., 2006), Arc was imaged in the red channel, and GFP fluorescence was not detectable in the green channel (Figure 11B). Within 1 h of protein incubation, Arc protein uptake into KO neurons was observed above antibody background levels (see Figure 11C for antibody specificity), peaking around 4 h of incubation (Figure 5A). To directly determine whether Arc capsids can import Arc mRNA into neurons, we measured Arc mRNA levels in Arc KO neurons incubated with prArc. After 4 h of incubation with prArc, Arc FISH demonstrated robust high levels of imported Arc mRNA (Figure 5B). Further suggesting that Arc capsids can protect and encapsulate Arc mRNA, RNase treatment of prArc before incubation had no effect on mRNA import (Fig. 12A). Blocking endocytosis with Dynasore prevented the uptake of both prArc protein and Arc mRNA (Fig. 12B). Imported mRNA and protein were evident in both early endosomes (characterized by Rab5) and nonendosomal fractions in dendrites (Fig. 12C). Uptake and import of both purified prArc-ΔCTD and CA-prArc protein and mRNA were significantly less than that of the full-length protein, suggesting that encapsidation is required for uptake into neurons (Fig. 5C and D). The lack of protein uptake was not due to poor detection by a custom-made Arc polyclonal antibody (Fig. 12D). Strikingly, prArc(RNA) could not be internalized but instead coated the outside of neurons, further suggesting that intact Arc capsids are required for uptake and import (FIG. 13).

[0108] To test whether endogenous Arc can import mRNA, Arc KO cultured hippocampal neurons were incubated with purified EVs prepared from the medium of WT or KO cortical neurons. Arc KO neurons incubated with WT EVs showed a clear increase in dendritic Arc levels, whereas KO neurons incubated with EVs derived from KO cells did not (Figure 6A). Furthermore, FISH demonstrated that Arc mRNA in WT EVs was imported into KO neurons (Figure 6B). Arc mRNA uptake was not significantly affected by EV pretreatment with RNase (Figure 14A), suggesting that uptake was not due to free or unbound Arc mRNA in the EV fraction. Blocking endocytosis with Dynasore prevented the uptake of Arc protein and mRNA from EVs (Figure 14B). Notably, imported Arc mRNA expression exhibited global localization in both early endosomes and nonendosomal compartments (Figure S4C), virtually indistinguishable from Arc mRNA distribution in WT neurons. These data indicate that endogenous Arc released by EVs can transfer Arc mRNA between neurons.

[0109] vii. Imported Arc mRNA can undergo activity-dependent translation Arc mRNA associated with Arc capsids is imported into the neuronal cytoplasm, and as previously shown for endogenous Arc (Waung et al., 2008), activation of metabotropic glutamate receptor type 1 (mGluR1 / 5) with the agonist DHPG would induce Arc mRNA translation, resulting in an increase in dendritic Arc protein. As expected, Arc protein levels in dendrites of Arc KO neurons were significantly elevated after DHPG (5 min, 100 mM) application to cells incubated with prArc (Figure 7A). This increase was not evident when a protein synthesis inhibitor (cycloheximide, 180 mM) was added before DHPG application. KO neurons incubated with WT EVs for 4 h and then treated with DHPG exhibited a similar protein synthesis-dependent increase in dendritic Arc levels (Figure 7B). Although these experiments could not clearly distinguish between newly translated Arc and internalized protein, these data suggest that Arc capsids or EVs can transfer Arc mRNA between neurons and that this mRNA is available for activity-dependent translation in the cytoplasm of dendrites.

[0110] Mammalian Arc proteins exhibit key characteristics of retrovirus- and retrotransposon-encoded Gag proteins: self-assembly into capsids, RNA encapsulation, lipid binding, release within EVs, and intercellular RNA transfer. These data suggest that Arc mediates intercellular transport of mRNA via Arc EVs (which we call ACBAR, for Arc Capsids Bearing Arc RNA) and reveal a novel molecular mechanism by which genetic information can be transferred between neurons.

[0111] Arc functions as a repurposed Gag protein The data demonstrate remarkable conservation of viral Gag properties in Arc. Given that Arc exhibits structural homology with the Gag CA domain (Zhang et al., 2015), its ability to self-assemble into oligomeric capsids is perhaps not surprising. However, Arc appears to retain other important biochemical properties of Gag that are not intuitional from its sequence. Despite lacking a distinct zinc finger RNA-binding domain like that found in HIV Gag, Arc encapsulates RNA, and RNA binding appears to be essential for capsid formation. This is reminiscent of foamy virus Gag, which has evolved a distinct RNA-binding motif from HIV Gag (Hamann and Lindemann, 2016) yet is structurally similar to Arc (Taylor et al., 2017). HIV Gag-RNA interactions are complex, involve multiple components of Gag, including the MA domain, and are regulated by host cellular factors (Mailler et al., 2016). The Gag MA-RNA interaction is also essential for viral particle formation at the membrane (Kutluay et al., 2014). Moreover, Gag can encapsulate host RNA in the absence of viral RNA, and any single-stranded nucleic acid longer than 20–30 nt can assist capsid assembly (Campbell and Rein, 1999), suggesting a general tendency to bind abundant RNA. Indeed, exactly how viral RNA is preferentially packaged into Gag capsids within cells remains an area of ​​intense research (Comas-Garcia et al., 2016).

[0112] The uptake and import of RNA by purified Arc protein is surprising because it occurs in the absence of an "envelope" or lipid bilayer. Uptake of both purified Arc capsids and endogenous EVs occurs via endocytosis. EVs and exosomes are easily internalized via the endosomal pathway, but how RNA can cross the endosomal membrane without a membrane fusion protein remains unclear (Tkach and Thery, 2016). Data suggest that, like nonenveloped viruses, Arc protein itself contains the ability to translocate RNA across the endosomal membrane. It remains unclear how nonenveloped capsids import RNA into the cytoplasm, but several studies have proposed that this may occur through specific receptor-capsid interactions or pH-dependent conformational changes in the capsid that enable either membrane pore formation or lytic degradation (Tsai, 2007). Arc proteins can interact with endosomal membranes, allowing mRNA import into the cytoplasm as the capsid disassembles. This is reflected in the time lag between protein uptake and mRNA expression observed in these experiments, which may be a result of the time it takes for the mRNA to become accessible to our FISH probes. In vivo, the lipid membrane surrounding ACBAR may be required for targeting and uptake, whereas the enclosed Arc capsid protects the RNA and enables its import. Interestingly, prArc lacking RNA cannot form capsids and be internalized, suggesting that uptake may be a regulated process requiring properly formed capsids. Because Arc appears to regulate naturally occurring RNA translocation mechanisms, exploiting this pathway may enable new avenues for genetic engineering or RNA delivery into cells using ACBAR that can circumvent the barriers of immune activation.

[0113] ix. Arc Gag homology reveals a novel neuronal signaling pathway Exosome and EV signaling have emerged as essential mechanisms of intracellular communication, particularly in the immune system and cancer biology (Becker et al., 2016). However, the role of EV-mediated intercellular signaling in the nervous system has only recently been explored, and studies suggest that these pathways may play an important role in synaptic plasticity (Budnik et al., 2016; Zappulli et al., 2016). Canonical exosomes are formed within MVBs, originating from the endosomal pathway and often requiring ESCRT complexes for release (Raposo and Stoorvogel, 2013). However, EV biogenesis in general is more diverse. HIV Gag can form virions independently of MVBs, but the ESCRT machinery is still required for particle release, suggesting that Arc may form ACBARs independently of the canonical exosome pathway. These pathways are not mutually exclusive, and further investigation is needed to elucidate ACBAR biogenesis in neurons.

[0114] Because Arc is rapidly synthesized locally in dendrites (Park et al., 2008; Waung et al., 2008), it is plausible that high local concentrations of Arc protein promote capsid assembly in dendrites, where encapsulation of dendrite-localized mRNAs may occur. Because Arc capsids do not appear to exhibit specificity in RNA binding in vitro, and Arc EVs can transport highly abundant mRNAs, we speculate that the specificity of ACBAR cargo is conferred by the precise spatial and temporal expression of Arc protein in neurons (Figure 14D). Consistent with the identification of Arc mRNA associated with Arc protein from the brain, Arc mRNA levels are uniquely abundant in dendrites after neuronal activity or experience in vivo (de Solis et al., 2017). Gag-RNA interactions are regulated by host cell proteins such as Staufen (Mouland et al., 2000), a protein that is also an essential regulator of dendritic mRNA transport, including Arc mRNA, in neurons (Heraud-Farlow and Kiebler, 2014). The parallels between dendritic mRNA regulation and virus-RNA interactions are striking and indicate that cellular factors can play important roles in ACBAR biogenesis and RNA packaging.

[0115] Our data further suggest that Arc can mediate intercellular signaling to non-cell-autonomously control synaptic function and plasticity. While data on neuronal EVs are scarce, previous studies have shown that EVs can be secreted in an activity-dependent manner and can contain AMPARs as cargo (Faure et al., 2006). Arc has previously been implicated in AMPAR transport at weak synapses (Okuno et al., 2012) and during synaptic and spine pruning (Chowdhury et al., 2006; Mikuni et al., 2013), suggesting that a potential role for ACBARs may be pruning synaptic material. Arc also regulates homeostatic forms of plasticity, such as AMPAR scaling (Shepherd et al., 2006) and cross-sensory plasticity across various brain regions (Kraft et al., 2017), which may be regulated non-cell-autonomously at the circuit level. Release of Arc function, which carries intercellular cargo that alters the state of neighboring cells, is required for cellular information fixation.

[0116] Previous studies have shown that Drosophila neuromuscular junction plasticity requires synaptic signaling mediated by the Wnt pathway in exosomes (Korkut et al., 2009). Interestingly, the Drosophila Arc homolog dArc1 exhibits similar properties of intercellular mRNA movement in the fly nervous system and is one of the most abundant proteins in Drosophila EVs (Ashley et al., 2018; Lefebvre et al., 2016), suggesting remarkable biological convergence despite the wide evolutionary divergence of these species. Recent studies have further implicated Arc in the mammalian immune system (Ufer et al., 2016), where it regulates dendritic cell-dependent T cell activation, extending the potential repertoire and importance of Arc-dependent intercellular signaling beyond the nervous system. Moreover, EVs have been implicated in the pathology of various neurodegenerative disorders, because several pathogenic proteins, such as prions, β-amyloid peptides, and α-synuclein, are released from cells in association with EVs (Zappulli et al., 2016). In AD, immunohistochemical analysis of brain sections from patients with AD showed that the exosomal marker ALIX was abundant around senile plaques (Rajendran et al., 2006). This suggests that EVs may provide an important source of extracellular Aβ peptides. Arc regulates the activity-dependent cleavage of APP and β-amyloid production through interaction with presenilins, suggesting that ACBAR may also be involved in AD pathology (Wu et al., 2011).

[0117] x. Synaptic plasticity and the evolution of cognition The Ty3 / gypsy retrotransposon is an ancient mobile element widely distributed and often abundant in eukaryotic genomes and is thought to be the ancestor of modern retroviruses (Malik et al., 2000). There is evidence that coding sequences derived from Ty3 / gypsy and other retrovirus-like elements have repeatedly been repurposed for cellular functions during evolution (Feschotte and Gilbert, 2012). For example, multiple envelope genes of retroviral origin were co-opted during mammalian evolution to promote cell-cell fusion and syncytiotrophoblast formation in the developing placenta (Cornelis et al., 2015). There are more than 100 Gag-derived genes in the human genome alone (Campillos et al., 2006), and gene knockout of their mouse orthologs revealed that some, such as Arc, are essential for cognition (Irie et al., 2015). However, the molecular functions of these Gag-derived proteins have not been fully characterized, and questions remain as to whether they were co-opted to serve similar cellular processes. This study and the accompanying paper by Ashley et al. (2018) now reveal that two distantly related Gag-derived genes were independently co-opted in the ancestors of flies and tetrapods and are involved in similar processes of EV-dependent intercellular transport of RNA in the nervous system.

[0118] 2. Method i. Plasmid The full-length rat Arc (NP_062234.1) cDNA open reading frame (ORF) was subcloned from pRK5-myc-Arc. The insert was amplified by PCR, digested with BamH1 and Xho1, and ligated between the BamH1 and Xho1 restriction sites of the pGEX-6p1 (GE Healthcare, Little Chalfont, UK) expression vector. The GST-Arc ORF was similarly amplified and cloned into the pFastBac1 vector (Thermo Fisher Scientific) between the BamH1 and Xho1 restriction sites. prArc-ΔCTD was generated by blunt-end cloning after PCR amplification of the Arc ORF from pGEX-6p1-Arc, excluding the sequence encoding aa 277–374. Similarly, aa 195–364 of the Arc ORF (CA-prArc) was cloned into the pET11a vector, which contained a His tag. pBluescript-SKII-GFP was generated by restriction digestion of mEGFP (BBA16881.1) from pGL4.11-arc7000-mEGFP-ArcUTRs (kindly provided by Dr. Haruhiko Bito, University of Tokyo) and subsequent ligation into the KpnI and SacI restriction sites flanking the insert in the pBluescript-SKII-ArcUTRs plasmid (kindly provided by Dr. Kristen Keefe, University of Utah). The pGEX-4T-1 Drosophila Arc1 (NP_610955.1) construct was kindly provided by Dr. Mark Metzstein, University of Utah. EGFP-C3-Arc and pRK5-myc-Arc were kindly provided by Dr. Kimberly Huber (UT Southwestern) and Dr. Paul Worley (Johns Hopkins University), respectively. All protein expression constructs were transformed into DH5α E. coli cells, and individual colonies were screened by Sanger sequencing (GeneWiz, South Plainfield, NJ) sequencing service using primers synthesized by Integrated DNA Technologies (Coralville, IA).Trace files were analyzed using the A Plasmid Editor (APE) freeware available from the University of Utah. The sequenced and verified constructs were then transformed into BL21-DE3 bacterial cells for protein expression.

[0119] ii. Protein purification Initial bacterial cultures for protein expression were grown overnight at 37°C in LB supplemented with ampicillin and chloramphenicol. The initial culture was used to inoculate a larger 500 mL culture of ZY autoinduction medium. The larger culture was grown at 37°C at 150 rpm to an OD600 of 0.6-0.8, then shifted to 19°C at 150 rpm for 16-20 hours. The culture was then pelleted at 5000 x g for 15 minutes at 4°C, and the cell pellet was suspended in 30 mL of lysis buffer (500 mM NaCl, 50 mM Tris, 5% glycerol, 1 mM DTT, pH 8.0 at room temperature (RT) for Arc constructs and GST; 300 mM KCl, 50 mM Tris, 1% Triton X-100, 1 mM DTT, pH 7.4 at RT for endophilin 3A) and flash-frozen in liquid nitrogen. Frozen pellets were quickly thawed at 37°C and adjusted to a final volume of 1 g pellet per 10 mL of lysis buffer supplemented with DNase, lysozyme, aprotinin, leupeptin, PMSF, and pepstatin. The lysate was then sonicated for 8-10 45-second pulses at a 90% duty cycle and pelleted at 21,000 x g for 45 minutes. For GST-tagged constructs, the clarified supernatant was then passed through a 0.45 mm filter and incubated overnight at 4°C in a gravity column with pre-equilibrated GST-Sepharose 4B affinity resin. The bound protein was then washed twice with 2 column volumes (20 resin bed volumes each) of lysis buffer and re-equilibrated with 150 mM NaCl, 50 mM Tris, 1 mM EDTA, 1 mM DTT, pH 7.2 at RT. Cleavage was performed on the resin overnight at 4°C using PreScission Protease (GE Healthcare) for GST-tagged constructs or thrombin (Sigma-Aldrich) for dArc1. The cleaved protein was then buffer-changed to 150 mM NaCl, 50 mM Tris, pH 7.4 at RT to abolish protease activity and loaded onto an S200 size-exclusion column to separate the cleaved protein. Peak fractions were pooled.GST was affinity purified as described above using Sepharose 4B resin and directly eluted with 15 mM reduced L-glutathione, 10 mM Tris, pH 7.4 at RT. His-tagged CA-prArc was affinity purified as described above using Ni+ resin (Roche, Basel, Switzerland) and directly eluted with 250 mM imidazole, 10 mM Tris, pH 7.4 at RT. The GST and CA-prArc buffer was then changed to 150 mM NaCl, 50 mM Tris, pH 7.4 at RT. To remove the Arc protein from the nucleic acid for prArc(RNA-) preparation, cell pellets were lysed as described above in 20 mM NaCl, 50 mM Tris, 5% glycerol, 2 mM MgCl2, 1 mM DTT, pH 8.0 at RT. Nucleic acids were precipitated from the cell supernatant by adding 10% PEI, pH 8.0, dropwise to a final concentration of 0.1%, followed by incubation at 4°C for 20 minutes and pelleting at 27,000 x g for 20 minutes. The resulting supernatant was then precipitated by adding saturated ammonium sulfate to a final concentration of 30%. The precipitated protein was pelleted at 10,000 x g for 10 minutes, resuspended in 60 mL of lysis buffer, and affinity purified. The cleaved affinity-purified product was then dialyzed overnight against Q-column buffer A (QA; 20 mM NaCl, 50 mM Tris, pH 7.4 at RT). The dialyzed protein was then subjected to anion exchange chromatography (HiTrap Q, GE Healthcare) using a gradient from QA buffer to QB buffer (1 M NaCl, 50 mM Tris, pH 7.4). The average yield of purified protein was 10.5 mg (8-13 mg) per liter of cell culture. Electron microscopy.

[0120] iii. Negative staining For all negatively stained specimens, Formvar and carbon-coated copper 200-mesh grids (Electron Microscopy Sciences or TedPella, Redding, CA) were glow-discharged in a vacuum chamber at 30 mA for 20–45 s. Afterwards, 3.5 mL of sample was applied to the grid and allowed to stand for 35–45 s, and excess sample was blotted using filter paper. The grid was then immediately washed with 2–4 30 mL water drops for 5 s, followed by one wash with 1% uranyl acetate (UA) on parafilm. The excess water / UA was blotted, and then a final UA drop was applied and allowed to stand for 30 s. After blotting, the grid was air-dried for 30–60 s. Imaging was performed using either an FEI T12, FEI Tecnai Spirit microscope, or a JEOL 1400 electron microscope equipped with a Gatan Orius SC200B CCD camera operated at 120 kV.

[0121] a. Low temperature EM Purified Arc protein was dialyzed against 300 mM NaCl, 50 mM Tris, pH 7.4, and concentrated twice using an Amicon 100 MWCO centrifugal filter (Millipore, Burlington, MA) to a final protein concentration of 2 mg / mL. 10 nm diameter gold beads were added to the sample. A degassed 2 / 2-3C C-plate grid (Electron Microscopy Sciences, Hatfield, PA) was glow discharged at 30 mA for 45 seconds. The sample was applied twice to the grid, allowed to stand for 30 seconds, and then the grid was plunged into liquid ethane and frozen using an FEI Vitrobot Mark IV. Micrographs were acquired using an FEI Tecnai G2 F20 microscope equipped with an FEI Falcon II direct detector and operated at 200 kV. The nominal defocus was 1.3 mm.

[0122] b.EM quantification The grids were visually inspected to ensure uniform sample application. For each experiment, six images were taken from randomly selected square grids. Fully and partially formed particles between 20 and 40 nm were then manually counted using ImageJ. The counts were divided by the image field (2.07 mm²) to express the data as oligomer counts / mm².

[0123] c.Arc capsid assembly assay GFP mRNA was added to prArc(RNA-) (5 mg / mL in low-salt buffer: 20 mM NaCl, 50 mM Tris, pH 7.4 at RT) at a nucleic acid:protein ratio of 7.3% (w / w) (corresponding to one Arc molecule for every 10 nucleotides). The reaction was then diluted to 1 mg / mL prArc(RNA-) by dropwise addition of low-salt buffer or capsid assembly buffer (500 mM NaPO4, 50 mM Tris, 0.5 mM EDTA, pH 7.5 at RT) and incubated for 2 hours at room temperature. After incubation, negative-stain EM grids were prepared for each 0.25 mg / mL reaction, and capsid formation was quantified by manual counting of six images. Fully formed capsids contained spherical particles of 20–50 nm with distinct double shells. Similar results were observed for three independent protein preparations.

[0124] d. Dynamic Light Scattering Purified Arc protein was subjected to dynamic light scattering measurements using a Malvern Zetasizer Nano ZSP instrument. Scattering was performed at 25°C at a fixed angle of 173°C (backscattering). Scattering intensity is expressed as particle number under the assumption that scattering intensity from spherical particles is proportional to the sixth power of particle size. Phylogenetic reconstruction

[0125] e.Animals The human or Drosophila Arc protein sequence was used to query the NCBI genome sequence database using tBLASTn. Repbase was also queried using the CENSOR program to identify known repeat families with high sequence similarity to mammalian or fly Arc genes, respectively. The following sequence IDs were used in the analysis: (GenBank loci) Mm ARC--AHBB01089569; Hs ARC--LIQK02016549; Ac ARC--AAWZ02020354; Lc gypsy2--AFYH01030203; CC gypsy--LHQP01046008; Dm ARC1--JSAE01000572; Ds ARC1--CAKG01020471; Sc ARC1--LDNW01019671; Dm ARC2--JXOZ01003752; Ds ARC2--AWUT01001000; Sc ARC2--LDNW01019670; Bm gypsy--BABH01046987; Tc gypsy--AAJJ02003810. Repbase: Lc gypsy--Gypsy2-1-I_Lch; Dr gypsy26--Gypsy-26-I_DR; Lh gypsy11--Gypsy-11_LH-I; Dm gypsy1--Gypsy1-I_DM; ty3--TY3. Protein (Arc and Gag) sequences found to have high similarity to Arc proteins and other related Ty3 / gypsy elements were aligned using the MUSCLE program. The truncated Arc / Gag alignment was uploaded to MEGA7 and 500 bootstrap iterations were performed to generate a phylogenetic tree for subsequent maximum likelihood phylogenetic reconstruction using default parameters. The Drosophila melanogaster dArc1 and dArc2 protein sequences were used to query the antler fly protein database using BLASTp. When darc1 was present in one-to-one orthologs in the examined species, many more hits than expected were observed. Protein FASTA sequence alignments were performed using MUSCLE, and maximum likelihood phylogenetic trees were generated using MEGA.

[0126] Arc knockout (KO) mice (gift from Dr. Kuan Wang at the NIH) in which GFP was knocked into the Arc ORF (Wang et al., 2006) and wild-type (WT) C57BL / 6 littermates were used for hippocampal and cortical lysate experiments. Hippocampal and cortical primary neuron cultures were prepared from WT or KO E18 embryos.

[0127] iv.Cell culture Primary neuronal cultures were prepared from the cortex and hippocampus of E18 mice as previously described (Shepherd et al., 2006). Tissues were dissociated with DNase (0.01%; Sigma-Aldrich) and papain (0.067%; Worthington Biochemicals, Lakewood, NJ) and then triturated with a flame-polished glass pipette to obtain a single-cell suspension. Cells were pelleted at 1000 x g for 4 min, the supernatant removed, and the cells resuspended and counted using a TC-20 cell counter (Bio-Rad, Hercules, CA). Neurons were seeded at 90,000 cells / mL in 12-well plates (Greiner Bio-One, Monroe, NC) or 800,000 cells / mL in 10 cm plastic dishes onto poly-L-lysine (0.2 mg / mL; Sigma-Aldrich)-coated coverslips (Carolina Biological Supply, Burlington, NC). Neurons were first seeded in Neurobasal medium (Thermo Fisher Scientific) containing 5% horse serum, 2% GlutaMAX, 2% B-27, and 1% penicillin / streptomycin in a 37°C incubator containing 5% CO2. On DIV4, neurons were fed with astrocyte-conditioned Neurobasal medium (Sigma-Aldrich) containing 1% horse serum, GlutaMAX, penicillin / streptomycin, 2% B-27, and 5 μM cytosine □-D-arabinofuranoside (AraC) by half-medium exchange, and then every 3 days.

[0128] HEK293 cells were maintained in DMEM medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin and passaged every 3–4 days at 70% confluence. For transfection and transfer experiments, HEK cells were seeded on 10 cm dishes or collagen-coated coverslips in 12-well plates.

[0129] v. Transfection HEK cells were transfected using polyethyleneimine (PEI) at a ratio of 3 mg of PEI to 1 mg of DNA diluted in Opti-MEM (Thermo Fisher Scientific). Cells were transfected at approximately 60-70% confluence. For EV isolation and media transfer experiments, the culture medium was changed 4-6 hours after transfection to remove PEI and DNA, and the medium was collected 24 hours later. HEK cell transfer experiments

[0130] vi. Transfection and Transfer Media from transfected HEK cells was collected 24 hours posttransfection and centrifuged at 500 x g for 4 minutes to remove dead cells and debris. Media from untransfected naive cells was removed and replaced with clarified transfected media and incubated for an additional 24 hours. After incubation, cells were fixed, and combined immunocytochemistry / fluorescence in situ hybridization (ICC / FISH) for Arc or GFP protein and RNA was performed as described below.

[0131] A blocking endocytosis To block endocytosis, groups of naive HEK cells seeded on coverslips in 12-well plates and receiving medium from GFP-Arc-transfected HEK cells were simultaneously treated with 80 mM Dynasore (Abcam, Cambridge, MA) for the first 6 hours, after which the medium was removed and replaced with fresh HEK medium. After 18 hours, Dynasore-treated and untreated HEK cells were fixed. The entire 18-mm coverslip was observed under a 20x objective, and the number of GFP-Arc-transfected cell aggregates was manually counted. Representative images were obtained using a 20x objective on an Olympus FV1000 confocal microscope (Tokyo, Japan).

[0132] vii. Neuron transfer experiments a. Imaging Cultured neurons at DIV15 were used for all neuron experiments. For purified Arc protein incubation experiments, neurons were treated with 4 mg of purified prArc, prArc-ΔCTD, CA-prArc, or prArc(RNA-) protein in standard neuron nutrient medium and incubated for 1 or 4 hours. For extracellular vesicle (EV) incubation experiments, neurons were treated with 10 mg of protein from purified EV fractions obtained from eight 10 cm dishes of cultured cortical neurons at DIV15 (see "Cell Culture" Methods) seeded with E18 WT cortical neurons at 800,000 cells / mL and incubated for 1 or 4 hours. For purified protein and EV treatment experiments, a subset of neurons was treated with 100 mM mGluR1 agonist dihydroxyphenylglycine ((S)-3,5-DHPG; Tocris Bioscience, Bristol, UK) for 5 min, then washed out and replaced with pre-conditioned neuronal medium for 25 min before fixation. To block protein translation during DHPG treatment, a subset of neurons was pretreated with 180 mM cycloheximide (CHX; Sigma-Aldrich) for 30 min before DHPG treatment. CHX was left in the medium for a total of 1 h. To block endocytosis, neurons were pretreated with 80 mM Dynasore (Abcam, Cambridge, MA) for 30 min before adding purified protein. For RNase treatment, either prArc or WT EV samples were incubated with RNase A (1:1000; Omega Bio-tek, Norcross, GA) for 15 min and then with SUPERase-In RNase inhibitor (1 U / mL; Thermo Fisher Scientific) immediately before addition to neurons. The treated samples were then added to neurons and incubated for 4 h.

[0133] After treatment, neurons were washed twice with 4% sucrose / 1X phosphate-buffered saline (PBS; 10X: 1.4 M NaCl, 26.8 mM KCl, 62 mM NaHPO, 35.3 mM KHPO, pH 7.4) at 37°C and then fixed with 4% sucrose / 4% formaldehyde (Thermo Fisher Scientific) in 1X PBS for 15 minutes. Neurons were washed 335 minutes with 1X PBS, permeabilized with 0.2% Triton X-100 (Amresco, Solon, OH) in 1X PBS for 10 minutes, and blocked in 5% normal donkey serum (Jackson ImmunoResearch, West Grove, PA) in 1X PBS. Neurons were then incubated in pooled diluted primary antibodies for 1 hour at room temperature, washed 335 minutes in 1X PBS, and incubated in pooled diluted secondary antibodies for 1 hour at room temperature. Neurons on coverslips were mounted on glass slides in Fluoromount (Thermo Fisher Scientific) and allowed to dry overnight at room temperature. Primary antibodies used were rabbit anti-Arc (1:1000; custom-made; ProteinTech, Rosemont, IL); rabbit anti-Arc (1:1000; Synaptic Systems, Goettingen, Germany); chicken anti-MAP2 (1:5000; ab5392; Abcam); mouse anti-Rab5 (1:1000; BD Biosciences, San Jose, CA); and DAPI nuclear stain (Molecular Probes, Thermo Fisher Scientific). Secondary antibodies used were Alexa Fluor 405, 488, 555, or 647 (1:750; Thermo Fisher Scientific or Jackson ImmunoResearch) for the appropriate animal host.

[0134] The fluorescence in situ hybridization (FISH) procedure for Arc and GFP was based on a previously published protocol (Daberkow et al., 2007). We used full-length rat Arc ribonucleotide probes (rat and mouse Arc are 99% identical at the aa level) or EGFP (see the cloning strategy described above in "Plasmids") as per the published protocol, but modified the protocol for use with cultured neurons and HEK cells instead of brain slices. Arc and GFP plasmids were linearized with Not1 and purified by standard phenol / chloroform extraction. Linearized antisense Arc or GFP was used to generate ribonucleotide probes incorporating DIG-UTP using a T7 DIG RNA labeling kit (Sigma-Aldrich) and then purified on a G-50 spin column (GE Healthcare). Cells were washed once with 4% sucrose / 1X PBS at 37°C and then fixed with 4% sucrose / 4% formaldehyde in 1X PBS for 15 minutes. Cells were washed with 1X PBS for 335 minutes, permeabilized in 0.2% Triton X-100 for 10 minutes, washed with 1X PBS for 235 minutes, then washed with 2X saline-sodium citrate (SSC; 20X: 3M NaCl, 300 mM citrate trisodium salt dihydrate, pH 7) for 5 minutes. Cells were prehybridized in 1X prehybridization solution (Sigma-Aldrich) for 30 minutes. DIG-labeled Arc or GFP ribonucleotide probes were diluted 1:3 with ddH2O, denatured at 90°C for 5 minutes, placed on wet ice for 2 minutes, and then mixed with RNA hybridization buffer (23.75 mM Tris-HCl, 1.19 mM EDTA, 357 mM NaCl, 11.9% dextran sulfate, 1.19X Denhardt's solution (Thermo Fisher Scientific), 2.5% nuclease-free water, 60% formamide (Fisher Scientific, Hampton, NH)). The Arc probe (1:500) or GFP probe (1:750) was hybridized to cultured cells for 16 hours at 56°C.The next day, cells were washed sequentially to reduce background signal: 2X SSC for 335 min, RNase A (1:1000; Omega Bio-tek) for 15 min at 37°C, 2X SSC for 10 min at RT, 0.2X SSC for 10 min at RT, 0.2X SSC for 15 min at 56°C, 0.2X SSC for 10 min at RT, and TNT (0.1 M Tris-HCl, 0.15 M NaCl, 0.05% Tween-20, pH 7.5) for 5 min. Cells were then blocked for 30 min with 2.5% sheep serum (Jackson ImmunoResearch) and 2.5% donkey serum in TNB (0.1 M Tris-HCl, 0.15 M NaCl, 0.5% w / v blocking agent (Sigma-Aldrich), pH 7.5). For the primary antibody step, DIG-HRP (1:1000; Sigma-Aldrich) was diluted with either MAP2 antibody (1:2500; Abcam), Arc antibody (1:500; custom-made), or Rab5 antibody (1:500; BD Biosciences) in TNB containing 2.5% sheep serum and 2.5% donkey serum and incubated on cells for 1 hour. After a 3:35 wash in TNT, the DIG-HRP signal was developed using a TSA Plus Cyanine3 kit (1:50; PerkinElmer, Waltham, MA) for 30 minutes. The cells were washed for 5 minutes in TNT and 5 minutes in 1X PBS, after which secondary antibodies were diluted 1:750 in 5% donkey serum and 1X PBS and incubated on cells for 1 hour to detect MAP2, Arc, or Rab5. Nuclei were stained with DAPI (Thermo Fisher Scientific), and then coverslips were mounted on glass slides with Fluoromount and dried overnight at RT.

[0135] b. Imaging Coverslips were imaged using a 60X oil-immersion objective on an Olympus FV1000 confocal microscope (Tokyo, Japan), and images were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD). Neurons included in the analysis were unbiasedly selected by examining MAP2 dendritic morphology to ensure cell health. In each independent experiment, coverslips were automatically scanned to find the brightest immunofluorescence, and this value was subsequently used to set the image acquisition environment for that experiment. Images from all coverslips in a given experiment were then acquired using the exact same environment.

[0136] c. Analysis of dendritic Arc protein and mRNA expression During analysis, images from each experiment were blind-thresholded at the brightest immunofluorescence (to remove background fluorescence and ensure that images were analyzed in the linear range), and the same threshold was applied to all other images within that experiment. The integrated density (mean pixel intensity × area) of two 30-mm dendritic segments / neuron was measured from each coverslip. Overall, our analysis avoided closely spaced dendritic branches to control for potential differences in dendritic mass. In each experiment, the control group, whether ICC or FISH, was set to "1," and the integrated density values ​​of other groups were normalized to this value and displayed as fold change ± SEM in the graphs. In representative images, ImageJ's Smart Lookup Table (LUT) was applied to highlight differences in Arc expression between groups. For the analysis of Arc / Rab5 colocalization, two 30-mm dendritic segments / neuron were selected for analysis of colocalization of Arc protein or mRNA with Rab5 protein. The Arc and Rab5 channels were thresholded to the same value across all images. Using ImageJ, a mask was created of the dendritic sections thresholded for both Rab5 and Arc. The Arc mask was applied to the Rab5 mask, and the number of overlapping points was quantified. Arc / Rab5 colocalization was determined by dividing the number of Arc particles overlapping with Rab5 by the total number of Arc particles within the dendritic span.

[0137] d. Immunoblotting and analysis by Western blot Western blot samples were mixed with 4X Laemli buffer (40% glycerol, 250 mM Tris, 4% SDS, 50 mM DTT, pH 6.8) and heated at 70°C for 5 minutes. Protein samples were separated using SDS-PAGE gel electrophoresis. The separated samples were transferred to a nitrocellulose membrane (GE Healthcare). After transfer, the membrane was briefly stained with 0.1% Ponceau stain and then destained with 1% acetic acid to remove total background for imaging of total protein. The membrane was blocked with 5% milk + 1X Tris-buffered saline (TBS; 10X: 152.3 mM Tris-HCl, 46.2 mM Tris base, 1.5 M NaCl, pH 7.6) for 30 minutes at room temperature, followed by incubation in primary antibody in 1X TBS for either 1 hour at room temperature or overnight at 4°C. Membranes were washed 3 x 10 min with 1X TBS and then incubated en bloc in HRP-conjugated secondary antibody (Jackson ImmunoResearch) for 1 h at RT. After 3 x 10 min with 1X TBS, protein bands were detected using a chemiluminescence kit (Bio-Rad, Hercules, CA), and membranes were imaged in an Azure c300 gel dock (Azure Biosystems, Dublin, CA). Blots were analyzed and quantified using the Gel Analysis plugin in ImageJ.

[0138] e.Antibodies Antibodies were used at the following concentrations: Arc (1:000; mouse monoclonal, Santa Cruz), Arc (1:000; rabbit polyclonal, custom-made, Protein Tech), ALIX (1:500; rabbit polyclonal, custom-made, provided by Dr. Wesley Sundquist), actin (1:1000; HRP-conjugated, Abcam), and GFP (1:1000; chicken polyclonal, Aves). Secondary antibodies were all used at a dilution of 1:10,000 (HRP-conjugated goat anti-rabbit, goat anti-mouse, and goat anti-chicken, Jackson ImmunoResearch). Coomassie gels.

[0139] Samples for analysis by SDS-PAGE were mixed with 4X Laemli buffer and heated at 70°C for 5 minutes. Protein samples were separated on a 10% SDS gel. The gel was then stained with 0.1% Coomassie Blue stain (0.1% w / v Coomassie Blue, 50% methanol, 10% acetic acid, 40% water) for 30 minutes and destained overnight in destaining solution (50% methanol, 10% acetic acid, 40% water). Gels were visualized using an Azure c300 gel dock with the autoexposure setting in the visible channel. Gel exposure was analyzed and quantified using the Gel Analysis plugin in ImageJ.

[0140] viii. Immunoprecipitation WT and Arc KO cortices were dissected and homogenized in 150 mM NaCl, 50 mM Tris, 1% Triton X-100, 0.5% sodium deoxycholate, 0.05% SDS, pH 7.4 (IP lysis buffer) with freshly added protease inhibitors (Roche). The homogenate was pelleted at 200 x g for 5 minutes at 4°C to remove tissue debris. The supernatant was removed, diluted to 2–4 mL, shaken at 4°C for 10 minutes, and then pelleted at 17,000 x g for 10 minutes at 4°C to remove insoluble material. The clarified supernatant was removed, and a small aliquot was taken as input, while the remainder was used for immunoprecipitation. Immunoprecipitation of supernatants was performed using 1 mg / 500 mL of Arc antibody (rabbit polyclonal, custom-made, Protein Tech) or standard rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA) at 1 mg / 500 mL lysate with gentle shaking for 2 hours at 4°C. After antibody incubation, 10% volume of washed 50 / 50 Protein A bead slurry (Thermo Fisher Scientific) was added to the antibody / lysate mixture and incubated for an additional hour at 4°C with shaking. The bead-antibody complex was then briefly pelleted at low speed, the supernatant removed, and the beads washed three times with IP buffer. The washed beads were then resuspended in 200 mL of IP buffer. Proteins were eluted from the beads with half the bead slurry in 17 mL of 4X Laemli buffer for 5 minutes at RT, followed by the addition of 50 mL of IP buffer. The solution was removed from the beads and placed in a new tube, which was then heated at 70°C for 5 minutes. The input (10% of the lysate volume) and 30 mL of each IgG and antibody eluate were separated on a 10% acrylamide gel by SDS-PAGE and immunoblotted as described above. The input and IgG and Arc eluate bands were analyzed using the Gel Analysis plugin in ImageJ, and the data were graphed as the ratio of the signal from each eluate to the input signal from each individual mouse. The other half of the bead slurry was used to adjust the IP buffer to 1% SDS, and 0.8 mg of proteinase K (New England Biolabs, Ipswich, MA) was added.Samples were then incubated for 30 min at RT with shaking, and total RNA was extracted as described below.

[0141] ix. Chemical cross-linking of Arc protein in situ Transfected HEK cells expressing myc-Arc-WT or GFP control were briefly trypsinized, quenched in DMEM (Thermo Fisher Scientific), and pelleted. The medium was removed, and the pelleted cells were then crosslinked with 0.4% formaldehyde in PBS for 10 minutes at room temperature with shaking. The cell suspension was immediately quenched with Tris to a concentration of 50 mM and repelleted. The supernatant was removed, and the cell pellet was then lysed in 150 mM NaCl, 50 mM Tris, 1% Triton X-100, pH 7.4 (lysis buffer) for 20 minutes at 4°C with shaking. Lysates were clarified by centrifugation at 21,000 × g for 10 min at 4°C, and the clarified supernatants were then run on 4–8% gradient gels and analyzed by Western blot using antibodies against Arc (mouse monoclonal, Santa Cruz) and GFP (chicken polyclonal, Aves).

[0142] x.RNA extraction Total RNA was extracted for all samples using TRIzol (Thermo Fisher Scientific). TRIzol-extracted samples were mixed 5:1 with chloroform, incubated at RT for 3 minutes, and pelleted at 12,000 x g for 10 minutes at 4°C. The resulting aqueous phase was collected, mixed 1:1 with isopropanol, incubated at RT, and pelleted at 12,000 x g for 10 minutes at 4°C. The resulting supernatant was removed, and the pellet was washed with 75% cold ethanol. The washed pellet was then repelleted at 7500 x g for 5 minutes at 4°C. The supernatant was removed, and the dried pellet was resuspended in ddH2O.

[0143] xi.RT-PCR Total RNA concentration was measured by A260 / 280 using a Nanodrop (Thermo Scientific). Reverse transcription reactions were performed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) with 100–200 ng of RNA as template. The resulting cDNA was amplified for 35 cycles using a rat Arc and GAPDH primer set at an annealing temperature of 60°C. The resulting PCR products were analyzed on a 1.5% agarose gel stained with SYBR Safe (Thermo Fisher Scientific). Rat Arc primers: forward, ACCATATGACCACCGGCGGC; reverse, TCCAGCATCTCAGCTCGGCAC. GAPDH primers: forward, CATGGCCTTCCGTGTTCCTA; reverse, GCCTGCTTCACCACCTTCTT. RT-PCR gels were quantified using the ImageJ gel analyzer tool.

[0144] xii.qRT-PCR To determine the amount of RNA associated with Arc protein, quantitative RT-PCR was performed on mRNA prepared from 1: whole mouse cortex immunoprecipitated with Arc and IgG proteins, 2: EV fraction prepared from HEK cells (see "Extracellular Vesicle Purification" below), and 3: lysates and purified protein from bacteria (BL21, Thermo Fisher Scientific) transfected with rat Arc plasmid (pGEX-GST-ArcFL). To determine whether mRNA associated with Arc protein is protected from degradation compared to exogenously added GFP antisense RNA (generated using T7 RNA polymerase from linearized pBluescript-SKII-GFP), some samples were treated with RNase (25 mg, RNase A, Thermo Fisher Scientific). Preparation 1: Mice were sacrificed after 24 hours in a dark enclosure and 2 hours in an enriched environment. Whole cortex was dissected and homogenized in IP lysis buffer as described above. After immunoprecipitation, the bead slurry was incubated in guanidine thiocyanate containing RLT lysis buffer, and column purification of RNA was performed using the QIAGEN RNeasy Micro kit (QIAGEN, Hilden, Germany). The entire eluate was used for reverse transcription using the High Capacity cDNA Reverse Transcription Kit with 50 U of Multiscribe reverse transcriptase and random oligo primers (Thermo Fisher Scientific). Preparations 2 and 3: Total RNA was extracted using TRIzol (Thermo Fisher Scientific) as described above ("RNA extraction"). Reverse transcription reactions (25°C for 10 min, 37°C for 2 h, 85°C for 5 min) were performed using the High Capacity cDNA Reverse Transcription Kit.The resulting cDNA was prepared for qPCR using PowerUp SYBRgreen Master Mix (Thermo Fisher Scientific) in 96-well plates with primers for rat Arc, GAPDH, and asnA (see "RT-PCR" above; asnA primers: forward, GCGTGGATGCCGACACGTTG; reverse, ATACCGCCGCCGATGGTCTG). qPCR was performed on a QuantStudio3 Real-Time PCR System (Thermo Fisher Scientific) using the following protocol: Preincubation: 50°C for 2 minutes, 95°C for 2 minutes. Amplification: 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 1 minute, for 40 cycles. Melting curve: 95°C for 1 second, 60°C for 20 seconds, with a continuous temperature ramp of 0.15°C / second to 95°C. Ct values ​​higher than 30 were considered undetectable. Differences in expression were determined using the standard curve method, in which standard DNA samples were serially diluted (10-fold), the genes of interest were analyzed, and a linear equation was calculated. The resulting linear equation was used to determine where the Ct value of the test sample corresponded on the standard curve, and the results were transformed (log10) to reflect the dilution of the standard sample. Differences were calculated by measuring the fold change (test / average control) from the mean control value for any given group.

[0145] xiii. Purification of extracellular vesicles Extracellular vesicles (EVs) were purified from HEK cells and primary neuron cultures as previously described (Lachenal et al., 2011). The medium was spun sequentially at 2,000 and 20,000 x g to remove dead cells and debris, followed by a spin at 100,000 x g to pellet the EVs. The crude EV pellet obtained after the first high-speed spin was resuspended in cold PBS and repelleted at 100,000 x g for 1 hour at 4°C in an SW41 rotor. The washed EV pellet was further purified by overnight centrifugation at 100,000 x g through a 10-20% sucrose-PBS gradient at 4°C. The resulting pellet was washed with cold PBS to remove excess sucrose and then repelleted at 100,000 x g for 1 hour at 4°C. The final washed pellet was resuspended in PBS and used for downstream analysis by EM, Western blotting, and neuron processing. For trypsin digestion and RNase assays, trypsin was added to prArc and EVs at 0.05 mg / mL for 30 minutes at RT, followed by inactivation of trypsin by the addition of 1 mM PMSF for 10 minutes. Untreated and trypsin-treated samples were then analyzed by Western blot. RNase A was added to WT neuron lysates and EVs at 50 mg / mL for 15 minutes at 37°C. Untreated and RNase-treated samples for RT-PCR were then directly extracted with TRIzol. Trypsin digestion and RNase assays

[0146] Trypsin was added to prArc and EVs at 0.05 mg / mL for 30 minutes at RT, followed by inactivation of trypsin by the addition of 1 mM PMSF for 10 minutes. Untreated and trypsin-treated samples were then analyzed by Western blot. RNase A was added to WT neuron lysates and EVs at 50 μg / mL for 15 minutes at 37°C. Untreated and RNase-treated samples for RT-PCR were then directly extracted with TRIzol.

[0147] xiv. Immunogold labeling Immunogold labeling was performed as previously described (Korkut et al., 2013) with modifications. Samples were fixed overnight in 2% formaldehyde at 4°C with gentle shaking. They were then applied to glow-discharged Formvar copper mesh grids (Ted Pella) and allowed to adhere for 10 minutes at room temperature. The samples were then quenched by three washes with 0.1 M Tris, pH 7.4. The samples were then permeabilized for 10 minutes at room temperature, blocked, and stained for Arc (1:500; custom-made). A 5 nm gold-conjugated secondary antibody was used for staining without silver enhancement. After antibody labeling, negative staining of the grids was performed as described above.

[0148] xv. Statistics Two-way ANOVA with or without repeated measures (with post-hoc Sidak test) or unpaired two-tailed t-tests were performed using GraphPad Prism (GraphPad Software, San Diego, CA) or JMP Pro statistical software (SAS; Cary, NC). Significance was set at p<0.05. All data shown are representative of at least two experimental replicates. Statistical details (N, number of experimental replicates, explanation of how data is displayed) can be found in the figure legends or Results section. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the methods and compositions described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A human or Drosophila Arc capsid composed of an Arc protein containing a CA domain, wherein a heterologous nucleic acid is encapsulated within the Arc capsid.

2. 2. The human or Drosophila Arc capsid of claim 1, wherein the heterologous nucleic acid is a therapeutic nucleic acid.

3. 3. The human or Drosophila Arc capsid of claim 1 or claim 2, wherein the heterologous nucleic acid is mRNA, siRNA, shRNA or microRNA.

4. 2. The human or Drosophila Arc capsid of claim 1, wherein the heterologous nucleic acid encodes a therapeutic protein.

5. 2. The human or Drosophila Arc capsid of claim 1, wherein the Arc protein comprises an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO:

2.

6. An extracellular vesicle or exosome comprising the human or Drosophila Arc capsid of any one of claims 1 to 5.

7. A host cell comprising a recombinant nucleic acid comprising a heterologous nucleic acid and a recombinant nucleic acid encoding an Arc protein comprising a CA domain capable of forming a human or Drosophila Arc capsid.

8. A host cell comprising the human or Drosophila Arc capsid of any one of claims 1 to 5.

9. 9. The host cell of claim 7 or claim 8, wherein the host cell is a mammalian cell.

10. The host cell according to any one of claims 7 to 9, wherein the host cell is a neuron.

11. 9. The host cell of claim 7 or 8, wherein the host cell is a bacterial cell or a fungal cell.

12. A method for producing the human or Drosophila Arc capsid of any one of claims 1 to 5, or the extracellular vesicles or exosomes of claim 6, comprising introducing into a host cell in vitro (i) a recombinant nucleic acid encoding an Arc protein comprising a CA domain; (ii) a heterologous nucleic acid; or (iii) a combination thereof.

13. 6. A method for producing the human or Drosophila Arc capsid of any one of claims 1 to 5, comprising contacting an isolated Arc protein comprising a CA domain with a heterologous nucleic acid in vitro under conditions that promote assembly of an Arc capsid comprising the heterologous nucleic acid, wherein the conditions that promote assembly of the Arc capsid comprise a salt concentration of 100 mM to 500 mM.

14. 12. A method for delivering a nucleic acid to a target cell, the method comprising contacting the target cell in vitro with the human or Drosophila Arc capsid of any one of claims 1 to 5, the extracellular vesicle or exosome of claim 6, or the host cell of any one of claims 7 to 11.

Citation Information

Patent Citations

  • Adeno-associated virus variants and methods of using them

    JP2016526045A

  • Targeted extracellular vesicles comprising membrane proteins with engineered glycosylation sites

    US20170087087A1

  • Immediate early gene arc interacts with endocytic machinery and regulates the trafficking and function of presenilin

    WO2009042727A1