Transcriptional Regulatory Elements and Uses Thereof
Nucleic acid regulatory elements, combining an apolipoprotein E hepatic control region and desmin promoter, enhance GAA expression in Pompe disease tissues, addressing immune response challenges and improving therapeutic efficacy.
Patent Information
- Application Number
- JP2023188066
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-02-05
- Filing Date
- 2023-11-02
- Publication Date
- 2025-11-26
- Estimated Expiration
- 2039-02-05
AI Technical Summary
Current treatments for Pompe disease, such as enzyme replacement therapy and gene therapy, face challenges in achieving effective expression of the acid alpha-glucosidase enzyme in affected tissues while minimizing the immune response, limiting their clinical efficacy.
The use of nucleic acid regulatory elements, including an apolipoprotein E hepatic control region and desmin promoter, operably linked to a transgene like GAA, promotes targeted expression in muscle and liver cells, enhancing immune tolerance and therapeutic benefits.
This approach achieves therapeutic benefits by ameliorating lysosomal enzyme deficiency in Pompe disease while reducing the immune response, providing improved expression and functional outcomes in muscle and liver tissues.
Smart Images

Figure 0007776477000012 
Figure 0007776477000013 
Figure 0007776477000014
Abstract
Description
[Technical Field]
[0001] The present invention relates to the field of nucleic acid biotechnology and provides compositions and methods for enhancing the expression of a gene of interest. [Background technology]
[0002] Pompe disease is a lysosomal storage disorder caused by mutations in the acid α-glucosidase (GAA) gene, which encodes an enzyme involved in lysosomal glycogen processing. Patients with Pompe disease exhibit a clinical phenotype across various tissues, including intracellular glycogen accumulation, cardiac, respiratory, and skeletal muscle dysfunction, and central nervous system pathology. Some of these disorders are significantly ameliorated by enzyme replacement therapy (ERT) using recombinant human GAA (rhGAA). Clinical efficacy has been limited by the immunogenicity of hGAA ERT and the lack of uptake of rhGAA into some affected tissues. Gene therapy has also been investigated as a potential treatment paradigm for this disease. Development of gene therapy approaches for the treatment of Pompe disease has been hampered by the difficulty associated with achieving therapeutically effective expression of GAA in affected tissues while preventing the immune system from mounting an anti-GAA immune response. There remains a need for transcriptional regulatory elements that can achieve this balance. Summary of the Invention
[0003] The present invention provides compositions and methods for promoting expression of a gene of interest, such as acid alpha-glucosidase (GAA), in cells of specific tissues, including cells affected by Pompe disease. The compositions and methods described herein relate to nucleic acid regulatory elements that stimulate transcription of a transgene, such as GAA, in muscle cells (e.g., cardiomyocytes), liver cells, and / or cells of the central nervous system. The nucleic acid regulatory elements described herein can be operably linked to a transgene, such as GAA, and administered to a patient (e.g., a human patient) for the treatment of a lysosomal storage disorder, such as Pompe disease. Advantageously, the compositions and methods described herein can be used to promote expression of GAA in muscle cells and / or neurons affected by a lysosomal storage disorder, such as in patients with Pompe disease, and simultaneously stimulate expression in the liver, resulting in surprising therapeutic benefits. Without being limited by mechanism, the present disclosure is based, in part, on the discovery that the transcriptional regulatory elements described herein can (i) promote expression of a transgene in cells affected by a lysosomal storage disorder, ameliorating pathology, and (ii) stimulate expression in the liver, which plays a role in promoting immune tolerance. Thus, the compositions and methods described herein can be used to treat lysosomal storage disorders, such as Pompe disease, in a manner that alleviates the deleterious effects of lysosomal enzyme deficiency (e.g., GAA deficiency) in the patient while preventing or reducing an increased immune response to the enzyme introduced by gene therapy.
[0004] In a first aspect, the present invention features a nucleic acid regulatory element including a first segment operably linked to a second segment, wherein the first segment includes an apolipoprotein E hepatic control region (ApoE-HCR) or a functional portion thereof, and the second segment includes a desmin promoter or a functional portion thereof. The 3' end of the first segment can be operably linked to the 5' end of the second segment. In some embodiments, the 5' end of the first segment is operably linked to the 3' end of the second segment.
[0005] In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having a nucleic acid sequence at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO: 4.
[0006] In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having a nucleic acid sequence at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO: 1.
[0007] In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence at least 95% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO: 2.
[0008] In some embodiments, the first segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4. For example, the first segment can comprise the nucleic acid set forth in SEQ ID NO:4.
[0009] In some embodiments, the first segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1. For example, the first segment may have the nucleic acid sequence of SEQ ID NO: 1.
[0010] In some embodiments, the first segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. The first segment may have a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the first segment may have a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:2. For example, the first segment may have the nucleic acid sequence of SEQ ID NO:2.
[0011] In some embodiments, the first segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. The first segment may have a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:3. For example, the first segment may have the nucleic acid sequence of SEQ ID NO:3.
[0012] In some embodiments, the second segment comprises a 5' region having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the 5' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the 5' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 5. For example, the 5' region may have the nucleic acid sequence of SEQ ID NO: 5.
[0013] In some embodiments, the second segment may include a 3' region having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the 3' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the 3' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. For example, the 3' region may have the nucleic acid sequence of SEQ ID NO:6.
[0014] In some embodiments, the second segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the second segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the second segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. For example, the 3' region may have the nucleic acid sequence of SEQ ID NO:7.
[0015] In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 10. For example, the nucleic acid regulatory element may have the nucleic acid sequence of SEQ ID NO: 10.
[0016] In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 12. For example, the nucleic acid regulatory element may have the nucleic acid sequence of SEQ ID NO: 12.
[0017] In some embodiments, the nucleic acid regulatory element further comprises a third segment located 5' or 3' to the first and second segments, and the third segment can be operably linked to the first and second segments.
[0018] In some embodiments, the third segment comprises a promoter that stimulates expression of a transgene operably linked thereto in cells of the central nervous system, such as neurons, glial cells, or astrocytes, among others. In some embodiments, the third segment comprises a promoter such as a synapsin promoter, a glial fibrillary acidic protein (GFAP) promoter, a calcium / calmodulin-dependent protein kinase III promoter, a tubulin αI promoter, a microtubulin-associated protein IB (MAP) promoter, a phosphodiesterase II (PHII ... the promoter is selected from a promoter selected from a nucleotide sequence of a wild-type promoter locus, a nucleotide sequence of ...
[0019] In some embodiments, the third segment comprises a promoter that stimulates expression of a transgene operably linked thereto in a neuron, hi some embodiments, the third segment comprises a synapsin promoter, or a functional portion thereof.
[0020] In some embodiments, the third segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the third segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the third segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the third segment has the nucleic acid sequence of SEQ ID NO: 8.
[0021] In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the nucleic acid regulatory element has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 11. For example, the nucleic acid regulatory element may have the nucleic acid sequence of SEQ ID NO: 11.
[0022] In another aspect, the invention features a nucleic acid regulatory element including a first segment operably linked to a second segment, where the first segment includes a desmin promoter or a functional portion thereof, and the second segment includes a promoter or a functional portion thereof that stimulates expression of a transgene operably linked thereto in a cell of the central nervous system, such as a neuron, glial cell, or astrocyte. In some embodiments, the second segment comprises a promoter selected from a synapsin promoter, a GFAP promoter, a calcium / calmodulin-dependent protein kinase III promoter, a tubulin alpha I promoter, a MAP IB promoter, a neuron-specific enolase promoter, a platelet-derived growth factor beta chain promoter, a neurofilament light chain promoter, a neuron-specific VGF gene promoter, a NeuN promoter, an APC promoter, an Iba-1 promoter, and an HB9 promoter, or a variant thereof (e.g., a variant having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the nucleic acid sequence of the wild-type promoter locus and capable of stimulating transcription of a transgene operably linked thereto upon introduction into a cell of the central nervous system), or a functional portion thereof.
[0023] In some embodiments, the second segment comprises a promoter that stimulates expression of a transgene operably linked thereto in a neuron, hi some embodiments, the second segment comprises a synapsin promoter, or a functional portion thereof.
[0024] In some embodiments, the 3' end of a first segment is operably linked to the 5' end of a second segment, hi some embodiments, the 5' end of a first segment is operably linked to the 3' end of a second segment.
[0025] In some embodiments, the first segment comprises a 5' region having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the 5' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the 5' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 5. For example, the 5' region may have the nucleic acid sequence of SEQ ID NO: 5.
[0026] In some embodiments, the first segment comprises a 3' region having a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the 3' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the 3' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. For example, the 3' region may have the nucleic acid sequence of SEQ ID NO:6.
[0027] In some embodiments, the first segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. For example, the first segment may have the nucleic acid sequence of SEQ ID NO:7.
[0028] In some embodiments, the second segment has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the second segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the second segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the second segment has the nucleic acid sequence of SEQ ID NO: 8.
[0029] In another aspect, the present invention features a vector including a nucleic acid regulatory element of any of the aforementioned aspects or embodiments thereof. The nucleic acid regulatory element can be operably linked to a transgene and can induce expression of the transgene upon introduction of the vector into a cell (e.g., a mammalian cell, such as a human cell). The cell can be, for example, a muscle cell (e.g., a cardiac muscle cell or a skeletal muscle cell), a neuron, or a hepatocyte. In some embodiments, the transgene encodes a lysosomal enzyme such as GAA. In some embodiments, the vector is a viral vector such as an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, or vaccinia virus. In some embodiments, the viral vector is an AAV, e.g., an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrh74 serotype. The viral vector can be a pseudotyped AAV, e.g., recombinant AAV (rAAV)2 / 8 or rAAV2 / 9.
[0030] In another aspect, the present invention features a composition comprising a nucleic acid regulatory element of any of the above aspects or embodiments thereof. The composition can be, for example, a liposome, a vesicle, a synthetic vesicle, an exosome, a synthetic exosome, a dendrimer, or a nanoparticle. In the composition, the nucleic acid regulatory element can be operably linked to a transgene (e.g., a transgene encoding a lysosomal enzyme such as GAA).
[0031] In yet another aspect, the invention features a method of expressing a transgene in a cell by contacting the cell with a vector or composition of any of the preceding aspects or embodiments thereof for a time sufficient to simulate transcription of the transgene in the cell.
[0032] In another aspect, the invention features a method of treating a lysosomal storage disease, such as Pompe disease, in a patient (e.g., a mammalian patient, such as a human patient) in need of treatment by administering to the patient a therapeutically effective amount of a vector or composition described herein.
[0033] In yet another aspect, the invention features a kit that includes a vector or composition described herein. The kit can include, for example, a package insert instructing a user of the kit to contact the vector or composition with a cell (e.g., a mammalian cell, such as a human cell) and thereby express a transgene operably linked to a regulatory element.
[0034] definition As used herein, the term "about" refers to a value within 10% above or below the stated value.
[0035] As used herein, the term "ApoE-HCR enhancer" refers to the human apolipoprotein E hepatic regulatory region, the nucleic acid sequence of which is set forth in SEQ ID NO: 3, having at least 85% identity (e.g., 85%, 86%, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the nucleic acid sequence of SEQ ID NO: 3, and which promotes expression of a transgene in a cell (e.g., a mammalian cell, a human cell, or a eukaryotic cell such as a human hepatocyte) when the transgene is operably linked to the enhancer.
[0036] As used herein, the terms "conservative mutation," "conservative substitution," or "conservative amino acid substitution" refer to the substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric bulk. These properties are summarized for each of the 20 naturally occurring amino acids in Table 1 below.
[0037] [Table 1]
[0038] From this table, conservative amino acid families are contemplated to include, for example, (i) G, A, V, L, I, P, and M, (ii) D and E, (iii) C, S, and T, (iv) H, K, and R, (v) N and Q, and (vi) F, Y, and W. Thus, a conservative mutation or substitution is one that substitutes one amino acid with a member of the same amino acid family (e.g., substitution of Ser for Thr or Lys for Arg).
[0039] As used herein, the term "desmin promoter" refers to the nucleic acid set forth in SEQ ID NO: 7, as well as nucleic acids having at least 85% identity (e.g., 85%, 86%, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the nucleic acid sequence of SEQ ID NO: 7 and which promotes expression of a transgene in a cell (e.g., a mammalian cell, a human cell, or a eukaryotic cell such as a human hepatocyte) when the transgene is operably linked to an enhancer.
[0040] As used herein in connection with a transcriptional regulatory element, the term "functional portion" refers to a portion of a larger nucleic acid that retains the ability to stimulate transcription of a gene of interest in a target cell. For example, the apolipoprotein E hepatic control region (ApoE-HCR) is a 774-nucleotide enhancer, the sequence of which is set forth in SEQ ID NO:3. A portion of this locus comprising 193 nucleotides (the nucleic acid sequence of which is set forth in SEQ ID NO:1) can retain the transcriptional activation properties of the larger locus. Thus, the 193-nucleotide portion set forth in SEQ ID NO:1 is a "functional portion" of the ApoE-HCR locus. As a further example, another portion of the ApoE-HCR locus that can retain the transcriptional activation properties of the full-length enhancer is the 320-nucleotide segment set forth in SEQ ID NO:2. Thus, the 320-nucleotide portion set forth in SEQ ID NO:2 is a "functional portion" of the ApoE-HCR locus. As a further example, another portion of the ApoE-HCR locus that can retain the transcriptional activation properties of the full-length enhancer is the 50-nucleotide segment set forth in SEQ ID NO:4. Thus, the 50 nucleotide portion set forth in SEQ ID NO:4 is also a "functional portion" of the ApoE-HCR locus.
[0041] As used herein, the term "operably linked" refers to a first molecule bound to a second molecule, the molecules being positioned so that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single, contiguous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribable polynucleotide molecule of interest in a cell, the promoter is operably linked to the transcribable polynucleotide molecule. Additionally, two portions of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements can be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or can be operably linked to each other without any intervening nucleotides.
[0042] "Percent sequence identity (%)" to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps as necessary to achieve the maximum percent sequence identity.Alignment for determining percent nucleic acid or amino acid sequence identity can be achieved in various ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared.For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST. As an example, the percent sequence identity of a given nucleic acid or amino acid sequence A to, with, or compared to a given nucleic acid or amino acid sequence B (which may alternatively be expressed as a given nucleic acid or amino acid sequence A having a certain percent sequence identity to, with, or compared to a given nucleic acid or amino acid sequence B) is calculated as follows: 100 x (fraction X / Y). where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and Y is the total number of nucleic acids in B. It will be recognized that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not equal the percent amino acid sequence identity of B to A.
[0043] As used herein, the term "pharmaceutical composition" refers to a mixture containing therapeutic compounds that is administered to a subject, such as a mammal, e.g., a human, to prevent, treat, or control a particular disease or condition that the subject is suffering from or may be suffering from.
[0044] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without undue toxicity, irritation, allergic response, and other complications commensurate with a reasonable benefit / risk ratio.
[0045] As used herein, the term "sample" refers to a specimen isolated from a subject (e.g., blood, a blood component (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villus sample, or cells). The subject may be, for example, a patient suffering from a disease described herein, such as a lysosomal storage disorder (e.g., Pompe disease).
[0046] As used herein, the phrases "specifically bind" and "bind" refer to a binding reaction that determines the presence of a particular molecule, such as a polypeptide, in a heterogeneous population of polypeptides and other biomolecules, specifically recognized by a ligand, such as an antibody or antigen-binding fragment thereof. A ligand (e.g., a complementary polynucleotide) that specifically binds to a protein has, for example, a K of less than 100 nM. D For example, a ligand that specifically binds to a protein may have a K of up to 100 nM (e.g., 1 pM to 100 nM). D A ligand that does not exhibit specific binding to another molecule or domain thereof can bind to a protein with a K of greater than 100 nM (e.g., greater than 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1 μM, 100 μM, 500 μM, or 1 mM) for a particular molecule or domain thereof. DA variety of assay formats can be used to determine the affinity of a ligand for a specific protein. For example, solid-phase ELISA assays are routinely used to identify ligands that specifically bind to a target protein. For a description of assay formats and conditions that can be used to determine specific protein binding, see, for example, Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999).
[0047] As used herein, the terms "subject" and "patient" refer to an organism being treated for a particular disease or condition described herein (such as a lysosomal storage disorder, e.g., Pompe disease). Examples of subjects and patients include mammals, such as humans, undergoing treatment for a disease or condition described herein.
[0048] As used herein, the term "synapsin promoter" refers to the nucleic acid set forth in SEQ ID NO: 8, and variants thereof having at least 85% identity (e.g., 85%, 86%, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the nucleic acid sequence of SEQ ID NO: 8 and that promotes expression of a transgene in a cell (e.g., a mammalian cell, a human cell, or a eukaryotic cell such as a human hepatocyte) when the transgene is operably linked to an enhancer.
[0049] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that controls, at least in part, the transcription of a gene of interest. Transcriptional regulatory elements can include promoters, enhancers, and other nucleic acids that control or help control gene transcription (e.g., polyadenylation signals). Examples of transcriptional regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990).
[0050] As used herein, the terms "treat" or "treatment" refer to therapeutic treatments whose purpose is to prevent or slow (reduce) undesirable physiological changes or disorders, such as, inter alia, the progression of lysosomal storage disorders such as Pompe disease. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, whether detectable or undetectable, reduction in the extent of disease, stabilization of disease pathology (i.e., not worsening), delay or slowing of disease progression, remission or alleviation of disease pathology, and remission (whether partial or complete). In the context of a lysosomal storage disorder, such as Pompe disease, treatment of a patient may involve, for example, increasing the concentration of acid alpha-glucosidase (GAA) protein or nucleic acid (e.g., DNA or RNA, e.g., mRNA) encoding GAA, or increasing GAA activity (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400% or more). This may manifest as one or more detectable changes, such as 0%, 400%, 500%, 600%, 700%, 800%, 900%, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 500-fold, 1,000-fold, or more. The concentration of GAA protein can be determined using protein detection assays known in the art, including the ELISA assays described herein. The concentration of nucleic acids encoding GAA can be determined using nucleic acid detection assays (e.g., RNA-Seq assays) described herein. Exemplary protocols for detecting GAA protein and nucleic acids are provided in Example 1 below. Additionally, treatment of patients suffering from lysosomal storage disorders, such as Pompe disease, may manifest as improved muscle function (e.g., cardiac or skeletal muscle function) and improved muscle coordination in the patient. An exemplary procedure for measuring muscle function is described in Example 1 below.
[0051] As used herein, the term "vector" refers to a nucleic acid, e.g., DNA or RNA, that can function as a vehicle for delivery of a gene of interest into a cell (e.g., a mammalian cell, such as a human cell), e.g., for replication and / or expression. Exemplary vectors useful in conjunction with the compositions and methods described herein are plasmids, DNA vectors, RNA vectors, virions, or other suitable replicons (e.g., viral vectors). Various vectors have been developed for delivering polynucleotides encoding exogenous proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO 1994 / 11026, the disclosure of which is incorporated herein by reference. The expression vectors described herein contain polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of a mammalian cell. Particular vectors that can be used for expressing the transgenes described herein include plasmids containing regulatory sequences, such as promoter and enhancer regions, that direct gene transcription. Other useful vectors for expressing transgenes include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, an internal ribosome entry site (IRES), and a polyadenylation signal site to direct efficient transcription of the gene carried on the expression vector. The expression vectors described herein may also contain a polynucleotide encoding a marker for selection of cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin. [Brief explanation of the drawings]
[0052] [Figure 1]Figure 1 shows the arrangement of elements in various vectors. GAAco, human codon-optimized acid α-glucosidase gene (GAA); ITR, inverted terminal repeat; SD, splice donor; SA; splice acceptor. [Figure 2] Graph showing GAA activity assessed one month after administration in quadriceps muscle tissue from male (black circles) and female (grey triangles) mice in control and vector-treated mice administered at 1×10 vg / kg. [Figure 3] Graph showing hGAA transcripts measured in liver tissue from male (circles) and female (triangle) mice in control and vector-treated mice dosed at 1×10 vg / kg by RNA-seq analysis. The median expression level of endogenous mouse GAA is indicated by the horizontal line. [Figure 4] Graph showing GAA activity assessed 1 month after administration in liver tissue from male (black circles) and female (grey triangles) mice in control and vector-treated mice dosed at 1×10 vg / kg. [Figure 5] A and B are graphs showing anti-GAA antibody levels assessed 1 month after administration in serum from male (circles) and female (triangle) mice in control and vector-treated mice administered at 1 × 10 vg / kg (Fig. 5A) or 3 × 10 vg / kg (Fig. 5B). [Figure 6] A and B are graphs showing GAA activity assessed 1 month after administration in serum from male (circles) and female (triangle) mice in control and vector-treated mice administered at 1 x 1013 vg / kg (Fig. 6A) or 3 x 1013 vg / kg (Fig. 6B). [Figure 7] A and B are graphs showing the pathological scores (reported in Table 5) assessed 1 month after administration in quadriceps tissue sections from male (circles) and female (triangle) mice in control and vector-treated mice administered at 1 x 10 vg / kg (Fig. 7A) or 3 x 10 vg / kg (Fig. 7B). [Figure 8]Images from H&E- and PAS-stained sections of a representative mouse are shown, along with corresponding measurements demonstrating increased GAA activity, decreased glycogen levels, and muscle pathological repair in mice administered vectors containing an hGAA transgene driven by a hybrid promoter and a liver-targeted promoter. Representative control and vector-treated mice administered at 3 x 10 vg / kg were analyzed for GAA activity in serum and quadriceps muscle, as well as glycogen accumulation in quadriceps muscle. Glycogen accumulation scores were assessed from tissue sections from isopentane-frozen quadriceps muscle that were cut and stained with H&E and PAS, according to standard procedures. [Figure 9] Graph showing GAA activity assessed one month after administration in spinal cords from male (black circles) and female (grey triangles) mice in control and vector-treated mice dosed at 3×10 13 vg / kg. [Figure 10] 1 is a graph showing quantification of hGAA transcripts measured in spinal cord tissue from male (circles) and female (triangle) mice in control and vector-treated mice dosed at 1×10 vg / kg by RNA-seq analysis. The median expression level of endogenous mouse GAA is indicated by the horizontal line. [Figure 11] Graph showing the level of RNA expression in the liver and spinal cord at 1 month post-administration, as determined by RNA-Seq analysis, divided by the mean vector copy number (VCN) in liver or brain tissue to estimate the ratio of expression levels per vector in liver or CNS tissue, respectively. DETAILED DESCRIPTION OF THE INVENTION
[0053] Described herein are transcriptional regulatory elements that stimulate transcription of a gene of interest, such as a gene encoding a lysosomal enzyme (e.g., acid alpha-glucosidase (GAA)), in cells of a particular tissue. In particular, the transcriptional regulatory elements described herein can promote expression of a target lysosomal enzyme gene in tissues affected by a lysosomal storage disorder, such as Pompe disease. Such tissues include muscle tissue (e.g., cardiac and skeletal muscle tissue) and central nervous system tissue. The nucleic acid regulatory elements described herein can be operably linked to a transgene, such as GAA, and incorporated into a vehicle for administration to a patient (e.g., a human patient) for the treatment of a lysosomal storage disorder, such as Pompe disease. The delivery vehicle can be a vector, such as a viral vector described herein, or other agent for introducing a nucleic acid into a cell of interest (e.g., a liposome, vesicle, exosome, dendrimer, or nanoparticle described herein).
[0054] The present invention is based, in part, on the discovery that (i) transgene expression can be enhanced in cells affected by lysosomal storage disorders, resulting in amelioration of the disease state, and (ii) can be used to stimulate expression in the liver, which plays a role in promoting immune tolerance. Thus, the compositions and methods described herein can be used to treat lysosomal storage disorders, such as Pompe disease, to prevent or reduce immune responses to the introduced enzyme (e.g., GAA), while treating the deleterious effects of lysosomal enzyme deficiency (e.g., GAA deficiency) on muscle tissue.
[0055] The following sections describe transcriptional regulatory elements that exhibit the aforementioned advantageous properties. The following sections also describe various transgenes, viral vectors, and transfection reagents that can be used in conjunction with the transcriptional regulatory elements described herein, as well as methods of using the compositions described herein to treat various disorders.
[0056] Transcriptional regulatory elements Transcriptional regulatory elements that can be used in conjunction with the compositions and methods described herein can include various portions operably linked to each other. For example, transcriptional regulatory elements described herein can include the apolipoprotein E hepatic control region (ApoE-HCR) as set forth in SEQ ID NO:3, or a functional portion thereof. An exemplary functional portion of ApoE-HCR is the 320-nucleotide portion set forth in SEQ ID NO:2 described in Dang et al., J. Biol. Chem. 270:22577-22585 (1995), the disclosure of which is incorporated herein by reference as it relates to the ApoE-HCR locus and its functional portions. Another example of an ApoE-HCR nucleic acid that can be used in conjunction with the compositions and methods described herein is the 193-nucleotide segment of ApoE-HCR, the nucleic acid sequence of which is set forth in SEQ ID NO:1. A further example of an ApoE-HCR nucleic acid that can be used in conjunction with the compositions and methods described herein is the 50-nucleotide segment set forth in SEQ ID NO:4. Additional nucleic acid regulatory elements useful in conjunction with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) with the above-described nucleic acid sequences.
[0057] Additionally or alternatively, the transcriptional regulatory element described herein can comprise a desmin promoter or a functional portion thereof. For example, the regulatory element can comprise a desmin promoter comprising nucleic acids −984 to −644 of the human desmin locus relative to the desmin transcription start site. The nucleic acid sequence of this construct is set forth in SEQ ID NO: 5. The regulatory element can comprise a desmin promoter comprising nucleic acids −269 to +76 of the human desmin locus relative to the desmin transcription start site. The nucleic acid sequence of this construct is set forth in SEQ ID NO: 6. The regulatory element can comprise the nucleic acid of SEQ ID NO: 5 fused to the nucleic acid of SEQ ID NO: 6, without intervening nucleic acids, to form a desmin promoter comprising nucleotides −984 to −644 and nucleotides −269 to +76 of the human desmin locus relative to the desmin transcription start site. The nucleic acid sequence of this regulatory element is set forth in SEQ ID NO: 7. Additional nucleic acid regulatory elements useful in conjunction with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.
[0058] Transcriptional regulatory elements that can be used in conjunction with the compositions and methods described herein include, among others, promoters that stimulate expression of a transgene operably linked thereto in cells of the central nervous system, such as neurons, glial cells, or astrocytes. Examples of such promoters include the synapsin promoter, the glial fibrillary acidic protein (GFAP) promoter, the calcium / calmodulin-dependent protein kinase III promoter, the tubulin αI promoter, the microtubulin-associated protein IB (MAP) promoter, and the ATPase inhibitor ... IB) promoter, neuron-specific enolase promoter, platelet-derived growth factor beta chain promoter, neurofilament light chain promoter, neuron-specific VGF gene promoter, neuronal nuclear (NeuN) promoter, adenomatous polyposis coli (APC) promoter, ionized calcium-binding adaptor molecule 1 (Iba-1), and homeobox protein 9 (HB9) promoter, or variants thereof (e.g., variants having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the nucleic acid sequence of the wild-type promoter locus and capable of stimulating transcription of a transgene operably linked thereto upon introduction into a cell of the central nervous system), or functional portions thereof.
[0059] For example, a transcriptional regulatory element that can be used in conjunction with the compositions and methods described herein can include a synapsin promoter or a functional portion thereof. An exemplary regulatory element containing the synapsin promoter region is set forth in SEQ ID NO: 8. This construct includes nucleotide -465 to nucleotide -90 of the human synapsin locus relative to the synapsin transcription start site. Additional nucleic acid regulatory elements useful in conjunction with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity to this nucleic acid sequence (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity).
[0060] The aforementioned nucleic acid regulatory elements are summarized in Table 2 below.
[0061] [Table 2] JPEG0007776477000003.jpg249157JPEG0007776477000004.jpg243149JPEG0007776477000005.jpg148156
[0062] In addition to the regulatory elements described above, regulatory elements described herein include those formed by combining an ApoE-HCR element, or a functional portion thereof, with a desmin promoter and / or a synapsin promoter, or a functional portion thereof. For example, regulatory elements useful in conjunction with the compositions and methods described herein include those comprising the 193-nucleotide segment of ApoE-HCR set forth in SEQ ID NO: 1 operably linked to a desmin promoter, or a functional portion thereof. A functional portion of the desmin promoter can be, for example, a nucleic acid spanning nucleotides -984 to -644 relative to the desmin transcription start site, or a nucleic acid spanning nucleotides -269 to +76 relative to the desmin transcription start site. In some embodiments, an ApoE-HCR element, or a functional portion thereof, is operably linked to a desmin promoter comprising nucleotides -984 to -644 and nucleotides -269 to +76 of the human desmin locus, relative to the desmin transcription start site. The transcriptional regulatory elements described herein can also comprise a synapsin promoter, or a functional portion thereof, in combination with an ApoE-HCR and / or desmin regulatory element.
[0063] Exemplary combinations of transcriptional regulatory elements are shown in Table 3 below.
[0064] [Table 3] JPEG0007776477000007.jpg254156JPEG0007776477000008.jpg253157JPEG0007776477000009.jpg75157
[0065] Additional nucleic acid regulatory elements useful in conjunction with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the nucleic acid sequences set forth in Table 3.
[0066] Methods for delivery of exogenous nucleic acids into target cells Transfection technology Techniques that can be used to introduce transgenes, such as transgenes operably linked to the transcriptional regulatory elements described herein, into target cells are known in the art. For example, electroporation can be used to permeabilize mammalian cells (e.g., human target cells) by applying an electrostatic potential to the target cells. Mammalian cells, such as human cells, exposed to an external electric field in this manner are then susceptible to the uptake of exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. A similar technique, Nucleofection™, utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and protocols useful for carrying out this technique are described in detail, for example, in Distler et al., Experimental Dermatology 14:315 (2005), and US 2010 / 0317114, the disclosures of each of which are incorporated herein by reference.
[0067] Additional techniques useful for transfection of target cells include squeezeporation. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores formed in response to applied stress. This technique is advantageous in that no vector is required to deliver nucleic acid to cells, such as human target cells. Squeezporation is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the disclosure of which is incorporated herein by reference.
[0068] Lipofection is another technique useful for transfecting target cells. This method involves loading nucleic acid into liposomes, which often present cationic functional groups, such as quaternary amines or protonated amines, toward the exterior of the liposome. Because cell membranes are anionic, this promotes electrostatic interactions between liposomes and cells, ultimately leading to the uptake of exogenous nucleic acid, for example, by direct fusion of liposomes with cell membranes or by endocytosis of the complex. Lipofection is described in detail, for example, in U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. A similar technique that utilizes ionic interactions with cell membranes to induce the uptake of exogenous nucleic acid involves contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules that associate with polynucleotides to impart a positive charge favorable for interaction with cell membranes are activated dendrimers (e.g., as described in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference) and diethylaminoethyl (DEAE)-dextran, the use of which as transfection agents is described in detail, for example, in Gulick et al., Current Protocols in Molecular Biology 40:1:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, as this method utilizes the application of a magnetic field to induce nucleic acid uptake. This technology is described in detail, for example, in US2010 / 0227406, the disclosure of which is incorporated herein by reference.
[0069] Another useful tool for inducing the uptake of exogenous nucleic acid by target cells is laser infection, which is a technique that involves exposing cells to electromagnetic radiation of a specific wavelength, so as to gently permeabilize cells and allow polynucleotides to penetrate the cell membrane.This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.
[0070] Microvesicles are another vehicle that can potentially be used to modify the genome of target cells according to the methods described herein.For example, to prepare the genome of a cell for covalently incorporating a target polynucleotide, such as a gene or regulatory sequence, microvesicles induced by the co-overexpression of glycoprotein VSV-G and, for example, a genome-modifying protein, such as a nuclease, can be used to efficiently deliver a protein that subsequently catalyzes the site-specific cleavage of endogenous polynucleotide sequences into cells.The use of such vesicles, also known as gesicles, for the genetic modification of eukaryotic cells is described in detail, for example, in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [abstract]. In: Methylation changes in early embryonic genes in cancer [abstract], in: Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; 2015 May 13, Abstract No. 122.
[0071] Targeted gene incorporation using gene editing technology In addition to the above, various tools have been developed that can be used to integrate a gene of interest into target cells, such as human cells. One such method that can be used to integrate a polynucleotide encoding a target gene into a target cell involves the use of transposons. A transposon is a polynucleotide that encodes a transposase enzyme and contains a polynucleotide sequence or gene of interest flanked by 5' and 3' excision sites. Once the transposon is delivered into a cell, expression of the transposase gene begins, producing an active enzyme that excises the gene of interest from the transposon. This activity is mediated by the transposase's site-specific recognition of transposon excision sites. In some cases, these excision sites can be terminal repeats or inverted terminal repeats. Once excised from the transposon, the gene of interest can be integrated into the mammalian cell genome by transposase-catalyzed cleavage of similar excision sites present in the nuclear genome of mammalian cells. This inserts the gene of interest into the complementary excision site of the excised nuclear DNA, and the integration process is then completed by covalent phosphodiester linkage of the gene of interest to the DNA of the mammalian cell genome. In certain cases, the transposon may be a retrotransposon, in which the gene encoding the target gene is first transcribed into an RNA product and then reverse-transcribed into DNA before being integrated into the mammalian cell genome. Exemplary transposon systems include the piggybac transposon (described in detail, e.g., in WO2010 / 085699) and the sleeping beauty transposon (described in detail, e.g., in US2005 / 0112764), the disclosures of each of which are incorporated herein by reference as they relate to transposons for use in gene delivery to cells of interest.
[0072] Another tool for integrating target genes into target cell genomes is the clustered regularly interspaced short palindromic repeats (CRISPR) / Cas system, a system that originally evolved as an adaptive defense mechanism for bacteria and archaea against viral infection. The CRISPR / Cas system comprises a palindromic repeat sequence within plasmid DNA and an associated Cas9 nuclease. This set of DNA and proteins first integrates foreign DNA into the CRISPR locus, thereby inducing site-specific DNA cleavage of the target sequence. Polynucleotides containing these foreign sequences and the repeat spacer element of the CRISPR locus are then transcribed in the host cell to generate guide RNAs, which can then anneal to the target sequence and localize the Cas9 nuclease to this site. In this way, highly site-specific Cas9-mediated DNA cleavage can occur in foreign polynucleotides because the interaction that brings Cas9 into proximity with the target DNA molecule is governed by RNA:DNA hybridization. As a result, CRISPR / Cas systems can be designed to cleave any target DNA molecule of interest. This technique has been utilized to edit eukaryotic genomes (Hwang et al., Nature Biotechnology 31:227 (2013)) and can be used as an efficient means of site-specifically editing a target cell genome to integrate a gene encoding a target gene after DNA cleavage. The use of CRISPR / Cas to regulate gene expression is described, for example, in U.S. Patent No. 8,697,359, the disclosure of which is incorporated herein by reference as it relates to the use of CRISPR / Cas systems for genome editing. Alternative methods for site-specific cleavage of genomic DNA in target cells followed by integration of a gene of interest include the use of zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Unlike CRISPR / Cas systems, these enzymes do not contain guide polynucleotides to localize to specific target sequences. Instead, target specificity is controlled by the DNA-binding domain within these enzymes.The use of ZFNs and TALENs in genome editing applications is described, for example, in Urnov et al., Nature Reviews Genetics 11:636 (2010) and Joung et al., Nature Reviews Molecular Cell Biology 14:49 (2013), the disclosures of each of which are incorporated by reference herein as they relate to compositions and methods for genome editing.
[0073] Further genome editing techniques that can be used to integrate a polynucleotide encoding a target gene into the genome of a target cell include the use of ARCUS™ meganuclease, which can be rationally designed to site-specifically cleave genomic DNA. Considering the defined structure-activity relationship established for such enzymes, it is advantageous to use these enzymes to integrate a gene encoding a target gene into the genome of a mammalian cell. Single-chain meganucleases can be modified at certain amino acid positions to create nucleases that selectively cleave DNA at desired locations, allowing the target gene to site-specifically integrate into the nuclear DNA of a target cell. These single-chain nucleases are extensively described, for example, in U.S. Patent No. 8,021,867 and U.S. Patent No. 8,445,251, the disclosures of which are incorporated herein by reference for their respective related compositions and methods for genome editing.
[0074] Vectors for delivery of exogenous nucleic acids to target cells Viral vectors for nucleic acid delivery Viral genomes provide a rich source of vectors that can be used to efficiently deliver genes of interest into the genomes of target cells (e.g., mammalian cells, such as human cells). Because the polynucleotides contained within viral genomes are typically integrated into the genomes of target cells by generalized or specialized transduction, these genomes are particularly useful vectors for gene delivery. These processes occur as part of the natural viral replication cycle and do not require additional proteins or reagents to induce gene integration. Examples of viral vectors include AAV, retroviruses, adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai), positive-strand RNA viruses such as picornaviruses and alphaviruses, and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses useful for delivering polynucleotides encoding the antibody light and heavy chains or antibody fragments of the invention include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma virus, mammalian type C, type B, and type D viruses, the HTLV-BLV complex, lentivirus, and spumavirus (Coffin, J.M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B.N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).Other examples include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor viruses, bovine leukemia viruses, feline leukemia viruses, feline sarcoma viruses, avian leukemia viruses, human T-cell leukemia viruses, baboon endogenous viruses, gibbon leukemia viruses, Mason-Pfizer monkey viruses, simian immunodeficiency viruses, simian sarcoma viruses, Rous sarcoma viruses, and lentiviruses. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which is incorporated herein by reference as it relates to viral vectors for use in gene therapy.
[0075] AAV vectors for nucleic acid delivery In some embodiments, the nucleic acids of the compositions and methods described herein are incorporated into rAAV vectors and / or virions to facilitate their introduction into cells. rAAV vectors useful in the present invention are recombinant nucleic acid constructs containing (1) a transgene to be expressed (e.g., a polynucleotide encoding a GAA protein) and (2) viral nucleic acid that facilitates the integration and expression of a heterologous gene. The viral nucleic acid may include those AAV sequences required in cis for DNA replication and packaging into virions (e.g., functional ITRs). In a typical application, the transgene encodes GAA, which is useful for correcting GAA deficiency in patients suffering from lysosomal storage disorders such as Pompe disease. Such rAAV vectors may also contain a marker or reporter gene. Useful rAAV vectors have one or more AAV WT genes deleted in whole or in part, but retain functional flanking ITR sequences. The AAV ITRs may be from any serotype (e.g., from serotype 2) that is suitable for the particular application. Methods for using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279-291 (2000) and Monahan and Samulski, Gene Delivery 7:24-30 (2000), the disclosures of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.
[0076] The nucleic acids and vectors described herein can be incorporated into rAAV virions to facilitate the introduction of the nucleic acid or vector into cells. The AAV capsid protein constitutes the outer, non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, required for virion assembly. Construction of rAAV virions is described, for example, in U.S. Pat. Nos. 5,173,414, 5,139,941, 5,863,541, 5,869,305, 6,057,152, and 6,376,237, as well as Rabinowitz et al., J. Virol. 76:791-801 (2002) and Bowles et al., J. Virol. 77:423-432 (2003), the disclosures of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.
[0077] rAAV virions useful in conjunction with the compositions and methods described herein include those derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, and 9. For targeting muscle cells, rAAV virions containing at least one serotype 1 capsid protein may be particularly useful. rAAV virions containing at least one serotype 6 capsid protein may also be particularly useful, as serotype 6 capsid protein is structurally similar to serotype 1 capsid protein and is expected to result in high GAA expression in muscle cells. rAAV serotype 9 has also been shown to be an efficient transducer of muscle cells. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619-623 (2000), Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428-3432 (2000), Xiao et al., J. Virol. 72:2224-2232 (1998), Halbert et al., J. Virol. 74:1524-1532 (2000), Halbert et al., J. Virol. 75:6615-6624 (2001), and Auricchio et al., Hum. Molec. Genet. 10:3075-3081 (2001), the disclosures of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.
[0078] Pseudotyped rAAV vectors are also useful in conjunction with the compositions and methods described herein. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). For example, a representative pseudotyped vector is an AAV8 or AAV9 vector encoding a therapeutic protein pseudotyped with a capsid gene from AAV serotype 2. Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662-7671 (2001), Halbert et al., J. Virol. 74:1524-1532 (2000), Zolotukhin et al., Methods, 28:158-167 (2002), and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001).
[0079] AAV virions with mutations in the virion capsid can be used to infect specific cell types more efficiently than non-mutated capsid virions. For example, suitable AAV mutants can have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635-45 (2000). Other rAAV virions that can be used in the methods of the present invention include capsid hybrids generated by molecular breeding of viruses and exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436-439 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423-428 (2001).
[0080] Treatment methods Pompe disease Pompe disease (also known as glycogen storage disease type II or GSD II) is caused by a deficiency of the lysosomal enzyme GAA. This disease is an inborn error of metabolism in which GAA deficiency ultimately leads to glycogen accumulation in all tissues, particularly striated muscle cells. In addition, the effects of glycogen accumulation within the central nervous system and its effect on skeletal muscle function have been documented.
[0081] The disorder has three known clinical forms: infantile, juvenile, and adult. Infantile Pompe disease develops shortly after birth and manifests with progressive muscle weakness and heart failure. The infantile form of Pompe disease is also characterized by the rapid onset of cardiomyopathy, with patients often presenting with myopathy and neurological deficits that typically lead to death in the first year of life. Symptoms in adult and juvenile patients develop later in life and primarily involve skeletal muscle and neurons. Patients with this form of Pompe disease ultimately die from respiratory failure. Exceptionally, patients can survive for more than 60 years. There is a correlation between disease severity and residual acid α-glucosidase activity, which is 10-20% of normal in late-onset disease and less than 2% in early-onset disease.
[0082] Human acid α-glucosidase The amino acid sequence of wild-type GAA is shown below in SEQ ID NO:14. (SEQ ID NO: 14)
[0083] Exemplary genes encoding GAA polypeptides that can be used in conjunction with the compositions and methods described herein include a gene encoding the wild-type GAA protein set forth in SEQ ID NO: 14, as well as functional GAA enzymes that are at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the amino acid sequence of SEQ ID NO: 14. Genes encoding GAA polypeptides that can be used in conjunction with the compositions and methods described herein further include those with one or more amino acid substitutions, such as one or more conservative amino acid substitutions, relative to the amino acid sequence set forth in SEQ ID NO: 14. For example, GAA polypeptides that can be used in conjunction with the compositions and methods described herein include those having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or more conservative amino acid substitutions relative to the amino acid sequence of SEQ ID NO:14.
[0084] The transcriptional regulatory elements described herein can be operably linked to a transgene, such as GAA, that is deficient in patients with lysosomal storage disorders, such as those suffering from Pompe disease. Constructs containing a lysosomal enzyme under the transcriptional control of the regulatory elements described herein can be incorporated into a vector (or other transfection agent described herein) and administered to a patient to treat the lysosomal storage disorder. Advantageously, the transcriptional regulatory elements described herein can promote transcription of a gene encoding a defective lysosomal enzyme (e.g., GAA) in disease-affected cells, such as muscle cells and cells of the central nervous system. Furthermore, the regulatory elements described herein convey the additional benefit of reducing or eliminating immune responses that may otherwise accompany the introduction of a gene encoding an enzyme that a patient is deficient in. The advantageous properties of the transcriptional regulatory elements described herein are reported in more detail in Example 1, below.
[0085] Pharmaceutical Compositions, Routes of Administration, and Unit Doses The transcriptional regulatory elements described herein can be operably linked to a transgene, such as a lysosomal enzyme (e.g., GAA), and incorporated into a vehicle for administration to a patient, such as a human patient suffering from a lysosomal storage disorder (e.g., Pompe disease). Pharmaceutical compositions containing a vector, such as a viral vector, containing the transcriptional regulatory elements described herein operably linked to a therapeutic transgene can be prepared using methods known in the art. For example, such compositions can be prepared in the desired form, for example, in the form of a lyophilized formulation or aqueous solution, using, for example, physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980), incorporated herein by reference).
[0086] Viral vectors, such as the AAV vectors described herein and others, comprising a transcriptional regulatory element operably linked to a therapeutic transgene can be administered to a patient (e.g., a human patient) by a variety of routes of administration. The route of administration can vary depending on the onset and severity of the disease and can include, for example, intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, transdermal, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. Intravascular administration includes delivery to the patient's vascular system. In some embodiments, administration is into a blood vessel considered intravascular (intravenous), while in some administrations, administration is into a blood vessel considered arterial (intraarterial). Veins include, but are not limited to, the internal jugular vein, peripheral veins, coronary veins, hepatic veins, portal vein, saphenous vein, pulmonary veins, superior vena cava, inferior vena cava, gastric vein, splenic vein, inferior mesenteric vein, superior mesenteric vein, cephalic vein, and / or femoral vein. Arteries include, but are not limited to, coronary arteries, pulmonary arteries, brachial arteries, internal carotid arteries, aortic arches, femoral arteries, peripheral arteries, and / or ciliary arteries. It is contemplated that delivery may be via or to arterioles or capillaries.
[0087] Treatment regimens vary and often depend on the severity of the disease and the age, weight, and sex of the patient. Treatment may include the administration of vectors (e.g., viral vectors) or other agents described herein as useful for introducing a gene of interest into target cells in various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as the specific route of administration and formulation, is within the skill of those skilled in the clinical arts. A unit dose need not be administered as a single injection, but may include continuous infusions over a set period of time. Unit doses of the viral vectors described herein may conveniently be described in terms of plaque-forming units (pfu) of the viral construct. A unit dose may be, for example, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 From 10 13 Additionally or alternatively, depending on the virus type and achievable titer, it can range from 1 to 100, 10 to 50, 100 to 1,000, or up to about or at least about 1 x 10 pfu. 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , or 1 × 10 15 or more infectious viral particles (vp), including all values and ranges therebetween.
[0088] Mixtures of the nucleic acids and viral vectors described herein can be prepared in water, suitably mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. These preparations may contain a preservative to prevent the growth of microorganisms under ordinary conditions of storage and use. Pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (described in U.S. Pat. No. 5,466,468, the disclosure of which is incorporated herein by reference). In all cases, the formulations can be sterile and fluid to the extent that easy syringability exists. The formulations can be stable under the conditions of manufacture and storage and can be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0089] For example, solutions containing the pharmaceutical compositions described herein may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that can be used will be known to those skilled in the art in light of the present disclosure. For example, one dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution or injected at the intended injection site. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. In any event, the person responsible for administration will determine the appropriate dosage for each individual subject. Furthermore, for human administration, preparations must meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biologics Evaluation and Control. [Example]
[0090] The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be merely illustrative and are not intended to limit the scope of what the inventors regard as their invention.
[0091] Example 1. Establishing optimal tissue expression for acid α-glucosidase gene delivery in Pompe disease patients the purpose Several adeno-associated virus (AAV) vectors were designed to target expression in different tissues (e.g., muscle and liver) over a range of doses in a mouse model of Pompe disease. We compared the results of six AAV vectors designed to induce expression of the human acid alpha-glucosidase gene (hGAA) in different tissues and / or tissue combinations over a range of doses after systemic administration in the Pompe mouse model. A vector with an optimal multi-tissue expression profile was selected for translation into clinical trials of systemically administered AAV-GAA for the treatment of Pompe disease.
[0092] In this study, we examined vector dose and target tissue expression profiles to determine how they affected various endpoints in this model that are relevant to Pompe disease in patients, including respiratory, cardiac, and skeletal muscle function, as well as tissue GAA activity and glycogen accumulation. The findings described herein support the clinical translation of optimized hGAA vectors for AAV gene therapy.
[0093] Materials and Methods Vectors and Vector Generation Vector 2 (AAV9-Des-hGAAco), Vector 3 (AAV8-LDes-hGAAco), Vector 4 (AAV8-LNDes-hGAAco), Vector 5 (AAV8-LDes2-hGAAco), and Vector 6 (AAV8-Des3-hGAAco) were cloned via standard molecular biology techniques and produced using a scaled production method based on two-plasmid transient transfection into mammalian cells. The genomic titer of each vector was determined by ddPCR. Candidate vectors are summarized in Table 4 below. A schematic diagram of the general organization of the inverted terminal repeat (ITR) regions of the constructs is shown in Figure 1.
[0094] [Table 4]
[0095] Transcriptional regulatory elements The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 1 comprises, from 5' to 3', a 193 nucleotide segment of ApoE-HCR (shown in SEQ ID NO: 1) operably linked to the human alpha-1 antitrypsin promoter (shown in SEQ ID NO: 13 below). The nucleic acid sequence of the combined ApoE-HCR / human alpha-1 antitrypsin regulatory element used in this construct is shown in SEQ ID NO: 9. CCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTCCCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACCTCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGTGGTTTAGGTAGTGTGAGAGGGGAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGT ACACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGcACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAATC (SEQ ID NO: 9) GAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTACACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGcACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGA CCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAATC (SEQ ID NO: 13)
[0096] The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 2 is a truncated desmin promoter. This truncated desmin promoter comprises a 5' region having the nucleic acid sequence of SEQ ID NO: 5 (including nucleotides -984 to -644 relative to the desmin transcription start site) fused to a 3' region having the nucleic acid sequence of SEQ ID NO: 6 (including nucleotides -269 to +70 relative to the desmin transcription start site). The nucleic acid sequence of the transcriptional regulatory element used in this construct is set forth in SEQ ID NO: 7.
[0097] The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 3 comprises, from 5' to 3', a 193-nucleotide segment of ApoE-HCR (set forth in SEQ ID NO: 1) operably linked to a truncated desmin promoter. This truncated desmin promoter comprises a 5' region having the nucleic acid sequence of SEQ ID NO: 5 (including nucleotides -984 to -644 relative to the desmin transcription start site) fused to a 3' region having the nucleic acid sequence of SEQ ID NO: 6 (including nucleotides -269 to +70 relative to the desmin transcription start site). The nucleic acid sequence of the combined desmin promoter used in this construct is set forth in SEQ ID NO: 7. The nucleic acid sequence of the combined ApoE-HCR / desmin transcriptional regulatory element used in this construct is set forth in SEQ ID NO: 10.
[0098] The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 4 comprises, from 5' to 3', a synapsin promoter operably linked to a 193-nucleotide segment of ApoE-HCR, operably linked to a truncated desmin promoter. The nucleic acid sequence of the synapsin promoter used in this construct is set forth in SEQ ID NO:8 (comprising nucleotides -465 to -90 relative to the synapsin transcription start site). The nucleic acid sequence of the segment of the ApoE-HCR region used in this construct is set forth in SEQ ID NO:1. The truncated desmin promoter used in this construct comprises a 5' region having the nucleic acid sequence of SEQ ID NO:5 (comprising nucleotides -984 to -644 relative to the desmin transcription start site) fused to a 3' region having the nucleic acid sequence of SEQ ID NO:6 (comprising nucleotides -269 to +70 relative to the desmin transcription start site). The nucleic acid sequence of the combined desmin promoter used in this construct is set forth in SEQ ID NO:7. The nucleic acid sequence of the combined synapsin / ApoE-HCR / desmin transcriptional regulatory element used in this construct is set forth in SEQ ID NO:11.
[0099] The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 5 comprises, from 5' to 3', a 50-nucleotide segment of ApoE-HCR (set forth in SEQ ID NO:4) operably linked to a truncated desmin promoter. This truncated desmin promoter comprises a 5' region having the nucleic acid sequence of SEQ ID NO:5 (including nucleotides -984 to -644 relative to the desmin transcription start site) fused to a 3' region having the nucleic acid sequence of SEQ ID NO:6 (including nucleotides -269 to +70 relative to the desmin transcription start site). The nucleic acid sequence of the combined desmin promoter used in this construct is set forth in SEQ ID NO:7. The nucleic acid sequence of the combined ApoE-HCR / desmin transcriptional regulatory element used in this construct is set forth in SEQ ID NO:12.
[0100] The nucleic acid sequence of the transcriptional regulatory element operably linked to the GAA transgene in Vector No. 6 is a truncated desmin promoter. This truncated desmin promoter comprises a 5' region having the nucleic acid sequence of SEQ ID NO: 5 (including nucleotides -984 to -644 relative to the desmin transcription start site) fused to a 3' region having the nucleic acid sequence of SEQ ID NO: 6 (including nucleotides -269 to +70 relative to the desmin transcription start site). The nucleic acid sequence of the transcriptional regulatory element used in this construct is set forth in SEQ ID NO: 7.
[0101] In vivo studies All animal procedures were approved by the Institutional Animal Care and Use Committee of Jackson Laboratories, Bar Harbor, ME, and were performed at Jackson Laboratories, Bar Harbor, ME. wt Mouse and B6.129-Gaa tm1Rabn Homozygous mutant mice were obtained from The Jackson Laboratory. AAV lots were prepared for injection by dilution with vehicle, and doses were administered by a single intravenous injection of vector or vehicle, at a dose of 3 × 10 as indicated, according to mouse weight measurements. 12vg / kg, 1 × 10 13 vg / kg, 3 × 10 13 vg / kg, or 1 × 10 14 The mice were administered 100 mg / kg of riboflavin. Clinical and mortality observations were conducted daily from dosing until the end of the study. After 4 or 12 weeks of dosing, the mice were sacrificed and necropsied. Tissues were processed and sent to a third-party contract research organization for further analysis.
[0102] GAA activity Alpha-glucosidase (GAA) activity was assessed in mouse tissues (e.g., liver, heart, brain, and spine) and serum. Serum or tissue homogenates were incubated with the fluorogenic substrate 4-methylumbelliferyl alpha-D-glucopyranoside (4-MUG), which is hydrolyzed by GAA to produce the hydrolysis product 4-methylumbelliferone (4-MU). 4-MU was detected using a fluorescent plate reader, and the enzyme activity of the samples was quantified using a 4-MU standard curve.
[0103] Anti-GAA antibody analysis Maxisorp 96-well plates (Thermo Fisher Scientific) were coated with recombinant hGAA protein (R&D Systems). After blocking, plasma samples diluted 1:200 were added to the plates and incubated at 37°C for 1 hour. An anti-mouse secondary antibody conjugated to HRP was used for detection. A fluorogenic substrate was then added to the wells, and light intensity was assessed using a plate reader.
[0104] RNA-Seq analysis Total RNA was isolated from tissues, and sequencing libraries were prepared using standard Illumina strand-specific protocols with polyA selection. Libraries were indexed per sample, pooled by tissue type, and sequenced on an Illumina HiSeq across four lanes (2 × 150 bp reads). Adapter sequences were first trimmed from FASTQ files using Skewer, and then hGAA-containing transcript abundance was quantified from the trimmed FASTQ files using Salmon (taking into account GC bias and strand information). Finally, transcript counts were normalized to library size using the DESeq2 package from Bioconductor.
[0105] Pathological evaluation Tissues frozen in isopentane were sectioned and stained with H&E and PAS according to standard procedures. Sections were then blindly analyzed by trained pathologists and scored according to the following annotations (see also Table 5): 1. normal; 2. small and large glycogen aggregates present in 10–49% of fibers; 3. small and large glycogen aggregates present in 50–90% of fibers; 4. small glycogen aggregates present in >90% of fibers and large glycogen aggregates present in only rare fibers; 5. small glycogen aggregates present in >90% of fibers and large glycogen aggregates present in >30% of fibers.
[0106] result Hybrid promoter regulates the balance of GAA expression in liver and muscle GAA activity was assessed in muscle and liver tissue. To determine GAA activity in muscle, 1 × 10 13 GAA activity in quadriceps muscle tissue from male (black circles) and female (gray triangles) mice treated with control and vector administered at 1 × 10 ng / kg was assessed 1 month after administration (see Materials and Methods) (Fig. 2). To determine GAA activity in liver tissue, 1 × 10 ng / kg of GAA was administered. 13GAA activity was assessed 1 month after administration in liver tissue from male (black circles) and female (gray triangles) mice in control and vector-treated mice administered at 1000 mg / kg (Figure 4). Additionally, hGAA transcripts were detected at 1 × 10 ng / mL by RNA-Seq analysis. 13 The median expression level of endogenous mouse GAA was measured in liver tissue from male (circles) and female (triangles) mice in control and vector-treated mice administered at 100 mg / kg (Figure 3). The median expression level of endogenous mouse GAA is indicated by the horizontal line.
[0107] These results indicate that the hybrid promoter constructs were expressed in both liver and muscle. GAA activity was preserved in the quadriceps muscle with the muscle-targeted hybrid promoter constructs. Consistent with the engineered liver-enhanced promoter design, Vector 1 and Hybrid Vectors 3 and 4 showed the highest levels of expression and activity in the liver.
[0108] The effect of hepatic expression on antibody reactivity to hGAA was also assessed. Anti-GAA antibody levels were measured in the 1 × 10 13 vg / kg (Figure 5A) or 3 × 10 13 GAA activity was assessed 1 month after administration in serum from male (black circles) and female (grey triangles) mice in control and vector-treated mice administered 1 x 10 ng / kg (Figure 5B). 13 vg / kg (Figure 6A) or 3 × 10 13 Sera from male (black circles) and female (grey triangles) mice in control and vector-treated mice were assessed 1 month after administration of 1000 mg / kg (Figure 6B).
[0109] Increased hepatic expression reduced antibody reactivity to hGAA. Reduced antibody reactivity to hGAA increased serum GAA levels for vectors 1, 3, and 4. In summary, increased hepatic promoter activity dose-dependently reduced anti-GAA immunogenicity and increased serum GAA activity levels.
[0110] Amelioration of quadriceps muscle pathology from hybrid promoter compared with liver-only promoter vector Muscle pathology is classically difficult to correct in humans by enzyme replacement therapy. To determine the impact of each vector on improving muscle pathology, 1 × 10 13 vg / kg (Figure 7A) or 3 × 10 13 Pathological scores (Table 5) of quadriceps muscles excised from male (black circles) and female (grey triangles) mice in control and vector-treated mice administered 100 mg / kg (Figure 7B) were evaluated.
[0111] GAA activity, glycogen levels, and muscle pathological repair were assessed in mice administered a vector containing the hGAA transgene driven by a hybrid promoter. 13 Representative control and vector-treated mice administered at 100 mg / kg were analyzed for GAA activity in serum and quadriceps, and glycogen accumulation in quadriceps, for which values are reported in Figure 8. Glycogen accumulation scores were assessed from tissue sections from isopentane-frozen quadriceps that were cut and stained with H&E and PAS according to standard procedures, and these values are reported in Figure 8. Images from H&E- and PAS-stained sections from representative mice are also shown in Figure 8.
[0112] Expression in muscle was required for the improvement of muscle lesions in vivo. Mice administered with the hybrid promoter achieved an improvement in muscle lesion scores in the GAA mouse model. Some vectors were expressed at 3 x 10 13 A dose of 0.15 vg / kg resulted in an improvement in pathological scores in both male and female mice.
[0113] [Table 5]
[0114] Evidence for vector 3-associated GAA activity and de novo GAA transcripts in the spinal cord To assess the ability of the hybrid vector to repair CNS-based Pompe symptoms, GAA activity was measured in 3 × 10 13 The hGAA transcript was assessed 1 month after administration in the spinal cord from male (black circles) and female (grey triangles) mice in control and vector-treated mice administered at 1000 mg / kg (Figure 9). Additionally, hGAA transcripts were detected at 1 x 10 ng / mL by RNA-seq analysis. 13 GAA expression was measured in spinal cord tissue from male (circles) and female (triangles) mice in control and vector-treated mice administered 100 mg / kg (Figure 10). The median expression level of endogenous mouse GAA is indicated by the horizontal line. To estimate the proportion of expression levels per vector in liver or CNS tissue, respectively, the level of RNA expression in liver or spinal cord was divided by the mean vector copy number (VCN) in liver or brain tissue, as determined by RNA-Seq analysis (Figure 11).
[0115] These results demonstrate evidence of GAA activity and de novo GAA transcripts from Vector 3 in spinal cord tissue. Spinal cord expression of Vector 3 was comparable to liver expression, per VCN.
[0116] conclusion As demonstrated by this example, engineered synthetic hybrid promoters such as Vector 3 directed bona fide hGAA expression in muscle, liver, and CNS tissues. Liver contribution, for example, resulted in a favorable immunogenicity profile for Vector 3. Muscle contribution, for example, resulted in favorable GAA activity, glycogen restoration, and muscle pathology observations for Vector 3. Additionally, CNS activity (e.g., for Vector 3) was demonstrated based on GAA activity in the spinal cord and de novo transcripts. Our findings support the clinical translation of the vectors described herein as optimized hGAA vectors for AAV gene therapy of Pompe disease.
[0117] Example 2. Treatment of Pompe disease by administration of a vector containing a GAA transgene operably linked to a transcriptional regulatory element Using conventional molecular biology techniques known in the art, a gene encoding a therapeutic protein, such as GAA, can be operably linked to a transcriptional regulatory element (e.g., the transcriptional regulatory element described in Example 1 above). The gene can then be incorporated into a vector, such as a viral vector, and administered to a patient suffering from a disease associated with a deficiency of the gene. For example, a patient suffering from Pompe disease, a lysosomal storage disorder characterized by a deficiency of GAA, can be administered a viral vector containing the GAA gene under the control of a transcriptional regulatory element that promotes GAA expression in muscle cells, neurons, and liver cells. For example, an AAV vector, such as a pseudotyped AAV2 / 8 or AAV2 / 9 vector, can be generated that incorporates the GAA gene between the 5' inverted terminal repeat and the 3' inverted terminal repeat of the vector, and the gene can be placed under the control of the transcriptional regulatory element described in Example 1 above. AAV vectors can be administered to a subject by various routes of administration, such as intravenous, intramuscular, or subcutaneous, among others.
[0118] After administering the vector to a patient, one skilled in the art can monitor the expression of the GAA gene and the patient's improvement in response to the therapy by various methods. For example, a physician can monitor the patient's muscle function (e.g., myocardial function) and / or glycogen accumulation to determine the patient's response to the therapy. A finding that the patient's muscle function improves and / or glycogen accumulation levels decrease after administering the therapy can indicate that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as needed.
[0119] Other embodiments All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0120] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications, and that this application is intended to cover any variations, uses, or adaptations of the invention which generally follow the principles of the invention, including departures from the invention as may be applied to the essential features hereinafter described and claimed, which come within known or customary practice within the art to which the invention pertains. The present application provides the following: 1. A nucleic acid regulatory element comprising a first segment operably linked to a second segment, wherein the first segment comprises an apolipoprotein E hepatic control region (ApoE-HCR) or a functional portion thereof, and the second segment comprises a desmin promoter or a functional portion thereof. 2. The nucleic acid regulatory element of claim 1, wherein the 3' end of the first segment is operably linked to the 5' end of the second segment. 3. The nucleic acid regulatory element of claim 1, wherein the 5' end of the first segment is operably linked to the 3' end of the second segment. 4. A nucleic acid regulatory element described in any one of 1 to 3 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 4. 5. The nucleic acid regulatory element described in 4 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 4. 6. The nucleic acid regulatory element described in 5 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 4. 7. The nucleic acid regulatory element according to claim 6, wherein the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO:4. 8. A nucleic acid regulatory element described in any one of 1 to 3 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1. 9. The nucleic acid regulatory element described in 8 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 1. 10. The nucleic acid regulatory element described in 9 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1. 11. The nucleic acid regulatory element according to claim 10, wherein the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO:1. 12. A nucleic acid regulatory element described in any one of 1 to 3 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2. 13. The nucleic acid regulatory element described in 12 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 2. 14. The nucleic acid regulatory element described in 13 above, wherein the first segment comprises an ApoE-HCR enhancer having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3, or a functional portion thereof having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 2. 15. The nucleic acid regulatory element according to claim 14, wherein the first segment comprises an ApoE-HCR enhancer having the nucleic acid sequence of SEQ ID NO:3, or a functional portion thereof having the nucleic acid sequence of SEQ ID NO:2. 16. The nucleic acid regulatory element described in any one of 1 to 15 above, wherein the first segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:4. 17. The nucleic acid regulatory element of claim 16, wherein the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4. 18. The nucleic acid regulatory element of claim 17, wherein the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4. 19. The nucleic acid regulatory element of claim 18, wherein the first segment comprises a nucleic acid having the nucleic acid sequence of SEQ ID NO:4. 20. The nucleic acid regulatory element described in any one of 1 to 15 above, wherein the first segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:1. 21. The nucleic acid regulatory element of claim 20, wherein the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:1. 22. The nucleic acid regulatory element of claim 21, wherein the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:1. 23. The nucleic acid regulatory element of claim 22, wherein the first segment has the nucleic acid sequence of SEQ ID NO:1. 24. The nucleic acid regulatory element described in any one of 1 to 15 above, wherein the first segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:2. 25. The nucleic acid regulatory element of claim 24, wherein the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:2. 26. The nucleic acid regulatory element of claim 25, wherein the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:2. 27. The nucleic acid regulatory element of claim 26, wherein the first segment has the nucleic acid sequence of SEQ ID NO:2. 28. The nucleic acid regulatory element described in any one of 1 to 15 above, wherein the first segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:3. 29. The nucleic acid regulatory element of claim 28, wherein the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:3. 30. The nucleic acid regulatory element of claim 29, wherein the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:3. 31. The nucleic acid regulatory element of claim 30, wherein the first segment has the nucleic acid sequence of SEQ ID NO:3. 32. The nucleic acid regulatory element described in any one of 1 to 31 above, wherein the second segment comprises a 5' region having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:5. 33. The nucleic acid regulatory element according to claim 32, wherein the 5' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:5. 34. The nucleic acid regulatory element according to claim 33, wherein the 5' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:5. 35. The nucleic acid regulatory element described in claim 34, wherein the 5' region has the nucleic acid sequence of SEQ ID NO:5. 36. The nucleic acid regulatory element described in any one of 1 to 35 above, wherein the second segment comprises a 3' region having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:6. 37. The nucleic acid regulatory element according to claim 36, wherein the 3' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. 38. The nucleic acid regulatory element according to claim 37, wherein the 3' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. 39. The nucleic acid regulatory element according to claim 38, wherein the 3' region has the nucleic acid sequence of SEQ ID NO:6. 40. The nucleic acid regulatory element described in any one of 1 to 39 above, wherein the second segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:7. 41. The nucleic acid regulatory element of claim 40, wherein the second segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. 42. The nucleic acid regulatory element of claim 41, wherein the second segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. 43. The nucleic acid regulatory element of claim 42, wherein the second segment has the nucleic acid sequence of SEQ ID NO:7. 44. The nucleic acid regulatory element described in any one of 1 to 43 above, further comprising a third segment located 5' to and operably linked to the first and second segments, wherein the third segment comprises a synapsin promoter or a functional portion thereof. 45. The nucleic acid regulatory element of claim 44, wherein the third segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:8. 46. The nucleic acid regulatory element of claim 45, wherein the third segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:8. 47. The nucleic acid regulatory element of claim 46, wherein the third segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:8. 48. The nucleic acid regulatory element described in 47 above, wherein the third segment has the nucleic acid sequence of SEQ ID NO:8. 49. The nucleic acid regulatory element of claim 1, wherein the nucleic acid regulatory element has at least 85% identity to the nucleic acid sequence of SEQ ID NO: 10. 50. The nucleic acid regulatory element of claim 49, wherein the nucleic acid regulatory element has at least 90% identity to the nucleic acid sequence of SEQ ID NO: 10. 51. The nucleic acid regulatory element of claim 50, wherein the nucleic acid regulatory element has at least 95% identity to the nucleic acid sequence of SEQ ID NO: 10. 52. The nucleic acid regulatory element described in claim 51, wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO: 10. 53. The nucleic acid regulatory element of claim 1, wherein the nucleic acid regulatory element has at least 85% identity to the nucleic acid sequence of SEQ ID NO: 12. 54. The nucleic acid regulatory element of claim 53, wherein the nucleic acid regulatory element has at least 90% identity to the nucleic acid sequence of SEQ ID NO: 12. 55. The nucleic acid regulatory element of claim 54, wherein the nucleic acid regulatory element has at least 95% identity to the nucleic acid sequence of SEQ ID NO: 12. 56. The nucleic acid regulatory element described in 55 above, wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO: 12. 57. The nucleic acid regulatory element of claim 1, wherein the nucleic acid regulatory element has at least 85% identity to the nucleic acid sequence of SEQ ID NO:11. 58. The nucleic acid regulatory element of claim 57, wherein the nucleic acid regulatory element has at least 90% identity to the nucleic acid sequence of SEQ ID NO:11. 59. The nucleic acid regulatory element of claim 58, wherein the nucleic acid regulatory element has at least 95% identity to the nucleic acid sequence of SEQ ID NO:11. 60. The nucleic acid regulatory element described in 59 above, wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO: 11. 61. A nucleic acid regulatory element comprising a first segment operably linked to a second segment, wherein the first segment comprises a desmin promoter or a functional portion thereof, and the second segment comprises a synapsin promoter or a functional portion thereof. 62. The nucleic acid regulatory element of claim 61, wherein the 3' end of the first segment is operably linked to the 5' end of the second segment. 63. The nucleic acid regulatory element of claim 61, wherein the 5' end of the first segment is operably linked to the 3' end of the second segment. 64. A nucleic acid regulatory element described in any of 61 to 63 above, wherein the first segment comprises a 5' region having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:5. 65. The nucleic acid regulatory element according to claim 64, wherein the 5' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:5. 66. The nucleic acid regulatory element according to claim 65, wherein the 5' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:5. 67. The nucleic acid regulatory element described in claim 66, wherein the 5' region has the nucleic acid sequence of SEQ ID NO:5. 68. A nucleic acid regulatory element according to any one of claims 61 to 67, wherein the first segment comprises a 3' region having a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:6. 69. The nucleic acid regulatory element according to claim 68, wherein the 3' region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. 70. The nucleic acid regulatory element according to claim 69, wherein the 3' region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. 71. The nucleic acid regulatory element described in claim 70, wherein the 3' region has the nucleic acid sequence of SEQ ID NO:6. 72. The nucleic acid regulatory element described in any one of 61 to 71 above, wherein the first segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:7. 73. The nucleic acid regulatory element of claim 72, wherein the first segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. 74. The nucleic acid regulatory element of claim 73, wherein the first segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. 75. The nucleic acid regulatory element described in claim 74, wherein the first segment has the nucleic acid sequence of SEQ ID NO:7. 76. The nucleic acid regulatory element described in any one of 61 to 75 above, wherein the second segment has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO:8. 77. The nucleic acid regulatory element of claim 76, wherein the second segment has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:8. 78. The nucleic acid regulatory element according to claim 77, wherein the second segment has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:8. 79. The nucleic acid regulatory element of claim 78, wherein the second segment has the nucleic acid sequence of SEQ ID NO:8. 80. A vector comprising a nucleic acid regulatory element according to any one of 1 to 79 above, wherein the nucleic acid regulatory element is operably linked to an introduced gene, and the nucleic acid regulatory element induces expression of the introduced gene upon introduction of the vector into a cell. 81. The vector according to claim 80, wherein the transgene is acid alpha-glucosidase (GAA). 82. The vector according to claim 80 or 81, wherein the cell is a muscle cell, a neuron, or a liver cell. 83. The vector according to any one of items 80 to 82 above, wherein the vector is a viral vector. 84. The vector according to claim 83, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, and vaccinia virus. 85. The vector according to claim 84, wherein the viral vector is AAV. 86. The vector described in 85 above, wherein the AAV is of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrh74 serotype. 87. The vector described in claim 83, wherein the viral vector is a pseudotyped AAV. 88. The vector described in 87 above, wherein the pseudotyped AAV is rAAV2 / 8 or rAAV2 / 9. 89. A composition comprising a nucleic acid molecule comprising a nucleic acid regulatory element according to any one of 1 to 79 above, wherein the composition is a liposome, a vesicle, a synthetic vesicle, an exosome, a synthetic exosome, a dendrimer, or a nanoparticle. 90. The composition described in claim 89, wherein the nucleic acid regulatory element is operably linked to a transgene, and the nucleic acid regulatory element induces expression of the transgene upon introduction of the composition into a cell. 91. A method for expressing a transgene in a cell, the method comprising contacting the cell with a vector described in any one of items 80 to 88 or a composition described in item 89 or 90 for a period of time sufficient to simulate transcription of the transgene in the cell. 92. The method described in claim 91, wherein the transgene is GAA. 93. A method for treating Pompe disease in a human patient in need thereof, comprising administering to the patient a therapeutically effective amount of a vector described in any one of 80 to 88 above or a composition described in 89 or 90 above. 94. A kit comprising a vector according to any one of claims 80 to 88 or a composition according to claim 89 or 90, further comprising an insert instructing a user of the kit to contact the vector or composition with a cell, thereby expressing a transgene operably linked to a regulatory control element.
[0121] Other embodiments are within the scope of the following claims.
[0122] [Sequence table] SEQUENCE LISTING <110> Audentes Therapeutics, Inc. <120> TRANSCRIPTION REGULATORY ELEMENTS AND USES THEREOF <130> PA23-564 <150> US 62 / 626,561 <151> 2018-02-05 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 193 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 1 cccctaaaat gggcaaacat tgcaagcagc aaacagcaaa cacacagccc tccctgcctg 60 ctgaccttgg agctggggca gaggtcagag acctctctgg gcccatgcca cctccaacat 120 ccactcgacc ccttggaatt tcggtggaga ggagcagagg ttgtcctggc gtggtttagg 180 tagtgtgaga ggg 193 <210> 2 <211> 320 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 2 ggctcagagg cacacaggag tttctgggct caccctgccc ccttccaacc cctcagttcc 60 catcctccag cagctgtttg tgtgctgcct ctgaagtcca cactgaacaa acttcagcct 120 actcatgtcc ctaaaatggg caaacattgc aagcagcaaa cagcaaacac acagccctcc 180 ctgcctgctg accttggagc tggggcagag gtcagagacc tctctgggcc catgccacct 240 ccaacatcca ctcgacccct tggaatttcg gtggagagga gcagaggttg tcctggcgtg 300 gtttaggtag tgtgagaggg 320 <210> 3 <211> 774 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 3 ctgcaggctc agaggcacac aggagtttct gggctcaccc tgcccccttc caacccctca 60 gttcccatcc tccagcagct gtttgtgtgc tgcctctgaa gtccacactg aacaaacttc 120 agcctactca tgtccctaaa atgggcaaac attgcaagca gcaaacagca aacacacagc 180 cctccctgcc tgctgacctt ggagctgggg cagaggtcag agacctctct gggcccatgc 240 cacctccaac atccactcga ccccttggaa tttcggtgga gaggagcaga ggttgtcctg 300 gcgtggttta ggtagtgtga gagggtccgg gttcaaaacc acttgctggg tggggagtcg 360 tcagtaagtg gctatgcccc gaccccgaag cctgtttccc catctgtaca atggaaatga 420 taaagacgcc catctgatag ggtttttgtg gcaaataaac atttggtttt tttgttttgt 480 tttgttttgt tttttgagat ggaggtttgc tctgtcgccc aggctggagt gcagtgacac 540 aatctcatct caccacaacc ttcccctgcc tcagcctccc aagtagctgg gattacaagc 600 atgtgccacc acacctggct aattttctat ttttagtaga gacgggtttc tccatgttgg 660 tcagcctcag cctcccaagt aactgggatt acaggcctgt gccaccacac ccggctaatt 720 ttttctattt ttgacaggga cggggtttca ccatgttggt caggctggtc taga 774 <210> 4 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 4 cccctaaaat gggcaaacat tgcaagcagc aaacagcaaa cacacagccc 50 <210> 5 <211> 342 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 5 taccccctgc cccccacagc tcctctcctg tgccttgttt cccagccatg cgttctcctc 60 tataaatacc cgctctggta tttggggttg gcagctgttg ctgccaggga gatggttggg 120 ttgacatgcg gctcctgaca aaacacaaac ccctggtgtg tgtgggcgtg ggtggtgtga 180 gtagggggat gaatcaggga gggggcgggg gacccagggg gcaggagcca cacaaagtct 240 gtgcgggggt gggagcgcac atagcaattg gaaactgaaa gcttatcaga ccctttctgg 300 aaatcagccc actgtttata aacttgaggc cccaccctcg ag 342 <210> 6 <211> 346 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 6 cgagataacc agggctgaaa gaggcccgcc tgggggctgg agacatgctt gctgcctgcc 60 ctggcgaagg attggcaggc ttgcccgtca caggaccccc gctggctgac tcaggggcgc 120 aggcctcttg cgggggagct ggcctccccg cccccacggc cacgggccgc cctttcctgg 180 caggacagcg ggatcttgca gctgtcaggg gaggggaggc gggggctgat gtcaggaggg 240 atacaaatag tgccgacggc tgggggccct gtctcccctc gccgcatcca ctctccggcc 300 ggccgcctgt ccgccgcctc ctccgtgcgc ccgccagcct cgcccg 346 <210> 7 <211> 688 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 7 taccccctgc cccccacagc tcctctcctg tgccttgttt cccagccatg cgttctcctc 60 tataaatacc cgctctggta tttggggttg gcagctgttg ctgccaggga gatggttggg 120 ttgacatgcg gctcctgaca aaacacaaac ccctggtgtg tgtgggcgtg ggtggtgtga 180 gtaggggggat gaatcaggga gggggcgggg gacccagggg gcagaggacca cacaaagtct 240 gtgcggggt gggagcgcac atagcaattg gaatgaaa gcttatcaga ccctttctgg 300 aaatcagccc actgtttata aacttgaggc cccaccctcg agcgagataa ccagggctga 360 aagaggcccg cctgggggct ggagacatgc ttgctgcctg ccctggcgaa ggattggcag 420 gcttgcccgt cacaggaccc ccgctggctg actcaggggc gcaggcctct tgcgggggag 480 ctggcctccc cgcccccacg gccacgggcc gccctttcct ggcaggacag cgggatcttg 540 cagctgtcag gggaggggag gcggggctg atgtcaggag ggataacaaat agtgccgacg 600 gctggggcc ctgtctcccc tcgccgcatc cactctccgg ccggccgcct gtccgccgcc 660 tcctccgtgc gcccgccagc ctcgcccg 688 <210> 8 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 8 aaaatgcctt ctgagttgaa tatcaacact acaaaccgag tatctgcaga gggccctgcg 60 tatgagtgca agtgggtttt aggaccagga tgaggcgggg tgggggtgcc tacctgacga 120 ccgaccccga cccactggac aagcacccaa cccccattcc ccaaattgcg catcccctat 180 cagagagggg gaggggaaac aggatgcggc gaggcgcgtg cgcactgcca gcttcagcac 240 cgcggacagt gccttcgccc ccgcctggcg gcgcgcgcca ccgccgcctc agcactgaag 300 gcgcgctgac gtcactcgcc ggtcccccgc aaactcccct tcccggccac cttggtcgcg 360 tccgcgccgc cgccg 375 <210> 9 <211> 449 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 9 cccctaaaat gggcaaacat tgcaagcagc aaacagcaaa cacacagccc tccctgcctg 60 ctgaccttgg agctggggca gaggtcagag acctctctgg gcccatgcca cctccaacat 120 ccactcgacc ccttggaatt tcggtggaga ggagcagagg ttgtcctggc gtggtttagg 180 tagtgtgaga ggggaatgac tcctttcggt aagtgcagtg gaagctgtac actgcccagg 240 caaagcgtcc gggcagcgta ggcgggcgac tcagatccca gccagtgcac ttagcccctg 300 tttgctcctc cgataactgg ggtgaccttg gttaatattc accagcagcc tcccccgttg 360 cccctctgga tccactgctt aaatacggac gaggacaggg ccctgtctcc tcagcttcag 420 gcaccaccac tgacctggga cagtgaatc 449 <210> 10 <211> 881 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 10 cccctaaaat gggcaaacat tgcaagcagc aaacagcaaa cacacagccc tccctgcctg 60 ctgacctgg agctggggca gaggtcagag acctctctgg gcccatgcca cctccaacat 120 ccactcgacc ccttggaatt tcggtggaga ggagcagagg ttgtcctggc gtggtttagg 180 tagtgtgaga gggtacccc tgccccccac agctcctctc ctgtgccttg tttcccagcc 240 atgcgttctc ctctataaat acccgctctg gtatttgggg ttggcagctg ttgctgccag 300 ggagatggtt gggttgacat gcggctcctg acaaaacaca aacccctggt gtgtgtgggc 360 gtgggtggtg tgagtagggg gatgaatcag ggagggggcg ggggacccag ggggcaggag 420 ccacacaaag tctgtgcggg ggtgggagcg cacatagcaa ttggaaactg aaagcttatc 480 agaccctttc tggaaatcag cccactgttt ataaacttga ggccccaccc tcgagcgaga 540 taaccagggc tgaaagaggc ccgcctgggg gctggagaca tgcttgctgc ctgccctggc 600 gaaggattgg caggcttgcc cgtcacagga cccccgctgg ctgactcagg ggcgcaggcc 660 tcttgcgggg gagctggcct ccccgccccc acggccacgg gccgcccttt cctggcagga 720 cagcgggatc ttgcagctgt caggggaggg gaggcggggg ctgatgtcag gagggataca 780 aatagtgccg acggctgggg gccctgtctc ccctcgccgc atccactctc cggccggccg 840 cctgtccgcc gcctcctccg tgcgcccgcc agcctcgccc g 881 <210> 11 <211> 1256 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 11 aaaatgcctt ctgagttgaa tatcaacact acaaaccgag tatctgcaga gggccctgcg 60 tatgagtgca agtgggtttt aggaccagga tgaggcgggg tgggggtgcc tacctgacga 120 ccgaccccga cccactggac aagcacccaa cccccattcc ccaaattgcg catcccctat 180 240. cagagagggg gaggggaac aggatgcggc gaggcgcgtg cgcactgcca gcttcagcac cgcggacagt gccttcgccc ccgcctggcg gcgcgcgcca ccgccgcctc agcactgaag gcgcgctgac gtcactcgcc ggtcccccgc aaactcccct tcccggccac cttggtcgcg 360 tccgcgccgc cgccgcccct aaaatgggca aacattgcaa gcagcaaaca gcaaacacac 420 agccctccct gcctgctgac cttggagctg gggcagaggt cagagacctc tctgggccca 480 tgccacctcc aacatccact cgaccccttg gaatttcggt ggagaggagc agaggttgtc 540 ctggcgtggt ttaggtagtg tgagagggta ccccctgccc cccacagctc ctctcctgtg 600 ccttgtttcc cagccatgcg ttctcctcta taaatacccg ctctggtatt tggggttggc 660 agctgttgct gccagggaga tggttgggtt gacatgcggc tcctgacaaa acacaaaccc 720 ctggtgtgtg tggggcgtggg tggtgtgagt aggggatga atcagggagg gggcggggga 780 cccagggggc aggagccaca caaagtctgt gcgggggtgg gagcgcacat agcaattgga 840 aactgaaagc ttatcagacc ctttctggaa atcagcccac tgtttataaa cttgaggccc 900 caccctcgag cgagataacc agggctgaaa gaggcccgcc tgggggctgg agacatgctt 960 gctgcctgcc ctggcgaagg attggcaggc ttgcccgtca caggaccccc gctggctgac 1020 tcaggggcgc aggcctcttg cgggggagct ggcctccccg cccccacggc cacgggccgc 1080 cctttcctgg caggacagcg ggatcttgca gctgtcaggg gaggggaggc gggggctgat 1140 gtcaggaggg atacaaatag tgccgacggc tgggggccct gtctcccctc gccgcatcca 1200 ctctccggcc ggccgcctgt ccgccgcctc ctccgtgcgc ccgccagcct cgcccg 1256 <210> 12 <211> 738 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 12 cccctaaaat gggcaaacat tgcaagcagc aaacagcaaa cacacagccc taccccctgc 60 cccccacagc tcctctcctg tgccttgttt cccagccatg cgttctcctc tataaatacc 120 cgctctggta tttggggttg gcagctgttg ctgccaggga gatggttggg ttgacatgcg 180 gctcctgaca aaaacaaac ccctggtgtg tgtgggcgtg ggtggtgtga gtaggggat 240 gaatcaggga gggggcgggg gacccagggg gcagaggacca cacaaagtct gtgcgggggt 300 gggagcgcac atagcaattg gaaatgaaa gcttatcaga ccctttctgg aaatcagccc 360 actgtttata aacttgaggc cccaccctcg agcgagataa ccagggctga aagaggcccg 420 cctggggct ggagacatgc ttgctgcctg ccctggcgaa ggattggcag gcttgcccgt 480 cacaggaccc ccgctggctg actcaggggc gcaggcctct tgcggggag ctggcctccc 540 cgcccccacg gccacgggcc gccctttcct ggcaggacag cgggatcttg cagctgtcag 600 gggaggggag gcgggggctg atgtcaggag ggatacaaat agtgccgacg gctgggggcc 660 ctgtctcccc tcgccgcatc cactctccgg ccggccgcct gtccgccgcc tcctccgtgc 720 gcccgccagc ctcgcccg 738 <210> 13 <211> 256 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 13 gaatgactcc tttcggtaag tgcagtggaa gctgtacact gcccaggcaa agcgtccggg 60 cagcgtaggc gggcgactca gatcccagcc agtgcactta gcccctgttt gctcctccga 120 taactggggt gaccttggtt aatattcacc agcagcctcc cccgttgccc ctctggatcc 180 actgcttaaa tacggacgag gacagggccc tgtctcctca gcttcaggca ccaccactga 240 cctgggacag tgaatc 256 <210> 14 <211> 952 <212> PRT <213> Homo sapiens <400> 14 Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val Cys 1 5 10 15 Ala Leu Val Ser Leu Ala Thr Ala Ala Leu Leu Gly His Ile Leu Leu 20 25 30 His Asp Phe Leu Leu Val Pro Arg Glu Leu Ser Gly Ser Ser Pro Val 35 40 45 Leu Glu Glu Thr His Pro Ala His Gln Gln Gly Ala Ser Arg Pro Gly 50 55 60 Pro Arg Asp Ala Gln Ala His Pro Gly Arg Pro Arg Ala Val Pro Thr 65 70 75 80 Gln Cys Asp Val Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys 85 90 95 Ala Ile Thr Gln Glu Gln Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro 100 105 110 Ala Lys Gln Gly Leu Gln Gly Ala Gln Met Gly Gln Pro Trp Cys Phe 115 120 125 Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser 130 135 140 Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe 145 150 155 160 Pro Lys Asp Ile Leu Thr Leu Arg Leu Asp Val Met Met Glu Thr Glu 165 170 175 Asn Arg Leu His Phe Thr Ile Lys Asp Pro Ala Asn Arg Arg Tyr Glu 180 185 190 Val Pro Leu Glu Thr Pro His Val His Ser Arg Ala Pro Ser Pro Leu 195 200 205 Tyr Ser Val Glu Phe Ser Glu Glu Pro Phe Gly Val Ile Val Arg Arg 210 215 220 Gln Leu Asp Gly Arg Val Leu Leu Asn Thr Thr Val Ala Pro Leu Phe 225 230 235 240 Phe Ala Asp Gln Phe Leu Gln Leu Ser Thr Ser Leu Pro Ser Gln Tyr 245 250 255 Ile Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser 260 265 270 Trp Thr Arg Ile Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly 275 280 285 Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly 290 295 300 Gly Ser Ala His Gly Val Phe Leu Leu Asn Ser Asn Ala Met Asp Val 305 310 315 320 Val Leu Gln Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly Ile 325 330 335 Leu Asp Val Tyr Ile Phe Leu Gly Pro Glu Pro Lys Ser Val Val Gln 340 345 350 Gln Tyr Leu Asp Val Val Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly 355 360 365 Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala Ile Thr 370 375 380 Arg Gln Val Val Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Val 385 390 395 400 Gln Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe 405 410 415 Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Val Gln Glu Leu His 420 425 430 Gln Gly Gly Arg Arg Tyr Met Met Ile Val Asp Pro Ala Ile Ser Ser 435 440 445 Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg 450 455 460 Gly Val Phe Ile Thr Asn Glu Thr Gly Gln Pro Leu Ile Gly Lys Val 465 470 475 480 Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu 485 490 495 Ala Trp Trp Glu Asp Met Val Ala Glu Phe His Asp Gln Val Pro Phe 500 505 510 Asp Gly Met Trp Ile Asp Met Asn Glu Pro Ser Asn Phe Ile Arg Gly 515 520 525 Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Val 530 535 540 Pro Gly Val Val Gly Gly Thr Leu Gln Ala Ala Thr Ile Cys Ala Ser 545 550 555 560 Ser His Gln Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly 565 570 575 Leu Thr Glu Ala Ile Ala Ser His Arg Ala Leu Val Lys Ala Arg Gly 580 585 590 Thr Arg Pro Phe Val Ile Ser Arg Ser Thr Phe Ala Gly His Gly Arg 595 600 605 Tyr Ala Gly His Trp Thr Gly Asp Val Trp Ser Ser Trp Glu Gln Leu 610 615 620 Ala Ser Ser Val Pro Glu Ile Leu Gln Phe Asn Leu Leu Gly Val Pro 625 630 635 640 Leu Val Gly Ala Asp Val Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu 645 650 655 Leu Cys Val Arg Trp Thr Gln Leu Gly Ala Phe Tyr Pro Phe Met Arg 660 665 670 Asn His Asn Ser Leu Leu Ser Leu Pro Gln Glu Pro Tyr Ser Phe Ser 675 680 685 Glu Pro Ala Gln Gln Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala 690 695 700 Leu Leu Pro His Leu Tyr Thr Leu Phe His Gln Ala His Val Ala Gly 705 710 715 720 Glu Thr Val Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser 725 730 735 Thr Trp Thr Val Asp His Gln Leu Leu Trp Gly Glu Ala Leu Leu Ile 740 745 750 Thr Pro Val Leu Gln Ala Gly Lys Ala Glu Val Thr Gly Tyr Phe Pro 755 760 765 Leu Gly Thr Trp Tyr Asp Leu Gln Thr Val Pro Val Glu Ala Leu Gly 770 775 780 Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala Ile His Ser 785 790 795 800 Glu Gly Gln Trp Val Thr Leu Pro Ala Pro Leu Asp Thr Ile Asn Val 805 810 815 His Leu Arg Ala Gly Tyr Ile Ile Pro Leu Gln Gly Pro Gly Leu Thr 820 825 830 Thr Thr Glu Ser Arg Gln Gln Pro Met Ala Leu Ala Val Ala Leu Thr 835 840 845 Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser 850 855 860 Leu Glu Val Leu Glu Arg Gly Ala Tyr Thr Gln Val Ile Phe Leu Ala 865 870 875 880 Arg Asn Asn Thr Ile Val Asn Glu Leu Val Arg Val Thr Ser Glu Gly 885 890 895 Ala Gly Leu Gln Leu Gln Lys Val Thr Val Leu Gly Val Ala Thr Ala 900 905 910 Pro Gln Gln Val Leu Ser Asn Gly Val Pro Val Ser Asn Phe Thr Tyr 915 920 925 Ser Pro Asp Thr Lys Val Leu Asp Ile Cys Val Ser Leu Leu Met Gly 930 935 940 Glu Gln Phe Leu Val Ser Trp Cys 945 950
Claims
1. A nucleic acid regulatory element comprising a first segment operably linked to a second segment, wherein the first segment comprises an apolipoprotein E liver control region (ApoE-HCR) and the second segment comprises a desmin promoter; (i) the ApoE-HCR has the nucleic acid sequence of SEQ ID NO: 1 and the desmin promoter has the nucleic acid sequence of SEQ ID NO: 7; or (ii) the ApoE-HCR has the nucleic acid sequence of SEQ ID NO: 4 and the desmin promoter has the nucleic acid sequence of SEQ ID NO: 7; The nucleic acid regulatory element.
2. The nucleic acid regulatory element of claim 1 , wherein the 3′ end of the first segment is operably linked to the 5′ end of the second segment.
3. The nucleic acid regulatory element of claim 1 , wherein the 5′ end of the first segment is operably linked to the 3′ end of the second segment.
4. 4. The nucleic acid regulatory element of claim 1, further comprising a third segment located 5' to and operably linked to the first and second segments, wherein the third segment comprises a synapsin promoter having the nucleic acid sequence of SEQ ID NO:
8.
5. The nucleic acid regulatory element of claim 1 , wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO:
10.
6. The nucleic acid regulatory element of claim 1 , wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO:
12.
7. The nucleic acid regulatory element of claim 1 , wherein the nucleic acid regulatory element has the nucleic acid sequence of SEQ ID NO:
11.
8. 8. A vector comprising the nucleic acid regulatory element of any one of claims 1 to 7, wherein the nucleic acid regulatory element is operably linked to a transgene, and wherein the nucleic acid regulatory element induces expression of the transgene upon introduction of the vector into a cell.
9. The vector of claim 8, wherein the transgene is acid α-glucosidase (GAA).
10. The vector of claim 8 or 9, wherein the cell is a muscle cell, a neuron, or a liver cell.
11. The vector according to any one of claims 8 to 10, wherein the vector is a viral vector.
12. 12. The vector of claim 11, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, and vaccinia virus.
13. The vector of claim 12, wherein the viral vector is an AAV.
14. 14. The vector of claim 13, wherein the AAV is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrh74 serotype.
15. The vector of claim 11 , wherein the viral vector is a pseudotyped AAV.
16. The vector of claim 15, wherein the pseudotyped AAV is rAAV2 / 8 or rAAV2 / 9.
17. 8. A composition comprising a nucleic acid molecule comprising the nucleic acid regulatory element of any one of claims 1 to 7, wherein the composition is a liposome, a vesicle, a synthetic vesicle, an exosome, a synthetic exosome, a dendrimer, or a nanoparticle.
18. 18. The composition of claim 17, wherein the nucleic acid regulatory element is operably linked to a transgene, and the nucleic acid regulatory element induces expression of the transgene upon introduction of the composition into a cell.
19. 19. The vector of any one of claims 8 to 16 or the composition of claim 17 or 18 for use in a method for expressing a transgene in a cell, said method comprising contacting said cell with said vector or composition for a time sufficient to stimulate transcription of said transgene in said cell.
20. 20. The vector or composition of claim 19, wherein the transgene is GAA.
21. A vector according to any one of claims 8 to 16 or a composition according to claim 17 or 18 for use in a method for treating Pompe disease in a human patient in need thereof.
22. 19. A kit comprising the vector of any one of claims 8 to 16 or the composition of claim 17 or 18, further comprising a package insert instructing a user of the kit to contact the vector or composition with a cell, thereby expressing a transgene operably linked to a nucleic acid regulatory element.
Citation Information
Patent Citations
Compositions and methods for treating diseases
JP2015523998A
Production of hepatocytes via forward programming by combined genetic and chemical manipulations
JP2016508726A
Muscle-specific nucleic acid regulatory elements and methods and uses thereof
JP2017505126A
Methods of packaging multiple adeno-associated virus vectors
US20170218395A1
Adeno-associated virus factor viii vectors, associated viral particles and therapeutic formulations comprising the same
WO2017053677A1