Method for treating and / or preventing diseases in which Regnase-1 is involved

Inhibiting the phosphorylation of specific Ser residues or binding of Regnase-1 to kinases addresses the challenge of treating inflammatory and autoimmune diseases by stabilizing Regnase-1, reducing inflammation and fibrosis.

JP7778301B2Active Publication Date: 2025-12-02OSAKA UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2020523181
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-05-09
Filing Date
2019-06-06
Publication Date
2025-12-02
Estimated Expiration
2039-06-06

AI Technical Summary

Technical Problem

There is no known method for treating or preventing inflammatory diseases, autoimmune diseases, and allergic diseases by inhibiting the phosphorylation of Regnase-1.

Method used

Inhibiting the phosphorylation of specific Ser residues in Regnase-1, such as positions 513, 494, 439, and 435, or inhibiting the binding of Regnase-1 to kinases like TBK1, IKKi, Act-1, IKK, and IRAK, to suppress inflammation, fibrosis, and expression of inflammatory factors.

Benefits of technology

Effectively suppresses inflammation, fibrosis, and expression of inflammatory factors by stabilizing Regnase-1, thereby treating and preventing diseases associated with Regnase-1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007778301000051
    Figure 0007778301000051
  • Figure 0007778301000052
    Figure 0007778301000052
  • Figure 0007778301000053
    Figure 0007778301000053
Patent Text Reader

Abstract

For example, they found that inhibiting phosphorylation of Ser residues in Regnase-1 is effective in treating and / or preventing diseases, etc. They also found that inhibiting the binding of Regnase-1 to at least one factor selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is effective in treating and / or preventing diseases, etc.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for treating and / or preventing diseases in which Regnase-1 is involved, etc. [Background technology]

[0002] Regnase-1 (also known as "Zc3h12a" or "MCPIP-1," and may be referred to as such herein) is a nuclease that belongs to the Regnase family and has a CCCH-type zinc finger domain and a PIN-like domain, and recognizes and degrades mRNA (Non-Patent Document 1). Regnase-1 destabilizes the mRNAs of interleukin (IL)-6 and IL-12p40, and is involved in their post-transcriptional regulation (Non-Patent Document 2). It has been reported that Ser435 and Ser439 of mouse Regnase-1 are phosphorylation sites by IκB kinase (IKK) induced by IL-1β stimulation, that Regnase-1 in which these amino acid residues are substituted with Ala (alanine) is resistant to degradation by IL-1β stimulation, and that in cells expressing the alanine-substituted Regnase-1, IL-6 mRNA expression after IL-1β stimulation is suppressed compared to cells expressing wild-type Regnase-1 (Non-Patent Document 3).It has been reported that heterozygous Regnase-1 knockout mice show worsening pathology in experimental autoimmune encephalomyelitis and psoriasis model experiments (Non-Patent Documents 4 and 5). [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Akira, S. Regnase-1, a ribonuclease involved in the regulation of immune responses. Cold Spring Harbor symposia on quantitative biology 78, 51-60 (2013). [Non-patent document 2] Matsushita, K. et al. Zc3h12a is an RNase essential for controlling immune responses by regulating mRNA decay. Nature 458, 1185-1190 (2009). [Non-patent document 3] Iwasaki, H. et al. The IkappaB kinase complex regulates the stability of cytokine-encoding mRNA induced by TLR-IL-1R by controlling degradation of regnase-1. Nat Immunol 12, 1167-1175 (2011). [Non-patent document 4] Garg, AV et al. MCPIP1 Endoribonuclease Activity Negatively Regulates Interleukin-17-Mediated Signaling and Inflammation. Immunity 43, 475-487 (2015). [Non-patent document 5] L. Monin et al. MCPIP1 / Regnase-1 Restricts IL-17A- and IL-17C-Dependent Skin Inflammation. J. Immunol. 198, 767-775 (2017). Summary of the Invention [Problem to be solved by the invention]

[0004] However, there has been no known method for treating or preventing inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, etc. by inhibiting the phosphorylation of Regnase-1. In one aspect, an objective of the present invention is to provide a method for treating diseases by inhibiting the phosphorylation of Regnase-1. [Means for solving the problem]

[0005] To achieve the above object, the present inventors searched for kinases that can phosphorylate Regnase-1 and identified the amino acid residues in Regnase-1 that are phosphorylated by these kinases. They then found that inhibition of phosphorylation of specific residues among these amino acid residues is effective in treating and / or preventing inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and the like, and thus completed the present invention.

[0006] In one non-limiting specific embodiment, the present invention includes the following. [a1] A method for treating and / or preventing a disease in which Regnase-1 is involved, by selectively inhibiting phosphorylation of Ser residues by Regnase-1. [a2] A method for suppressing inflammation by selectively inhibiting phosphorylation of Ser residues by Regnase-1. [a3] A method for suppressing fibrosis of cells, tissues, or organs; or epithelial hyperplasia, by selectively inhibiting phosphorylation of Ser residues by Regnase-1. [a4] A method for suppressing the destabilization and / or intracellular degradation of Regnase-1 by selectively inhibiting phosphorylation of Ser residues in Regnase-1. [a5] The method described in [a4], wherein the destabilization and / or intracellular degradation of Regnase-1 is downstream of signal transduction involving at least one molecule selected from the group consisting of IL-17, IL-1, IL-36 and TLR ligands. [a6] A method for suppressing the production of inflammatory factors by selectively inhibiting phosphorylation of Ser residues by Regnase-1. [a7] A method for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB by selectively inhibiting phosphorylation of Ser residues with Regnase-1. [a8] A method described in any of [a1] to [a7], wherein the Ser residue is a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [a9] The method described in any of [a1] to [a8], wherein the positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1, respectively, are (i) positions 513, 494, 439, and 435 of SEQ ID NO: 1; or (ii) positions 516, 497, 442, and 438 of SEQ ID NO: 2. [a10] A method described in any of [a1] to [a9], wherein the Ser residue is a Ser residue contained in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1. [a11] The method described in any one of [a1] to [a10], wherein the Regnase-1 is mammalian Regnase-1. [a12] The method according to any one of [a1] to [a11], wherein the Ser residue is a Ser residue of the following (i) or (ii): (i) Ser residues at either or both of the positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Ser residues at either or both of the positions corresponding to positions 439 and 435 of SEQ ID NO: 1 in Regnase-1.

[0007] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [A1] A method for treating and / or preventing a disease in which Regnase-1 is involved, by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [A2] A method for suppressing inflammation by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [A3] A method for suppressing fibrosis of cells, tissues, or organs; or epithelial hyperplasia, by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [A4] A method for suppressing the destabilization and / or intracellular degradation of Regnase-1 by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK. [A5] The method described in [A4], wherein the destabilization and / or intracellular degradation of Regnase-1 is destabilization and / or intracellular degradation of Regnase-1 downstream of signal transduction involving at least one molecule selected from the group consisting of IL-17, IL-1, IL-36 and TLR ligands. [A6] A method for suppressing the production of inflammatory factors by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [A7] A method for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [A8] A method described in any of [A1] to [A7], which inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [A9] The method according to any one of [A1] to [A8], wherein the at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. [A10] The method described in any of [A1] to [A9], wherein the Regnase-1 is mammalian Regnase-1. [A11] The method according to any one of [A1] to [A10], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is TBK1 and IKK.

[0008] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [B1] A composition for treating and / or preventing diseases involving Regnase-1, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B2] A composition for treating and / or preventing diseases involving Regnase-1, comprising a Regnase-1 binding molecule that inhibits phosphorylation of Ser residues contained in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4) and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1. [B3] A composition for treating and / or preventing a disease involving Regnase-1, comprising a Regnase-1 binding molecule that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK. [B4] A composition described in [B3] that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B5] A composition described in any of [B1] to [B4], wherein the disease in which Regnase-1 is involved is at least one disease selected from the group consisting of inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections. [B6] A composition described in any of [B1] to [B5], wherein the disease in which Regnase-1 is involved is a disease in which at least one factor selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB is involved in the formation, progression and / or continuation of the disease. [B7] A composition described in any of [B1] to [B6], wherein the disease in which Regnase-1 is involved is a disease in which at least one factor selected from the group consisting of IL-17, IL-1, IL-36 and TLR ligands is involved in the formation, exacerbation and / or continuation of the disease. [B8] A composition described in any of [B1] to [B7], wherein the disease in which Regnase-1 is involved is a disease in at least one tissue or organ selected from the group consisting of the kidneys, lungs, skin, blood vessels, eyes, brain, and nerves. [B9] The composition described in any one of [B1] to [B8], wherein the disease in which Regnase-1 is involved is a TH17 cell-associated disease. [B10] A composition described in any of [B1] to [B9], wherein the disease in which Regnase-1 is involved is at least one disease selected from the group consisting of multiple sclerosis, psoriasis, scleroderma, nephritis, uveitis, pulmonary fibrosis, renal fibrosis, vascular fibrosis, keloid, rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, pneumonia, dermatitis, vasculitis, neuritis, arthritis, ocular inflammation, encephalomyelitis, and asthma. [B11] The composition described in any one of [B1] to [B10], wherein the disease in which Regnase-1 is involved is a disease accompanied by fibrosis of cells, tissues, or organs. [B12] The composition described in any one of [B1] to [B10], wherein the disease in which Regnase-1 is involved is a disease accompanied by epithelial hyperplasia. [B13] A composition described in any one of [B1] to [B12] for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB. [B14] The composition according to any one of [B1] to [B13], for suppressing the production of inflammatory factors. [B15] A composition for suppressing inflammation, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B16] A composition for suppressing fibrosis of cells, tissues or organs, or epithelial hyperplasia, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B17] A composition for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B18] A composition for suppressing the production of inflammatory factors, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B19] A composition described in any of [B1] to [B18], wherein the positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1, respectively, are (i) positions 513, 494, 439, and 435 of SEQ ID NO: 1; or (ii) positions 516, 497, 442, and 438 of SEQ ID NO: 2. [B20] A composition described in any of [B1] to [B19], which contains a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1. [B21] The composition described in [B20], wherein the positions corresponding to positions 513 and 494 of SEQ ID NO: 1, respectively, are (i) positions 513 and 494 of SEQ ID NO: 1; or (ii) positions 516 and 497 of SEQ ID NO: 2. [B22] The composition described in any of [B3] to [B21], wherein the at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. [B23] The composition described in any one of [B1] to [B22], wherein the Regnase-1 is mammalian Regnase-1. [B24] The composition according to any one of [B1] to [B23], wherein the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1 is a Ser residue selected from the group consisting of the following (i) and (ii): (i) Ser residues at either or both of the positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Ser residues at either or both of the positions corresponding to positions 439 and 435 of SEQ ID NO: 1 in Regnase-1. [B25] The composition described in any of [B1] to [B24], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is TBK1 and IKK. [B26] The composition described in any one of [B1] to [B25], wherein the Regnase-1 binding molecule is a Regnase-1 binding molecule described in any one of [H1] to [H24].

[0009] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [D1] A method for identifying a substance that inhibits the phosphorylation of Regnase-1, using phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439 and 435 of SEQ ID NO: 1 as an indicator. [D2] The method according to [D1], comprising the following steps (a) and (b): (a) mixing Regnase-1 with a kinase capable of phosphorylating Regnase-1 in the presence of a test substance, and detecting the phosphorylation of Regnase-1 by the kinase; (b) identifying a substance that inhibits phosphorylation of Regnase-1 by said kinase compared to the absence of the test substance; [D3] The method described in [D1] or [D2], wherein the kinase is a kinase capable of phosphorylating a Ser residue at at least one position selected from the group consisting of positions corresponding to each of positions 513, 494, 439 and 435 of SEQ ID NO: 1. [D4] The method according to any one of [D1] to [D3], wherein the kinase is at least one kinase selected from the group consisting of TBK1, IKKi, IKK, and IRAK. [D5] A method described in any of [D1] to [D4], wherein the detection of phosphorylation of Regnase-1 in step (a) is carried out using an antibody capable of detecting phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439 and 435 of SEQ ID NO: 1. [D6] A method described in any of [D1] to [D5], wherein the Regnase-1 is human Regnase-1, and the positions corresponding to positions 513, 494, 439, and 435, respectively, of SEQ ID NO: 1 are positions 516, 497, 442, and 438, respectively, of SEQ ID NO: 2. [D7] A method according to any one of [D1] to [D6], which uses phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 as an indicator. [D8] The method described in any of [D2] to [D7], wherein the test substance is a Regnase-1 binding molecule.

[0010] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [E1] A composition for identifying a substance that inhibits the phosphorylation of Regnase-1, the composition comprising a predetermined amount of a kinase and Regnase-1. [E2] The composition described in [E1], wherein the kinase is at least one kinase selected from the group consisting of TBK1, IKKi, IKK, and IRAK. [E3] A composition described in [E1] or [E2], wherein the phosphorylation of Regnase-1 is phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439 and 435 of SEQ ID NO: 1. [E4] A composition described in any of [E1] to [E3], wherein the Regnase-1 is human Regnase-1, and the positions corresponding to positions 513, 494, 439, and 435, respectively, of SEQ ID NO: 1 are positions 516, 497, 442, and 438, respectively, of SEQ ID NO: 2. [E5] A composition described in any of [E1] to [E4], wherein the phosphorylation of Regnase-1 is phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1. [E6] The composition described in any of [E1] to [E5], further comprising a Regnase-1 binding molecule.

[0011] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [F1] A method for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK, comprising the following steps (a) and (b): (a) mixing at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK with Regnase-1 in the presence of a test substance, and measuring the binding activity of the binding molecule with Regnase-1; (b) identifying a substance that can reduce the binding activity of the binding molecule to Regnase-1 compared to the absence of the test substance; [F2] The method described in [F1], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. [F3] A composition for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK, the composition comprising a predetermined amount of the binding molecule and Regnase-1. [F4] A method for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK, and inhibits the phosphorylation of Regnase-1, comprising the method described in any of [D1] to [D8] and the method described in [F1] or [F2]. [F5] A method according to any one of [F1], [F2] and [F4], wherein the test substance is a Regnase-1 binding molecule.

[0012] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [G1] An antibody that specifically recognizes Regnase-1 in which the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439 and 435 of SEQ ID NO: 1 is phosphorylated. [G2] An antibody that specifically recognizes Regnase-1 in which the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 is phosphorylated. [G3] An antibody that specifically recognizes Regnase-1 in which the Ser residue corresponding to position 513 of SEQ ID NO: 1 is phosphorylated. [G4] An antibody that specifically recognizes Regnase-1 in which the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 439 and 435 of SEQ ID NO: 1 is phosphorylated. [G5] An antibody that specifically recognizes Regnase-1 in which the Ser residues at positions corresponding to positions 439 and 435 of SEQ ID NO: 1 are phosphorylated. [G6] An antibody that specifically recognizes human Regnase-1 in which the Ser residue at at least one position selected from positions 516, 497, 442, and 438 of SEQ ID NO: 2 is phosphorylated. [G7] An antibody that specifically recognizes human Regnase-1 in which the Ser residue at at least one position selected from positions 516 and 497 of SEQ ID NO: 2 is phosphorylated. [G8] An antibody that specifically recognizes human Regnase-1 in which the Ser residue at position 516 of SEQ ID NO: 2 is phosphorylated. [G9] An antibody that specifically recognizes human Regnase-1 in which the Ser residue at at least one position selected from positions 442 and 438 of SEQ ID NO: 2 is phosphorylated. [G10] An antibody that specifically recognizes human Regnase-1 in which the Ser residues at positions 442 and 438 of SEQ ID NO: 2 are phosphorylated. [G11] An antibody according to any one of [G1] to

[10] , which can bind to both human Regnase-1 and mouse Regnase-1.

[0013] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [H1] A Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [H2] Regarding binding to Regnase-1, the following PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag were used: TIFF0007778301000001.tif244170TIFF0007778301000002.tif246170TIFF0007778301000003.tif249170TIFF0007778301000004.tif234170TIFF0007778301000005.tif68170TIFF0007778301000006.tif108170TIFF0007778301000007.tif88170TIFF0007778301000008.tif77170, or an antibody (i) an antibody (REA0023) comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 20 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 21; (ii) an antibody (REA0027) comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 22 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 23; (iii) an antibody (REB0007) comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 24 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 25; (iv) an antibody (REB0014) comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 26 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 27; and (v) An antibody (REB0022) comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 28 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 29. competes with at least one antibody selected from A Regnase-1 binding molecule described in [H1]. [H3] A Regnase-1 binding molecule according to [H1] or [H2], which competes with compound PP7 for binding to Regnase-1. [H4] A Regnase-1-binding molecule according to any one of [H1] to [H3], which competes with compound PP23 for binding to Regnase-1. [H5] A Regnase-1-binding molecule according to any one of [H1] to [H4], which competes with compound PP10 for binding to Regnase-1. [H6] A Regnase-1 binding molecule according to any one of [H1], [H2], [H4], or [H5], which does not compete with compound PP7 for binding to Regnase-1. [H7] A Regnase-1 binding molecule according to any one of [H1] to [H3], [H5], or [H6], which does not compete with compound PP23 for binding to Regnase-1. [H8] A Regnase-1 binding molecule according to any one of [H1] to [H4], [H6], or [H7], which does not compete with compound PP10 for binding to Regnase-1. [H9] A Regnase-1-binding molecule according to any one of [H1] to [H8], which specifically binds to Regnase-1. [H10] A Regnase-1 binding molecule described in any of [H1] to [H9], wherein the positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1, respectively, are (i) positions 513, 494, 439, and 435 of SEQ ID NO: 1; or (ii) positions 516, 497, 442, and 438 of SEQ ID NO: 2. [H11] A Regnase-1-binding molecule according to any one of [H1] to [H10], which inhibits phosphorylation of Ser residues (i) and (ii) below: (i) Ser residues at either or both of the positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Ser residues at either or both of the positions corresponding to positions 439 and 435 of SEQ ID NO: 1 in Regnase-1. [H12] A Regnase-1 binding molecule described in any of [H1] to [H11], which inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1. [H13] A Regnase-1 binding molecule described in any of [H1] to [H12], which inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 439 and 435 of SEQ ID NO: 1. [H14] A Regnase-1 binding molecule according to any of [H1] to [H13], which binds to Regnase-1 at the same site on Regnase-1 as the binding site on Regnase-1 to which a compound selected from compounds PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag, or an antibody selected from antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 binds. [H15] A Regnase-1-binding molecule according to any one of [H1] to [H14], which binds to Regnase-1 at the same site on Regnase-1 as the binding site to which compound PP7 binds. [H16] A Regnase-1-binding molecule according to any one of [H1] to [H15], which binds to Regnase-1 at the same site on Regnase-1 as the binding site to which compound PP23 binds. [H17] A Regnase-1-binding molecule according to any one of [H1] to [H16], which binds to Regnase-1 at the same binding site on Regnase-1 as that to which compound PP10 binds. [H18] A Regnase-1 binding molecule described in any of [H1] to [H17], wherein the Ser residue is a Ser residue contained in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1. [H19] A Regnase-1 binding molecule described in any of [H1] to [H18], which inhibits the binding of Regnase-1 to at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [H20] A Regnase-1 binding molecule described in any of [H1] to [H19], wherein the phosphorylation is phosphorylation that can be induced by at least one molecule selected from the group consisting of IL-17 and IL-1. [H21] A Regnase-1 binding molecule that inhibits the binding of Regnase-1 to at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [H22] A Regnase-1 binding molecule described in any of [H1] to [H21], which binds to amino acid residues contained in the amino acid sequence of positions 544 to 596 shown in SEQ ID NO: 1 or the amino acid sequence of positions 547 to 599 shown in SEQ ID NO: 2. [H23] The Regnase-1 binding molecule according to any one of [H1] to [H22], which is a cyclic polypeptide. [H24] The Regnase-1-binding molecule according to any one of [H1] to [H22], which is an antibody.

[0014] Furthermore, the present invention includes the following in one non-limiting specific embodiment. [I1] A method for treating and / or preventing a disease associated with Regnase-1, comprising administering a composition described in any of [B1] to [B26] or a Regnase-1 binding molecule described in any of [H1] to [H24] to a subject in need thereof (wherein the subject in need thereof may be a subject suffering from or at risk of suffering from the disease associated with Regnase-1). [I2] Use of a composition described in any of [B1] to [B26] or a Regnase-1 binding molecule described in any of [H1] to [H24] in the manufacture of a pharmaceutical for the treatment and / or prevention of a disease in which Regnase-1 is involved. [I3] A composition described in any of [B1] to [B26] or a Regnase-1 binding molecule described in any of [H1] to [H24] for use in the treatment and / or prevention of a disease in which Regnase-1 is involved. [Brief explanation of the drawings]

[0015] [Figure 1-1] 1 shows a comparison of the amino acid sequences of mouse Regnase-1 (SEQ ID NO: 1) and human Regnase-1 (SEQ ID NO: 2). Q5D1E7 and Q5D1E8 represent Uniprot accession numbers. [Figure 1-2](A) Method for generating Regnase-1 S435A / S439A amino acid substitution mutant (Regnase-1AA / AA) mice. Schematic diagrams of the wild-type Regnase-1 gene (top), targeting vector (center), and predicted mutant allele (bottom) are shown. The targeting vector contains the S435A and S439A mutations in exon 6. (B) Sequencing results of Regnase-1 exon 6 in the Regnase-1AA / AA mouse genome are shown. The sequence chromatogram shows that TCA and TCC at Ser435 and Ser439 have been replaced by GCA and GCC, respectively. [Figure 1-3] (C) Immunoblot analysis of NFκB, phospho-NFκB, IκB, phospho-IκB, MAPK p38, phospho-MAPK p38, ERK1, phospho-ERK1, JNK, and phospho-JNK in wild-type and Regnase-1AA / AA macrophages stimulated with LPS (100 ng / ml) for 0 to 240 min. [Figure 1-4] (D) IL-6, IL-12, and TNF-α production by wild-type and Regnase-1AA / AA macrophages stimulated with low concentrations of LPS (10 ng / ml), CpG (0.1 μM), or Pam3Csk4 (10 ng / ml) for 24 hours. Cytokine production in cell supernatants was assessed by ELISA. Error bars represent mean ± SEM. ***P < 0.005. [Figure 2-1](A) Clinical scores of EAE in wild-type (filled circles; n = 15) and Regnase-1AA / AA mice (filled squares; n = 12). (B) Histological analysis of CD4+ T cell infiltration into the spinal cord. Frozen sections were stained with hematoxylin-eosin (top row) and anti-CD3ε (bottom row). Arrows indicate inflammatory cell infiltration. Scale bar, 200 μm. (C) Number of CD4+ T cells in the spinal cord (1.0 x 10 cells) 15 days after immunization. Analysis was performed using flow cytometry. (D) Clinical scores of EAE in chimeric mice generated by (i) intravenous injection of wild-type bone marrow cells into wild-type or Regnase-1AA / AA mice (n = 8 in each group) or (ii) intravenous injection of wild-type or Regnase-1AA / AA bone marrow cells into wild-type mice (n = 12 in each group). [Figure 2-2] (E and F) Histological analysis of endothelial cell inflammation in wild-type and Regnase-1AA / AA mice. 12 hours after intravenous injection of pathogenic CD4+ T cells (1.5 x 107 cells / mouse), sections of the spleen (E) and lumbar spinal cord V (F) were prepared and stained with anti-type IV collagen and anti-phospho-STAT3 antibodies. Black and white arrows indicate phospho-STAT3-positive and -negative endothelial cells, respectively. Scale bar, 50 μm. (G and H) The relative number of anti-phospho-STAT3-positive cells among vascular endothelial cells (type IV collagen-positive) was measured in the spleen (H) and lumbar spinal cord V (I). (I) qPCR analysis of IL-6, Regnase-1, CXCL-1, CXCL2, and CCL-20 mRNA in wild-type and Regnase-1AA / AA MEFs. Cells were stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0–24 hours. Error bars represent mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.005. [Figure 3-1](A) Flow cytometry analysis of CD4+ T cell subsets (TH1, TH17, and iTreg) differentiated from naive CD4+ T cells under in vitro conditions. (B) qPCR analysis of IL-6, TNF-α, CXCL-1, and CXCL2 mRNA in wild-type and Regnase-1AA / AA liver sinusoidal endothelial cells (LSECs) after stimulation with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0 to 24 hours. [Figure 3-2] (C) Production of IL-6, CXCL-1, and CXCL-2 by mouse LSECs in response to 24-hour exposure to IL-6 (20 ng / ml), TNF-α (20 ng / ml), IL-17A (50 ng / ml), IL-6 + IL-17A, or TNF-α + IL-17A was assessed by ELISA in the cell supernatant. [Figure 4] (A) Thickness of the applied area on the ears of wild-type and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 5 mice per group). (B) Macroscopic findings of the dorsal neck skin of wild-type and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 5 mice per group). [Figure 5] (A) Histopathological images of the skin at the application site of the ear in wild-type and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (hematoxylin-eosin stained specimens) (neutrophil infiltration (*); microabscesses (arrowheads)). (B) Epidermal thickness at the application site of the ear in wild-type and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard deviation; 5 mice per group). [Figure 6] This shows changes in the expression levels of various genes in the skin at the application site of the ear in wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (normalized by B2m expression levels). [Figure 7](A) Serum creatinine levels and urinary total protein to creatinine ratios in wild-type and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model (Mann-Whitney U test; ****: p<0.0001). (B) Hydroxyproline levels per kidney weight in wild-type and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model (Mann-Whitney U test; ***: p<0.001). [Figure 8] (A) Changes in Col1a1 and Acta-2 expression in the kidneys of wild-type and Regnase-1 AA mutant mice in an anti-GBM antibody-induced nephritis model (normalized to GAPDH expression, Mann-Whitney U test; **:p<0.01, ***:p<0.001). (B) Changes in gene expression in the kidneys of wild-type and Regnase-1 AA mutant mice in an anti-GBM antibody-induced nephritis model (normalized to GAPDH expression, Mann-Whitney U test; **:p<0.01, ***:p<0.001, ****:p<0.0001). (C) Changes in blood cell counts (white blood cells, neutrophils, and monocytes per μL of blood) in wild-type and Regnase-1 AA mutant mice in an anti-Glomerular Basement Membrane Antibody-induced nephritis model (Mann-Whitney U test; **: p<0.01, ****: p<0.0001). [Figure 9] (A) Histopathological images of the kidneys of wild-type and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model (hematoxylin-eosin stained specimens). (B) The percentage of glomerular lesions in wild-type and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model (mean and standard deviation; 15 mice per group). (C) Histopathological images of the lungs of wild-type and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model (hematoxylin-eosin stained specimens). [Figure 10](A) Hydroxyproline levels per skin weight in wild-type and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model. (B) Histopathological images of lungs in wild-type and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model (hematoxylin-eosin stained specimens). (C) Changes in Col1a1 expression levels in lungs in wild-type and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model (normalized by GAPDH expression, Mann-Whitney U test; **: p<0.01). [Figure 11-1] The graph shows the results of pathological analysis in a mouse model of experimental autoimmune uveitis. WTNC indicates wild-type mice without pathology induction, WTDC indicates wild-type mice with pathology induction, AANC indicates Regnase-1 AA mutant mice without pathology induction, and AADC indicates Regnase-1 AA mutant mice with pathology induction. (A) The inflammatory scores in both eyes of mice administered 140 nmol of peptide. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the inflammatory score (mean ± standard error). (B) The inflammatory scores in both eyes of mice administered 280 nmol of peptide. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the inflammatory score (mean ± standard error). [Figure 11-2] (C) Structural damage scores in both eyes of mice administered 140 nmol of peptide. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the structural damage score (mean ± standard error). (D) Structural damage scores in both eyes of mice administered 280 nmol of peptide. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the structural damage score (mean ± standard error). [Figure 12-1](A) Immunoblot analysis of Regnase-1 in IL-17-stimulated wild-type and Regnase-1AA / AA MEFs. The two arrows indicate the phosphorylated (top) and unphosphorylated (bottom) forms of Regnase-1. (B) Immunoblot analysis of Regnase-1 in IL-17-stimulated wild-type and MEFs lacking each molecule. (C) Immunoblot analysis of Regnase-1 in IL-17-stimulated wild-type MEFs in the presence of BX795 (50 μM). [Figure 12-2](D) In ​​vitro phosphorylation of Regnase-1 by TBK1 and IKKi. Purified Regnase-1 from Regnase-1-deficient MEFs expressing the FLAG-tagged Regnase-1 AA mutant was incubated with recombinant TBK1 and / or IKKi for 3 hours in the presence or absence of γ-phosphatase. Regnase-1 phosphorylation was analyzed by Western blotting (i) and [32P]-autoradiography (ii). Arrows indicate phosphorylated Regnase-1. (E) Immunoblot analysis of FLAG-tagged Regnase-1 in HEK293 cells transfected with FLAG Regnase-1, Myc-tagged Act-1, Myc-tagged Act-1 mutant (Myc-Act1 ΔSEFIR), HA-tagged TBK1, and HA-tagged IKKi. (F) Co-immunoprecipitation of full-length or N- or C-terminally truncated Regnase-1 with Act1. FLAG-tagged Regnase-1 variants were co-immunoprecipitated with Myc-tagged Act1. The eluted proteins were subjected to immunoblot analysis using anti-FLAG and anti-Myc antibodies. (G and H) Co-immunoprecipitation of FLAG-tagged Regnase-1, Myc-tagged Act-1 variants (full-length and C-terminally truncated), HA-tagged TBK1, and HA-tagged IKKi. Cell lysates from HEK293 transfectants were mixed as indicated and co-immunoprecipitated with anti-Myc-coated beads (G) or anti-FLAG M2 agarose beads (H). The eluted proteins were subjected to immunoblot analysis using anti-FLAG, anti-Myc, anti-HA, and anti-actin antibodies. [Figure 12-3] (I) Immunoblot analysis of Regnase-1, IκB, phospho-IκB, NFκB, and phospho-NFκB expression in wild-type and Regnase-1AA / AA MEFs stimulated with IL-17A. (J) Immunoblot analysis of Regnase-1 expression in wild-type, Regnase-1AA / AA, TBK1 / IKKi double-deficient, Act1-deficient, and IRAK1 / IRAK2 double-deficient MEFs stimulated with IL-1β. [Figure 13-1] (A) Schematic diagram of Regnase-1 domains and mapping of phosphorylation sites by IKK (IKKα and IKKβ) and TBK1 / IKKi. (B) Immunoblot analysis of Regnase-1 in HeLa cells transfected with Regnase-1 mutants (wild-type, S494A, T505A / S508A, S513A, and S494A / S513A). Cells were stimulated with IL-1β (10 ng / ml) and IL-17A (50 ng / ml) for 1 hour. [Figure 13-2] (C) (i) Schematic of the GST-fused Regnase-1 (440-598) construct. (ii) Gel filtration results of wild-type and mutant (S494E / S513E or S494E / T505E / S508E / S513E) Regnase-1 (440-598). The molecular weight of each elution peak was estimated using molecular weight standard markers and defined as multimer (Mw: ∞), hexamer (Mw: 120 kDa), trimer (Mw: 60 kDa), or monomer (Mw: 20 kDa). (iii) Quantification of the eluted fractions (multimer + hexamer, trimer, and monomer) as a percentage of the total eluted protein. [Figure 13-3] (D) Immunoblotting of Regnase-1. Regnase-1 was obtained from Regnase-1-deficient MEFs expressing a FLAG-tagged Regnase-1 AA mutant and stimulated with IL-1β (10 ng / ml) and IL-17A (50 mg / ml) for 1 hour. Purified Regnase-1 was analyzed by native-PAGE and Western blotting. (E) Immunoblotting of Regnase-1 phosphorylated by TBK1 and IKKi. Purified Regnase-1 was incubated with GST-fused TBK1 and / or IKKi for 3 hours in the presence or absence of γ-phosphatase. Proteins were separated by native-PAGE and SDS-PAGE and analyzed by Western blotting of Regnase-1. [Figure 14-1](A and B) Immunoblot analysis of subcellular organelle fractions shows the expression of Regnase-1, ribosomal protein L7a (rpL7a; an ER marker), and GAPDH (a cytoplasmic marker) in cell homogenates, soluble cytosolic fractions, microsomes, and rough ER membranes. Fractions were prepared from Regnase-1AA / AA MEFs stimulated with IL-1β (10 ng / ml) and IL-17A (50 ng / ml) for 1 hour each (A), and from Regnase-1AA / AA and Act1-deficient MEFs stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 1 hour each (B). Arrows indicate the phosphorylated (top) and unphosphorylated (bottom) forms of Regnase-1. (C) Immunoblot analysis of Regnase-1 and rpL7a in rough ER membranes prepared from wild-type and Regnase-1AA / AA MEFs stimulated with IL-17A (50 ng / ml) for 0 to 8 hours. [Figure 14-2] (D) FLAG-tagged Regnase-1 was immunoprecipitated from the organelle fraction of Regnase-1-deficient MEFs expressing the FLAG-tagged Regnase-1 AA mutant, stimulated with or without IL-17A (50 ng / ml) for 1 hour. The immunoprecipitates were subjected to immunoblot analysis for Regnase-1, TBK1, phospho-TBK1, IKKi, and phospho-IKKi. (E) Immunoblot analysis of Regnase-1, phospho-TBK1, phospho-IKKi, and rpL7a in ER membrane fractions isolated from wild-type and Act1-deficient MEFs. Cells were stimulated with IL-17A (50 ng / ml) for 0, 1, and 8 hours. [Figure 15-1](A) Immunoblotting and quantitative PCR (qPCR) analysis of wild-type MEFs stimulated with TNF-α for 2 hours followed by IL-17A for 0-4 hours. (i) Cell lysates were analyzed by immunoblotting for Regnase-1. (ii) IL-6 mRNA expression in wild-type cells stimulated with a combination of TNF-α and IL-17A as described above. (B) IL-6 mRNA expression in wild-type and Regnase-1AA / AA and TBK1 / IKKi doubly deficient MEFs stimulated with TNF-α for 2 hours followed by IL-17A for 0-4 hours. [Figure 15-2] (C) (i) Autoradiography of IL-6 (top) and Actb (bottom) mRNA levels in Tet-off HEK293 cells cotransfected with the pTRE-tight-IL6-CDS+3'UTR vector along with control (Act1+IKKi), Regnase-1, or Regnase-1+Act1+IKKi expression plasmids. Total mRNA was prepared from cells treated with doxycycline for 0 to 4 hours and then subjected to Northern blotting using a [32P]-labeled probe. (ii) Relative IL-6 mRNA levels in Tet-off HEK293 cells during doxycycline treatment. (D) Immunoblot analysis of Regnase-1 in Regnase-1AA / AA MEFs. Cells were treated with IL-17A (50 ng / ml) for 1 hour and then incubated for 0–240 minutes in medium without IL-17A (control), medium containing cycloheximide (100 μM), or medium containing both cycloheximide and okadaic acid (0.5 μM). (E) qPCR analysis of IL-6 and TNF mRNA levels in Regnase-1AA / AA MEFs treated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 2 hours and then incubated for 0–180 minutes in medium containing ActD (5 μg / ml) or both ActD and okadaic acid (0.5 μM). qPCR data (A, B, and E) were pooled from four independent experiments. Error bars represent mean ± SEM. ***P < 0.005. [Figure 16-1](A) Immunoblot analysis of lysates from Regnase-1-deficient MEFs stably expressing FLAG-tagged Regnase-1ΔCTD / ΔCTD. Cells were stimulated with or without IL-17A for 1 hour and probed with anti-FLAG antibody. (B) Immunoblot analysis of Regnase-1 and β-actin in Regnase-1ΔCTD / ΔCTD MEFs stimulated with TNF-α, IL-17A, TNF-α + IL-17A, and IL-1β for 0 to 4 hours. Regnase-1 is indicated by an arrow. (C) Co-expression of FLAG-tagged wild-type Regnase-1 or Regnase-1ΔCTD with Act-1, TBK-1, and IKKi in HEK293 cells. Cell lysates were subjected to immunoblot analysis using anti-FLAG antibody. (D) Co-immunoprecipitation of FLAG-tagged wild-type Regnase-1, Regnase-1ΔCTD, and Myc-tagged Act-1. Cell lysates from HEK293 transfectants were mixed as described and co-immunoprecipitated with anti-FLAG M2 agarose beads. The eluted proteins were subjected to immunoblot analysis using anti-FLAG, anti-Myc, and anti-actin antibodies. [Figure 16-2] (E) Immunoblot analysis of Regnase-1, Rpl7a, GAPDH, and phospho-TBK-1 in intracellular organelles (homogenates, cytosol, and microsomes) isolated from wild-type and Regnase-1ΔCTD / ΔCTD MEFs after stimulation with 50 ng / ml IL-17A for 0, 1, and 4 hours. (F and G) Immunoblot analysis of polysome fractions. (F) UV absorbance profile (at 260 nm) of sucrose gradient fractions from MEF cell lysates. (G) Immunoblot analysis of Regnase-1 and Rpl7a in sucrose gradient fractions isolated from wild-type and Regnase-1ΔCTD / ΔCTD cell lysates. RpL7a is indicated by an arrow. [Figure 16-3](H) qPCR analysis of IL-6, TNF, LCN-2, and GM-CSF mRNA in wild-type, Regnase-1ΔCTD / +, and Regnase-1ΔCTD / ΔCTD MEFs. Cells were stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0–24 hours. (I) Clinical scores of EAE in wild-type (closed circles; n = 8) and Regnase-1ΔCTD / ΔCTD mice (closed squares; n = 8) over 28 days. (J and K) Flow cytometry analysis of spinal cord cells (1.0 × 106 cells) 28 days after immunization. (J) Populations of CD4+ T cells (top) and F4 / 80+ macrophages (bottom) in the spinal cord from wild-type and Regnase-1ΔCTD / ΔCTD mice are shown. (K) The cell counts of CD4+ T cells and F4 / 80 macrophages in (I) are shown (n = 5 in each group). Error bars represent the mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 16-4] (L) Immunoblot analysis of Regnase-1 and β-actin in Regnase-1 S513A MEFs stimulated with IL-1β, IL-17A, or TNF-α for 0 to 4 hours. (M) Immunoblot analysis of Regnase-1 in wild-type, Regnase-1AA / AA, and Regnase-1 S513A MEFs. Cells were stimulated with TNF-α, IL-1β, LPS, or IL-17A for 0 to 120 minutes in the presence of the transcriptional inhibitor cycloheximide. [Figure 16-5] (N) Quantitation of Regnase-1 protein measured by immunoblotting and normalized to β-actin (control) is shown, along with the calculated half-life of Regnase-1 protein. [Figure 17-1](A) Schematic diagram of wild-type Regnase-1 (top) and 1-bp deleted Regnase-1 (bottom). The CRISPR-Cas9 targeting site is located in the proline-rich region of Regnase-1. The amino acid sequence introduced by the frameshift mutation and the premature stop codon 146 bases downstream from the mutation are underlined. (B) Sequencing of Regnase-1 exon 6 in a mouse genome mutated with the CRISPR-Cas9 system. The sequence chromatogram shows the deletion of a cytosine base at Pro517 to initiate the frameshift mutation. (C) Schematic diagram of wild-type Regnase-1 (top) and S513A mutant Regnase-1 (bottom). The CRISPR-Cas9 targeting site is located at Ser513 of Regnase-1. (D) Sequencing of Regnase-1 exon 6 in a mouse genome mutated with the CRISPR-Cas9 system. The sequence chromatogram shows a TAC to TAT substitution at Tyr511 (nonsense mutation) and a TCT to GCT substitution at Ser513 (S513A mutation). [Figure 17-2] (C) qPCR analysis of IL-6, TNF, CXCL-1, CXCL-2, CCL-5, CCL20, LCN-2, and GM-CSF expression in wild-type, Regnase-1ΔCTD mutant, and TBK1 / IKKi double-deficient MEFs. Error bars represent mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 17-3] (D) IL-6, CXCL-1, and CXCL-2 production by wild-type and Regnase-1ΔCTD / ΔCTD MEFs in response to exposure to IL-6 (20 ng / ml), TNF-α (20 ng / ml), IL-17A (50 ng / ml), IL-6 + IL-17A, or TNF-α + IL-17A for 24 hours. Protein production in cell supernatants was assessed by ELISA. Error bars represent mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 17-4](E) qPCR analysis of IL-6, TNF, Regnase-1, and LCN-2 mRNA in wild-type, Regnase-1ΔCTD / ΔCTD, and Regnase-1 S513A MEFs. Cells were stimulated with TNF-α and IL-17A for 0 to 24 hours. (F) qPCR analysis of IL-6, TNF, CXCL-1, CXCL-2, CCL-5, CCL-20, LCN-2, and GM-CS mRNA in wild-type, Regnase-1ΔCTD / ΔCTD, and TBK1 / IKKi double-deficient MEFs. Cells were stimulated with TNF-α (20 ng / ml) for 2 hours, followed by IL-17A (50 ng / ml) for 0 to 4 hours. [Figure 18] (A) Flow cytometry analysis of CD4+ T cell subsets (TH1 and TH17) in (1) lymph node cells (1.0 × 106 cells) and (2) splenocytes (1.0 × 106 cells) from wild-type and Regnase-1ΔCTD / ΔCTD mice 28 days after EAE immunization. (B) Numbers of TH1 and TH17 cells in (A) are shown (n = 5 per group). Error bars represent mean ± SEM. *P < 0.05. [Figure 19-1] The results of luciferase assays for each target gene are shown. The measured firefly luciferase activity was normalized to the internal standard Renilla luciferase activity and pGL3-empty plasmid. Error bars represent the standard deviation (SD) of two sets. [Figure 19-2] This is a figure showing a continuation of Figure 19-1. [Figure 19-3] This is a figure showing the continuation of Figure 19-2. [Figure 19-4] This is a figure showing the continuation of Figure 19-3. [Figure 19-5] This is a figure showing a continuation of Figure 19-4. [Figure 20] The results of detecting phosphorylated Regnase-1 by Western blotting are shown. [Figure 21](A) (i) Immunoblot analysis of Regnase-1 in cell organelle fractions (cell homogenates, cytosolic fractions, and microsomes) prepared from the following mutant MEF cell lines: wild-type, Regnase-1 S513A (Ser513 replaced by Ala), and Regnase-1 ΔCTD (lacking the C-terminal domain) stimulated with IL-1β (10 ng / ml) or IL-17A (50 mg / ml) for 1 hour. (ii) Microsome-bound Regnase-1 protein levels were assessed as a percentage of total cell homogenate. (B) qPCR analysis of IL-6 and TNF mRNA in wild-type, Regnase-1 S513A, and Regnase-1 ΔCTD MEFs co-stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0–4 hours. [Figure 22] (A) Thickness of the applied area on the ear pinnae of wild-type and Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 6 mice per group). (B) Total score of macroscopic findings in the dorsal neck skin of wild-type and Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 6 mice per group). [Figure 23] The synthesis scheme for peptide compounds is shown below. It mainly consists of five steps: (1) peptide elongation reaction on the resin, (2) peptide cleavage from the resin, (3) peptide cyclization reaction, (4) deprotection of functional groups on the peptide side chains, and (5) peptide purification. [Figure 24] The results of detecting phosphorylated Regnase-1 using AlphaScreen are shown. Regnase-1 was phosphorylated by reacting kinase (IKKβ or TBK1) with Regnase-1 in the presence of ATP. After the reaction, Regnase-1 was reacted with an antibody against phosphorylated Regnase-1, and the amount of binding was measured using AlphaScreen. The left side of the figure shows the results when IKKβ was used, and the right side shows the results when TBK1 was used. [Figure 25-1]The results of compound-mediated inhibition of phosphorylation of full-length Regnase-1 (FL_Reg1) are shown. FL_Reg1 was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and then Regnase-1 was phosphorylated by TBK1. The resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 25-2] The results of compound-mediated inhibition of phosphorylation of full-length Regnase-1 (FL_Reg1) are shown. FL_Reg1 was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and then phosphorylation of Regnase-1 by IKKβ was performed. The amount of phosphorylated Regnase-1 produced was measured by AlphaScreen. [Figure 26-1] This shows the results of compound-mediated inhibition of phosphorylation of C-terminal domain-deleted Regnase-1 (ΔCTD_Reg1). ΔCTD_Reg1 was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and Regnase-1 was phosphorylated by TBK1. The resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 26-2] This figure shows the results of compound-mediated inhibition of phosphorylation of C-terminal domain-deleted Regnase-1 (ΔCTD_Reg1). ΔCTD_Reg1 was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and then phosphorylation of Regnase-1 by IKKβ was performed. The resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 27-1] The results of compound inhibition of the binding of kinases to Regnase-1 are shown. Full-length Regnase-1 (FL_Reg1) was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and then TBK1 was added. The binding of TBK1 to Regnase-1 was measured by AlphaScreen. [Figure 27-2]The results of compound inhibition of the binding of kinases to Regnase-1 are shown. Full-length Regnase-1 (FL_Reg1) was mixed with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and then IKKβ was added. The binding of IKKβ to Regnase-1 was measured by AlphaScreen. [Figure 28] The effect of compounds on the RNA degradation activity of wild-type Regnase-1 is shown. After adding a compound (PP1, PP2, PP3, PP4, PP5, or PP6) to a mixture of RNA and wild-type Regnase-1 and allowing the reaction to proceed, the RNA concentration in the reaction mixture was measured. [Figure 29] The effect of compounds on the RNA degradation activity of mutant Regnase-1 (D141N) is shown. After adding a compound (PP1, PP2, PP3, PP4, PP5, or PP6) to a mixture of RNA and mutant Regnase-1 (D141N), the RNA concentration in the reaction mixture was measured. [Figure 30] This shows the effect of compounds on the RNA degradation activity of wild-type Regnase-1. After adding compounds (PP7 to PP25) to a mixture of RNA and wild-type Regnase-1 and allowing the reaction to proceed, the RNA concentration in the reaction mixture was measured. [Figure 31] The effect of compounds on the RNA degradation activity of mutant Regnase-1 (D226N, D244N) is shown. After the compounds (PP7 to PP25) were added to a mixture of RNA and mutant Regnase-1 (D226N, D244N) and the reaction was allowed to proceed, the RNA concentration in the reaction mixture was measured. [Figure 32] The figure shows the binding of anti-Regnase-1 antibodies to human Regnase-1 peptides and full-length human Regnase-1. The anti-Regnase-1 antibodies used were REA0023, REA0027, REB0007, REB0014, and REB0022. Peptide 1 (CLDSGIGSLESQMSELWGVRGG) and peptide 2 (AFPPREYWSEPYPLPPPTC-NH2) in the figure are both partial peptides of human Regnase-1. FL_Reg1 represents full-length human Regnase-1. [Figure 33] The results of evaluating the inhibitory activity of anti-Regnase-1 antibodies against Regnase-1 phosphorylation are shown. (A) Western blotting results of Regnase-1 phosphorylation by each kinase (IKKβ or TBK1) are shown. (B) The inhibitory activity of anti-Regnase-1 antibodies (REA0023, REA0027) against Regnase-1 phosphorylation by IKKβ is shown. Anti-Regnase-1 antibodies were evaluated at final concentrations of 16.7 μg / ml and 5.0 μg / ml. (C) The inhibitory activity of anti-Regnase-1 antibodies (REB0007, REB0014, REB0022) against Regnase-1 phosphorylation by TBK1 is shown. Anti-Regnase-1 antibodies were evaluated at final concentrations of 16.7 μg / ml and 5.0 μg / ml. [Figure 34] This shows the effect of anti-Regnase-1 antibodies on the RNA degradation activity of wild-type Regnase-1. Anti-Regnase-1 antibodies (REA0023, REA0027, REB0007, REB0014, REB0022) were added to a mixture of RNA and wild-type Regnase-1, and the RNA concentration in the reaction mixture was then measured. [Figure 35] This shows the effect of anti-Regnase-1 antibodies on the RNA degradation activity of mutant Regnase-1 (D226N, D244N). Anti-Regnase-1 antibodies (REA0023, REA0027, REB0007, REB0014, REB0022) were added to a mixture of RNA and mutant Regnase-1 (D226N, D244N), and the RNA concentration in the reaction mixture was then measured. [Figure 36] The results of pathological analysis of wild-type and Regnase-1 AA mutant mice in an experimental autoimmune uveitis T cell transfer model are shown. (A) Fundus examination inflammation scores (mean ± standard error; 7 mice per group) are shown. Statistical analysis was performed by calculating the area under the curve for each individual and using the Mann-Whitney U test (***: P<0.001). (B) Histopathological analysis structural damage scores are shown. Statistical analysis was performed using the Mann-Whitney U test (*: P<0.05). [Figure 37]This shows changes in gene expression in the skin of wild-type and S513A mutant mice at the application site of the ear in an imiquimod-induced psoriasis model (normalized by B2m expression levels, mean ± standard error). "Non-disease" in the figure indicates mice in which pathology was not induced. [Figure 38] EAE clinical scores are shown for wild-type (filled circles; n = 10) and Regnase-1 S513A mutant mice (filled squares; n = 10). [Figure 39] 1 shows a synthetic scheme for a compound in which a GG-TFPI tag is attached to the C-terminus of a cyclic polypeptide. [Figure 40] 1 shows a synthetic scheme of Fmoc-Asp(O-Trt(2-Cl)-resin)-bMeAla-OAllyl (compound RS3). [Figure 41] The process for synthesizing cyclized product B from cyclized product A is shown below. [Figure 42] 1 shows the steps for synthesizing a cyclized product+GG-TFPI-tag compound from cyclized product B. [Figure 43] The structural information of the cyclized product + GG-TFPI-tag compound is shown. DETAILED DESCRIPTION OF THE INVENTION

[0016] 1.Definition As used herein, the term "Regnase-1" (also known as Zc3h12a or MCPIP-1) refers to any naturally occurring Regnase-1 from any vertebrate source, including mammals such as primates (e.g., humans), rodents (e.g., mice, rats), and the like, unless otherwise indicated. The term encompasses "full-length," unprocessed Regnase-1 as well as Regnase-1 resulting from processing in cells. The amino acid sequence of an exemplary mouse Regnase-1 is published under Uniprot Accession No. Q5D1E7 (SEQ ID NO: 1), and the amino acid sequence of an exemplary human Regnase-1 is published under Uniprot Accession No. Q5D1E8 (SEQ ID NO: 2). Literature describing Regnase-1 includes, for example, WO2010 / 098429; Nature Immunology, Vol. 12, Number 12, December 2011, pp. 1167-1175; Nature 458, 2009, pp. 1185-1190; Cold Spring Harbor Symposia on Quantitative Biology, Volume LXXVIII, 2013, pp. 51-60; and Biochimica et Biophysica Acta 1823, 2012, pp. 1905-1913. Regnase-1 as used herein is preferably mammalian Regnase-1.

[0017] As used herein, "Regnase-1-associated disease" refers to a disease in which Regnase-1 is involved in the formation, aggravation, and / or continuation of the disease. "Diseases in which Regnase-1 is involved in the formation, aggravation, and / or continuation of the disease" includes not only diseases in which Regnase-1 is directly involved in the formation, aggravation, and / or continuation of the disease, but also diseases in which Regnase-1 is indirectly involved. Without being limited thereto, "Regnase-1-associated disease" may refer to, for example, diseases in which destabilization and / or intracellular degradation of Regnase-1 is involved in the formation, aggravation, and / or continuation of the disease. "Regnase-1-associated disease" includes inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections. "Regnase-1-associated disease" may also be a TH17 cell-associated disease.

[0018] As used herein, an "inflammatory disease" is a disease or illness resulting from the overactivation of an individual's immune system. Inflammatory diseases can be caused by a pathological stage that results in inflammation, typically, but not limited to, leukocyte influx and / or neutrophil chemotaxis. Examples of such diseases include inflammatory skin diseases (including psoriasis and atopic dermatitis); systemic sclerosis; nephritis; reactions associated with inflammatory bowel disease (Crohn's disease and ulcerative colitis); surgical tissue reperfusion injury, myocardial ischemic conditions such as myocardial failure, heart failure, perfusion after cardiac surgery and perfusion after percutaneous transluminal coronary angioplasty, stroke, and ischemia-perfusion disease including abdominal aortic aneurysm; post-stroke cerebral edema; cranial trauma; hypovolemic shock; respiratory arrest; adult respiratory distress syndrome; acute lung injury; Behcet's disease; dermatomyositis; polymyositis; multiple sclerosis; dermatitis; meningitis; encephalitis; uveitis; ocular inflammation; diabetic retinopathy; diabetic macular edema; osteoarthritis; Lubes nephritis; diabetic nephropathy; rheumatoid arthritis; These conditions include autoimmune diseases such as eumatoid arthritis, Sjogren's syndrome, and vasculitis; spondyloarthritis (including ankylosing spondylitis and psoriatic arthritis); diseases involving leukocyte leakage; central nervous system (CNS) inflammatory diseases, multi-organ injury following sepsis or trauma; alcoholic hepatitis; bacterial pneumonia; antigen-antibody complex mediated diseases including glomerulonephritis; sepsis; sarcoidosis; graft rejection after tissue / organ transplantation; graft-versus-host disease; age-related macular degeneration; Kawasaki disease; eosinophilic esophagitis; neuritis; and pulmonary inflammation including pleuritis, alveolitis, pneumonia, chronic bronchitis, bronchiectasis, diffuse panbronchiolitis, hypersensitivity pneumonitis, idiopathic pulmonary fibrosis (IPF), and cystic fibrosis. Preferred conditions include acute lung injury, adult respiratory distress syndrome, ischemic perfusion (including surgical tissue perfusion injury, myocardial ischemia, and acute myocardial failure), hypovolemic shock, asthma, bacterial pneumonia, and inflammatory bowel diseases such as ulcerative colitis. Inflammatory diseases overlap in part with other categories of diseases such as autoimmune diseases, allergic diseases, and fibrotic diseases, and vice versa.

[0019] As used herein, "autoimmune disease" refers to a disease or disorder arising from and directed against an individual's own tissues. As used herein, autoimmune disease specifically excludes malignant or cancerous diseases or conditions, and specifically excludes B-cell lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), hairy cell leukemia, and chronic myeloblastic leukemia.Examples of autoimmune diseases or disorders include, but are not limited to, inflammatory responses such as inflammatory skin diseases, including psoriasis and dermatitis (e.g., atopic dermatitis); systemic sclerosis and sclerosis; responses associated with inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis); respiratory distress syndrome (including adult respiratory distress syndrome (ARDS)); dermatitis; meningitis; encephalitis; uveitis; ocular inflammation; colitis; glomerulonephritis; allergic conditions, such as eczema and asthma and other conditions involving T-cell infiltration and chronic inflammatory responses; atherosclerosis; leukocyte adhesion deficiency; rheumatoid arthritis; and systemic lupus erythematosus (SLE). (including, but not limited to, lupus nephritis, cutaneous lupus); diabetes (e.g., type 1 diabetes or insulin-dependent diabetes); multiple sclerosis; Raynaud's syndrome; autoimmune thyroiditis; Hashimoto's thyroiditis; allergic encephalomyelitis; autoimmune encephalomyelitis; Sjogren's syndrome; juvenile-onset diabetes; and immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T lymphocytes, typically seen in tuberculosis, sarcoidosis, polymyositis, granulomatosis, and vasculitis; pernicious anemia (Addison's disease); diseases associated with leukocyte leakage; and the central nervous system (CNS). Inflammatory disorders; multiple organ injury syndrome; hemolytic anemia (including, but not limited to, cryoglobulinemia or Coombs-positive anemia); myasthenia gravis; antigen-antibody complex-mediated disease; antiglomerular basement membrane disease; antiphospholipid syndrome; allergic neuritis; Graves' disease; Lambert-Eaton myasthenic syndrome; bullous pemphigoid; pemphigus; autoimmune polyendocrinopathy; Reiter's disease; stiff-man syndrome; Behçet's disease; giant cell arteritis; immune complex nephritis; IgA nephropathy; IgM polyneuropathy; immune thrombocytopenic purpura (ITP) or autoimmune thrombocytopenia. Autoimmune diseases overlap in part with other categories of diseases, such as inflammatory, allergic, and fibrotic disorders, and vice versa.

[0020] As used herein, the term "allergic disease" refers to any symptom, tissue damage, or loss of tissue function resulting from allergies. Allergic diseases include hypersensitivity disorders classified as immediate and delayed types, or allergic diseases classified as types I to IV. Examples of such diseases include, but are not limited to, type I allergies (e.g., systemic anaphylaxis, bronchial asthma, and hay fever), type II allergies (e.g., hemolysis in blood group-incompatible transfusions and autoimmune hemolytic anemia), type III allergies (e.g., serum sickness, glomerulonephritis, and rheumatoid arthritis), and type IV allergies (e.g., contact dermatitis, granulomas, and transplant rejection). Examples of allergic diseases include asthma, allergic encephalomyelitis, autoimmune encephalomyelitis, allergic neuritis, contact hypersensitivity, delayed hypersensitivity, airway hypersensitivity, atopic dermatitis, antigen-specific allergies such as hay fever, allergic rhinitis, and urticaria. Allergic diseases overlap to some extent with other categories of diseases such as autoimmune diseases, inflammatory diseases, and fibrotic diseases, and vice versa.

[0021] As used herein, a "TH17 cell-associated disease" refers to a disease in which TH17 cells play a certain role in the formation, aggravation, and / or continuation of the disease. Examples of such diseases include inflammatory diseases, autoimmune diseases, and allergic diseases in which TH17 cells are involved in the formation, aggravation, and / or continuation of the disease, including multiple sclerosis, rheumatoid arthritis, scleroderma, psoriasis, nephritis (e.g., glomerulonephritis), asthma, contact hypersensitivity, delayed hypersensitivity, and airway hypersensitivity.

[0022] As used herein, "fibrotic disease" refers to a condition involving the abnormal or excessive formation of fibrous connective tissue in a cell, organ, or tissue. Fibrotic diseases can occur as part of a repair or reaction process in a cell, tissue, or organ resulting from, for example, physical injury, inflammation, infection, etc. As used herein, the term "fibrotic disease" can be used interchangeably with the terms "fibrosis," "fibrotic disorder," and "fibrotic condition."

[0023] Examples of fibrotic diseases include, but are not limited to, vascular fibrosis, pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), skin fibrosis (e.g., scleroderma, post-traumatic, surgical skin scarring, keloids, and skin keloid formation), scleroderma, systemic sclerosis, liver fibrosis (e.g., after hepatitis C virus infection or liver transplant), kidney fibrosis (e.g., interstitial fibrosis in focal segmental glomerulosclerosis and nephrogenic systemic fibrosis), musculoskeletal fibrosis, and the like. fibrosis, cardiac fibrosis (e.g., endomyocardial fibrosis, idiopathic cardiomyopathy), splenic fibrosis, ocular fibrosis (e.g., ocular sclerosis, glaucoma, conjunctival and corneal scarring, and pterygium), progressive systemic sclerosis (PSS), chronic graft-versus-host disease, Peyronie's disease, connective tissue disease, post-cystoscopic urethral stricture, mediastinal fibrosis, idiopathic and pharmacologically induced retroperitoneal fibrosis, progressive severe fibrosis, proliferative fibrosis, neoplastic fibrosis, and fibrosis resulting from surgical implantation of artificial organs. Other diseases, disorders, and conditions associated with fibrosis include, for example, cirrhosis, which can lead to liver fibrosis, diffuse lung disease, post-vasectomy pain syndrome, tuberculosis, which can lead to pulmonary fibrosis, sickle cell anemia, which can lead to splenic enlargement and ultimately fibrosis, rheumatoid arthritis, and Crohn's disease, which can cause recurrent inflammation and healing of intestinal tissue, resulting in fibrosis of the intestinal wall. Fibrotic diseases also occur as a result of viral hepatitis, alcoholism, complications of hemochromatosis, Wilson's disease, schistosomiasis, biliary disorders, exposure to toxins, and metabolic disorders. Fibrotic diseases overlap in part with other categories of diseases, such as autoimmune, allergic, and inflammatory diseases, and vice versa.

[0024] As used herein, "RNA virus" refers to a virus having an RNA genome. RNA viruses include single-stranded RNA viruses (including positive-stranded RNA viruses and negative-stranded RNA viruses) and double-stranded RNA viruses. The term "RNA virus infection" refers to any disorder caused by an RNA virus invading the surface, local, or systemic space of a host. The host may be an individual as used herein.

[0025] As used herein, "treatment" (and its grammatical derivatives, such as "treat," "treating," etc.) refers to a clinical intervention intended to alter the natural course of the individual being treated and can be performed prophylactically or during the course of a clinical condition. Desirable effects of treatment include, but are not limited to, prevention of disease onset or recurrence, alleviation of symptoms, attenuation of any direct or indirect pathological effects of the disease, prevention of metastasis, reduction in the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, the Regnase-1-binding molecules of the present invention are used to delay the onset of disease or slow the progression of disease.

[0026] As used herein, "inhibiting the phosphorylation" of a molecule means reducing the degree to which a molecule is phosphorylated or preventing a molecule from being phosphorylated.

[0027] As used herein, "selectively inhibiting phosphorylation of Regnase-1" means inhibiting the phosphorylation of Regnase-1 while not inhibiting the phosphorylation of other molecules, or the degree of inhibition of phosphorylation of molecules other than Regnase-1 is smaller than the degree of inhibition of phosphorylation of Regnase-1 (for example, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less). In one embodiment, but not limited to, the phosphorylation of Regnase-1 may be selectively inhibited by inhibiting the phosphorylation of Regnase-1 using a Regnase-1-binding molecule. Note that "selectively inhibiting phosphorylation of Regnase-1" does not include an embodiment in which the phosphorylation of a substrate of Regnase-1 (including molecules other than Regnase-1) is non-selectively inhibited by inhibiting the activity of the kinase itself that phosphorylates Regnase-1.

[0028] As used herein, the term "equivalent position" can be used to characterize amino acid residues in the amino acid sequences of Regnase-1 from different sources (shared sources) or processed Regnase-1 by reference to mouse Regnase-1 (SEQ ID NO: 1). Alignment to determine equivalent positions can be achieved by various methods within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, Megalign (DNASTAR) software, or GENETYX® (Genetyx Corporation). Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum alignment across the entire length of the sequences being compared.

[0029] An alignment of the amino acid sequences of mouse and human Regnase-1 prepared using GENETYX® is shown in Figure 1. Table 1 shows the amino acid residues in human Regnase-1 at the corresponding positions for some amino acid residues in mouse Regnase-1.

[0030] [Table 1]

[0031] As used herein, "inhibiting inflammation" may mean that inflammation does not occur, that inflammation progresses slowly compared to an untreated control group, that existing inflammation is weakened, or that the extent of inflammation is reduced. One indicator of inflammation inhibition may be, but is not limited to, inhibition of the production of inflammatory factors.

[0032] As used herein, "inflammatory factors" encompass inflammatory cytokines and leukocyte chemotactic factors. Examples of inflammatory factors are disclosed herein.

[0033] As used herein, "targeting" or "targeting" Regnase-1 means that a molecule can be degraded by the RNase activity of Regnase-1, and whether or not a certain mRNA can be targeted by Regnase-1 can be confirmed, for example, by the method described in the "Activity Measurement Method" section of this specification.

[0034] As used herein, "inhibiting fibrosis" means reducing or eliminating fibrotic lesions in tissues where fibrosis has occurred, or slowing or preventing further progression of fibrosis (inhibiting the growth of fibrotic lesions).

[0035] As used herein, "epithelial hyperplasia" refers to a condition in which the number of normal cells arranged normally in epithelial tissue is abnormally increased. Epidermal hyperplasia is known to be a characteristic of many disorders, including psoriasis. As used herein, "inhibiting epithelial hyperplasia" means reducing the number of increased normal cells in epithelial tissue, or slowing or preventing their further proliferation.

[0036] As used herein, "inhibiting keratinocyte proliferation" means reducing the number of keratinocytes or slowing or preventing their further proliferation. Whether a substance inhibits keratinocyte proliferation can be verified, for example, by histological examination.

[0037] As used herein, "intracellular degradation of Regnase-1" refers to a decrease in the amount of Regnase-1 protein in cells or the disappearance of Regnase-1 from cells, and includes degradation via the ubiquitin-proteasome system. For example, if the amount of Regnase-1 protein is higher in cells treated with a test substance than in cells not treated with a test substance, it can be considered that the intracellular degradation of Regnase-1 has been suppressed by the test substance treatment.

[0038] As used herein, "destabilization of Regnase-1" refers to a reduction in the RNase activity of Regnase-1 compared to a control (e.g., non-phosphorylated Regnase-1 can be used). For example, when Regnase-1 is present but has lost the ability to degrade target mRNA, the Regnase-1 is said to be destabilized. While not limited to this, destabilization of Regnase-1 can be confirmed by methods described herein (e.g., see the section on activity measurement methods), and IL-6 mRNA may be used as a target, for example. Regnase-1 with reduced RNase activity is sometimes referred to as an "inactive form."

[0039] As used herein, "suppressing the destabilization of Regnase-1" may mean suppressing the destabilization of Regnase-1 or suppressing the generation of an inactive form of Regnase-1.

[0040] As used herein, "inhibiting dissociation of Regnase-1 oligomers" refers to suppressing or inhibiting the dissociation of Regnase-1 oligomers into smaller aggregates or monomers in vitro or in vivo. For example, this includes suppressing or inhibiting the dissociation of Regnase-1 hexamers or higher aggregates into trimers or monomers.

[0041] As used herein, "inhibiting the release of Regnase-1 from the endoplasmic reticulum" refers to suppressing or inhibiting the release of Regnase-1 from the endoplasmic reticulum in vitro or in vivo. "Endoplasmic reticulum" may also be abbreviated as "ER." As used herein, "endoplasmic reticulum" preferably refers to the rough endoplasmic reticulum.

[0042] As used herein, "methods for identifying substances that inhibit phosphorylation" include, but are not limited to, methods for screening substances that inhibit phosphorylation, methods for confirming that a substance is a substance that inhibits phosphorylation, and the like.

[0043] As used herein, the term "binding molecule" refers to a molecule that can bind to a certain molecule. For example, if A can bind to B, A is said to be a binding molecule of B.

[0044] As used herein, the term "Regnase-1 binding molecule" refers to a molecule capable of binding to Regnase-1. Examples include, but are not limited to, synthetic small molecule compounds, peptides, polypeptides, proteins, antibodies, carbohydrates, nucleic acids, and derivatives thereof. A "Regnase-1 binding molecule" may be a molecule capable of specifically binding to Regnase-1.

[0045] As used herein, the term "polypeptide" refers to a substance in which four or more amino acids and / or amino acid analogs are linked by amide bonds and / or ester bonds. It may be a natural polypeptide, a synthetic polypeptide, a recombinant polypeptide, or the like. Polypeptides include antibodies and cyclic polypeptides.

[0046] The term "antibody" is used in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), modified antibodies, and antibody fragments, so long as they exhibit the desired antigen-binding activity.

[0047] The term "modified antibody" refers to an antibody in which amino acids, glycosylation state, etc. have been modified from an unmodified parent antibody. Examples include modifications to increase affinity for an antigen, modifications to extend half-life in blood, modifications to alter C1q binding or complement-dependent cytotoxicity (CDC), and modifications to increase the antibody's ability to internalize into cells. As used herein, modified antibodies also include antibody derivatives to which a non-protein moiety (e.g., a drug, polyethylene glycol (PEG), or nucleic acid) has been added.

[0048] The term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of the intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0049] The terms "full length antibody," "complete antibody," and "whole antibody" are used interchangeably herein and refer to an antibody having a structure substantially similar to a native antibody structure or having a heavy chain that includes an Fc region.

[0050] The term "cyclic polypeptide" refers to a polypeptide containing a cyclic structure formed by four or more amino acids and / or amino acid analogs. A cyclic polypeptide may have a linear portion in addition to the cyclic portion. The bonding mode of the cyclization portion is not particularly limited and may be a bond other than an amide bond or an ester bond. Preferred examples of the bonding mode of the cyclization portion include covalent bonds such as an amide bond, a carbon-carbon bond, a disulfide bond, an ester bond, a thioester bond, a thioether bond, a lactam bond, a bond via an azoline skeleton, a bond via a triazole structure, and a bond via a fluorophore structure. The position of the functional group, such as a carboxyl group or an amino group, used for cyclization may be on the main chain or on a side chain, and is not particularly limited as long as it is located in a position that allows cyclization. As used herein, the "bonding mode of the cyclization portion" refers to the bonding mode at the site cyclized by the cyclization reaction.

[0051] As used herein, "amino acid" includes natural amino acids and unnatural amino acids. As used herein, "natural amino acids" refer to Gly (glycine), Ala (alanine), Ser (serine), Thr (threonine), Val (valine), Leu (leucine), Ile (isoleucine), Phe (phenylalanine), Tyr (tyrosine), Trp (tryptophan), His (histidine), Glu (glutamic acid), Asp (aspartic acid), Gln (glutamine), Asn (asparagine), Cys (cysteine), Met (methionine), Lys (lysine), Arg (arginine), and Pro (proline). Examples of unnatural amino acids include, but are not limited to, β-amino acids, γ-amino acids, D-amino acids, N-substituted amino acids, α,α-disubstituted amino acids, and amino acids with side chains different from those of natural amino acids. As used herein, amino acids may have any configuration. There are no particular restrictions on the selection of the side chain of an amino acid. In this specification, an amino acid in which the main chain amino group is substituted is referred to as an "N-substituted amino acid." While not intended to be limiting, N-substituted amino acids include N-alkylamino acids, of which N-methylamino acids are preferred examples. In this specification, "amino acid analog" preferably refers to a hydroxycarboxylic acid, more preferably an α-hydroxycarboxylic acid. Like amino acids, the side chain of an α-hydroxycarboxylic acid is not particularly limited.

[0052] As used herein, amino acids constituting proteins, polypeptides, and peptides may be referred to as amino acid residues. A serine residue may be referred to as a "Ser residue," and a threonine residue may be referred to as a "Thr residue." For example, the 513th serine residue in a given amino acid sequence may be referred to as S513 or Ser513, and the substitution of this serine residue with alanine may be referred to as S513A or Ser513Ala.

[0053] The term "affinity" refers to the strength of the total non-covalent interactions between one binding site of a molecule (e.g., an antibody) and the molecule's binding partner (e.g., an antigen). Unless otherwise indicated, "binding affinity," as used herein, refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y can generally be expressed by the dissociation constant (KD). Affinity can be measured by conventional methods known in the art. Specific illustrative and exemplary embodiments for measuring binding affinity are described below.

[0054] The terms "molecule capable of specifically binding to Regnase-1" and "molecule capable of specifically recognizing Regnase-1" are used interchangeably and refer to a molecule capable of specifically binding to Regnase-1 with sufficient affinity such that the molecule is useful as a diagnostic and / or therapeutic agent when it targets Regnase-1. In one embodiment, the degree of binding of a "molecule capable of specifically binding to Regnase-1" to an unrelated, non-Regnase-1 protein is less than about 10% of the binding to Regnase-1, as measured, for example, by surface plasmon resonance assay, radioimmunoassay (RIA), enzyme immunoassay, etc. In certain embodiments, a "molecule capable of specifically binding to Regnase-1" has an affinity of 1 μM or less, 100 nM or less, 10 nM or less, 1 nM or less, 0.1 nM or less, 0.01 nM or less, or 0.001 nM or less (e.g., 10 -8 M or less, e.g. 10 -8 M~10 -13 M, e.g., 10 -9 M~10 -13In one embodiment, the degree of binding of a "molecule capable of specifically binding to Regnase-1" to an unrelated, non-Regnase-1 protein is less than about 10% of its binding to Regnase-1, as measured by the methods described herein, for example, by surface plasmon resonance assay. In a specific embodiment, a "molecule capable of specifically binding to Regnase-1" binds to an epitope of Regnase-1 that is conserved among Regnase-1 from different species, but is not limited to this. In a specific embodiment, a "molecule capable of specifically binding to Regnase-1" binds to mouse and human Regnase-1, but is not limited to this.

[0055] As used herein, the terms "a molecule capable of specifically binding to Regnase-1 phosphorylated at a specific site" and "a molecule capable of specifically recognizing phosphorylated Regnase-1" are used interchangeably, and in one aspect, the degree of binding to Regnase-1 that is not phosphorylated at a specific site may be less than about 10% of the binding to Regnase-1 that is phosphorylated at a specific site, when measured by methods such as surface plasmon resonance assay, radioimmunoassay (RIA), Western blotting, etc.

[0056] As used herein, "a molecule capable of specifically binding to Regnase-1" includes, but is not limited to, antibodies and polypeptides such as cyclic polypeptides.

[0057] As used herein, "Toll-like receptor (TLR) ligand" includes, but is not limited to, a TLR1 ligand, a TLR2 ligand, a TLR7 ligand, or a TLR4 ligand (lipopolysaccharide (LPS)).

[0058] An "effective amount" of an agent (eg, a pharmaceutical formulation) refers to an amount, at dosages and for periods of time necessary, effective to achieve a desired therapeutic or prophylactic result.

[0059] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the originally transformed cell and progeny derived from that cell regardless of the number of passages. The progeny may not be completely identical in nucleic acid content to the parent cell and may contain mutations. Mutant progeny that have the same function or biological activity as that for which the original transformed cell was screened or selected are also included herein.

[0060] The term "individual" or "subject" refers to a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is human.

[0061] The term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies. That is, the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variants (e.g., variants containing naturally occurring mutations or variants that arise during the production of a monoclonal antibody preparation; such variants are typically present in small amounts). In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a population of substantially homogeneous antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies for use in accordance with the present invention may be produced by a variety of techniques, including, but not limited to, hybridoma technology, recombinant DNA technology, phage display technology, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci.

[0062] The term "polyclonal antibody" refers to a population that typically includes different antibodies directed against different determinants (epitopes). The modifier "polyclonal" indicates the characteristics of the antibodies and is not to be construed as requiring production of the antibodies by any particular method.

[0063] The term "TBK1" refers to a serine / threonine kinase also known as TANK-binding kinase 1, and exemplary amino acid sequences of human TBK1 and mouse TBK1 are available from Uniprot accession numbers Q9UHD2 and Q9WUN2, respectively.

[0064] The term "IKKi" refers to a kinase also known as inducible IκB kinase or IKK-E, and examples of the amino acid sequences of human IKKi and mouse IKKi are available under Uniprot accession numbers Q14164 and Q9R0T8, respectively.

[0065] The term "Act-1" refers to an adaptor molecule also known as TRAF3IP2, CIKS, or Nuclear factor NF-kappa-B activator 1. An example amino acid sequence of human Act-1 is available from Uniprot accession number 043734.

[0066] The term "IKK" is used synonymously with IκB kinase, and IKK includes IKKα and / or IKKβ. As used herein, IKKβ is a preferred example of IKK.

[0067] The term "IRAK" is used synonymously with IL-1R-associated kinase, and IRAK includes IRAK1 and IRAK2. Preferred examples of IRAK herein include IRAK1 and IRAK2.

[0068] The term "pharmaceutical formulation" refers to a preparation in a form that allows the biological activity of the active ingredient contained therein to be effective, and that does not contain additional components that are unacceptably toxic to the subject to which the formulation is administered.

[0069] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, that is non-toxic to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0070] As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors as self-replicating nucleic acid structures and vectors that integrate into the genome of a host cell into which they are introduced. Certain vectors are capable of effecting the expression of nucleic acids to which they are operatively linked. Such vectors are also referred to herein as "expression vectors."

[0071] 2. Treatment methods and therapeutic compositions, etc. In this section, a "therapeutic and / or preventive method" may be simply referred to as a "therapeutic method." Furthermore, a "therapeutic and / or preventive composition" may be simply referred to as a "therapeutic composition."

[0072] In one aspect, the present invention is based on the discovery that inhibiting phosphorylation of specific sites in Regnase-1 is effective in treating and / or preventing inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, TH17 cell-related diseases, and the like. In one aspect, the present invention is based on the discovery that inhibiting phosphorylation of specific sites in Regnase-1 is effective in at least one selected from the group consisting of the following (i) to (xi): (i) treatment and / or prevention of diseases in which Regnase-1 is involved; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues, or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) suppression of destabilization of Regnase-1; (vii) suppression of production of inflammatory factors; (viii) suppression of intracellular degradation of Regnase-1; (ix) inhibition of release of Regnase-1 from the endoplasmic reticulum; (x) inhibition of dissociation of Regnase-1 oligomers; and (xi) suppression of keratinocyte proliferation. In one aspect, the present invention is based on the finding that (a) TBK1 or IKKi, and (b) Act-1 are involved in IL-17-stimulated phosphorylation of Regnase-1.

[0073] Despite its rapid induction, Regnase-1 mRNA is present in various cells, including macrophages and fibroblasts, even in the unstimulated state, where it is thought to suppress unnecessary inflammatory responses (Nature Immunology, Vol.12, Number 12, December 2011, p.1167-1175). In response to external stimuli, such as Toll-like receptor (TLR) ligands and IL-1 family members, via MyD88, Regnase-1 is phosphorylated by IκB kinase (IKK) and is thought to undergo ubiquitin-dependent degradation (Nature Immunology, Vol.12, Number 12, December 2011, p.1167-1175). In parallel, IKK-phosphorylated IκB is also degraded, releasing NF-κB, which then translocates to the nucleus and induces the expression of various inflammation-related genes, including Regnase-1. It is thought that the induced Regnase-1 degrades target mRNA and controls biological responses through a negative feedback mechanism that suppresses the persistence of excessive inflammation.

[0074] Without intending to be bound by any particular theory, the present inventors hypothesized as follows. Specifically, based on the results disclosed herein, mouse Regnase-1 with S435A and S439A mutations is phosphorylated to become inactive, but its degradation is inhibited. It is believed that a portion of Regnase-1 is subsequently dephosphorylated to generate active Regnase-1 with RNase activity. Experiments in which various diseases were induced in animals expressing such Regnase-1 mutants (EAE, a model of multiple sclerosis, as well as models of psoriasis, glomerulonephritis, and scleroderma) demonstrated the therapeutic utility of inhibiting the destabilization and / or intracellular degradation of Regnase-1. However, since even Regnase-1 with S435A and S439A mutations is phosphorylated to become inactive, it was thought that inhibiting this process could have a stronger therapeutic effect. Although the research results obtained by IL-17 and IL-1 stimulation are shown below, as will be described later, stimulation with LPS (known as a ligand for TLR4) also showed a similar phosphorylation pattern to that obtained by IL-17 and IL-1 stimulation, and stimulation of Regnase-1AA / AA cells with Pam3-Csk4 (known as a ligand for TLR1 and TLR2) reduced the production of IL-6 and IL-12, which are targets of Regnase-1. In addition, imiquimod, which was used to induce the psoriasis model, is known to be an agonist of TLR7. Therefore, it is thought that inhibiting the destabilization and / or intracellular degradation of Regnase-1 may also be effective in diseases involving TLR ligands.

[0075] Based on these findings, in one aspect, the inventors discovered that inhibiting phosphorylation of the sites where Regnase-1 is phosphorylated by IKK (Ser residues corresponding to positions 435 and 439 of SEQ ID NO: 1) is effective in at least one selected from the group consisting of the following (i) to (viii): (i) treatment and / or prevention of diseases in which Regnase-1 is involved; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB; (vi) suppression of production of inflammatory factors; (vii) suppression of intracellular degradation of Regnase-1; (viii) suppression of keratinocyte proliferation.

[0076] Although not intending to be bound by a particular theory, the present inventors believe as follows (1) to (4).

[0077] (1) The present inventors focused on Ser494, Thr505, Ser508, and Ser513 (SEQ ID NO: 1) of the amino acid residues in mouse Regnase-1 that were confirmed to be phosphorylated upon stimulation with IL-17 and IL-1. To investigate the effect of phosphorylation of these residues on the destabilization of Regnase-1, we created Regnase-1 mutants in which each of these four residues was substituted with alanine (Ala) to inhibit phosphorylation. Using these Regnase-1 mutants, we examined the phosphorylation of Regnase-1 after stimulation with IL-17 and IL-1 by Western blotting. Regnase-1 with the T505A / S508A mutations exhibited a band shift indicative of phosphorylation, but not with Regnase-1 with the S494A, S513A, or S494A and S513A mutations. This suggests that phosphorylation of the Ser residues at positions corresponding to 494 and / or 513 of SEQ ID NO: 1 in Regnase-1 contributes to the band shift.

[0078] (2) In experiments targeting IL-6 mRNA, the inventors demonstrated that the phosphorylated Regnase-1 corresponding to the shifted bands observed upon stimulation with IL-17 and IL-1 is an inactive form with reduced ability to degrade target mRNA. Therefore, it is believed that inhibiting the phosphorylation of Regnase-1 at Ser494 and Ser513 can suppress the generation of inactive phosphorylated Regnase-1 (suppressing the destabilization of Regnase-1) and maintain Regnase-1 activity.

[0079] (3) Based on the research results disclosed for the first time in this specification, the present inventors hypothesized the intracellular roles of Ser494 and Ser513 as follows: Regnase-1 exists in the form of oligomers in the endoplasmic reticulum, a ribosome-containing organelle. Phosphorylation of Regnase-1 induced by cell stimulation dissociates Regnase-1 oligomers, promoting their release from the endoplasmic reticulum and subsequent translocation to the cytoplasm. Furthermore, phosphorylated Regnase-1 loses its RNase activity. The phosphorylated Regnase-1 is then degraded by the proteasome in the cytoplasm. Inhibiting phosphorylation of Ser residues at positions 494 and / or 513 in SEQ ID NO: 1, which play a central role in the phosphorylation of Regnase-1 induced by IL-17 and / or IL-1 stimulation, can suppress the dissociation of Regnase-1 oligomers induced by cell stimulation, their release from the endoplasmic reticulum, and Regnase-1 degradation. Regnase-1 degrades target mRNA in the endoplasmic reticulum. Therefore, by inhibiting phosphorylation of the Ser residue at positions corresponding to positions 494 and / or 513 in SEQ ID NO: 1 and inhibiting the release of Regnase-1 from the endoplasmic reticulum (and subsequent translocation to the cytoplasm), the target mRNA degradation activity of Regnase-1 can be exerted even after stimulation (the destabilization of Regnase-1 can be suppressed).

[0080] (4) Furthermore, based on the findings disclosed herein that TBK1 and IKKi are kinases that phosphorylate Ser494 and Ser513, the present inventors conducted studies using animals expressing Regnase-1ΔCTD, which is resistant to phosphorylation by TBK1 and IKKi. The results demonstrated that inhibiting the phosphorylation of Ser513 and Ser494 is highly effective in treating and / or preventing diseases involving Regnase-1. This therapeutic and / or preventive effect was greater than that achieved by substituting Ser435 and Ser439 with Ala to inhibit phosphorylation of these residues. Furthermore, Act-1 was shown to contribute to the phosphorylation of Regnase-1 mediated by TBK1 and IKKi. Furthermore, IRAK was hypothesized as the kinase that phosphorylates Ser494 and Ser513 upon IL-1 stimulation.

[0081] Based on these findings, in one aspect, the present inventors have found that inhibiting phosphorylation of the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1, and / or inhibiting the interaction of Regnase-1 with at least one selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK, is effective in at least one selected from the group consisting of the following (i) to (ix): (i) treatment and / or prevention of diseases in which Regnase-1 is involved; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues, or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) suppression of production of inflammatory factors; (vii) suppression of destabilization of Regnase-1; and (viii). Inhibition of intracellular degradation of Regnase-1; (ix) inhibition of keratinocyte proliferation.

[0082] Without intending to be bound by any particular theory, the present inventors also believe as follows: IL-36 stimulation signals via a MyD88-mediated pathway, similar to stimulation by IL-1 or TLR ligands. Destabilization and degradation of Regnase-1 by IL-1 or TLR ligand stimulation is thought to proceed via MyD88-mediated activation of IKK and IRAK, followed by phosphorylation of Regnase-1 by these kinases. Therefore, IL-36 stimulation also leads to phosphorylation of Regnase-1 via activation of IKK and IRAK, resulting in destabilization and / or degradation of Regnase-1. It has been reported that IL-36 stimulation degrades Regnase-1, and a relationship between IL-36-related diseases and Regnase-1 has also been demonstrated (Journal of Investigative Dermatology (2018) 138, 1439-1442). Based on this, it is thought that suppressing the destabilization and / or intracellular degradation of Regnase-1 may be effective for diseases involving IL-36, and inhibiting the phosphorylation of Regnase-1 may be an effective means for this purpose.

[0083] Without intending to be bound by any particular theory, the present inventors believe as follows: Regnase-1 has been reported to exhibit anti-RNA virus activity (J Immunol 2014; 193:4159-4168; Proc Natl Acad Sci USA 2013; 110: 19083-19088; Nucleic Acids Res 2013; 41:3314-3326; Nature 2009; 461: 399-401). In one aspect, the present invention can suppress the destabilization and / or intracellular degradation of Regnase-1, thereby maintaining the RNase activity of Regnase-1 and is therefore considered to be effective against RNA virus infections.

[0084] In some embodiments, the method of the present invention may be a method that relies on selective inhibition of phosphorylation of Ser residues by Regnase-1, or may include a step of selectively inhibiting phosphorylation of Ser residues by Regnase-1.

[0085] In some embodiments, the compositions of the present invention may inhibit phosphorylation of the Ser residue of Regnase-1, and in one embodiment, may selectively inhibit phosphorylation of Regnase-1. In some embodiments, the compositions of the present invention may comprise a Regnase-1 binding molecule that inhibits phosphorylation of the Ser residue of Regnase-1.

[0086] In some embodiments, the method or composition of the present invention may inhibit the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK (herein, these molecules are also referred to as "Regnase-1-acting molecules"). In one embodiment, the method or composition of the present invention may inhibit the binding of Regnase-1 to any of the following binding molecules (i) to (xi): (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) At least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (v) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. An example of the IKK in (i) to (xi) above is, but is not limited to, IKKβ.

[0087] In some embodiments, the compositions of the present invention may contain a Regnase-1 binding molecule that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK.

[0088] In some embodiments, the method or composition of the present invention may be a method or composition for at least one selected from the group consisting of (i) to (xi) below: (i) for treating and / or preventing a disease involving Regnase-1; (ii) for suppressing inflammation; (iii) for suppressing fibrosis of cells, tissues, or organs; (iv) for suppressing epithelial hyperplasia; (v) for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) for suppressing the destabilization of Regnase-1; (vii) for suppressing the production of inflammatory factors; (viii) for suppressing the intracellular degradation of Regnase-1; (ix) for inhibiting the release of Regnase-1 from the endoplasmic reticulum; (x) for inhibiting the dissociation of Regnase-1 oligomers; (xi) for suppressing keratinocyte proliferation.

[0089] Although not limited thereto, in some embodiments, the methods or compositions of the present invention may be methods or compositions for two or more, three or more, four or more, or five or more selected from (i) to (xi) above.

[0090] Whether a substance or composition inhibits the release of Regnase-1 from the endoplasmic reticulum can be determined, for example, by the method described in the Examples (a method of isolating intracellular compartments and analyzing their protein distribution using Western blotting). Whether a substance inhibits the dissociation of Regnase-1 oligomers can be determined, for example, by non-denaturing PAGE analysis described in the Examples.

[0091] In some embodiments, the Ser residues of the present invention may be Ser residues at at least one position or two or more positions selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1, and may be Ser residues at at least one position or two or more positions selected from the group consisting of (i) positions 513, 494, 439, and 435 of SEQ ID NO: 1; or (ii) positions 516, 497, 442, and 438 of SEQ ID NO: 2.

[0092] In some embodiments, the Ser residues of the present invention may be Ser residues at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1, or at both positions, and may be Ser residues at at least one position selected from the group consisting of (i) positions 513 and 494 of SEQ ID NO: 1; or (ii) positions 516 and 497 of SEQ ID NO: 2, or at both positions.

[0093] In some embodiments, the Ser residue in the present invention may be the Ser residue corresponding to position 513 of SEQ ID NO: 1 in Regnase-1, and may be (i) the Ser residue at position 513 of SEQ ID NO: 1; or (ii) the Ser residue at position 516 of SEQ ID NO: 2.

[0094] In some embodiments, the Ser residues of the present invention may be Ser residues at at least one position selected from the group consisting of positions corresponding to positions 439 and 435 of SEQ ID NO: 1 in Regnase-1, or at both positions, and may be Ser residues at at least one position selected from the group consisting of (i) positions 439 and 435 of SEQ ID NO: 1; or (ii) positions 442 and 438 of SEQ ID NO: 2, or at both positions.

[0095] In some embodiments, the Ser residue in the present invention can be both of the following (i) and (ii) Ser residues: (i) Ser residues at either or both of positions corresponding to 513 and 494 of SEQ ID NO: 1 in Regnase-1; (ii) Ser residues at either or both of positions corresponding to 439 and 435 in SEQ ID NO: 1 in Regnase-1. Without intending to be bound by any particular theory, the effects of the present invention can be enhanced by inhibiting the phosphorylation of both the Ser residues (i) phosphorylated by TBK1 and IKKi and (ii) phosphorylated by IKK in Regnase-1, thereby achieving greater efficacy in the treatment and / or prevention of, for example, inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, and TH17 cell-related diseases.

[0096] In some embodiments, the Ser residue in the present invention may be a Ser residue contained in at least one or more amino acid sequences selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4) and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1.

[0097] In some embodiments, the substance capable of inhibiting phosphorylation of Ser residues in the present invention may be at least one compound (cyclic polypeptide) selected from PP1 to PP25 described herein, which have the amino acid sequences set forth in SEQ ID NOs: 11 to 16 and 30 to 48, respectively. In some embodiments, the substance capable of inhibiting phosphorylation of Ser residues in the present invention may be at least one compound (a cyclic polypeptide having a linear portion) selected from PP7+tag, PP10+tag, and PP23+tag described herein, which have the amino acid sequences set forth in SEQ ID NOs: 57 to 59, respectively.

[0098] In some embodiments, the substance capable of inhibiting phosphorylation of Ser residues in the present invention is an antibody. The antibody can be selected from anti-Regnase-1 antibodies, for example, those having the amino acid sequences described below. REA0023, comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:20 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:21. REA0027, comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:22 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:23. REB0007, comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:24 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:25. REB0014, comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:26 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:27. REB0022, comprising a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:28 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:29.

[0099] In some embodiments, the phosphorylation in the present invention may be phosphorylation that can be induced by at least one molecule selected from the group consisting of IL-17, IL-1, IL-36, and a TLR ligand; or by at least one molecule selected from the group consisting of IL-17, IL-1, and a TLR ligand, preferably at least one molecule selected from the group consisting of IL-17 and IL-1, more preferably IL-17. Although not limited thereto, in one embodiment, the IL-17, IL-1, IL-36, and TLR ligand may each independently be IL-17A, IL-1β, IL-36α, and a ligand for TLR1, a ligand for TLR2, a ligand for TLR4, a ligand for TLR7, or LPS. The cells stimulated by the molecules herein are not particularly limited, and may be non-hematopoietic cells, such as macrophages, fibroblasts (e.g., mouse embryonic fibroblasts (MEF) can be used experimentally), and endothelial cells (e.g., liver sinusoidal wall endothelial cells (LSEC) can be used experimentally).

[0100] In another aspect, the phosphorylation in the present invention may be phosphorylation by at least one kinase selected from the group consisting of TBK1 (TANK-binding kinase 1), IKKi (inducible IκB kinase), IRAK (IL-1R-associated kinase) 1, IRAK2, and IKK (IκB kinase), or may be phosphorylation by at least one kinase selected from the group consisting of TBK1, IKKi, and IKK, or may be phosphorylation by IKK, or may be phosphorylation by IRAK, or may be phosphorylation by TBK1 and / or IKKi.

[0101] The degree of inhibition of Regnase-1 phosphorylation in the present invention is not particularly limited, and phosphorylation may be inhibited if the degree of Regnase-1 phosphorylation is reduced when the test substance is added compared to a negative control without the test substance. For example, the degree of phosphorylation may be reduced to 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less.

[0102] In the present invention, the degree of inhibition of binding between Regnase-1 and at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is not particularly limited, and the binding between the binding molecule and Regnase-1 may be considered to be inhibited if the degree of binding between the binding molecule and Regnase-1 is reduced when a test substance is added, compared to a negative control without the test substance. For example, the degree of inhibition may be 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less.

[0103] The test substance in the present invention is not particularly limited, and examples thereof include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, etc., and preferably includes antibodies and cyclic polypeptides.

[0104] In some embodiments, the methods and / or compositions of the present invention may be for treating and / or preventing diseases in which Regnase-1 is involved.

[0105] The "Regnase-1-associated disease" may be at least one disease selected from the group consisting of inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, and TH17 cell-associated diseases. In one embodiment, the "Regnase-1-associated disease" may be at least one disease selected from the group consisting of inflammatory diseases accompanied by fibrosis and / or epithelial hyperplasia; autoimmune diseases; allergic diseases; RNA virus infections; and TH17 cell-associated diseases. By applying the methods and / or compositions of the present invention to such diseases, anti-fibrotic and epithelial hyperplasia-inhibiting effects can be exerted in addition to anti-inflammatory effects. Examples of "diseases involving Regnase-1" include, but are not limited to, multiple sclerosis, psoriasis, scleroderma, nephritis (including, but not limited to, glomerulonephritis), uveitis, pulmonary fibrosis, renal fibrosis, vascular fibrosis, keloid, rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, pneumonia, dermatitis, vasculitis, neuritis, arthritis, ocular inflammation, encephalomyelitis, and asthma.

[0106] In one embodiment, a "disease involving Regnase-1" may be a disease in the following tissues or organs: kidney, lung, skin, liver, heart, pancreas, bone marrow, blood vessels (including vascular endothelial cells), nerves, eyes, uterus, brain, and prostate. Exemplary tissues or organs include, but are not limited to, at least one tissue or organ selected from the group consisting of kidney, skin, lung, blood vessels, eyes, brain, and nerves.

[0107] In one embodiment, the "disease associated with Regnase-1" may be at least one disease selected from the group consisting of (i) to (viii) below, but is not limited thereto: (i) a disease in which the expression of mRNA that can be targeted by Regnase-1 is involved in the formation, aggravation, and / or continuation of the disease; (ii) a disease in which TH17 cells are involved in the formation, aggravation, and / or continuation of the disease; (iii) a disease in which at least one selected from the group consisting of IL-17, IL-1, and a TLR ligand is involved in the formation, aggravation, and / or continuation of the disease; (iv) a disease in which at least one selected from the group consisting of IL-17 and IL-1 is involved in the formation, aggravation, and / or continuation of the disease; (v) a disease accompanied by fibrosis of cells, tissues, or organs; (vi) a disease accompanied by epithelial hyperplasia; (vii) (viii) a disease in which at least one molecule selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB is involved in the formation, aggravation, and / or continuation of the disease. In one embodiment, the IL-17, IL-1, IL-36, and TLR ligand may each independently be IL-17A; IL-1β; IL-36α; and a TLR1 ligand, a TLR2 ligand, a TLR4 ligand, a TLR7 ligand, or LPS.

[0108] The "mRNA that can be targeted by Regnase-1" in (i) above is not limited as long as it can be degraded by Regnase-1. Examples of mRNA that can be degraded by Regnase-1 include FABP5, ACKR3, CTGF, ADAMTS1, ATF2, CD80, CYR61, DDR1, DUOX, DUSP6, CSF3, HBEGF, ID3, IL19, MAP3K8, IL1a, MCOLN3, MITF, ORC1, PDGFB, PTGS1, SESN1, PTGER4, SHQ1, SULF1, TNFRSF9, ZC3H12C, RARB, and TMEM9 (see Examples); CXCL1, CXCL2, CXCL3, NFKIBZ, NFKBID, PTGS2, ID1, MAFK, ZC3H12A, TM2D3, and IL6 (Cell. 2015 May 2015). 21;161(5):1058-1073); REL, TNFRSF4, IL2, ICOS, CD44, TNFRSF1B, IL1b, and NFATC1 (Cell. 2013 May 23;153(5):1036-49); GATA3 (J Allergy Clin Immunol. 2017 Oct 27. pii: S0091-6749(17)31654-8); CEBPB (PLoS One. 2017 Mar 22;12(3):e0174381); FURIN, IL12RB1, RC3H1, RC3H2, and IL18R1 (J Immunol. 2017 Dec 15;199(12):4066-4077); BCL2L1, RELB, BIRC3, and BCL3 (Cancer Res. 2016 Mar 15;76(6):1429-40; IL12b and CALCR (Nature. 2009 Apr 30;458(7242):1185-90); TFRC and EGLN3 (Cell Rep. 2017 May 23;19(8):1614-1630). The "mRNA that can be targeted by Regnase-1" may be at least one selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB. Information on the proteins corresponding to these mRNAs is available from the Uniprot database.Whether or not an mRNA can be a target of Regnase-1 can be confirmed using known methods described in the above-cited documents or the methods described herein. In one embodiment, the "mRNA that can be a target of Regnase-1" may be the mRNA of a molecule produced from a non-hematopoietic cell. When referring to each name of mRNA herein, uppercase and lowercase letters may be used interchangeably (for example, "HBEFG" and "Hbefg" refer to the same mRNA).

[0109] Without intending to be limiting, mRNAs that can be degraded by Regnase-1 may include IL6, IL1a, IL1b, IL12b, CXCL1, CXCL2, and CXCL3 (inflammatory factors); CTGF, DDR1 and PDGFB (organ fibrosis-related factors); and IL2 and HBEGF (cell growth factor), with IL6 and IL1a; CXCL1 and CXCL2; HBEGF; and CTGF, DDR1 and PDGFB being preferred examples. The correspondence between the above mRNAs and the proteins produced from them is as follows: IL6 (IL-6), IL1a (IL-1α), IL1b (IL-1β), IL12b (IL-12 subunit β), CXCL1 (CXCL-1), CXCL2 (CXCL-2), CXCL3 (CXCL-3); CTGF (Connective tissue growth factor), DDR1 (Epithelial discoidin domain-containing receptor 1), PDGFB (Platelet-derived growth factor subunit B (PDGF-2)); IL2 (IL-2), HBEGF (Proheparin-binding EGF-like growth factor).

[0110] In some embodiments, the present invention may degrade a target mRNA described in any of the following (i) to (iii): In one embodiment, the present invention may degrade a target mRNA described in any of the following (i) to (iii) by inhibiting phosphorylation of Regnase-1 and / or inhibiting binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK.

[0111] (i) Fibrosis-related factors Examples include CTGF, DDR1, and PDGFB. The present inventors were the first to discover that CTGF, DDR1, and PDGFB, which are indicators of organ fibrosis, can be targets of Regnase-1. Additionally, they found in animal models that inhibiting the phosphorylation of Regnase-1 suppresses the expression of these factors and inhibits organ fibrosis. Based on these findings, the present invention provides a method or composition for inhibiting the expression of at least one, two or more, or all of the mRNAs selected from the group consisting of CTGF, DDR1, and PDGFB. In another aspect, a method or composition for inhibiting fibrosis of cells, tissues, or organs by inhibiting the expression of at least one, two or more, or all of the mRNAs selected from the group consisting of CTGF, DDR1, and PDGFB is provided.

[0112] (ii) inflammatory factors; Examples of such proteins include IL2, IL6, IL12b, IL12p40, IL1a, IL1b, CXCL1, CXCL2, CXCL3, CCL5, CCL30, GMCSF, PTGS2, NFKBIZ, NFKBID, ICOS, OX40, c-Rel, NFATC1, Gata3, C / EBPb, IL-18R, CXL2L1, RELB, Ackr3, Adamts1, Atf2, CD80, Cyr61, Duox, Dusp6, Csf3, ID3, IL19, Map3k8, Ptgs1, Ptger4, Tnfrsf9, and zc3h12c. Of these, IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3 are preferred. The present inventors have first discovered that Ackr3, Adamts1, Atf2, CD80, Cyr61, Duox, Dusp6, Csf3, ID3, IL19, Map3k8, Ptgs1, Ptger4, Tnfrsf9, and zc3h12c can be targets of Regnase-1. Furthermore, they have found that inhibiting Regnase-1 phosphorylation suppresses the expression of IL6, IL1a, CXCL1, and CXCL2 and inhibits inflammation in animal models. Based on these findings, the present invention provides a method or composition for suppressing the expression of at least one or more mRNAs selected from the group consisting of IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3; or the group consisting of IL6, IL1a, CXCL1, and CXCL2. In another aspect, there is provided a method or composition for suppressing inflammation by suppressing the expression of at least one or more mRNAs selected from the group consisting of IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3; or the group consisting of IL6, IL1a, CXCL1, and CXCL2.

[0113] (iii) Cell growth factors Examples of such targets include ID1, TM2D3, CD44, BIRC3, BCL3, Fabp5, Hbefg, mcoln3, Mitf, Orc1, Sesn1, Sulf1, Rarb, and Tmem9. The present inventors were the first to discover that the cell growth factors ID1, TM2D3, CD44, BIRC3, BCL3, Fabp5, Hbefg, mcoln3, Mitf, Orc1, Sesn1, Sulf1, Rarb, and Tmem9 can be targets of Regnase-1. Additionally, they found that inhibiting Regnase-1 phosphorylation suppresses Hbefg expression and keratinocyte proliferation in animal models. Based on these findings, the present invention provides a method or composition for suppressing Hbefg mRNA expression. In another aspect, a method or composition for suppressing epithelial hyperplasia by suppressing Hbefg mRNA expression is provided. The protein corresponding to HBEGF mRNA is known as proheparin-binding EGF-like growth factor (HB-EGF).

[0114] In some embodiments, the methods and / or compositions of the present invention may suppress the expression of mRNA that can be targeted by Regnase-1, although this is not limited thereto. In one embodiment, the method and / or composition may suppress the expression of at least one mRNA selected from the group consisting of the molecules listed above as "mRNA that can be targeted by Regnase-1," and may particularly suppress the expression of at least one mRNA selected from the group consisting of inflammatory factors, cell growth factors, and fibrosis-related factors. In one embodiment, such molecules may be molecules produced by non-hematopoietic cells.

[0115] Without being limited thereto, in some embodiments, the methods and / or compositions of the present invention may suppress the expression of at least one mRNA selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, CCL5, CCL20, LCN2, GMCSF, HBEGF, SPRR2I, KERATIN 6A, COL1A1, ACTA2, CTGF, DDR1, and PDGFB, or may suppress the expression of at least one mRNA selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB.

[0116] Without being limited thereto, in some embodiments, the methods and / or compositions of the present invention may have at least one characteristic selected from the group consisting of the following (i) to (iv): (i) the ability to suppress the production of inflammatory factors; (ii) the ability to suppress the production of cell growth factors; (iii) the ability to suppress the production of fibrosis-related factors; and (iv) the ability to inhibit the activation of STAT-3.

[0117] "Inflammatory cells" as used herein include, but are not limited to, T cells and neutrophils.

[0118] In some embodiments, the methods and / or compositions of the present invention may be used to treat and / or prevent symptoms in the following tissues or organs: kidney, lung, skin, liver, heart, pancreas, bone marrow, blood vessels (including vascular endothelial cells), nerves, eyes, uterus, brain, and prostate. Exemplary tissues or organs include, but are not limited to, at least one tissue or organ selected from the group consisting of kidney, skin, lung, blood vessel, eye, brain, and nerve. Examples of such symptoms include, but are not limited to, inflammation, autoimmune response, fibrosis, and epithelial hyperplasia.

[0119] In some embodiments, the destabilization and / or intracellular degradation of Regnase-1 in the present invention may be destabilization and / or intracellular degradation of Regnase-1 downstream of at least one signal selected from the group consisting of IL-17, IL-1, IL-36, and a TLR ligand; the group consisting of IL-17, IL-1, and a TLR ligand; or the group consisting of IL-17 and IL-1. Without being limited thereto, in one embodiment, the IL-17, IL-1, IL-36, and TLR ligand may each independently be IL-17A, IL-1β, IL-36α, and a TLR1 ligand, a TLR2 ligand, a TLR4 ligand, a TLR7 ligand, or LPS.

[0120] In some embodiments, an effective amount of the composition of the present invention may be administered to a mammal, preferably a human.

[0121] Any of the Regnase-1-binding molecules of the present invention may be used in therapeutic and / or preventive methods. In one aspect, a Regnase-1-binding molecule for use as a pharmaceutical is provided. In one aspect, a Regnase-1-binding molecule of the present invention may inhibit phosphorylation of the Ser residue of Regnase-1. In one aspect, a Regnase-1-binding molecule of the present invention may inhibit the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. In a further aspect, a Regnase-1-binding molecule is provided for use in the treatment and / or prevention of a disease in which Regnase-1 is involved. In a specific embodiment, a Regnase-1-binding molecule of the present invention is provided for use in a therapeutic and / or preventive method. In certain embodiments, the present invention provides a Regnase-1-binding molecule of the present invention for use in a method for treating an individual with a Regnase-1-mediated disease and / or a method for preventing an individual at risk of developing a Regnase-1-mediated disease, the method comprising administering to the individual an effective amount of a Regnase-1-binding molecule of the present invention. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent (e.g., as described below). In a further embodiment, the present invention provides a Regnase-1-binding molecule of the present invention for use in (i) inhibiting fibrosis, (ii) inhibiting epithelial hyperplasia, and / or (iii) inhibiting inflammation. In certain embodiments, the present invention provides a Regnase-1-binding molecule of the present invention for use in the methods (i), (ii), and / or (iii) above in an individual, the method comprising administering to the individual an effective amount of a Regnase-1-binding molecule of the present invention for (i), (ii), and / or (iii) above. An "individual" according to any of the above aspects is preferably a human.

[0122] In a further aspect, the present invention provides use of a Regnase-1-binding molecule of the present invention in the manufacture or preparation of a medicament. In one embodiment, the medicament is for the treatment and / or prevention of a disease associated with Regnase-1. In a further embodiment, the medicament is for use in a method for treating a disease associated with Regnase-1, the method comprising administering an effective amount of the medicament to an individual having the disease. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent (e.g., as described below). In a further embodiment, the medicament is for (i) suppressing fibrosis, (ii) suppressing epithelial hyperplasia, and / or (iii) suppressing inflammation. In a further embodiment, the medicament is for use in an individual in the methods of (i), (ii), and / or (iii) above, the method comprising administering to the individual an effective amount of the medicament for (i), (ii), and / or (iii) above. The "individual" in any of the above embodiments may be a human.

[0123] In a further aspect, the present invention provides methods for treating and / or preventing diseases involving Regnase-1. In one embodiment, the method comprises administering an effective amount of a Regnase-1-binding molecule of the present invention to an individual who has or may have such a disease involving Regnase-1 in the future. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent (as described below). The "individual" according to any of the above embodiments may be a mammal, preferably a human.

[0124] In a further aspect, the present invention provides a method for (i) inhibiting fibrosis, (ii) inhibiting epithelial hyperplasia, and / or (iii) inhibiting inflammation in an individual. In one embodiment, the method comprises administering to the individual an effective amount of a Regnase-1-binding molecule of the present invention for (i), (ii), and / or (iii). In one embodiment, the "individual" is a mammal, preferably a human.

[0125] In a further aspect, the present invention provides pharmaceutical compositions comprising any of the Regnase-1-binding molecules of the present invention (e.g., for use in any of the therapeutic and / or prophylactic methods described above). In one embodiment, the Regnase-1-binding molecules of the present invention are capable of inhibiting phosphorylation of the Ser residue of Regnase-1. In another embodiment, the Regnase-1-binding molecules of the present invention are capable of inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. In one embodiment, a pharmaceutical composition comprises any of the Regnase-1-binding molecules of the present invention and a pharmaceutically acceptable carrier. In another embodiment, a pharmaceutical composition comprises any of the Regnase-1-binding molecules of the present invention and at least one additional therapeutic agent (e.g., as described below).

[0126] The Regnase-1-binding molecules of the present invention can be used in therapy either alone or in combination with other agents. For example, the Regnase-1-binding molecules of the present invention can be co-administered with at least one additional therapeutic agent.

[0127] The Regnase-1-binding molecules of the present invention (and any additional therapeutic agents) can be administered by any suitable means, including oral, parenteral, pulmonary, and nasal administration, and, if desired for localized treatment, intralesional administration. Parenteral administration includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, for example, by injection, such as intravenous or subcutaneous injection, depending in part on whether administration is brief or chronic. Various dosing schedules are contemplated herein, including, but not limited to, single administration or repeated administration over various time periods, bolus administration, and pulse infusion.

[0128] (Pharmaceutical composition) The present invention provides pharmaceutical compositions containing the Regnase-1-binding molecules of the present invention. The pharmaceutical compositions of the present invention can be formulated by known methods by incorporating a pharmaceutically acceptable carrier in addition to the Regnase-1-binding molecules of the present invention. For formulation, commonly used excipients, binders, lubricants, colorants, flavorings, and optionally stabilizers, emulsifiers, absorption enhancers, surfactants, pH adjusters, preservatives, antioxidants, etc. can be used. The compositions are formulated by standard methods by combining ingredients commonly used as raw materials for pharmaceutical formulations. For example, to prepare oral formulations, a compound of the present invention or a pharmaceutically acceptable salt thereof and excipients, optionally including binders, disintegrants, lubricants, colorants, flavorings, etc., are added, followed by standard methods to form powders, fine granules, granules, tablets, coated tablets, capsules, etc.

[0129] Examples of these components include animal and vegetable oils such as soybean oil, beef tallow, and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane, and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicone resins; silicone oils; surfactants such as polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, and polyoxyethylene polyoxypropylene block copolymers; water-soluble polymers such as hydroxyethyl cellulose, polyacrylic acid, carboxyvinyl polymers, polyethylene glycol, polyvinylpyrrolidone, and methylcellulose; lower alcohols such as ethanol and isopropanol; polyhydric alcohols such as glycerin, propylene glycol, dipropylene glycol, and sorbitol; sugars such as glucose and sucrose; inorganic powders such as silicic anhydride, aluminum magnesium silicate, and aluminum silicate; and purified water.

[0130] Examples of excipients include lactose, corn starch, sucrose, glucose, mannitol, sorbitol, crystalline cellulose, and silicon dioxide.

[0131] Examples of binders include polyvinyl alcohol, polyvinyl ether, methyl cellulose, ethyl cellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl methylcellulose, hydroxypropyl cellulose, polyvinylpyrrolidone, polypropylene glycol-polyoxyethylene-block polymer, and meglumine.

[0132] Examples of disintegrants include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextrin, pectin, and carboxymethylcellulose calcium.

[0133] Examples of lubricants include magnesium stearate, talc, polyethylene glycol, silica, and hydrogenated vegetable oil.

[0134] Coloring agents that are permitted to be added to pharmaceuticals are used, and flavoring agents include cocoa powder, peppermint, aromatic powder, peppermint oil, borneol, cinnamon powder, etc.

[0135] These tablets and granules may be coated with sugar or other suitable coatings as necessary. When preparing liquid preparations such as syrups and injection preparations, the compounds of the present invention or their pharmacologically acceptable salts are formulated in a conventional manner by adding a pH adjuster, a solubilizer, an isotonicity adjuster, and, if necessary, a solubilizer, a stabilizer, etc.

[0136] For example, they can be administered parenterally in the form of a sterile solution or suspension in water or other pharmaceutically acceptable liquid for injection. For example, they can be formulated by appropriately combining them with pharmacologically acceptable carriers or vehicles, specifically, sterile water, physiological saline, vegetable oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, etc., and blending them in a unit dosage form required for generally accepted pharmaceutical practice. Specific examples of carriers include light anhydrous silicic acid, lactose, crystalline cellulose, mannitol, starch, carmellose calcium, carmellose sodium, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl acetal diethylaminoacetate, polyvinylpyrrolidone, gelatin, medium-chain fatty acid triglycerides, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethylcellulose, cornstarch, inorganic salts, etc. The amount of active ingredient in these formulations is such that an appropriate dose within the indicated range can be obtained. Sterile compositions for injection can be formulated according to conventional pharmaceutical practice using a vehicle such as distilled water for injection.

[0137] Examples of aqueous solutions for injection or bases for eye drops include physiological saline, isotonic solutions containing glucose or other adjuvants, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, and these may be used in combination with appropriate solubilizing agents, such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, and nonionic surfactants such as Polysorbate 80 (registered trademark) and HCO-50.

[0138] Examples of oily liquids include sesame oil and soybean oil, and they may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol. They may also contain buffers such as phosphate buffer and sodium acetate buffer, soothing agents such as procaine hydrochloride, stabilizers such as benzyl alcohol, phenol, and antioxidants. The prepared injection solution is usually filled into suitable ampoules.

[0139] The administration is preferably oral administration, but the administration method is not limited to oral administration. Specific examples of parenteral administration include injections, intranasal administrations, pulmonary administrations, transdermal administrations, and eye drops. Examples of injections include intravenous injections, intramuscular injections, intraperitoneal injections, subcutaneous injections, and intravitreal injections, which can be used for systemic or local administration.

[0140] Furthermore, the administration method can be selected appropriately depending on the patient's age and symptoms. The dosage of a pharmaceutical composition containing a peptide compound produced by the method of the present invention can be selected, for example, from the range of 0.0001 mg to 1,000 mg per kg of body weight per administration. Alternatively, the dosage can be selected, for example, from the range of 0.001 to 100,000 mg / body weight per patient, but is not necessarily limited to these values. As an eye drop, for example, it can be administered at a concentration of 0.0001% to 10% (w / v), preferably 0.01% to 5% (w / v), once to several times a day, or at intervals of several days, but is not limited thereto. The dosage and administration method vary depending on the patient's weight, age, symptoms, etc., but can be appropriately selected by those skilled in the art.

[0141] 3.Regnase-1 binding molecule In one aspect, the present invention is based in part on the discovery that inhibiting the phosphorylation of Regnase-1 and / or inhibiting the binding of Regnase-1 to TBK1, IKKi, Act-1, IKK, and IRAK is effective in treating and / or preventing certain diseases. In some embodiments, a Regnase-1-binding molecule that inhibits the phosphorylation of Regnase-1 is provided. In one embodiment, a Regnase-1-binding molecule that inhibits the binding of Regnase-1 to at least one binding molecule (Regnase-1-acting molecule) selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is provided. The Regnase-1-binding molecules of the present invention are useful, for example, for treating and / or preventing diseases in which Regnase-1 is involved.

[0142] Without intending to be bound by any particular theory, in one aspect, the present invention is based on the first discovery by the inventors that Regnase-1 interacts with TBK1, IKKi, and Act-1, and further finding that inhibiting the phosphorylation of Regnase-1 through these interactions plays an important role in Regnase-1 exerting its anti-inflammatory, anti-fibrotic, and anti-epidermal hyperplasia effects via target mRNA degradation. Furthermore, experiments using Regnase-1 mutated at S513A and / or S494A suggested that the phosphorylation sites (Ser513 and Ser494 in SEQ ID NO: 1) that render Regnase-1 inactive are common to both IL-17 and IL-1 stimulation. Therefore, it can be understood that inhibiting Regnase-1 phosphorylation through its interaction with IRAK, which functions as a kinase that phosphorylates Regnase-1 downstream of IL-1, produces the same effects as those described above. Therefore, any method, molecule, or composition capable of inhibiting the interaction between Regnase-1 and at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK can be included as an embodiment of the present invention. Based on the disclosures herein, those skilled in the art can identify and produce a substance capable of inhibiting the interaction between Regnase-1 and at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. Illustratively, the interaction between Regnase-1 and TBK1, IKKi, or Act-1 can be analyzed using known techniques such as surface plasmon resonance (SPR) in a system to which a substance capable of binding to Regnase-1 has been added, thereby identifying and producing the substance of interest.

[0143] Without intending to be bound by any particular theory, in one aspect, the present invention provides a method for the preparation of a nucleotide sequence encoding a specific Ser residue of Regnase-1 (at least one selected from the group consisting of positions corresponding to each of positions 513, 494, 439, and 435 of SEQ ID NO: 1; preferably at least one selected from the group consisting of positions corresponding to each of positions 513 and 494; preferably both of the following (i) and (ii): (i) either or both of the positions corresponding to positions 513 and 494 of SEQ ID NO: 1; and (ii) either or both of positions 439 and 435 of SEQ ID NO: 1. This invention is based on the discovery that inhibiting phosphorylation of this Ser residue plays an important role in the anti-inflammatory, anti-fibrotic, and anti-epidermal hyperplasia effects mediated by Regnase-1 degradation of target mRNA. Therefore, any method, molecule, or composition capable of inhibiting phosphorylation of this Ser residue may be included as part of the present invention. Based on the disclosures herein, those skilled in the art will be able to identify and produce substances capable of inhibiting phosphorylation of this Ser residue. For example, a substance of interest can be identified and produced by analyzing the inhibition of Regnase-1 phosphorylation by TBK1 or IKKi in a system to which a substance capable of binding to Regnase-1 has been added, using the methods disclosed herein or known techniques.

[0144] In one aspect, the present invention provides a Regnase-1-binding molecule that inhibits the phosphorylation of Regnase-1. In one aspect, the present invention provides a Regnase-1-binding molecule that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK.

[0145] In some embodiments, the Regnase-1 binding molecules of the present invention may inhibit phosphorylation of Ser or Thr residues contained in Regnase-1, preferably inhibiting phosphorylation of Ser residues.

[0146] In some embodiments, the amino acid residues in Regnase-1 whose phosphorylation can be inhibited by the Regnase-1 binding molecules of the present invention may be at least one, two or more, or three or more amino acid residues selected from the group consisting of positions corresponding to Ser28, Ser124, Thr115, Ser288, Ser494, Ser508, Ser513, Thr109, Ser404, Ser435, Ser454, Ser470, Ser482, Thr498, Thr505, Ser592, Ser21, Ser268, Ser386, Ser439, and Ser474 in SEQ ID NO: 1 (mouse Regnase-1). In some embodiments, when there are multiple amino acid residues in Regnase-1 whose phosphorylation can be inhibited by the Regnase-1 binding molecules of the present invention, such amino acid residues may be either or both of the amino acid residues at positions corresponding to Ser513 and Ser494, respectively, and either or both of the amino acid residues at positions corresponding to Ser439 and Ser435, respectively, in SEQ ID NO: 1 (mouse Regnase-1).

[0147] In some embodiments, the Regnase-1-binding molecules of the present invention may inhibit phosphorylation of the Ser residue of Regnase-1. In some embodiments, the Ser residue may be the Ser residue described above in the present invention. In some embodiments, the phosphorylation may be the phosphorylation described above in the present invention.

[0148] In some embodiments, the Ser residue in Regnase-1 whose phosphorylation is inhibited by the Regnase-1 binding molecule of the present invention can be a Ser residue contained in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4) and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1.

[0149] In some embodiments, Regnase-1-binding molecules of the present invention can be compounds that compete for binding to Regnase-1 with at least one compound selected from PP1 to PP25 described herein, e.g., at least one compound selected from the group consisting of PP7, PP23, and PP10. In certain embodiments, Regnase-1-binding molecules of the present invention can be compounds that do not compete with at least one compound selected from the group consisting of PP7, PP23, and PP10. In certain embodiments, Regnase-1-binding molecules of the present invention can be compounds that compete with PP7 and PP23, but do not compete with PP10. Such a Regnase-1 binding molecule is preferably a molecule that specifically binds to Regnase-1, and is preferably a molecule that binds to Regnase-1 at the same site in Regnase-1 as the site to which at least one compound selected from the group consisting of PP1 to PP25, for example, PP7, PP23 and PP10, binds. Furthermore, Regnase-1 binding molecules of the present invention also include compounds that compete with at least one compound selected from PP7+tag, PP10+tag, and PP23+tag described herein for binding to Regnase-1.

[0150] In some embodiments, the Regnase-1 binding molecule of the present invention may be a compound that competes for binding to Regnase-1 with at least one antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 described herein. Such a Regnase-1 binding molecule is preferably a molecule that specifically binds to Regnase-1, and is preferably a molecule that binds to Regnase-1 at the same site in Regnase-1 as the site to which an antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 binds.

[0151] Whether a Regnase-1-binding molecule competes with other Regnase-1-binding molecules for binding to Regnase-1 can be confirmed, for example, by a competition assay as described in section "B. Binding and other assays" of "9. Assays" of this specification.

[0152] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues contained in the amino acid sequence of positions 544 to 596 shown in SEQ ID NO: 1 or the amino acid sequence of positions 547 to 599 shown in SEQ ID NO: 2.

[0153] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues contained in the amino acid sequence of positions 1 to 543 shown in SEQ ID NO: 1 or the amino acid sequence of positions 1 to 546 shown in SEQ ID NO: 2.

[0154] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues contained in the amino acid sequence of positions 301 to 596 shown in SEQ ID NO: 1 or the amino acid sequence of positions 301 to 599 shown in SEQ ID NO: 2.

[0155] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues contained in the amino acid sequence of positions 1 to 300 shown in SEQ ID NO: 1 or the amino acid sequence of positions 1 to 300 shown in SEQ ID NO: 2.

[0156] In some embodiments, the Regnase-1-binding molecules of the present invention do not substantially inhibit or reduce the RNase activity of Regnase-1. In certain embodiments, in the presence of a Regnase-1-binding molecule of the present invention, the RNase activity of Regnase-1 remains at 50% or more, 60% or more, or 70% or more compared to the absence of the molecule. In further embodiments, in the presence of a Regnase-1-binding molecule of the present invention, the RNase activity of Regnase-1 remains at 80% or more, 85% or more, 90% or more, or 95% or more compared to the absence of the molecule. RNase activity can be measured, for example, according to the method described in "C. Activity Measurement Method" of "9. Measurement Method (Assay)" of this specification.

[0157] In some embodiments, the Regnase-1-binding molecule of the present invention may inhibit binding of any of the following binding molecules (i) to (xi) to Regnase-1: (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (vii) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. The IKK in (i) to (xi) may be IKKβ.

[0158] In some embodiments, the Regnase-1 binding molecule of the present invention may have the property of being effective in at least one selected from the group consisting of the following (i) to (xi): (i) treatment and / or prevention of diseases in which Regnase-1 is involved; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues, or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) suppression of destabilization of Regnase-1; (vii) suppression of production of inflammatory factors; (viii) suppression of intracellular degradation of Regnase-1; (ix) inhibition of release of Regnase-1 from the endoplasmic reticulum; (x) inhibition of dissociation of Regnase-1 oligomers; (xi) suppression of keratinocyte proliferation.

[0159] Although not intended to be limiting, in some embodiments, the Regnase-1-binding molecule of the present invention may be a polypeptide, and the polypeptide may be a cyclic polypeptide. In some embodiments, the molecular weight of the cyclic polypeptide of the present invention may be 500 to 4,000, 500 to 3,000, or 500 to 2,000.

[0160] In some embodiments, the cyclic polypeptide of the present invention may contain at least one amino acid selected from the group consisting of natural amino acids, unnatural amino acids, and amino acid analogs. The ratio of these amino acids is not particularly limited.

[0161] In some embodiments, the total number of amino acids and amino acid analogs contained in the cyclic polypeptide of the present invention may be 4 to 20, 4 to 15, 6 to 15, 8 to 15, 9 to 13, or 10 to 13. In certain embodiments, the total number of amino acids and amino acid analogs contained in the cyclic portion of the cyclic polypeptide of the present invention may be 5 to 15, 7 to 12, 10 to 13, or 9 to 11.

[0162] In some embodiments, when the cyclic polypeptide of the present invention has a linear portion, the number of amino acids and / or amino acid analogs in the linear portion is preferably 0 to 17, more preferably 0 to 8, even more preferably 0 to 5, and particularly preferably 0 to 3. In a non-limiting embodiment, the "linear portion" herein may include natural amino acids and unnatural amino acids (including chemically modified or backbone-converted amino acids).

[0163] In one embodiment, the linear portion of the cyclic polypeptide of the present invention may be a linear portion composed of a tag and a linker. The tag of the present invention may contain, for example, at least one, two, three, or four amino acid residues selected from Thr, MePhe, Pro, and Ile. Examples of such tags include, but are not limited to, tags containing one, two, or three or more sequences consisting of Thr-MePhe-Pro-Ile (SEQ ID NO: 61), and even more preferably, tags also referred to herein as "TFIP tags." In addition to the FLAG tag, GST tag, HA tag, and Myc tag described herein, various tags known to those skilled in the art can be suitably used in the present invention. Examples of linkers constituting the linear portion of the present invention include, but are not limited to, a Gly-Gly linker, a linker composed of Gly and Ser (for example, 1 to 3 repeats of Gly-Gly-Gly-Ser (SEQ ID NO: 62)), and a linker composed of Thr and Gly (for example, 1 to 3 repeats of Thr-Gly). The linear portion in the present invention may have an amino acid residue at its C-terminus protected with a protecting group.

[0164] In some aspects, the polypeptides of the present invention may be modified to enhance their intracellular translocation ability. Such modifications are not particularly limited, as known methods can be used, and an example is a method of attaching a cell membrane-permeable peptide. Known sequences can be used as cell membrane-permeable peptides, such as the Tat peptide (GRKKRRQRRRPPQ [SEQ ID NO: 10]) derived from the HIV Tat protein (Brooks, H. et al., Advanced Drug Delivery Reviews, Vol. 57, Issue 4, 2005, pp. 559-577) or polyarginine consisting of 6 to 12 arginine residues (Nakase, I. et al., Advanced Drug Delivery Reviews, Vol. 60, 2008, pp. 598-607). It has also been reported that peptides can gain access to the cytoplasm by linking them to fatty acids or stilbene derivatives (Covic, L. et al. (2002) Nat Med. 8:1161; Endres, PJ et al. (2006) Molecular Imaging 4:485; and Goubaeva, F. et al., J. Biol. Chem. 278:19634). Using such methods, polypeptides can be transported into cells.

[0165] In some embodiments, the cyclic polypeptide of the present invention can be at least one compound selected from PP1 to PP25 described herein. In some embodiments, the cyclic polypeptide of the present invention can be at least one compound (cyclic polypeptide having a linear portion) selected from PP7+tag, PP10+tag, and PP23+tag described herein.

[0166] Although not intended to be limiting, in some embodiments, the polypeptide of the present invention may be an antibody (anti-Regnase-1 antibody). That is, in some embodiments, the antibody of the present invention may be at least one antibody selected from the antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 described herein.

[0167] In a further aspect of the present invention, the anti-Regnase-1 antibody is a monoclonal antibody, including a chimeric, humanized, or human antibody. In one embodiment, the anti-Regnase-1 antibody is an antibody fragment, such as an Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a full-length antibody, such as an IgG antibody or other antibody class or isotype. In another embodiment, the antibody is a multispecific antibody (e.g., a bispecific antibody).

[0168] (drug delivery to intracellular targets) Certain embodiments of the present invention provide antibodies or antigen-binding fragments thereof that can target Regnase-1 intracellularly. Antibodies that inhibit Regnase-1 phosphorylation can be delivered intracellularly by modifying or altering the antibodies using techniques known to those skilled in the art. In one embodiment, the antibodies of the present invention can be expressed intracellularly as intrabodies (intrabody-expressed antibodies). As used herein, the term "intrabody" refers to an antibody or antigen-binding fragment thereof that is expressed intracellularly and can selectively bind to a target molecule, as described, for example, in Marasco, Gene Therapy 4: 11-15 (1997); Kontermann, Methods 34: 163-170 (2004); U.S. Patent Nos. 6,004,940 and 6,329,173; U.S. Patent Application Publication No. 2003 / 0104402; and PCT Publication WO2003 / 077945. See also, for example, WO 96 / 007321 published March 14, 1996 concerning the use of gene therapy to generate intracellular antibodies.

[0169] Intracellular expression of intrabodies can be achieved by introducing into target cells a nucleic acid encoding the desired antibody or antigen-binding fragment thereof (lacking the native leader sequence and secretion signal normally associated with the gene encoding that antibody or antigen-binding fragment). One or more nucleic acids encoding all or a portion of an antibody of the invention can be delivered to target cells such that one or more intrabodies capable of binding to and modulating the activity of an intracellular target polypeptide are expressed. Any standard method for introducing nucleic acids into cells can be used, including (but not limited to): microinjection, ballistic injection, electroporation, calcium phosphate precipitation, liposomes, and transfection with retroviruses, adenoviruses, adeno-associated viruses, and vaccinia vectors carrying the nucleic acid of interest.

[0170] In certain embodiments, nucleic acid (optionally contained in vector) can be introduced into patient's cells by in vivo and ex vivo methods.In one example of in vivo delivery, nucleic acid is directly injected into patient, for example, at the site where therapeutic intervention is required.In another example of in vivo delivery, nucleic acid is introduced into cell by transfection using viral vector (for example, adenovirus, type I herpes simplex virus, or adeno-associated virus) and lipid-based system (useful lipids for lipid-mediated gene transfer are, for example, DOTMA, DOPE, and DC-Chol).For a review of specific gene marking and gene therapy protocols, see Anderson et al., Science 256:808-813 (1992) and WO93 / 25673 and the references cited therein. In an example of ex vivo treatment, a patient's cells are removed, a nucleic acid is introduced into the isolated cells, and the modified cells are either administered directly to the patient or encapsulated, for example, within a porous membrane that is implanted into the patient (see, e.g., U.S. Patent Nos. 4,892,538 and 5,283,187). A commonly used vector for ex vivo delivery of nucleic acids is a retroviral vector.

[0171] In another embodiment, an internalizing antibody is provided.Antibodies can have specific characteristics that improve the delivery of antibodies to cells, or can be modified to have such characteristics.Methods for achieving this are known in the art.For example, a complete immunoglobulin-type antibody (cytotransmab) is known, which has a humanized light chain variable region (VL) single domain that can penetrate the interior of cells and distribute to the cytoplasm (see, for example, WO2016 / 013870). A heavy chain variable region (VH) library is used to select a heavy chain variable region (VH) that specifically binds to Regnase-1. This VH is then substituted for the VH of an antibody in the form of a complete immunoglobulin that penetrates the interior of the cell and distributes in the cytoplasm, thereby producing an anti-Regnase-1 antibody in the form of a complete immunoglobulin (iMAB: internalizing & interfering monoclonal antibody) that can penetrate the interior of the cell and specifically bind to Regnase-1 in the cytoplasm (see, for example, WO2016 / 013870). It is also known that intracellular delivery of antibodies is possible by, for example, attaching a phosphorothioate nucleic acid or a phosphorothioate polymer backbone to an antibody (see, for example, WO2015 / 031837). Antibodies that can penetrate the interior of the cell and specifically bind to Regnase-1 in the cytoplasm can be produced by covalently or non-covalently attaching a phosphorothioate nucleic acid or a phosphorothioate polymer backbone to an antibody against Regnase-1. Also, for example, cationization of antibodies is known to promote their cellular uptake (see, for example, U.S. Patent No. 6,703,019). Lipofection or liposomes can also be used to deliver antibodies into cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the target protein may be used. For example, based on the variable region sequence of an antibody, a peptide molecule that retains the ability to bind to the target protein sequence can be designed. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology.See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA 90: 7889-7893 (1993). Alternatively, antibodies can be produced by treating antibodies with enzymes such as papain or pepsin to generate antibody fragments, or by constructing DNA encoding these antibody fragments or minibodies, introducing the DNA into an expression vector, and then expressing the vector in a suitable host cell (e.g., Co, MS et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, AH, Methods Enzymol. (1989) 178, 476-496; Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, E., Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al., Methods Enzymol. (1986) 121, 652-663). 663-669; Bird, RE and Walker, BW, Trends Biotechnol. (1991) 9, 132-137).

[0172] Antibody entry into target cells can be enhanced by other methods known in the art. For example, certain sequences, such as those derived from HIV Tat or Antennapedia homeodomain proteins, can result in efficient uptake of heterologous proteins across cell membranes. See, for example, Chen et al., Proc. Natl. Acad. Sci. USA 96:4325-4329 (1999).

[0173] In some embodiments, the Regnase-1-binding molecule of the present invention may be a dominant-negative form of at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. Such dominant-negative forms are not particularly limited, as long as they bind to Regnase-1 but lack the ability to phosphorylate Regnase-1. For example, a dominant-negative form of TBK1 or IKKi may lack kinase activity, and a dominant-negative form of Act-1 may lack the ability to bind to TBK1 and / or IKKi.

[0174] 4. Methods for identifying substances that inhibit the phosphorylation of Regnase-1 As described above, as a result of intensive research by the present inventors, it has been found that inhibiting phosphorylation of Regnase-1 is effective for treating and / or preventing certain diseases. In particular, it is believed that phosphorylation of the Ser residues corresponding to positions 513 and / or 494 in SEQ ID NO: 1 induces dissociation (e.g., monomerization) of Regnase-1 oligomers, their release from the endoplasmic reticulum, the generation of inactive Regnase-1 (destabilization of Regnase-1), and subsequent degradation of Regnase-1.

[0175] In some embodiments, the identification method of the present invention may be a method for identifying a substance that inhibits the phosphorylation of Regnase-1, using as an indicator the phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to each of positions 513, 494, 439, and 435 of SEQ ID NO: 1. In one embodiment, the method of the present invention for identifying a substance that inhibits phosphorylation may use as an indicator the phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to each of positions 513 and 494 of SEQ ID NO: 1.

[0176] In one embodiment, the method of the present invention for identifying a substance that inhibits phosphorylation may use the phosphorylation of both of the following Ser residues (i) and (ii) as indicators. (i) Ser residues at either or both of positions corresponding to 513 and 494 of SEQ ID NO: 1 in Regnase-1; (ii) Ser residues at either or both of positions corresponding to 439 and 435 in SEQ ID NO: 1 in Regnase-1.

[0177] In some embodiments, the method for identifying a substance that inhibits phosphorylation of the present invention may comprise the following steps (a) and (b): (a) mixing Regnase-1 with a kinase capable of phosphorylating Regnase-1 in the presence of a test substance, and detecting the phosphorylation of Regnase-1 by the kinase; (b) identifying a substance that inhibits phosphorylation of Regnase-1 by said kinase compared to the absence of the test substance;

[0178] Alternatively, in some embodiments, the method for identifying a substance that inhibits phosphorylation of the present invention may comprise the following steps (a) and (b): (a) contacting Regnase-1 with a test substance under conditions that allow phosphorylation of Regnase-1, and detecting phosphorylation of Regnase-1; (b) identifying a substance that inhibits phosphorylation of Regnase-1 compared to the absence of the test substance;

[0179] In some embodiments, the method of the present invention for identifying a substance that inhibits phosphorylation may be performed by comparing the degree of phosphorylation of a specific amino acid residue in Regnase-1 in the presence and absence of a test substance, and selecting a test substance that reduces the degree of phosphorylation.

[0180] In some embodiments, the test substance in the method for identifying a substance that inhibits phosphorylation of the present invention may be a Regnase-1 binding molecule.

[0181] In some embodiments, the method of the present invention for identifying a substance that inhibits phosphorylation may comprise a method of screening for a substance that has specific binding ability to Regnase-1.

[0182] Whether a substance inhibits phosphorylation of the Ser residue corresponding to positions 513, 494, 439 or 435 of SEQ ID NO: 1 in Regnase-1 can be confirmed using the methods disclosed herein, for example, using an antibody that recognizes the phosphorylated Ser residue.

[0183] In some embodiments, the method of the present invention for identifying a substance that inhibits phosphorylation may be carried out using an antibody capable of detecting phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to each of positions 513, 494, 439, and 435 of SEQ ID NO: 1.

[0184] In some embodiments, the method of the present invention for identifying a substance that inhibits phosphorylation may be a method for identifying a substance that inhibits the phosphorylation of human Regnase-1. In one embodiment, the identification method of the present invention may be a method for identifying a substance that inhibits the phosphorylation of Regnase-1, using phosphorylation of Ser residues at positions 516, 497, 442, and 438 of SEQ ID NO: 2 as an indicator.

[0185] In some embodiments, the "substance that inhibits the phosphorylation of Regnase-1" may be a Regnase-1 binding molecule. Therefore, in one embodiment, the identification method of the present invention may further include a step of measuring the binding activity of the test substance to Regnase-1, and / or a step of identifying or selecting a test substance having binding activity to Regnase-1.

[0186] In one aspect, the present invention provides an antibody that specifically recognizes phosphorylated Regnase-1. As described above, such an antibody can be used to identify substances that inhibit the phosphorylation of Regnase-1.

[0187] In some embodiments, the antibody of the present invention may be an antibody that recognizes Regnase-1 with a phosphorylated Ser residue, and may be an antibody that specifically recognizes Regnase-1 with a phosphorylated Ser residue at at least one position selected from the group consisting of positions corresponding to each of positions 513, 494, 439 and 435 of SEQ ID NO: 1.

[0188] In one aspect, the antibody of the present invention may be an antibody capable of binding to phosphorylated human Regnase-1, or may be an antibody capable of binding to both phosphorylated mouse Regnase-1 and phosphorylated human Regnase-1.

[0189] In one aspect, the present invention provides a composition for identifying a substance that inhibits the phosphorylation of Regnase-1. Such a composition may comprise a predetermined amount of a kinase and / or a predetermined amount of Regnase-1.

[0190] In some embodiments, the kinase used in the identification method of the present invention or the kinase contained in the composition of the present invention may be a kinase capable of phosphorylating at least one Ser residue in Regnase-1 selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1. Examples of such kinases include at least one kinase selected from the group consisting of TBK1, IKKi, IRAK, and IKK, and may be at least one kinase selected from the group consisting of TBK1, IKKi, and IKK; the group consisting of TBK1, IKKi, and IRAK; or the group consisting of TBK1 and IKKi.

[0191] In some embodiments, the phosphorylation in the present invention may be phosphorylation of at least one Ser residue selected from the group consisting of positions corresponding to each of positions 513, 494, 439, and 435 of SEQ ID NO: 1, or may be phosphorylation of at least one Ser residue selected from the group consisting of positions corresponding to each of positions 513 and 494 of SEQ ID NO: 1, or may be phosphorylation of at least one Ser residue selected from the group consisting of positions 516, 497, 442, and 438 of SEQ ID NO: 2, or may be phosphorylation of at least one Ser residue selected from the group consisting of positions 516 and 497 of SEQ ID NO: 2, or may be phosphorylation of a Ser residue at position 516 of SEQ ID NO: 2, or may be phosphorylation of a Ser residue at at least one position selected from the group consisting of positions 442 and 438 of SEQ ID NO: 2.

[0192] In some embodiments, the compositions of the present invention may comprise a Regnase-1 binding molecule, and may comprise a predetermined amount of the Regnase-1 binding molecule.

[0193] In some embodiments, the Regnase-1 of the present invention may be human Regnase-1.

[0194] In some embodiments, the compositions of the present invention may comprise a predetermined amount of a kinase and a predetermined amount of Regnase-1. In some embodiments, the Regnase-1 contained in the compositions of the present invention may be dephosphorylated Regnase-1 or dephosphorylated Regnase-1.

[0195] In the present invention, the "predetermined amount" is not particularly limited, and may be an amount determined before the assay is performed.

[0196] 5. Method for identifying a substance that inhibits binding of a binding molecule to Regnase-1 As a result of extensive research by the present inventors, it has been found that inhibiting the binding of TBK1 and IKKi, or Act-1 and Regnase-1, is effective in treating and / or preventing certain diseases. In one aspect, the present invention provides a method for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK.

[0197] In some embodiments, the method for identifying a substance that inhibits binding of the present invention may comprise the following steps (a) and (b): (a) mixing at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK with Regnase-1 in the presence of a test substance, and measuring the binding activity of the binding molecule with Regnase-1; (b) identifying a substance that can reduce the binding activity of the binding molecule to Regnase-1 compared to the absence of the test substance;

[0198] In the present invention, the binding activity can be measured by the method described below.

[0199] As used herein, "inhibiting binding" means reducing the binding activity between a first molecule and a second molecule, or preventing the two molecules from binding together.

[0200] In some embodiments, the "substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK" may be a Regnase-1-binding molecule. Thus, in one embodiment, the identification method of the present invention may further comprise the step of measuring the binding activity of the test substance to Regnase-1 and / or the step of identifying or selecting a test substance having binding activity to Regnase-1.

[0201] Alternatively, in some embodiments, the "substance that inhibits binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK" may be a substance that inhibits the phosphorylation of Regnase-1. Thus, in one embodiment, the identification method of the present invention may further comprise the step of measuring the Regnase-1 phosphorylation activity of the test substance and / or the step of identifying or selecting a test substance having said activity. Alternatively, in one aspect, the method of the present invention for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK and IRAK may be used in combination with the method for identifying a substance that inhibits the phosphorylation of Regnase-1 described above.

[0202] In one aspect, the present invention provides a composition for identifying a substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. In one embodiment, the composition of the present invention may comprise a predetermined amount of the binding molecule and Regnase-1, or may comprise a predetermined amount of the binding molecule and a predetermined amount of Regnase-1.

[0203] In some embodiments, the identification method of the present invention may be a method for identifying a substance that inhibits binding between any of the following (i) to (x) and Regnase-1, and the composition of the present invention may comprise any of the following binding molecules (i) to (x) and Regnase-1: (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (v) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. The IKK in (i) to (xi) may be IKKβ.

[0204] In some embodiments, the Regnase-1 used in the identification method of the present invention, or the Regnase-1 contained in the composition of the present invention, may be dephosphorylated Regnase-1 or Regnase-1 that has been dephosphorylated.

[0205] 6. Methods for identifying substances that compete with a reference substance for binding to Regnase-1 7. Method for identifying substances that bind to the same site on Regnase-1 as the site to which a reference substance binds In one aspect, the present invention relates to a method for identifying a test substance that competes with a reference substance for binding to Regnase-1. In one aspect, the present invention relates to a method for identifying a test substance that binds to the same site on Regnase-1 as the site to which the reference substance binds. Using this method, it is possible to obtain a Regnase-1-binding molecule that inhibits phosphorylation of the Ser residue of Regnase-1. Such a molecule can be used in the treatment and / or prevention of diseases in which Regnase-1 is involved.

[0206] To identify such a substance, for example, a competitive assay can be used. That is, the method for identifying a substance that competes with a reference substance for binding to Regnase-1 in the present invention can illustratively include carrying out the competitive assay described in "9. Assays" of this specification, "B. Binding assays and other assays." The amount of a reference substance bound to Regnase-1 is indirectly correlated with the binding ability of a candidate competitor (test substance) that competes with the reference substance for binding to Regnase-1, more specifically, the binding affinity of the candidate competitor (test substance) that competes with the reference substance for binding to the Regnase-1 site. That is, the greater the amount or affinity of the test substance that binds to the same site on Regnase-1 as the reference substance, the lower the amount of binding of the reference substance to Regnase-1 and the higher the amount of binding of the test substance to Regnase-1. Specifically, an appropriately labeled reference substance and the test substance to be evaluated are simultaneously added to Regnase-1, and the bound reference substance is detected using the label. The amount of the reference substance bound to Regnase-1 can be easily measured by pre-labeling the substance. The labeling method is not particularly limited, but a labeling method appropriate for the technique can be selected. Specific labeling methods include fluorescent labeling, radiolabeling, and enzyme labeling.

[0207] Alternatively, in the present invention, a substance that binds to the same site on Regnase-1 as the site on Regnase-1 to which a reference substance binds can be obtained by a known epitope mapping method (for details of epitope mapping, see also the section "B. Binding Measurement Methods and Other Measurement Methods" in "9. Measurement Methods (Assays)" of this specification). Specifically, the site on Regnase-1 to which a reference substance binds (epitope) can be analyzed by an epitope mapping method using Regnase-1 or a partial peptide thereof, and a substance that binds to the identified epitope can be prepared using a peptide containing the epitope, thereby obtaining a substance that binds to the same site on Regnase-1 as the site on Regnase-1 to which a reference substance binds. Therefore, a method for identifying a substance that binds to the same site on Regnase-1 to which a reference substance binds in the present invention can illustratively include performing an epitope mapping method.

[0208] The substances obtained in this manner are expected to exhibit inhibitory activity similar to that of compounds PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag or antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 obtained in the Examples with respect to the inhibitory activity of phosphorylating the Ser residue of Regnase-1. Thus, substances that compete with compounds PP1 to PP25, PP7+tag, PP10+tag, PP23+tag, or antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 isolated in the Examples for binding to Regnase-1 and that have inhibitory activity against the phosphorylation of the Ser residue in Regnase-1, or substances that bind to substantially the same site in Regnase-1 as the sites to which compounds PP1 to PP25, PP7+tag, PP10+tag, PP23+tag, or antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 obtained in the Examples bind, and that have inhibitory activity against the phosphorylation of the Ser residue in Regnase-1, can be suitably used as Regnase-1-binding molecules in the present invention.

[0209] The test substance in the present invention is not particularly limited, and examples thereof include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, etc., and preferably includes antibodies and cyclic polypeptides.

[0210] In one non-limiting aspect, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may comprise the amino acid sequence of positions 544 to 596 shown in SEQ ID NO: 1, or the amino acid sequence of positions 547 to 599 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.

[0211] In one non-limiting aspect, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may comprise the amino acid sequence of positions 1 to 543 shown in SEQ ID NO: 1, or the amino acid sequence of positions 1 to 546 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.

[0212] In one non-limiting aspect, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may comprise the amino acid sequence of positions 301 to 596 shown in SEQ ID NO: 1, or the amino acid sequence of positions 301 to 599 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.

[0213] In one non-limiting aspect, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may comprise the amino acid sequence of positions 1 to 300 shown in SEQ ID NO: 1, or the amino acid sequence of positions 1 to 300 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.

[0214] The reference substance in the present invention is not particularly limited as long as it can bind to and inhibit phosphorylation of Regnase-1. In a non-limiting embodiment, the reference substance can be at least one compound selected from the following: PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag, or at least one antibody selected from the following: REA0023, REA0027, REB0007, REB0014, and REB0022.

[0215] The present invention may further include the steps of measuring the phosphorylation activity of at least one binding molecule (Regnase-1 acting molecule) selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK by the test substance selected by the competitive assay, and selecting a test substance that inhibits or reduces the phosphorylation activity. Measurement of the phosphorylation activity can be carried out, for example, according to the method described in the section "A. Method for detecting phosphorylation inhibition" of "9. Measurement methods (assays)" of this specification. Alternatively, the present invention may further include a step of measuring the RNase activity of Regnase-1 using test substances selected by the above-mentioned competitive assay, and a step of selecting test substances that do not inhibit or reduce RNase activity. Measurement of RNase activity can be carried out, for example, according to the method described in "C. Activity Measurement Method" of "9. Measurement Method (Assay)" of this specification.

[0216] The test substance in the present invention is not particularly limited, and examples thereof include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, etc., and preferably includes antibodies and cyclic polypeptides.

[0217] 8. Method for producing the Regnase-1 binding molecule of the present invention Methods for producing Regnase-1-binding molecules of the present invention are not particularly limited, and include, for example, methods for chemically synthesizing polypeptides or methods for expressing recombinant polypeptides using cells, as described below. In one embodiment, the production method may also include the method of the present invention for identifying a substance that inhibits the phosphorylation of Regnase-1, which, for example, allows the production of Regnase-1-binding molecules that inhibit the phosphorylation of Regnase-1. In another embodiment, the production method may also include the method of the present invention for identifying a substance that competes with a reference substance (e.g., any of the above-mentioned compounds PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag, or antibodies REA0023, REA0027, REB0007, REB0014, and REB0022) for binding to Regnase-1.

[0218] The method for producing a Regnase-1-binding molecule of the present invention may include a method for identifying a Regnase-1-binding molecule. Methods known to those skilled in the art can be used to identify a Regnase-1-binding molecule. For example, an animal may be immunized with Regnase-1 or a peptide fragment thereof to identify an antibody that binds to Regnase-1. These methods are also described herein. Alternatively, a peptide library may be used to identify a peptide that binds to Regnase-1. Such identification methods are known, for example, in WO2013 / 100132, WO2012 / 033154, etc.

[0219] A. Chemical Synthesis of Polypeptides Examples of chemical synthesis methods for polypeptides that bind to Regnase-1 in the present invention include liquid-phase synthesis, solid-phase synthesis using Fmoc or Boc, and combinations thereof. In Fmoc synthesis, the base unit is an amino acid in which the main chain amino group is protected with an Fmoc group, and the side chain functional groups are protected as needed with a protecting group that is not cleaved by a base, such as piperidine, and the main chain carboxylic acid is not protected. The base unit is not particularly limited as long as it has an Fmoc-protected amino group and a carboxylic acid group. For example, a dipeptide may be used as the base unit. The base unit placed at the N-terminus may be other than an Fmoc amino acid. For example, it may be a Boc amino acid or a carboxylic acid analog without an amino group. The main chain carboxylic acid group is supported on the solid phase by chemical reaction with a functional group on the solid support. Subsequently, the Fmoc group is deprotected with a base such as piperidine or DBU, and the newly generated amino group is condensed with the subsequently added base unit, a protected amino acid with a carboxylic acid, to form a peptide bond. Various combinations of DIC and HOBt, DIC and HOAt, and HATU and DIPEA are possible for the condensation reaction. The desired peptide sequence can be generated by repeated Fmoc group removal and subsequent peptide bond formation. After the desired sequence is obtained, the peptide is cleaved from the solid phase and, if necessary, the protective groups on the side chain functional groups are removed. It is also possible to perform structural transformation or cyclization of the peptide before cleavage from the solid phase. Cleavage from the solid phase and deprotection can be performed under the same conditions, such as 90:10 TFA / HO, or, if necessary, under separate conditions. Cleavage from the solid phase can be performed using a weak acid such as 1% TFA, or by using a protecting group such as Pd to take advantage of the orthogonal nature of the two chemical reactions. Cyclization and other steps can also be performed between or after these steps. For example, a side-chain carboxylic acid can be condensed with an amino group on the N-terminus of the main chain, or a side-chain amino group can be condensed with a carboxylic acid on the C-terminus of the main chain.In this case, orthogonality is required between the C-terminal carboxylic acid and the side-chain carboxylic acid to be cyclized, or between the N-terminal main-chain amino group or hydroxy group and the side-chain amino group to be cyclized. As mentioned above, the protecting group is selected taking into consideration the orthogonality of the protecting group. Furthermore, by positioning a chloroacetyl group at the N-terminus, cyclization with the thiol group in the side chain of a cysteine ​​residue is also possible. The reaction product obtained in this manner can be purified using a reverse-phase column or a molecular sieve column. Details of these procedures are described, for example, in the Solid-Phase Synthesis Handbook published by Merck Ltd. on May 1, 2002.

[0220] B. Methods for expressing recombinant polypeptides using cells Polypeptides that bind to Regnase-1 can be produced using recombinant methods or constructs. In one embodiment, when the polypeptide is an antibody, an isolated nucleic acid encoding an anti-Regnase-1 antibody described herein is provided, e.g., as described in U.S. Patent No. 4,816,567. Such a nucleic acid may encode an amino acid sequence comprising the VL and / or an amino acid sequence comprising the VH of the antibody (e.g., the light chain and / or heavy chain of the antibody). In a further embodiment, one or more vectors (e.g., expression vectors) comprising such nucleic acids are provided. In a further embodiment, a host cell comprising such nucleic acids is provided. In one such embodiment, the host cell comprises (e.g., is transformed with) (1) a vector comprising a nucleic acid encoding an amino acid sequence comprising the VL of the antibody and an amino acid sequence comprising the VH of the antibody, or (2) a first vector comprising a nucleic acid encoding an amino acid sequence comprising the VL of the antibody and a second vector comprising a nucleic acid encoding an amino acid sequence comprising the VH of the antibody. In one embodiment, the host cell is eukaryotic (e.g., Chinese hamster ovary (CHO) cell) or lymphoid cell (e.g., Y0, NS0, Sp2 / 0 cell). In one embodiment, a method of producing an anti-Regnase-1 antibody is provided, comprising culturing a host cell containing nucleic acid encoding the antibody as described above under conditions suitable for expression of the anti-Regnase-1 antibody, and optionally recovering the antibody from the host cell (or host cell culture medium).

[0221] For recombinant production of an anti-Regnase-1 antibody, nucleic acid encoding the antibody (e.g., as described above) is isolated and inserted into one or more vectors for further cloning and / or expression in a host cell. Such nucleic acid may be readily isolated and sequenced using conventional procedures (e.g., using oligonucleotide probes capable of specifically binding to genes encoding the antibody heavy and light chains).

[0222] Suitable host cells for cloning or expressing antibody-encoding vectors include prokaryotic or eukaryotic cells as described herein. For example, antibodies may be produced in bacteria, particularly if glycosylation and Fc effector functions are not required. For expression of antibody fragments and polypeptides in bacteria, see, e.g., U.S. Patent Nos. 5,648,237, 5,789,199, and 5,840,523. (See also Charlton, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ, 2003), pp. 245-254, which describes the expression of antibody fragments in E. coli.) After expression, the antibody may be isolated in a soluble fraction from the bacterial cell paste or further purified.

[0223] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors, including fungal and yeast strains whose glycosylation pathways have been "humanized," resulting in the production of antibodies with partial or fully human glycosylation patterns. See Gerngross, Nat. Biotech. 22:1409-1414 (2004) and Li et al., Nat. Biotech. 24:210-215 (2006).

[0224] Vertebrate cells can also be used as hosts. For example, mammalian cell lines that have been adapted to grow in suspension may be useful. Other examples of useful mammalian host cell lines include SV40-transformed monkey kidney CV1 (COS-7); human embryonic kidney (293 or 293 cells, e.g., as described in Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney (BHK) cells; mouse Sertoli cells (TM4 cells, e.g., as described in Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney (CV1); African green monkey kidney (VERO-76); human cervical carcinoma (HELA); canine kidney (MDCK); Buffalo rat hepatocytes (BRL 3A); human lung cells (W138); human hepatocytes (Hep G2); mouse mammary carcinoma (MMT 060562); TRI cells (e.g., as described in Mather et al., Annals NY Acad. Sci. 383:44-68 (1982)). (described in

[1999] ); MRC5 cells; and FS4 cells. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells (Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); and myeloma cell lines such as Y0, NS0, and Sp2 / 0. For a review of specific mammalian host cell lines suitable for antibody production, see, e.g., Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003).

[0225] 9. Assay Regnase-1 binding molecules of the present invention may be identified, screened, or characterized for their physical / chemical properties and / or biological activity by a variety of assays known in the art.

[0226] In the assay of the present invention, tagged Regnase-1 or tagged kinase may be used as appropriate, including, but not limited to, FLAG, GST, HA, and Myc.

[0227] A. Methods for detecting phosphorylation inhibition Methods for detecting whether a substance inhibits the phosphorylation of Regnase-1 include, but are not limited to, methods using radioisotope-labeled ATP and methods using antibodies that specifically recognize phosphorylated Regnase-1. Cell-based assays, cell lysate assays, and cell-free assays are also applicable. Kinases that can be used in experiments include TBK1, IKKi, IKK, IRAK1, and IRAK2.

[0228] As a method using radioisotope-labeled ATP, 32 An example of such a method is to phosphorylate Regnase-1 using a certain type of kinase with [P]ATP, and then visualize the phosphorylated Regnase-1 by autoradiography. More specifically, an example is the method described in the Examples below.

[0229] Furthermore, by using an antibody that specifically recognizes phosphorylated Regnase-1, it is possible to detect whether phosphorylation of a specific amino acid residue in Regnase-1 is inhibited. For example, by using an antibody that specifically recognizes human Regnase-1 in which Ser at position 516 of SEQ ID NO: 2 is phosphorylated, phosphorylation of Ser516 can be detected by Western blotting or the like. More specifically, the method described in the Examples below can be exemplified.

[0230] In some embodiments, the antibody that specifically recognizes phosphorylated Regnase-1 provided by the present invention may be an antibody that binds to phosphorylated Regnase-1 but not to unphosphorylated Regnase-1, or may be an antibody that binds more strongly to phosphorylated Regnase-1 than to unphosphorylated Regnase-1. The antibody may be a polyclonal antibody or a monoclonal antibody. In some embodiments, the antibody may be an antibody that specifically recognizes at least one Regnase-1 selected from the group consisting of the following (i) to (viii): (i) mouse Regnase-1 phosphorylated at Ser435 and / or Ser439 of SEQ ID NO: 1; (ii) mouse Regnase-1 phosphorylated at Ser494 of SEQ ID NO: 1; (iii) mouse Regnase-1 phosphorylated at Ser513 of SEQ ID NO: 1; (iv) human Regnase-1 phosphorylated at Ser438 and / or Ser442 of SEQ ID NO: 2; (v) human Regnase-1 phosphorylated at Ser437 of SEQ ID NO:2; (vi) human Regnase-1 phosphorylated at Ser516 of SEQ ID NO:2; (vii) mouse Regnase-1 phosphorylated at Ser435, Ser439, Ser494, and Ser513 of SEQ ID NO: 1; (viii) Mouse Regnase-1 in which Ser438, Ser442, Ser437, and Ser516 of SEQ ID NO: 2 are phosphorylated.

[0231] In some embodiments, the antibody of the present invention may be an antibody capable of detecting phosphorylation of human Regnase-1, or may be an antibody capable of detecting phosphorylation of both mouse Regnase-1 and human Regnase-1, or may be an antibody that specifically recognizes Regnase-1 of (i) and (iv); (ii) and (v); (iii) and (iv); or (vii) and (viii).

[0232] Antibodies that specifically recognize phosphorylated Regnase-1 can be produced by known methods using Regnase-1, preferably a partial peptide, in which a specific amino acid residue is phosphorylated, as an antigen. For example, an animal such as a rabbit can be immunized with the antigen using a conventional method, and antibodies can be obtained from the serum of the animal, but this method is not limited to this. More specifically, the method described in the Examples below can be exemplified.

[0233] Whether the antibody obtained by the above method specifically recognizes phosphorylated Regnase-1 can be confirmed by evaluating its binding activity to phosphorylated Regnase-1 and non-phosphorylated Regnase-1 using techniques such as Western blotting.

[0234] In one aspect, the present invention provides an antibody that specifically recognizes the above-described phosphorylated Regnase-1.

[0235] B. Binding and Other Assays In one aspect, the Regnase-1 binding molecules of the present invention are tested for their Regnase-1 binding activity by known methods, such as ELISA, Western blotting, surface plasmon resonance assays, and the like.

[0236] In another aspect, competitive assays can be used to identify Regnase-1 binding molecules that compete with a reference substance for binding to Regnase-1.In certain embodiments, such competing molecules bind to the same site (epitope, for example, linear or conformational epitope) on Regnase-1 as that bound by the reference substance.Detailed exemplary methods for mapping the epitope that a polypeptide binds to are provided in Morris (1996) "Epitope Mapping Protocols," in Methods in Molecular Biology, vol. 66 (Humana Press, Totowa, NJ).

[0237] Examples of such reference substances include, but are not limited to, at least one compound selected from PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag described herein, or at least one antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 described herein. Examples of reference substances include at least one compound selected from the group consisting of PP7, PP23, and PP10 described herein.

[0238] In an exemplary competitive assay, immobilized Regnase-1 is incubated in a solution containing a first labeled substance that binds to Regnase-1 and a second unlabeled Regnase-1-binding molecule to be tested for its ability to compete with the first substance for binding to Regnase-1. As a control, immobilized Regnase-1 is incubated in a solution containing the first labeled substance but not the second unlabeled Regnase-1-binding molecule. After incubation under conditions that allow binding of the first substance to Regnase-1, excess unbound substance is removed and the amount of label bound to immobilized Regnase-1 is measured. If the amount of label bound to immobilized Regnase-1 is substantially reduced in the test sample compared to the control sample, this indicates that the second molecule competes with the first substance for binding to Regnase-1. See Harlow and Lane (1988) Antibodies: A Laboratory Manual ch. 14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

[0239] In another exemplary competitive assay, BIACORE® analysis is used to determine the ability of a test substance to compete with the binding of a second (reference) substance to Regnase-1. In a further aspect, using a BIACORE® instrument (e.g., BIACORE® 3000) according to the manufacturer's recommendations, Regnase-1 is captured onto a CM5 BIACORE® chip using standard techniques known in the art, creating a Regnase-1-coated surface. Typically, 200-800 resonance units of Regnase-1 are coupled to the chip (an amount that results in a readily measurable level of binding but is easily saturable with the test substance concentration used). The two substances to be evaluated for their ability to compete with each other (i.e., the test substance and the reference substance) are mixed in an appropriate buffer at a 1:1 molar ratio of binding sites to form a mixture. When calculating the concentration based on binding sites, the molecular weight of the test substance or reference substance is calculated by dividing the total molecular weight of the corresponding substance by the number of Regnase-1 binding sites on that substance. The concentrations of each substance (i.e., test substance and reference substance) in the mixture must be high enough to easily saturate the binding sites of the substance on the Regnase-1 molecules captured on the BIACORE® chip. The test substance and reference substance in the mixture are at the same molar concentration (based on binding), typically 1.00-1.5 micromolar (based on binding sites). Separate solutions containing only the test substance and only the reference substance are also prepared. The test substance and reference substance in these solutions can be in the same buffer as the mixture, at the same concentration, and under the same conditions. The mixture containing the test substance and reference substance is passed over a BIACORE® chip coated with Regnase-1, and the total amount of binding is recorded. The chip is then treated to remove any bound test substance or reference substance without damaging the Regnase-1 bound to the chip. Typically, this is done by treating the chip with 30 mM HCl for 60 seconds. A solution of the test substance alone is then passed over the Regnase-1-coated surface, and the amount of binding is recorded.The chip is again treated to remove all of the bound substance without damaging the Regnase-1 bound to the chip.Then, a solution of only the reference substance is passed over the surface coated with Regnase-1, and the amount of binding is recorded.Then, the theoretical maximum binding of the mixture of the test substance and the reference substance is calculated, which is the sum of the binding of each substance (i.e., test and reference) when passing alone over the Regnase-1 surface.If the actual recorded binding of the mixture is less than this theoretical maximum, the test substance and the reference substance compete with each other for binding to Regnase-1. Thus, generally, a competing test substance is one that binds to Regnase-1 in the above-described BIACORE® blocking assay in the presence of a reference substance such that the binding recorded during the assay is between 80% and 0.1% (e.g., 80% > 4%) of the theoretical maximum binding (as defined above) for the combined test substance and reference substance, particularly between 75% and 0.1% (e.g., 75% - 4%) of the theoretical maximum binding, and more particularly between 70% and 0.1% (e.g., 70% - 4%) of the theoretical maximum binding.

[0240] In another exemplary competitive assay, BIACORE® analysis is used to determine the ability of a test substance to compete with the binding of a second (reference) substance to Regnase-1. In a further aspect, operating a BIACORE® instrument (e.g., BIACORE® 3000) according to the manufacturer's recommendations, a reference substance is captured on a BIACORE® chip using standard techniques known in the art to create a reference-coated surface. Typically, 200-800 resonance units of the reference substance are coupled to the chip (an amount that results in a readily measurable level of Regnase-1 binding). The test substance to be evaluated for its ability to compete with the reference substance and Regnase-1 are mixed in an appropriate buffer to form a mixture. Separate solutions containing only Regnase-1 are also prepared. The Regnase-1 in these solutions can be in the same buffer, at the same concentration, and under the same conditions as the mixture. The solution containing only Regnase-1 is passed over the BIACORE® chip coated with the reference substance, and the total amount of binding is recorded. To regenerate the chip, the chip is treated to remove the reference substance coated on the chip surface. For example, if a reference substance is coated via an antibody on a BIACORE® chip to which Protein A is covalently immobilized, the chip is treated with 10 mM Glycine-HCl to remove the antibody bound to Protein A. Then, the mixture containing the test substance and Regnase-1 is passed over the BIACORE® chip coated with the reference substance, and the total amount of binding is recorded. If the total amount of binding recorded when the mixture containing the test substance and Regnase-1 is passed over is smaller than the total amount of binding recorded when a solution containing Regnase-1 alone is passed over, the test substance and the reference substance are competing substances. Without being limited thereto, competition between the test substance and the reference substance may mean that the value obtained by dividing (the total amount of binding when a test mixture containing the test substance and Regnase-1 is passed through) by (the total amount of binding when a solution containing only Regnase-1 is passed through) is 0.8 or less, 0.7 or less, 0.6 or less, or 0.5 or less.

[0241] To capture a reference substance on a BIACORE® chip, a tag may be attached to the reference substance. Examples of such tags include the TFPI-tag and FLAG-tag described herein. The reference substance and tag may be linked via a linker. Examples of such linkers include a Gly-Gly linker, a linker composed of Gly and Ser (e.g., 1 to 3 repeats of Gly-Gly-Gly-Ser (SEQ ID NO: 62)), or a linker composed of Thr and Gly (e.g., 1 to 3 repeats of Thr-Gly). Examples of tagged reference substances include, but are not limited to, the PP7+tag, PP23+tag, and PP10+tag disclosed herein. The tagged reference substance may be captured on the chip via an antibody against the tag. More detailed methods for capturing tagged reference substances on a chip are described in the Examples.

[0242] C. Activity measurement method In one aspect, a method for determining the biological activity of Regnase-1 binding molecules is provided.Biological activity may include, for example, the activity of degrading target mRNA (RNase activity) or the activity of suppressing the expression of target mRNA.Also provided is a Regnase-1 binding molecule that has such biological activity under in vivo and / or in vitro conditions.

[0243] As used herein, "suppressing mRNA expression" means reducing the amount of mRNA, and includes reducing the amount of mRNA by degrading the mRNA.

[0244] In certain embodiments, the Regnase-1-binding molecules of the present invention are tested for such biological activity. The activity of degrading a target mRNA can be measured using the methods described herein. For example, HEK293 cells are overexpressed with IL-6 mRNA and its 3'UTR as target mRNA in the presence of Regnase-1, and the difference in IL-6 mRNA levels in the presence and absence of a test substance is assessed by Northern blotting. The target is not limited to IL-6 mRNA. Alternatively, a test substance may be administered to a disease model animal, and the target mRNA expression level in tissues collected from the animal may be measured by quantitative PCR analysis.

[0245] D. Affinity Measurements In one embodiment, the dissociation constant (KD) is measured by radiolabeled antigen binding assay (RIA). In one embodiment, the RIA is performed using a Fab version of the antibody of interest and its antigen. For example, the solution binding affinity of the Fab for the antigen is measured by measuring the lowest concentration ( 125 I) Measurement is performed by equilibrating Fab with labeled antigen and then capturing the bound antigen using a plate coated with anti-Fab antibody. (See, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999)). To establish measurement conditions, MICROTITER® multiwell plates (Thermo Scientific) are coated overnight with 5 μg / ml of capture anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), followed by blocking with 2% (w / v) bovine serum albumin in PBS for 2-5 hours at room temperature (approximately 23°C). In non-adsorbent plates (Nunc #269620), 100 pM or 26 pM [ 125[I]-antigen is mixed with serial dilutions of the Fab of interest (e.g., as in the evaluation of the anti-VEGF antibody, Fab-12, in Presta et al., Cancer Res. 57:4593-4599 (1997)). The Fab of interest is then incubated overnight, although this incubation can be continued for longer periods (e.g., approximately 65 hours) to ensure equilibrium is reached. The mixture is then transferred to a capture plate for incubation at room temperature (e.g., 1 hour). The solution is then removed, and the plate is washed eight times with 0.1% polysorbate 20 (TWEEN-20®) in PBS. Once the plate has dried, 150 μl / well of scintillant (MICROSCINT-20™, Packard) is added, and the plate is counted for 10 minutes in a TOPCOUNT™ gamma counter (Packard). The concentration of each Fab that gives 20% or less of maximum binding is selected for use in the competitive binding assay.

[0246] In another embodiment, KD is measured using a BIACORE® surface plasmon resonance assay. For example, measurements using a BIACORE®-2000 or BIACORE®-3000 (BIAcore, Inc., Piscataway, NJ) are performed at 25°C using a CM5 chip with approximately 10 response units (RU) of antigen immobilized. In one embodiment, a carboxymethylated dextran biosensor chip (CM5, BIACORE, Inc.) is activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. The antigen is diluted to 5 μg / ml (approximately 0.2 μM) with 10 mM sodium acetate, pH 4.8, before injection at a flow rate of 5 μl / min to achieve protein binding of approximately 10 response units (RU). After antigen injection, 1 M ethanolamine is injected to block unreacted groups. For kinetic measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS containing 0.05% polysorbate 20 (TWEEN-20™) surfactant (PBST) at 25°C and a flow rate of approximately 25 μl / min. The binding rate (k on ) and dissociation rate (k off ) is calculated by simultaneously fitting the association and dissociation sensorgrams with a simple one-to-one Langmuir binding model (BIACORE® Evaluation Software version 3.2). The equilibrium dissociation constant (Kd) is given by k off / k on The on-rate is calculated as a ratio of 10 to 10. See, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999). 6 M -1 s -1If the on-rate exceeds , the on-rate can be determined by using a fluorescence quenching technique to measure the increase or decrease in fluorescence emission intensity (excitation = 295 nm; emission = 340 nm, bandpass 16 nm) at 25°C of 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2 in the presence of increasing concentrations of antigen, as measured in a spectrometer (e.g., a stopped-flow spectrophotometer (Aviv Instruments) or an 8000 series SLM-AMINCO™ spectrophotometer (ThermoSpectronic) using a stirred cuvette).

[0247] 10.Regnase-1 mutants In one aspect, the present invention provides a Regnase-1 variant in which the Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1 is replaced with another amino acid residue.

[0248] In some embodiments, the Regnase-1 variants of the present invention may be Regnase-1 variants in which the Ser residues at positions corresponding to positions 513 and 494, 513, or 494 of SEQ ID NO: 1 have been substituted with other amino acids. In one embodiment, such Regnase-1 variants may be Regnase-1 variants in which the Ser residues at positions 513 and 494 of SEQ ID NO: 1, 513 of SEQ ID NO: 1, 494 of SEQ ID NO: 1, 516 and 497 of SEQ ID NO: 2, 516 of SEQ ID NO: 2, or 497 of SEQ ID NO: 2 have been substituted with other amino acids. Amino acid substitutions can be performed using methods well known to those skilled in the art.

[0249] In some embodiments, the Regnase-1 variant of the present invention may be mammalian Regnase-1, and may be mouse or human Regnase-1.

[0250] As used herein, the term "substituted" means that an amino acid residue at a certain position in a reference amino acid sequence is replaced with another amino acid residue, and does not necessarily require an actual substitution step.

[0251] In some embodiments, the amino acid to be substituted for the Ser residue in the present invention includes, but is not limited to, Ala or Glu. Substitution with Ala or the like can produce a Regnase-1 mutant in which the amino acid at the target position is not phosphorylated, making it useful as a control substance for non-phosphorylated Regnase-1. Furthermore, substitution with Glu can mimic phosphorylation of the amino acid at the target position, making it useful as a mimetic substance for phosphorylated Regnase-1.

[0252] The present invention also relates to non-human animals having mutations in Regnase-1 and their progeny. Such non-human animals can be obtained using methods known to those skilled in the art, for example, by producing transgenic non-human animals into which genes encoding the Regnase-1 mutants described herein have been introduced. Examples of non-human animals include monkeys, pigs, dogs, rats, mice, rabbits, hamsters, cows, sheep, cats, and horses. [Example]

[0253] The following are examples of the present invention: In light of the above general description, it will be appreciated that various other embodiments may be practiced.

[0254] Materials and Methods Unless otherwise specified in each example, experiments were performed using the methods described in this section.

[0255] (Generation of mouse Regnase-1 S435A / S439A(AA) knock-in mice) Genomic DNA containing the Regnase-1 gene was isolated from embryonic stem (ES) cells (GSI-1). An approximately 12-kbp genomic fragment encompassing exons 5, 6, and the downstream end of the Regnase-1 gene was subcloned into the pCR-TOPO vector (Thermo Fisher Scientific). A targeting vector was designed to replace Ser435 and Ser439 residues in exon 6 with Ala by site-directed mutagenesis. A neomycin resistance gene flanked by two loxP sites was inserted into the intron between exons 5 and 6. The linearized vector was introduced into GSI-1 ES cells by electroporation. Targeted ES cells were screened and identified by genomic PCR and Southern blotting. These cells were microinjected into blastocysts derived from C57BL / 6 mice. Chimeric male mice were mated with C57BL / 6 female mice to generate F1 heterozygous mice. To remove the neomycin gene cassette, the F1 mice were further bred with CAG-Cre transgenic mice. After removing the CAG-Cre allele by mating with C57BL / 6 mice, the Regnase-1 AA heterozygous (Regnase-1AA / +) mice were backcrossed with C57BL / 6 mice for at least 10 generations to obtain Regnase-1 AA / AA homozygous mice (hereinafter referred to as "Regnase-1AA / AA mice" or "Regnase-1 AA mutant mice").

[0256] (Generation of a mouse Regnase-1 mutant allele with a frameshift mutation at the C-terminal amino acid) Regnase-1 frameshift mutant mice were designed and constructed using CRISPR / Cas9 genome editing technology by Dr. M. Ikawa and M. Okabe of the Biotechnology Research and Development Group (Osaka University, Osaka, Japan). The gRNA sequences used in this study were 5'-GTGGGTGGGGGTAATGGGTA-3' (SEQ ID NO: 52) and 5'-CCTACCCATCCAGAGTAC-3' (SEQ ID NO: 53). Each gRNA sequence was cloned in-frame into the CRISPR / Cas9 vector pSpCas9(BB)-2A-Puro PX459 (Addgene; #62988) (Nat Protoc 8, 2281-2308 (2013)). Using a previously described method, the PX459 vector was introduced into fertilized eggs from C57BL / 6 x C57BL / 6 mice (Dev Growth Differ 56, 122-129 (2014)). These mouse embryos were transferred into the oviducts of pseudopregnant ICR females. Genetic mutations in the Regnase-1 allele were identified by DNA sequencing. Mutant mice containing a frameshift mutation resulting in the expression of a C-terminally truncated Regnase-1 protein (Regnase-1ΔCTD) were intercrossed to obtain Regnase-1ΔCTD homozygotes (also referred to as "Regnase-1ΔCTD / ΔCTD").

[0257] (Generation of mouse Regnase-1 S513A / S513A mutant allele) Mouse Regnase-1 S513A mutant mice were constructed using CRISPR / Cas9 genome editing technology by Dr. M. Ikawa and M. Okabe of the Biotechnology Research and Development Group (Osaka University, Osaka, Japan). The gRNA sequences used in this study were 5'-GTGGGTGGGGGTAATGGGTA-3' and 5'-CCTACCCATCCAGAGTAC-3'. Each gRNA sequence was cloned in-frame into the CRISPR / Cas9 vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene; #42230) (Science 339, 819-23 (2013)). Additionally, for the S513A mutation, a single-stranded oligodeoxynucleotide sequence (103 bases, 5'-CCACCGACTATGTGCCCCCGCCACCCACCTACCCATCCAGAGAGTAtTGGgCTGAGCCGTAtCC ATTACCCCCACCCACTCCTGTCCTTCAGGAGCCCCAGAG -3' (SEQ ID NO: 54)) was synthesized. As previously reported (Dev Growth Differ 56, 122-129 (2014)), the PX459 vector and single-stranded oligodeoxynucleotide sequence were introduced into fertilized eggs derived from C57BL / 6 x C57BL / 6 mice. These mouse embryos were implanted into the oviducts of pseudopregnant ICR females. The genetic mutation in the Regnase-1 allele was identified by DNA sequencing.

[0258] (plasmid) Regnase-1 expression vectors, including pFLAG-CMV2 (Sigma) and pcDNA3.1-Myc, as well as viral expression vectors such as pMRX-FLAG-Regnase-1-ires-puro, have been previously described (Nature 458, 1185-1190 (2009); Nat Immunol 12, 1167-1175 (2011)). Truncated Regnase-1 lacking the N- or C-terminus was constructed by PCR amplification of Regnase-1 cDNA and inserted into the pFLAG-CMV2 vector. Point mutations in the Regnase-1 expression construct were prepared using the Quickchange II Site-Directed Mutagenesis Kit (Agilent Technologies). For overexpression in E. coli, a portion of Regnase-1 containing the proline-rich domain and the C-terminal domain (441-598) was amplified from Regnase-1 cDNA and inserted into the pGEX 6P vector (GE Healthcare). Myc-Act1, HA-TBK1, and HA-IKKi were PCR-amplified from each cDNA and inserted in-frame into the pcDNA3.1 vector. The pTREtight-IL-6 CDS+3'UTR vector was previously described (Nature 458, 1185-1190 (2009)).

[0259] (Mouse Regnase-1(45-339)) The expression construct was a GST-tagged fragment of mouse Regnase-1 (ZC3h12a) (Uniprot ID: Q5D1E7) (SEQ ID NO: 1) covering amino acids 45-339. Mouse Regnase-1 (45-339) was expressed in Escherichia coli using the above construct, purified with Glutathione-Sepharose 4B (GE Healthcare), cleaved off the GST portion with PreScission Protease (GE Healthcare), and isolated by gel filtration chromatography.

[0260] (Anti-Regnase-1 antibody) Rabbits were immunized with mouse Regnase-1 (45-339) protein. RNA was prepared from the immunized rabbit cells, and RT-PCR was performed to amplify the antibody genes. The antibody genes were then inserted into a plasmid. The plasmid containing the antibody genes was then introduced into E. coli and cultured, and the plasmid was purified from the cultured E. coli. The plasmid containing the antibody genes was then introduced into HEK293 cells, and the antibody was expressed in the culture supernatant. The antibody in the culture supernatant was purified using Protein A.

[0261] (anti-phosphorylated Regnase-1 antibody) We synthesized the peptides LD(pS)GIG(pS)LESQMSEC (SEQ ID NO: 6), which contains a cysteine ​​residue attached to the end of the sequence containing phosphorylated serine residues 435 and 439 of mouse Regnase-1, and CTYPSREYW(pS)EPY (SEQ ID NO: 7), which contains a cysteine ​​residue attached to the end of the sequence containing phosphorylated serine residue 513 of mouse Regnase-1. KLH was conjugated to each cysteine ​​residue, and rabbits were immunized with these proteins. Antibodies were purified from the antisera of immunized rabbits by affinity purification with the phosphorylated peptide and absorption with the non-phosphorylated peptide. The original amino acid sequence LDSGIGSLESQMSE (SEQ ID NO: 8) and a portion of the original sequence, REYWSEPY (SEQ ID NO: 9), used here are conserved between mouse and human.

[0262] (Anti-TFPI-tag peptide antibody) A synthetic TFPI-tag peptide sequence (Thr-Gly-Thr-Gly-Thr-Gly-Thr-Gly-Thr-MeF-Pro-Ile-Thr-MeF-Pro-Ile (SEQ ID NO: 56), where MeF represents N-methylphenylalanine) containing a T cell epitope peptide (Phe-Asn-Asn-Phe-Thr-Val-Ser-Phe-Trp-Leu-Arg-Val-Pro-Lys-Val-Ser-Ala-Ser-His-Leu-Glu-Gly (SEQ ID NO: 55), derived from tetanus toxin TT p30) at the N-terminus and a PEG5 spacer was administered to rabbits for immunization. RNA was prepared from immunized rabbit cells, and antibody genes were amplified by RT-PCR. The antibody genes were then incorporated into plasmids. The plasmids containing the antibody genes were transformed into Escherichia coli and cultured, and the plasmids were purified from the cultured E. coli. The plasmid carrying the antibody gene was transfected into HEK293 cells, and the antibody was expressed in the culture supernatant. The antibody in the culture supernatant was purified using Protein A.

[0263] (reagents, cells) Recombinant mouse IL-17A was purchased from R&D systems. Recombinant mouse IL-1β, mouse TNF-α, mouse IL-6, and human IL-17A were purchased from Biolegend. Anti-Act1 (H-300), IκB-α (C-21), NFκB p65 (C-20), MAPK p38 (C-20), and ERK1 (K23) were purchased from Santa Cruz Biotechnology. Anti-RPL7A (15340-1-AP) was obtained from Proteintech. Anti-FLAG M2, Myc (9E10), and HA (12CA5) antibodies, FLAG M2 affinity gel, and FLAG x 3 peptide were purchased from Sigma. Antibodies against phospho-IκBα (Ser32 / 36), phospho-NFκB p65 (Ser468), phospho-MAPK p38 (Thr180 / Tyr182), phospho-ERK 1 / 2 (Thr202 / Tyr204), JNK, phospho-JNK (Thr183 / Tyr185), phospho-STAT3 (Tyr705), phospho-TBK1 (Ser172), and phospho-IKKε (Ser172) were obtained from Cell Signaling Technology. Anti-CD3ε and type IV collagen were obtained from Abcam. LPS (S. Minnesota R595) and BX795 were purchased from InvivoGen. Bone marrow-derived macrophages were generated by culturing bone marrow cells in RPMI medium containing 20 ng / ml macrophage colony-stimulating factor (M-CSF) (Peprotech). HeLa cells were purchased from the American Type Culture Collection. Wild-type and Regnase-1AA / AA MEFs were prepared from mouse embryos at 13.5 days of gestation. Act1-deficient MEFs were generated from Traf3ip2ADJM mice, a kind gift from Dr. Y. Matsushima (J Immunol 185, 2340-2349 (2010)).Regnase-1- / -, TBK1- / -, IKKi- / -, and TBK1- / - / IKKi- / - MEFs were prepared as previously described (Nature 458, 1185-1190 (2009); J Exp Med 199, 1641-1650 (2004); Nat Immunol 9, 684-691 (2008)). IKKα- / - / IKKβ- / - MEFs were kindly provided by Dr. I. Verma (Genes & development 14, 1729-1733 (2000)). Effector CD4+ T cells induced by in vitro differentiation were generated as previously described (Annu Rev Immunol 28, 445-489 (2010)). For the induction of TH1, TH17, or iTreg cells, naive CD4+ T cells (1.0 x 10 cells) were used. 6Cells (number of cells) were seeded onto anti-CD3ε (BD Bioscience, 10 μg / ml) 96-well plates, activated with anti-CD3ε (1 μg / ml) and anti-CD28 (1 μg / ml), and cultured for 3 days under TH1, TH17, or iTreg differentiation conditions: 10 μg / ml anti-IL-4 (BD Bioscience) and 10 ng / ml IL-12 (Peprotech) for TH1; 10 μg / ml anti-IL-4, 10 μg / ml anti-IFN-γ (BD Bioscience), 10 ng / ml TGF-β (Peprotech), 30 ng / ml IL-6, and 50 ng / ml IL-23 (Peprotech) for TH17; or 10 μg / ml anti-IL-4, 10 μg / ml anti-IFN-γ, and 10 ng / ml TGF-β for iTreg. LSECs were prepared as previously described (Journal of Leukocyte Biology 38, 213-230 (1985)). Cell lines expressing Regnase-1 with an N-terminal FLAG epitope tag were constructed by retroviral infection of Regnase-1- / - immortalized MEFs with virus-containing culture supernatant from Plat-E retroviral packaging cells transfected with pMRX-FLAG-Regnase-1-ires-puro (Gene Therapy 7, 1063-1066 (2000)). Cells were cultured and maintained in DMEM containing 2 μg / ml puromycin.

[0264] (EAE model) Conventional EAE was induced by immunization with myelin oligodendrocyte glycoprotein (MOG) (35-55) peptide (AnaSpec). An emulsion of MOG (35-55) peptide (300 ng / mouse) mixed with complete Freund's adjuvant (CFA, InvivoGen) at a 1:1 ratio was subcutaneously injected into mice. After intraperitoneal injection of pertussis toxin on days 0 and 2, mice were monitored daily and evaluated by clinical scoring between days 7 and 28 after immunization. Clinical scores were measured using a previously defined scale (Immunity 14, 471-481 (2001)). For bone marrow chimeric mouse construction, 4- to 5-week-old γ-irradiated mice (10 Gy) were injected with bone marrow cells (3.0-5.0 x 10 cells). 7 The chimeric mice were intravenously injected with 1000 cells / ml of EAE. At least 4 weeks later, EAE induction was performed in the chimeric mice. EAE induction, induced by passive transfer of pathogenic CD4+ T cells, was performed according to a previously described method (Cell 148, 447-457 (2012)). Briefly, wild-type mice were sacrificed 10 days after injection of MOG(35-55) peptide / CFA and pertussis toxin. Splenocytes (4 x 10 cells) were then transferred to the chimeric mice. 6 CD4+ T cells were isolated from wild-type, Regnase-1AA / AA, and Regnase-1ΔCTD mice (1.5 x 10 cells) and co-cultured with irradiated splenocytes pulsed with MOG peptide. CD4+ T cells isolated from the co-cultured cells using CD4(L3T4) microbeads and an autoMACS separator (Miltenyi) were cultured at 1000 x 1000 cells / mL. 7 The mice were intravenously injected with 1000 mg / mouse (1000 mg / mouse). Frozen sections were prepared from the spinal cord, lymph nodes, and spleen using a Leica CM 1850 cryostat (Leica) and immunostained with the indicated antibodies. To prepare spinal cord sections, we used a previously described method (Archives of Histology and Cytology 66, 123-143 (2003)).

[0265] (Flow cytometry) The following antibodies were prepared for flow cytometry: PerCP-Cy5.5-conjugated anti-mouse CD4, PE-conjugated anti-mouse IL-17A, FITC-conjugated anti-mouse IFN-γ, PE-conjugated anti-mouse CD25 (BD Bioscience), and Alexa-647-conjugated anti-mouse Foxp3 (Biolegend). Spinal cord cells were stained with anti-CD4 and F4 / 80 antibodies (Biolegend). CD4+ T cells were cultured with 100 nM phorbol 12-myristate 13-acetate (PMA) (Sigma), 1 μM ionomycin (Sigma), and GolgiPlug (BD Bioscience) for 2 h at 37°C. After cell permeabilization and fixation, intracellular staining (IFNγ, IL-17A, and Foxp3) was performed using either the Cytofix / Cytoperm intracellular staining kit (BD bioscience, for IFNγ and IL-17A) or the Foxp3 / transcription factor staining buffer kit (Affymetrix, for Foxp3).

[0266] (immunoprecipitation) The method for transient protein expression using HEK293 cells has been previously described ( Nat Immunol 12, 1167-1175 (2011)). Twenty-four hours after transfection, cells were disrupted by sonication. After centrifugation at 20,000 x g for 5 minutes to remove cell debris, the cell lysate was incubated with either anti-FLAG M2 antibody or anti-Myc antibody (Sigma) conjugated to Dynabeads Protein G (Thermo Fisher Scientific) for 1 hour at 4°C. The beads were then washed twice with Tris buffer. The immunoprecipitated proteins were eluted with 3x SDS sample buffer and subjected to 10% SDS-PAGE gel analysis. Phosphorylated mouse Regnase-1 was purified from MEFs stably expressing FLAG-Regnase-1. After stimulation with IL-1β or IL-17A, cells were disrupted by sonication. Cell lysates were incubated with anti-FLAG M2 affinity gel for 1 hour at 4° C. Bound proteins were eluted with 0.15 mg / ml FLAG x 3 peptide (Sigma) in Tris buffer and subjected to 7.5% native PAGE gel.

[0267] (Gel filtration analysis) The C-terminal segment of mouse Regnase-1 (441–598) was produced as a GST fusion protein in Escherichia coli Rosetta2 (DE3) cells (Merck Millipore). Cells were lysed in Bugbuster protein extraction reagent (Merck Millipore) supplemented with protease inhibitors. The fusion protein was purified from the cell lysate by affinity chromatography using Glutathione Sepharose 4B (GE Healthcare) and cleaved with PreScission Protease (GE Healthcare) in Tris buffer [20 mM Tris-HCl (pH 7.4) and 150 mM NaCl] to release the mouse Regnase-1 segment. After adding 1% CHAPS to increase protein solubility, the GST protein was removed using a Glutathione Sepharose 4B column. The purified mouse Regnase-1 segment was loaded onto a Superdex 200 gel filtration column (GE Healthcare). The apparent molecular weight of the elution peak was estimated from the elution pattern of molecular weight markers for gel filtration chromatography (Sigma).

[0268] (in vitro phosphorylation assay) Mouse Regnase-1 protein was obtained from MEFs stably expressing FLAG-Regnase-1. Cells were suspended in 20 mM Tris-HCl, pH 7.4, and 150 mM NaCl supplemented with Complete mini protease inhibitor and PhosStop phosphatase inhibitor cocktail (Roche) and disrupted using an ultrasonic water bath (Bioruptor Plus, Diagenode). Regnase-1 was purified using FLAG M2 affinity gel (Sigma). For in vitro phosphorylation assays, the following recombinant proteins were prepared: GST protein (Sigma), GST-tagged TBK1 (Sigma), GST-tagged IKKi (Thermo Fisher Scientific), and Lambda protein phosphatase (New England BioLabs). FLAG-Regnase-1 (50 μg / ml) was incubated for 4 hours at 30°C in 0.2 M HEPES, pH 7.0, 20 mM MgCl2, 2 mM ATP (or 50 μCi [γ-32P]ATP), and 1.0 M mannitol. Samples were mixed with either 3x SDS sample buffer or 4x native PAGE sample buffer (0.2 M Tris-HCl, pH 6.8, 40% glycerol, and 0.4% bromophenol blue) and loaded onto 10% SDS-PAGE gels or 7.5% native PAGE gels. Regnase-1 was detected by immunoblotting. Phosphorylated proteins were visualized in the presence of [γ-32P]ATP by autoradiography.

[0269] (Isolation of subcellular fractions) Separation and isolation of ER membrane fractions were performed according to a previously described method (Rna 9, 1123-1137 (2003)). MEF cells (5 x 10 cells) were used. 7The cells were suspended in homogenization buffer [10 mM HEPES-KOH, pH 7.5, 10 mM KoAc, 1.5 mM Mg(OAc)2, 2 mM DTT, 1 mM PMSF, and 200 U / ml RNaseOUT ribonuclease inhibitor (Thermo Fisher Scientific)] and then disrupted using a Dounce homogenizer. To separate the microsomal and cytosolic fractions, the homogenate was subjected to low-speed centrifugation (1,500 x g) for 5 minutes. The supernatant was further subjected to high-speed centrifugation at 65,000 x g (Beckman TLA 45 rotor) for 20 minutes at 4°C. The microsomal pellet was resuspended in Tris buffer. To isolate the ER membrane fraction, the homogenate was mixed with 2.5 M sucrose in HKM buffer [50 mM HEPES-KOH, 150 mM KoAc, and 5 mM Mg(OAc)2] at a ratio of 1:4. 2 ml of the mixture was layered with 0.5 ml of 0.25 M sucrose in HKM buffer and 0.75 ml of 1.3 M sucrose in HKM buffer. After centrifugation at 500,000 x g for 45 min at 4°C (Beckmann TLA100.3 rotor), the ER membranes within the 1.3 M / 2.0 M sucrose interface were extracted and diluted with HKM buffer. After centrifugation at 500,000 x g for 20 min at 4°C, the membranes were resuspended in Tris buffer.

[0270] (Polysome profiling) WT and mouse Regnase-1ΔCTD MEF cells (1–2 × 10 cells) 8Cells (800 cells) were pretreated with 5 μg / ml cycloheximide for 10 minutes before harvesting. The harvested cells were suspended in 1 ml homogenization buffer supplemented with 100 μg / ml cycloheximide and hypotonicly lysed using several strokes of a Dounce homogenizer. To solubilize the membrane-containing cellular fraction, 10% digitonin was added to a final concentration of 2%. After 5 minutes of low-speed centrifugation (1500 × g), the lysate supernatant was loaded onto the top of a linear gradient of 10–60% sucrose in polysome buffer [50 mM HEPES-KOH, pH 7.5, 150 mM KCl, 10 mM MgSO4, 2 mM DTT, 1 mM PMSF, 100 μg / ml cycloheximide, and 100 U / ml RNaseOUT ribonuclease inhibitor]. After ultracentrifugation at 36,000 rpm for 2 h at 4°C in a Beckman SW41 Ti rotor, fractions were collected from the top of the sucrose gradient using a piston gradient fractionator (Biocomp Instruments), transferred to a UV-Star® 96-well plate (Greiner Bio-one), and monitored by UV absorbance at 260 nm.

[0271] (Quantitative PCR analysis) Total RNA was purified using the High Pure™ RNA Isolation Kit (Roche) and reverse transcribed using the ReverTra Ace® Kit (TOYOBO). For quantitative PCR, PCR amplification of cDNA was performed using the Thunderbird® Probe qPCR Mix (TOYOBO). TaqMan probes for mouse IL-6, TNF, LCN-2, GM-CSF, CXCL-1, CXCL2, CCL5, and CCL-20 were purchased from Applied Biosystems. Fluorescence was detected using a Viia7™ Real-Time PCR System (Applied Biosystems). 18S rRNA expression was used to normalize mRNA expression levels.

[0272] (Tet-off system) HEK293 Tet-off cells (cells 3.0 x 10 6 Cells were co-transfected with the previously described 8pTREtight-IL6-CDS + 3'UTR along with a series of expression vectors encoding mouse Regnase-1, Act1, and IKKi. After 3 hours, cells were split into three 60 mm culture dishes and cultured overnight. Repression of IL6-CDS + 3'UTR expression was induced by culturing the cells in the presence of 1 μg / ml doxycycline.

[0273] (statistical analysis) Unless otherwise stated, statistical analysis of differences between two groups was performed by Student's t-test (two-tailed). P < 0.05 was considered statistically significant.

[0274] <Result> Example 1 In this example, it was shown that the S435A / S439A (AA) mutation prevents IKK-mediated phosphorylation and degradation of Regnase-1.

[0275] Regnase-1 is phosphorylated by the IKK complex and subsequently degraded via the ubiquitin-proteasome system in LPS-activated macrophages. Two serine residues, Ser435 and Ser439, in Regnase-1 have been identified as putative IKK phosphorylation sites. To elucidate how IKK-mediated phosphorylation and degradation of Regnase-1 regulate cytokine expression during immune responses, we generated knock-in mice with two amino acid substitutions, Ser435 and Ser439, in the Regnase-1 protein to Ala (Figures 1-2A). The mutated Regnase-1 gene was confirmed by genomic PCR and direct sequencing (Figures 1-2B). Homozygous Regnase-1 knock-in mice (Regnase-1AA / AA) were born at the expected Mendelian ratio, developed normally, and did not exhibit any symptoms of autoimmune disease, as previously described in Regnase-1-deficient mice.

[0276] To detect the unphosphorylated and phosphorylated forms of Regnase-1, we generated monoclonal antibodies with excellent sensitivity. As expected, LPS-stimulated Regnase-1AA / AA macrophages showed no Regnase-1 proteolysis, suggesting that this mutant protein is resistant to IKK-mediated degradation (Figures 1-3C). Compared with wild-type macrophages, Regnase-1AA / AA macrophages significantly increased their protein production over time, indicating that IKK-mediated phosphorylation of Regnase-1 is essential for its degradation. Phosphorylation of Regnase-1 by IKK was detected as a retarded band in electrophoresis (Figures 1-3C). This process occurs via an IKK-independent pathway, and is therefore typically observed in Regnase-1AA / AA macrophages. The phosphorylation of other proteins induced by LPS, such as IκB and NF-κB p65 in the NF-κB signaling pathway, and mitogen-activated protein kinase (MAPK) p38 and extracellular signal-regulated kinase (ERK) 1 / 2 in the MAPK pathway, was similar in both wild-type and Regnase-1AA / AA macrophages (Figure 1-3C), indicating that this mutation does not affect the LPS signaling pathway in Regnase-1AA / AA macrophages. Nevertheless, Regnase-1AA / AA macrophages showed reduced production of IL-6 and IL-12, but not TNF-α, compared with wild-type macrophages in the presence of very low concentrations of LPS or TLR ligands (Figure 1-4D), indicating that cytokine production was suppressed by this mutation upon exposure to various TLR ligands in vitro.

[0277] Example 2 In this example, it was shown that Regnase-1AA / AA mice are resistant to experimental autoimmune encephalomyelitis (EAE) via an attenuated response to IL-17.

[0278] To further investigate the immunosuppressive effect of the Regnase-1 AA mutant, we used an EAE model. Regnase-1AA / AA mice showed delayed onset and slower progression of EAE compared with controls (Figure 2-1A). Histological analysis of the spinal cord revealed significantly reduced inflammation, demyelination, axonal degeneration, and T cell infiltration into neuronal tissue in Regnase-1AA / AA mice (Figure 2-1B). The number of infiltrating CD4+ T cells was significantly lower in Regnase-1AA / AA mice than in control mice (Figure 2-1C). Immunofluorescence analysis of lymph nodes revealed impaired germinal center formation and accumulation of plasma cells in the lymph nodes of Regnase-1AA / AA mice (data not shown).

[0279] To clarify which cell type expressing Regnase-1AA / AA protein is responsible for EAE resistance, we compared the in vitro differentiation ability of naive CD4+ T cells into TH1, TH17, or Treg cells between wild-type and Regnase-1AA / AA mice. These showed similar differentiation patterns (Figure 3A). Next, we used bone marrow chimeras to investigate whether immune cells or non-hematopoietic cells generated from bone marrow were required for the suppression of EAE pathogenesis in Regnase-1AA / AA mice. Transplantation of wild-type bone marrow cells into Regnase-1AA / AA mice resulted in more effective disease suppression than controls, whereas wild-type mice with Regnase-1AA / AA bone marrow cells showed no significant difference (Figure 2D). These results suggest that the amelioration of EAE disease in Regnase-1AA / AA mice was mediated by non-hematopoietic cells, rather than immune cells.

[0280] To further confirm this, we used a transplantation EAE model in which MOG-specific autoreactive CD4+ T cells were intravenously transferred into wild-type and Regnase-1AA / AA mice (Immunity 29, 628-636 (2008); Cell 148, 447-457 (2012)). In this model, activated T17 cells can induce STAT3 (signal transducer and activator of transcription 3) activation and inflammation in endothelial cells of the dorsal vessels of the lumbar spinal cord in an IL-6- and IL-17-dependent manner. Immunohistochemical analysis of phosphorylated STAT3, an indicator of inflammation, in splenic endothelial cells (type IV collagen-positive) revealed low levels of phospho-STAT3 in Regnase-1AA / AA mice, suggesting that the Regnase-1 AA mutation suppresses endothelial cell inflammation primarily induced by pathogenic T17 cells (Figures 2E and 2F). STAT3 phosphorylation was also reduced in endothelial cells of the dorsal vessels in the lumbar spinal cord of Regnase-1AA / AA mice (Figures 2G and 2H). These findings suggest that the mutated protein suppresses STAT3 activation in endothelial cells by reducing IL-6 production, and that IKK-mediated degradation of Regnase-1 plays an important role in the induction of EAE pathogenesis.

[0281] IL-17 activates both the NF-κB and MAPK signaling pathways, but is a weak activator of NF-κB (Nature reviews. Immunology 9, 556-567 (2009)). In non-hematopoietic cells, cooperative stimulation of IL-6 and IL-17 leads to overexpression of IL-6 in a feedback amplification loop of NF-κB and STAT3 activation (Immunity 29, 628-636 (2008); J Immunol 189, 1928-1936 (2012)). We measured cytokine and chemokine production in primary cells from wild-type and Regnase-1AA / AA mice after stimulation with IL-17A or a combination of IL-17A and TNF-α or IL-6. In mouse embryonic fibroblasts (MEFs) and liver sinusoidal endothelial cells (LSECs) derived from Regnase-1AA / AA mice, 24 hours after stimulation with TNF-α plus IL-17A, decreased expression of IL-6, Regnase-1, CXCL-1, CXCL-2, and CCL-20 mRNA was observed compared to wild-type cells (Figure 2-2I [MEFs] and Figure 3-1B [LSECs]). Differences in target mRNA expression in MEFs between wild-type and Regnase-1AA / AA cells were more evident during the latter part of the stimulation period (Figure 2-2I). Similarly, IL-6, CXCL-1, and CXCL-2 mRNA levels after stimulation with IL-17A and either IL-6 or TNF-α were also lower in LSECs from Regnase-1AA / AA mice than in wild-type cells (Figure 3-2C). These results indicate that IL-17A stimulation in non-hematopoietic cells leads to IKK-mediated phosphorylation and degradation of Regnase-1 via NF-κB activation, which may regulate the expression of inflammatory factor mRNA.

[0282] Example 3. Pathological alleviation effect of Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model C57BL / 6 mice (wild-type mice; WT) or Regnase-1 AA mutant mice (AA) were treated daily for 5 days with 62.5 mg of imiquimod cream (Veselna Cream 5%; Mochida Pharmaceutical Co., Ltd.) on the right ear and shaved dorsal neck skin. Auricle lesions were assessed by serially measuring the thickness of the right ear using a dial thickness gauge (Ozaki Seisakusho) before and after imiquimod application. The dorsal neck skin was evaluated by visually assessing the severity of erythema, thickening, and scaling on a 4-point scale, with the combined score calculated as a total of 12 points.

[0283] As a result, in wild-type mice, application of imiquimod resulted in significant thickening of the ears (Fig. 4A). Furthermore, application of imiquimod induced psoriasis-like skin lesions, such as erythema, thickening, and scaling, in the skin of the dorsal neck (Fig. 4B). In contrast, in Regnase-1 AA mutant mice, ear thickening and psoriasis-like skin lesions (erythema, thickening, and scaling) were reduced compared to wild-type mice (Fig. 4A, 4B).

[0284] (Pathological examination) Three days after the final imiquimod application, wild-type or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then autopsied. Skin samples from the treated ear were immersion-fixed in 10% neutral buffered formalin, embedded in paraffin using standard methods, and sliced ​​to approximately 3 micrometers to prepare hematoxylin-eosin (HE)-stained specimens. The HE-stained specimens from the treated ear were examined histopathologically under a light microscope. Epidermal thickness was also measured using a micrometer and divided into the following sections: basal and spinous layers, granular layer, stratum corneum, and total epidermal thickness.

[0285] Wild-type mice exhibited significant psoriasis-like skin lesions, including epidermal hyperplasia and microabscesses accompanied by neutrophil infiltration in the dermis (Fig. 5A, Table 2). Regnase-1 AA mutant mice, on the other hand, exhibited reduced psoriasis-like lesions compared with wild-type mice. Furthermore, morphometric measurements of epidermal thickness showed lower values ​​in Regnase-1 AA mutant mice than in wild-type mice in all sections (Fig. 5B).

[0286] [Table 2]

[0287] (Quantitative analysis of various gene expression) Imiquimod was applied every other day on Days 0, 2, and 4. The mice were euthanized one day after application and ear samples were collected from the application site. RNA was extracted using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and the RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. Complementary DNA was obtained by reverse transcription, and the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) on a LightCycler 480 II (Roche). The Taqman probes used are listed below. B2m (Applied Biosystems, Mm00437762_m1): Endogenous control Il6 (Applied Biosystems, Mm00446190_m1): Inflammatory cytokine Il1a (Applied Biosystems, Mm00439620_m1): Inflammatory cytokine Cxcl2 (Applied biosystems, Mm00436450_m1): Leukocyte migration factor Hbegf (Applied Biosystems, Mm00439306_m1): Cell growth factor Sprr2i (Applied Biosystems, Mm00726832_s1): keratinocyte marker Keratin 6A (Applied Biosystems, Mm00833464_g1): keratinocyte marker

[0288] As a result, in wild-type mice, the expression of Regnase-1 target genes (Il6, Il1a, Cxcl2, and Hbegf) (see Figures 19-1 to 19-5) increased with the onset of psoriasis (Figure 6). In contrast, in Regnase-1 AA mutant mice, the increase in expression of these genes was suppressed during the onset of psoriasis (Figure 6). This suggests that Regnase-1 AA mutant mice have an inhibitory effect on the production of inflammatory cytokines and cell proliferation associated with the pathology. Furthermore, in wild-type mice, the expression of Sprr2i and Keratin 6A, factors expressed in keratinocytes, increased with the onset of psoriasis (Figure 6). In contrast, in Regnase-1 AA mutant mice, the increase in expression of these genes was suppressed, reflecting the alleviation of psoriasis-like lesions. This suggests that keratinocyte proliferation is suppressed in Regnase-1 AA mutant mice.

[0289] Example 4. Pathological alleviation effect of Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced nephritis model Anti-glomerular basement membrane antibody-induced nephritis was induced in wild-type and Regnase-1 AA mutant mice. Mice were immunized with sheep IgG antibody mixed with adjuvant, and then sheep antiserum (nephrotoxic serum) obtained by immunizing rat glomeruli with sheep was administered once daily for four consecutive days. Two weeks after administration of the nephrotoxic serum, blood samples were collected and serum creatinine, urea nitrogen, and cystatin C, indicators of renal damage, were measured. Urine was also collected at the same time and urinary total protein and creatinine levels were measured. Serum and urinary parameters were measured using a TBA-120-FR (Toshiba Medical Systems Corporation). The abbreviations used in each figure are as follows: non-pathologically induced wild-type mice (WTNC); non-pathologically induced Regnase-1 AA mutant mice (AANC); pathologically induced wild-type mice (WTDC); pathologically induced Regnase-1 AA mutant mice (AADC).

[0290] As a result, serum creatinine levels and urinary total protein-to-urinary creatinine ratios, indicators of glomerular injury, were lower in pathology-induced Regnase-1 AA mutant mice (AADC) than in pathology-induced wild-type mice (WTDC) (Fig. 7A), suggesting that Regnase-1 AA mutant mice have a protective effect against renal injury.

[0291] (Quantitative determination of hydroxyproline) Two weeks after administration of the nephrotoxic serum, the mice were euthanized and the kidneys were collected. The collected kidneys were freeze-dried and weighed, then hydrolyzed overnight at 95°C with 6N hydrochloric acid, and the amount of hydroxyproline (Hyp) per kidney weight was measured by mass spectrometry.

[0292] As a result, the amount of hydroxyproline, an indicator of tissue fibrosis, was lower in pathology-induced Regnase-1 AA mutant mice (AADC) than in pathology-induced wild-type mice (WTDC) (Fig. 7B), suggesting that Regnase-1 AA mutant mice have a protective effect against renal fibrosis.

[0293] (Quantitative analysis of various gene expression) Two weeks after administration of the nephrotoxic serum, the mice were euthanized and their kidneys were collected. RNA was extracted from the collected kidneys using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and the RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. Complementary DNA was obtained by reverse transcription, and the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) on a LightCycler 480 II (Roche). The Taqman probes used are listed below. Gapdh (Applied Biosystems, Mm99999915_g1): endogenous control Col1a1 (Applied Biosystems, Mm00801666_g1): Organ fibrosis indicator Acta2 (Applied Biosystems, Mm00725412_s1): Organ fibrosis index Ctgf (Applied Biosystems, Mm01192933_g1): Organ fibrosis index Ddr1 (Applied Biosystems, Mm01273496_m1): Organ fibrosis index Pdgfb (Applied Biosystems, Mm00440677_m1): Organ fibrosis index

[0294] As a result, the gene dosages of Col1a1 and Acta2, which are indicators of tissue fibrosis, were lower in pathology-induced Regnase-1 AA mutant mice (AADC) than in pathology-induced wild-type mice (WTDC) (Fig. 8A), suggesting that Regnase-1 AA mutant mice have a protective effect against renal fibrosis.

[0295] Furthermore, in wild-type mice, the expression of genes targeted by Regnase-1 (Ctgf, Ddr1, Pdgfb) (see Figures 19-1 to 19-5) increased with the onset of the disease. In contrast, the increase in these genes was suppressed in Regnase-1 AA mutant mice (Figure 8B). This suggests that Regnase-1 AA mutant mice have an inhibitory effect on fibrosis through the suppression of the expression of fibrosis-related factors.

[0296] (Changes in the number of various blood cells in the blood) Blood counts were measured using an XT-2000iV (Sysmex Corporation) using blood obtained from mice 2 weeks after administration of nephrotoxic serum. In wild-type mice, the number of leukocytes, neutrophils, and monocytes per unit blood volume increased with the onset of pathology. However, in Regnase-1 AA mutant mice (AADC), the increase in blood neutrophils and monocytes associated with pathology was suppressed (Figure 8C). These findings suggest that Regnase-1 AA mutant mice may suppress the increase in inflammatory cells associated with the onset of nephritis.

[0297] (Pathological examination) Two weeks after the start of anti-GBM antibody administration, wild-type or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then autopsied. Kidneys and lungs were collected, immersion-fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at approximately 3 micrometers to prepare hematoxylin-eosin (HE)-stained specimens. HE-stained specimens of kidney and lung were examined histopathologically under a light microscope. Regarding kidney specimens, the total number of glomerular lesions was counted: crescents, sclerosis, the sum of crescents and sclerosis, and total glomerular lesions. The percentages were calculated.

[0298] In the kidneys, wild-type mice (WT) exhibited prominent crescentic glomerulonephritis lesions, such as crescent formation and glomerular sclerosis (Fig. 9A, 9B). In contrast, Regnase-1 AA mutant mice (AA) exhibited reduced glomerulonephritis lesions compared with wild-type mice. In the lungs, wild-type mice exhibited prominent inflammatory cell infiltration and granulomas in the alveoli and perivascular interstitium (Fig. 9C, Table 3). In contrast, Regnase-1 AA mutant mice exhibited reduced lung lesions compared with wild-type mice.

[0299] [Table 3]

[0300] Example 5. Pathological alleviation effect of Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model Bleomycin-induced scleroderma was induced in wild-type and Regnase-1 AA mutant mice. Bleomycin was administered via a subcutaneously implanted pump. Four weeks later, the mice were euthanized and the skin and lungs were collected from the administration site. The following abbreviations are used in each figure: wild-type mice (WTNC), Regnase-1 AA mutant mice (AANC), wild-type mice (WTDC), and Regnase-1 AA mutant mice (AADC).

[0301] (Quantitative determination of hydroxyproline in skin) The collected skin was freeze-dried and then weighed. It was hydrolyzed with 6N hydrochloric acid, and the amount of hydroxyproline per skin weight was measured by mass spectrometry.

[0302] As a result, the amount of hydroxyproline, an indicator of tissue fibrosis, was lower in the pathologically induced Regnase-1 AA mutant mice (AADC) than in the pathologically induced wild-type mice (WTDC) (Figure 10A). This suggests that Regnase-1 AA mutant mice have a protective effect against skin fibrosis.

[0303] (Quantification of various gene expression in the lungs) Four weeks after the start of bleomycin administration, the mice were euthanized and their lungs were collected. RNA was extracted from the collected lungs using standard methods, using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and the RNeasy 96 kit (QIAGEN, No. 74182). Complementary DNA was obtained by reverse transcription, and the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) on a LightCycler 480 II (Roche). The Taqman probes used are listed below. Gapdh (Applied Biosystems, Mm99999915_g1): endogenous control Col1a1 (Applied Biosystems, Mm00801666_g1): Organ fibrosis indicator

[0304] As a result, in wild-type mice, the Col1a1 gene, an indicator of fibrosis, increased with the onset of the disease. On the other hand, in Regnase-1 AA mutant mice, the increase in the gene was suppressed (Fig. 10C), suggesting that Regnase-1 AA mutant mice have an inhibitory effect on fibrosis.

[0305] (Pathological examination of the lungs) Four weeks after the start of bleomycin administration, wild-type or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then autopsied. Lungs were collected, immersion-fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at approximately 3 micrometers for hematoxylin-eosin (HE) staining. The HE-stained lung specimens were examined histopathologically under a light microscope.

[0306] Wild-type mice exhibited significant alveolar epithelial degeneration and necrosis, alveolar / interstitial inflammatory cell infiltration (neutrophils, mononuclear cells / foam cells), alveolar eosinophilic material / exudates, bronchoalveolar epithelial hyperplasia, alveolar / interstitial fibrosis, and vascular / peribronchial interstitial edema / lymphangiectasia (Fig. 10B, Table 4).Regnase-1 AA mutant mice, on the other hand, exhibited reduced lung injury compared to wild-type mice, particularly inflammatory cell infiltration, bronchoalveolar epithelial hyperplasia, alveolar / interstitial fibrosis, and vascular / peribronchial interstitial edema / lymphangiectasia.

[0307] [Table 4]

[0308] Example 6. Pathological alleviation effect of Regnase-1 AA mutant mice in an experimental autoimmune uveitis model C57BL / 6 mice (wild-type mice) or Regnase-1 AA mutant mice were intradermally immunized with a mixture of complete Freund's adjuvant and IRBP (interphotoreceptor retinoid-binding protein) peptide. Mice assigned to the non-pathological control group were administered the vehicle and complete Freund's adjuvant mixture without peptide. Peptides were administered at 140 nmol or 280 nmol per mouse. The sequences of the peptides used are shown below. IRBP peptide: LAQGAYRTAVDLESLASQLT (SEQ ID NO: 19)

[0309] After immunization, fundus examinations were performed approximately three times a week, and the degree of inflammation and retinal structural damage was scored. Scoring was performed based on a literature review, and scores were evaluated on a 5-point scale from 0 to 4 (Exp Eye Res 87(4), 319-326 (2008)). The results are shown in Figure 11-1 A and B and Figure 11-2 C and D.

[0310] As a result, while wild-type mice showed increased inflammation and structural damage scores upon pathological induction, the increase in inflammation and structural damage scores was barely observed in Regnase-1 AA mutant mice, suggesting that Regnase-1 AA mutant mice have a protective effect against ocular inflammation and retinal structural damage.

[0311] Example 7. Pathological alleviation effect of Regnase-1 AA mutant mice in an experimental autoimmune uveitis T cell transfer model As in Example 6, complete Freund's adjuvant and IRBP (interphotoreceptor retinoid binding protein) peptide were mixed and used to intradermally immunize C57BL / 6 mice (wild-type mice). Twelve days after immunization, mice were euthanized and their spleens were collected. Spleen cells were hemolyzed and cultured for 2 days in RPMI-1640 medium containing 5 μM IRBP peptide and 0.3 μg / ml ODN1826 (Invitrogen, tlrl-1826). Cells were isolated using the Pan T Cell Isolation Kit II, mouse (Miltenyi, 130-095-130), and 1 x 10 cells were collected per mouse. 6 The cells were transferred intraperitoneally into wild-type and Regnase-1 AA mutant mice. After the transfer, fundus examinations were performed on both eyes from day 11 to day 18, and the degree of inflammation was scored on a 5-point scale from 0 to 4. On day 18 after transplantation, animals were euthanized by exsanguination under deep anesthesia and then autopsied. Eyeballs were collected, immersion-fixed in glutaraldehyde or 4% paraformaldehyde, embedded in paraffin using standard or AMeX methods, and sectioned at approximately 3 micrometers to prepare hematoxylin-eosin (HE)-stained specimens. HE-stained specimens were examined histopathologically under a light microscope. Retinal structural changes were scored for each region according to the following criteria, and the sum of the scores was calculated. Rod outer segments: score 1, cellular infiltration; score 2, partial loss; score 3, moderate loss; score 4, almost complete loss. Neuronal layer: score 1, cellular infiltration; score 2, partial loss; score 3, moderate loss; score 4, almost complete loss; score 5, complete loss. Retinal structure: score 1, less than 10% retinal folds; score 2, 10% to 50% retinal folds; score 3, more than 50% retinal folds. Fundus examination revealed that Regnase-1 AA mutant mice (AA) showed reduced inflammation in the eyes (Fig. 36A). Histopathological analysis revealed that Regnase-1 AA mutant mice (AA) had reduced retinal structural damage scores (Fig. 36B). These findings suggest that Regnase-1 may be involved not only in immune sensitization but also in the progression of pathology after sensitization.

[0312] Example 8 In this example, it was shown that Regnase-1 is phosphorylated by TBK1 and IKKi in the IL-17 receptor signaling pathway.

[0313] We next investigated how Regnase-1 is post-translationally modified by IL-17A signaling components. Immunoblot analysis of Regnase-1 in wild-type and Regnase-1AA / AA MEFs revealed that IL-17A treatment induced Regnase-1 phosphorylation, which manifested as an electrophoretic mobility shift of Regnase-1 (Figure 12-1A). Although there was no dramatic loss of Regnase-1 upon IL-17A stimulation in wild-type MEFs (Figure 12-1A), the Regnase-1 phosphorylation pattern resembled that observed with IRAK1- and IRAK2-mediated phosphorylation upon LPS or IL-1 stimulation (Nat Immunol 12, 1167-1175 (2011)). IL-17A stimulation resulted in weak activation of NF-κB (Figure 12-3I), indicating that weak IKK activation in the IL-17A signaling pathway led to weak degradation of Regnase-1 upon IL-17A stimulation. Indeed, the phosphorylated form of Regnase-1 AA mutant protein gradually accumulated during IL-17A stimulation in Regnase-1AA / AA MEFs.

[0314] To identify the kinase responsible for Regnase-1 phosphorylation in the IL-17A signaling pathway, we investigated a series of MEFs lacking TBK1, IKKi, TBK1 / IKKi, Act1, IKKα / IKKβ, or IRAK1 / IRAK2. We found that Regnase-1 phosphorylation did not occur in MEFs lacking both TBK1 and IKKi or Act1, an adaptor protein essential for the IL-17A signaling pathway (Figure 12-1B). In MEFs lacking either TBK1 or IKKi, phosphorylation of Regnase-1 in response to IL-17A was observed, indicating that TBK1 and IKKi possess Regnase-1 kinase activities independent of each other (Figure 12-1B). Treatment of MEFs with BX795, an inhibitor of both TBK1 and IKKi, inhibited Regnase-1 phosphorylation upon IL-17A stimulation (Figure 12-1C). To investigate whether TBK1 and IKKi directly phosphorylate Regnase-1, we prepared purified recombinant Regnase-1 from an MEF cell line stably expressing FLAG-tagged Regnase-1. Phosphorylation of recombinant Regnase-1 by recombinant TBK1 and / or IKKi under in vitro conditions was confirmed by immunoblotting and immunohistochemistry. 32 The phosphorylation of Regnase-1 by IRAK appeared similar to that by TBK1 and IKKi, but it occurred in IRAK1 / IRAK2 double-deficient MEFs (Fig. 12-2E). In contrast, Regnase-1 phosphorylation in response to IL-1β occurred in TBK1 / IKKi double-deficient MEFs (Fig. 12-3J). These results suggest that TBK1 and IKKi phosphorylate Regnase-1 in an IRAK-independent manner, and that IRAK phosphorylates Regnase-1 in a TBK1- and IKKi-independent manner.

[0315] Example 9 In this example, it was shown that Act1 contributes to TBK1 / IKKi-mediated phosphorylation of Regnase-1 by TBK1 / IKKi by interacting with Regnase-1.

[0316] We investigated whether Regnase-1 interacts with Act1, TBK1, and IKKi. Co-immunoprecipitation of full-length or N- or C-terminally truncated Regnase-1 with Act1 revealed that Regnase-1 binds to Act1 via its C-terminal domain (Figure 12-2F). We then co-expressed Regnase-1 with Act1, TBK1, or IKKi in HEK293 cells. A phosphorylation band shift of Regnase-1 was observed when co-expressed with Act1 but not with TBK1 or IKKi, and a stronger band of phosphorylated Regnase-1 was detected when co-expressed with Act-1 and TBK1 or Act-1 and IKKi (Figure 12-2G). In contrast, the amount of phosphorylated Regnase-1 was reduced when Act1ΔSEFIR, a mutant form of Act-1 lacking the C-terminal part containing the SEFIR domain, was coexpressed with TBK1 or with Act1ΔSEFIR and IKKi (Figure S12-2H), suggesting that Regnase-1 phosphorylation by TBK1 or IKKi requires the interaction between the C-terminal domain of Regnase-1 and Act1. Coimmunoprecipitation analysis demonstrated that Regnase-1 interacts with TBK1, IKKi, and the Act-1 SEFIR domain, and that Act1 interacts with TBK1, IKKi, and Regnase-1 (Figure S12-2G and Figure S12-2H). These results indicate that binding of Act1 to Regnase-1 via its C-terminal domain resulted in increased accessibility of Regnase-1 to TBK1 and IKKi and simultaneous phosphorylation of Regnase-1 and Act1 by TBK1 or IKKi.

[0317] Example 10 In this example, it was shown that phosphorylation of residues within the proline-rich region dissociates oligomerized Regnase-1.

[0318] We attempted to identify the amino acid residues phosphorylated by TBK1 and IKKi in Regnase-1. Phosphorylated Regnase-1 (from mouse) was prepared by coexpression of Act1 with TBK1 or IKKi. Purified phosphorylated Regnase-1 was digested with proteases and analyzed by high-resolution liquid chromatography-mass spectrometry (LC-MS). Five Regnase-1 residues (Ser439, Ser494, Thr505, Ser508, and Ser513) were identified as critical phosphorylation sites (Figure 13-1A, Table 5). One of the five residues (Ser439) ​​corresponds to the phosphorylation target of IKK. The remaining four residues (Ser494, Thr505, Ser508, and Ser513) are located within the proline-rich region of Regnase-1 and do not contain any consensus sequences for phosphorylation. We investigated whether these residues contribute to the phosphorylation of Regnase-1 in the IL-17 receptor (IL-17R) signaling pathway. Substitution of Ser494 and Ser513 with alanine resulted in the loss of phosphorylated Regnase-1 upon stimulation with IL-1β or IL-17A in HeLa cells (Figure 13-1B), indicating that these residues are key residues responsible for the change in electrophoretic mobility of phosphorylated Regnase-1 and that they are common phosphorylation sites for IRAK and TBK1 / IKKi.

[0319] [Table 5]

[0320] We next investigated the role of Regnase-1 phosphorylation within this proline-rich region. The proline-rich region has been reported to be involved in Regnase-1 oligomerization, and a truncated Regnase-1 mutant lacking this region loses its RNase activity ( Mol Cell 44, 424-436 (2011); Nucleic Acids Res 41, 3314-3326 (2013)). These findings raised the possibility that phosphorylation of the proline-rich segment regulates Regnase-1 self-assembly. We generated and purified GST-tagged Regnase-1 fragments containing the proline-rich region and the C-terminal domain. We also constructed mutant fragments in which Ser and Thr residues in the proline-rich region were replaced with glutamic acid to mimic phosphorylation. The oligomerization of Regnase-1 fragments (wild-type, S494E / S513E, and S494E / T505E / S508E / S513E) was analyzed using gel filtration chromatography. The wild-type fragment formed several high-molecular-weight oligomers, whereas the mutant fragments inhibited oligomerization (Figure 13-2C). This indicates that the introduction of phosphoserine and phosphothreonine residues into the proline-rich region promotes the dissociation of oligomerized Regnase-1. To investigate the molecular assembly of phosphorylated Regnase-1, we used native-PAGE analysis of Regnase-1 purified from MEFs stably expressing N-terminal FLAG-tagged Regnase-1. This experiment demonstrated that IL-1β or IL-17A stimulation induced the appearance of Regnase-1 monomers (Figure 13-3D). In vitro phosphorylation of Regnase-1 with recombinant TBK1 and IKKi also induced its conversion to the monomeric form (Figure 13E). These results support the idea that phosphorylation of the proline-rich region of Regnase-1 affects interactions required for Regnase-1 self-assembly and promotes the conversion of the oligomerized form to the monomeric form.

[0321] Example 11 In this example, it was shown that phosphorylation of Regnase-1 changes its intracellular localization from the ER to the cytosol.

[0322] Regnase-1 protein is found in the rough ER membrane fraction (Cell 161, 1058-1073 (2015)). We isolated intracellular compartments, such as ER membrane, microsomes, and soluble cytosolic fractions, from cell homogenates of MEFs stimulated with IL-1β or IL-17A and analyzed their protein distribution using Western blotting. All phosphorylated Regnase-1 protein was present in the cytoplasm (Figure 14-1A), whereas non-phosphorylated Regnase-1 remained localized to ribosome-containing organelles (Figure 14-1A). This cytosolic distribution of Regnase-1 protein was not observed in TNF-α-stimulated MEFs or IL-17A-stimulated Act-1-deficient MEFs, in which Regnase-1 was not phosphorylated (Figure 14-1B), indicating that Regnase-1 phosphorylation and subsequent dissociation of Regnase-1 oligomers triggered the translocation of Regnase-1 from the ER to the cytoplasm. Interestingly, after IL-17A stimulation, the amount of unphosphorylated Regnase-1 in the ER fraction became higher over time in Regnase-1AA / AA MEFs than in wild-type cells (Figure 14-1C). This finding suggests that unphosphorylated Regnase-1 protein attached to the ER upon IL-17A stimulation mediates the regulation of Regnase-1 target mRNA levels.

[0323] The change in the intracellular distribution of phosphorylated Regnase-1 also raises the possibility that Regnase-1 binds to Act1 and TBK1 / IKKi in the ER. We investigated whether the interaction between Regnase-1, Act1, and TBK1 / IKKi occurs in the ER by co-immunoprecipitation of subcellular fractions isolated from IL-17A-stimulated or unstimulated cells. Regnase-1 interacting with phosphorylated TBK1 and phosphorylated IKKi was observed in microsomes but not in the soluble cytosolic fraction (Figure 14-2D). Western blot analysis of subcellular fractions isolated from wild-type and Act1-deficient MEFs revealed that Act1 is responsible for the phosphorylation of both TBK1 and IKKi in the ER in response to IL-17A and promotes the kinase-mediated phosphorylation of Regnase-1 (Figure 14-2E). These results suggest that Act1 acts as a signaling factor to promote the phosphorylation of TBK1, IKKi, and Regnase-1 on the ER membrane after IL-17A stimulation.

[0324] Example 12 In this example, it was shown that IL-17-mediated phosphorylation of Regnase-1 leads to the loss of its RNase activity.

[0325] We next investigated whether dissociation of phosphorylated Regnase-1 from the ER affects IL-6 mRNA levels upon cell stimulation. Unlike stimulation with IL-1β and TNF-α, IL-17A induces Regnase-1 phosphorylation, but this cytokine does not sufficiently induce IL-6 mRNA due to its weak NF-κB activation. TNF-α induces IL-6 mRNA expression with strong NF-κB activation, but is unable to induce Regnase-1 phosphorylation. We measured IL-6 mRNA levels in MEFs pretreated with TNF and then stimulated with IL-17A alone. In wild-type MEFs, IL-6 mRNA induction was strongly enhanced upon IL-17A stimulation, which led to Regnase-1 phosphorylation (Figure 15-1A). In Regnase-1 AA mutant cells and TBK1 / IKKi double-deficient cells, IL-6 mRNA induction was suppressed upon IL-17A stimulation, and was particularly significantly inhibited in double-deficient MEFs (Figure 15-1B). TBK1 / IKKi double-deficient cells did not exhibit Regnase-1 phosphorylation and maintained its intracellular localization in ribosome-containing organelles in response to IL-17A (data not shown).

[0326] We used a Tet-off induction system to evaluate the effect of Regnase-1 phosphorylation on mRNA degradation. When coexpressed with Act1 and IKKi, Regnase-1 was readily phosphorylated. IL-6 mRNA and the 3'UTR were overexpressed in Tet-off HEK293 cells in the presence of either Regnase-1 or phosphorylated Regnase-1, and IL-6 mRNA levels were then assessed by Northern blotting. IL-6 mRNA degradation by Regnase-1 was blocked by coexpression with Act1 and IKKi (Figure 15-2C). This strongly indicates that phosphorylated Regnase-1 lacks the ability to degrade its target mRNA.

[0327] We next investigated the mechanism of target mRNA suppression in Regnase-1AA / AA cells. As described above, target mRNA suppression is more potent during the later stages of IL-17A stimulation. We used immunoblot analysis of phosphorylated and non-phosphorylated Regnase-1 during the recovery period after IL-17A stimulation. Non-phosphorylated Regnase-1 protein gradually appeared in wild-type MEFs during the recovery period, and this was observed in the presence of protein synthesis inhibitors (Figure 15-2D). The increase in non-phosphorylated Regnase-1 protein was much stronger in Regnase-1AA / AA MEFs than in wild-type cells. In contrast, non-phosphorylated Regnase-1 did not appear in the presence of okadaic acid, an inhibitor of protein phosphatases 1 and 2A (Figure 15-2D), indicating that the appearance of non-phosphorylated Regnase-1 is mediated by phosphatases. Furthermore, IL-6 mRNA stability was also enhanced in the presence of okadaic acid during the recovery phase after TNF-α and IL-17A treatment of Regnase-1AA / AA MEFs (Figure 15-2E). These results suggest that the conversion of phosphorylated Regnase-1 to the unphosphorylated form is required for the suppression of Regnase-1 target mRNAs observed in Regnase-1AA / AA cells upon IL-17A stimulation.

[0328] Example 13 In this example, we demonstrated that the C-terminal truncated mutant (Regnase-1ΔCTD) and S513A mutant (Regnase-1 S513A) of Regnase-1 inhibit IL-17-mediated phosphorylation and abolish IL-17-mediated inflammatory responses in vitro and in vivo.

[0329] Phosphorylated Regnase-1 is released from the ER by conversion from constitutively active oligomers to inactive monomers. This finding suggests that Regnase-1 mutants may maintain RNase function in the absence of phosphorylation. To investigate this, we expressed various stable Regnase-1 mutants in MEFs and sought Regnase-1 mutants resistant to IL-17-mediated phosphorylation. We found that a Regnase-1 mutant lacking the C-terminal domain essential for interaction with Act-1 was not phosphorylated by IL-17A stimulation (Figure 16-1A). We next attempted to generate genetically mutant mice expressing C-terminally truncated Regnase-1 by introducing a frameshift and premature stop codon into the proline-rich domain of Regnase-1 (Figure 17-1A). We successfully generated mutant mice with a 1-bp deletion at codon 517, resulting in a frameshift mutation (referred to as Regnase-1ΔCTD; Figure 17-1B). To examine the effect of this mutation on protein expression levels and any post-translational modifications, MEFs derived from Regnase-1ΔCTD / ΔCTD mutant mice were stimulated with TNF-α, IL-17A, and IL-1β. These stimuli induced an NF-κB-dependent increase in Regnase-1ΔCTD protein, without a mobility-shifted band indicative of phosphorylation (Figure 16-1B). To investigate the possibility of Regnase-1ΔCTD protein phosphorylation upon IL-17A stimulation, FLAG-tagged Regnase-1ΔCTD was coexpressed with Myc-Act-1, HA-TBK-1, and HA-IKKi in HEK293 cells and co-immunoprecipitated. The Regnase-1ΔCTD protein showed significantly reduced phosphorylation compared to the wild-type protein (Figure 16-1C) and did not co-immunoprecipitate with Act-1 (Figure 16-1D). These results demonstrate that Regnase-1ΔCTD lacks the binding to Act-1 that is essential for Regnase-1 phosphorylation and remains in a non-phosphorylated form upon IL-17A stimulation.

[0330] We generated mutant mice in which Ser513 was replaced by alanine (Figures 17-1C and 17-1D). To examine the effect of this mutation on protein expression levels and any post-translational modifications, we stimulated MEFs derived from Regnase-1 S513A mutant mice with TNF-α, IL-17A, and IL-1β. These stimulations induced an NF-κB-dependent increase in Regnase-1 S513A protein, without the mobility-shifted bands associated with phosphorylation (Figure 16-4L). We then examined the protein stability of the Regnase-1 mutant proteins. MEFs derived from Regnase-1 AA mutant mice and Regnase-1 S513A mutant mice were stimulated with TNF-α, IL-1β, LPS, and IL-17A in the presence of the transcriptional inhibitor cycloheximide. As a result, in wild-type MEFs, the Regnase-1 protein level was significantly reduced after stimulation with IL-1β, LPS, and IL-17A, whereas no reduction in Regnase-1 protein level was observed in MEFs derived from Regnase-1 AA mutant mice or Regnase-1 S513A mutant mice (Figure 16-4M, Figure 16-5N). Thus, the Regnase-1 S513A mutation was resistant to phosphorylation and degradation induced by IL-17A stimulation, resulting in enhanced stability of the Regnase-1 protein.

[0331] We next investigated the binding pattern of Regnase-1ΔCTD protein in ribosome-containing organelles. We isolated cytosolic and microsomal fractions from cell homogenates of IL-17A-stimulated Regnase-1ΔCTD / ΔCTD MEFs and analyzed the protein distribution of Regnase-1, ribosomal protein L7a, GAPDH, and phospho-TBK1 by Western blot analysis. Wild-type Regnase-1 was phosphorylated by IL-17A and was no longer localized in microsomes following its translocation to the cytoplasm, whereas the Regnase-1ΔCTD mutant remained bound to microsomes after IL-17A stimulation. This was accompanied by an increase in Regnase-1ΔCTD protein in microsomes (Figure 16-2E). Reganase-1 also binds to translationally active ribosomes assembled on polysomes and promotes mRNA degradation at the translating ribosomes (Cell 161, 1058-1073 (2015)). We confirmed the binding of Regnase-1 to translationally active polysomes in wild-type and Regnase-1ΔCTD / ΔCTD MEFs stimulated with TNF-α and IL-17A (Figure 16-2F). While the localization of Regnase-1 to polysomes was reduced by cytokine stimulation in wild-type MEFs, the localization of Regnase-1 to translationally active polysomes was increased in mutant MEFs stimulated with these cytokines compared with unstimulated MEFs (Figure 16-2G). The opposite protein localization patterns between wild-type and mutant Regnase-1 implicate a role for the Regnase-1ΔCTD mutation in downregulating target mRNA expression even during inflammatory stimulation. To test this, the present inventors examined the mRNA induction of Regnase-1-targeted genes in wild-type and Regnase-1ΔCTD / ΔCTD MEFs, and Regnase-1 S513A MEFs stimulated with proinflammatory cytokines.In wild-type MEFs, stimulation with TNF-α plus IL-17A induced a time-dependent increase in Regnase-1 target mRNAs, such as IL-6, LCN-2, and GM-CSF, but not in mutant MEFs (Figures 16-3H and 17-4E). In mutant MEFs, sequential stimulation with TNF-α and IL-17A induced reduced mRNA production of IL-17-related genes, such as IL-6, CXCL-1, CXCL-2, CCL-20, LCN-2, and GM-CSF (Figures 17-2C and 17-4F). Furthermore, after 24 hours of stimulation with IL-17A and either IL-6 or TNF-α, the protein production of IL-6, CXCL-1, and CXCL-2 was significantly lower in Regnase-1ΔCTD / ΔCTD MEFs than in wild-type-derived cells (Figure 17-3D). These findings indicate that the Regnase-1ΔCTD protein maintains its intracellular localization in ribosome-containing organelles after IL-17A stimulation and acts as a negative regulator that inhibits IL-17A-mediated enhancement of mRNA stability and subsequent production of inflammatory cytokines.

[0332] To examine whether impaired IL-17-mediated release of Regnase-1 from the ER is important for suppressing T17 cell-mediated autoimmune disorders, we induced EAE in Regnase-1ΔCTD / ΔCTD mice. The severity of EAE was significantly attenuated in these mice compared with wild-type mice (Figure 16-3I). Flow cytometry analysis of mice 28 days after immunization showed significantly reduced infiltration of CD4+ T cells and macrophages into neuronal tissues in Regnase-1ΔCTD / ΔCTD mice (Figures 16-3J and 16-3K). Meanwhile, the numbers of T1 and T17 cells in spleen and lymph node cells were comparable between wild-type and mutant mice, except for increased numbers of spleen-derived T1 cells in mutant mice compared with wild-type mice (Figure 18). These results suggest that the Regnase-1ΔCTD mutation also suppresses EAE pathogenesis through sustained inhibition of STAT3 activation in endothelial cells, disrupting T17 cell-mediated inflammation, which is necessary for T17 cell infiltration into neural organs.

[0333] Example 14. Search for Regnase-1 target genes by luciferase assay (Luciferase assay) HEK293 cells were transfected with the pGL3-target gene 3'UTR plasmid expressing firefly luciferase or the control pGL3-empty plasmid, along with a wild-type Regnase-1 expression plasmid, a mutant Regnase-1 (D141N) expression plasmid, or a control empty plasmid. A Renilla luciferase expression plasmid was also transfected as an internal control. After 24 hours of culture, luciferase activity in the cell lysates was measured using the Dual-luciferase reporter assay system (Promega).

[0334] (expression plasmid) Wild-type mouse Regnase-1 and a mutant mouse Regnase-1 (D141N) with a D-to-N substitution at amino acid 141 were inserted into the pCXND3 plasmid (Chugai Pharmaceutical Co., Ltd.) to prepare wild-type and mutant Regnase-1 (D141N) expression plasmids. A FLAG tag was inserted into the pCXND3 plasmid, and an empty control plasmid was prepared. The pGL3-target gene 3'UTR plasmid was constructed by inserting the 3'UTR sequence of the target gene mRNA into the XbaI site of the pGL3 plasmid (Promega). The target gene was selected by RNA immunoprecipitation assay using RAW264.7 and immortalized mouse keratinocytes.

[0335] As a result, in cells transfected with pGL3 plasmids containing Fabp5, Ackr3, Ctgf, Adamts1, Atf2, Cd80, Cyr61, Ddr1, Duox1, Dusp6, Csf3, Hbegf, Id3, Il19, Map3k8, Il1a, mcoln3, Mitf, Orc1, Pdgfb, Ptgs1, Sesn1, Ptger4, Shq1, Sulf1, Tnfrsf9, zc3h12c, Rarb, and Tmem9 3'UTRs, luciferase activity was significantly reduced by Regnase-1 compared to cells transfected with the empty plasmid, and a dose-dependent decrease was observed (Figures 19-1 to 19-5). In contrast, transfection with a mutant Regnase-1 (D141N) expression plasmid did not significantly alter luciferase activity, suggesting that the above genes may be novel targets regulated by Regnase-1.

[0336] Example 15. Detection of phosphorylation of Regnase-1 by IKKβ or TBK1 (Preparation of human Regnase-1) The target protein was the full-length sequence of human Regnase-1 (UniProt ID: Q5D1E8) (SEQ ID NO: 2), with a GST tag at the N-terminus and a recognition sequence for the biotin ligase BirA at the C-terminus. Regnase-1 was expressed in mammalian cells Expi293 and purified with glutathione Sepharose. The GST tag was cleaved with Turbo3C protease (Accelagen), and then isolated by gel filtration chromatography. If necessary, dephosphorylation was performed by adding 7 units of lambda phosphatase (SIGMA, P9614) per 1 μg of Regnase-1 and incubating at 4°C for 2 hours, followed by isolation by gel filtration chromatography.

[0337] (phosphorylation reaction) The phosphorylation reaction was carried out by reacting the kinase (IKKβ (SignalChem) or TBK1 (SignalChem)) with the biotinylated human Regnase-1 prepared above in the presence of 20 μM ATP at room temperature for 1 hour using Kinase assay buffer III (SignalChem) supplemented with 2 mM DTT, 100 μM sodium vanadate, and 2 mM manganese chloride.

[0338] (Detection of phosphorylated human Regnase-1) Phosphorylated human Regnase-1 was detected by Western blotting using the above antibodies. Western blotting was performed by transferring proteins from SDS-PAGE gels to a PVDF membrane (Bio-Rad). The primary antibody was either the anti-Regnase-1 antibody or an anti-phosphorylated Regnase-1 antibody, and the secondary antibody was an anti-rabbit IgG horseradish peroxidase-linked antibody (Cell Signaling Technology). The peroxidase reaction was performed using Supersignal Westpura Extended Duration Substrate (Thermo), and chemiluminescence was detected using an ImageQuant LAS 4000 mini (GE Healthcare). The anti-phosphorylated Regnase-1 antibody specifically detected phosphorylated human Regnase-1 generated by kinase phosphorylation, while the anti-Regnase-1 antibody specifically detected human Regnase-1 (Figure 20).

[0339] The results of Example 15 confirmed that human Regnase-1 is phosphorylated by IKKβ and TBK1. Furthermore, the phosphorylation site in human Regnase-1 was considered to be equivalent to the phosphorylation site in mouse Regnase-1. By using the methods of these Examples, it is possible to identify substances that inhibit the phosphorylation of Regnase-1.

[0340] Without intending to be bound by any particular theory, the present inventors consider the following (1) to (5) based on the results of this study.

[0341] (1) Regnase-1 undergoes two-step phosphorylation in response to IL-1 or LPS, which activates the MyD88-dependent pathway. The first phosphorylation is mediated by the IRAK family of protein kinases, followed by IKK-mediated phosphorylation, which leads to protease-dependent degradation. Reduced Regnase-1 protein levels due to IKK-dependent degradation appear to attenuate its function as a "brake" on mRNA expression, which induces the expression of Regnase-1 target mRNAs. However, our present results demonstrate that IKK-independent phosphorylation of Regnase-1 contributes to the cessation of RNase activity. Regnase-1 exists in an oligomeric form in ribosome-containing organelles, but phosphorylation induced by cellular stimuli disrupts Regnase-1 self-assembly, causing its release from the ER and translationally active polysomes. In our experiments, phosphorylation of Regnase-1 was maintained for a longer period than its degradation and contributed to the stabilization of Regnase-1 target mRNAs in response to stimulation with cytokines or TLR ligands.

[0342] (2) We introduced a mutant form of Regnase-1 (AA) in which two serine residues phosphorylated by IKK were mutated to alanine residues. IL-17A stimulation induced rapid phosphorylation of Regnase-1 in both wild-type and Regnase-1 AA mutant MEFs. In the case of Regnase-1 AA mutant cells, we observed the appearance of unphosphorylated Regnase-1 at a late stage after IL-17A stimulation. This may be due to the suppression of a series of mRNAs regulated by Regnase-1 protein and the reduced severity of EAE observed in Regnase-1 AA mutant mice. This accumulation of unphosphorylated Regnase-1 protein in Regnase-1 AA mutant cells occurred even in the presence of protein synthesis inhibitors, suggesting that phosphorylated Regnase-1 was converted to the unphosphorylated form. We speculated that the appearance of unphosphorylated Regnase-1 protein may be due to dephosphorylation by phosphatases. This hypothesis was confirmed by treating Regnase-1 AA mutant cells with the phosphatase inhibitor okadaic acid, which dramatically extended the half-life of IL-6 mRNA. Dephosphorylation of Regnase-1 restores mRNA degradation activity via its attachment to the ER. Thus, Regnase-1 may inhibit the expression of its target mRNAs in response to weak stimuli through reversible dephosphorylation and rapid relocation to the ER.

[0343] (3) We also generated Regnase-1ΔCTD mutant mice expressing Regnase-1 protein lacking the C-terminal domain required for interaction with Act1. Similar to Regnase-1 AA mutant mice, these mice also showed reduced EAE severity compared with wild-type mice due to impaired TH17 cell-mediated inflammation in non-hematopoietic cells. Meanwhile, a previous report showed that Regnase-1-deficient heterozygotes are more susceptible to EAE due to increased inflammation in non-hematopoietic cells (Immunity, 2015 Sep 15; 43(3): 475-487), demonstrating the important role of Regnase-1 in suppressing inflammation in non-hematopoietic cells during EAE pathogenesis. However, the mechanism of inhibition of EAE pathogenesis in Regnase-1ΔCTD / ΔCTD mice may be different from that in Regnase-1AA / AA mice. Due to the lack of its degradation induced by IKK-mediated phosphorylation, the Regnase-1 AA mutant protein is more abundant than the wild-type, which has beneficial effects in EAE. The Regnase-1ΔCTD mutant exhibited lower levels of protein expression at steady state and increased expression upon stimulation with several inflammatory cytokines, promoting the accumulation of unphosphorylated Regnase-1 in the ER and accelerating target mRNA degradation. Because Regnase-1 mRNA contains its own binding site in the 3'UTR, the low steady-state levels of Regnase-1ΔCTD may result from autoregulation of its own mRNA. This provides important insight into the regulatory role of Regnase-1 phosphorylation not only in transmitting signals leading to protein degradation but also in attenuating target mRNA degradation activity to avoid the intracellular accumulation of unphosphorylated / active protein.

[0344] (4) IL-17 signals into the cytoplasm through interaction between Act1, an essential adaptor protein in the IL-17 signaling pathway, and the IL-17 receptor (IL-17R). We identified an association between Regnase-1 and Act1, TBK1, and IKKi in the ER. Regnase-1 associates with Act1 via its C-terminal domain. Binding of Act1 to Regnase-1 strongly promotes Regnase-1 phosphorylation by TBK1 and IKKi, which enhances Regnase-1 translocation from the ER to the cytoplasm and blocks its mRNA degradation. These findings suggest that Regnase-1 phosphorylation is directly correlated with Act1 activation following IL-17R association and that Regnase-1 is involved in regulating IL-17-induced mRNA expression. Indeed, a group of genes that are upregulated in response to IL-17, such as IL-6, IL-8, CXCL1, and CXCL2, correspond to target mRNAs of Regnase-1.

[0345] (5) Regnase-1 is an RNA-binding RNase that destabilizes specific mRNAs under steady-state conditions and is rapidly inactivated upon IL-17 stimulation, stabilizing specific mRNAs during the IL-17 response. In our study, IL-17-induced phosphorylation of Regnase-1 was severely impaired in Regnase-1ΔCTD mutant cells. Co-stimulation with TNF-α and IL-17 dramatically reduced IL-6, CXCL1, CXCL2, CCL-20, lipocalin-2, and GM-CSF production in Regnase-1ΔCTD mutant cells to levels comparable to those of TBK1 / IKKi double knockout cells. These results strongly suggest that interactions between Regnase-1, Act1, and TBK1 / IKKi influence the expression of these inflammatory genes induced by IL-17 stimulation and that Regnase-1 plays a central role in regulating the inflammatory response to IL-17. Blocking Regnase-1 phosphorylation may provide a new strategy for the treatment of TH17 cell-associated diseases.

[0346] Example 16. Effect of phosphorylation of Regnase-1 at position 513 on IL-6 production To confirm that IL-6 mRNA levels are regulated by Regnase-1 phosphorylation and its dissociation from the ER upon stimulation, we generated mouse Regnase-1 mutants that are resistant to phosphorylation by TBK1 / IKKi. We established two MEF cell lines expressing Regnase-1 mutants: one containing a substitution of Ser513 by Ala (Regnase-1 S513A) and the other lacking the C-terminal domain (Regnase-1 ΔCTD). Neither mutant showed Regnase-1 phosphorylation and maintained its intracellular localization in the ER in response to IL-1β or IL-17A (Fig. 21A). IL-6 mRNA production upon costimulation with TNF-α and IL-17A was significantly reduced in these mutant MEFs compared with wild-type cells (Fig. 21B). These results indicate that inhibition of Regnase-1 phosphorylation at position 513 strongly suppresses IL-6 production.

[0347] Example 17. Pathological alleviation effect of Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model Imiquimod cream (62.5 mg, Veselna Cream 5%; Mochida Pharmaceutical Co., Ltd.) was applied to the right ear and shaved dorsal neck skin of C57BL / 6 mice (wild-type mice; WT) or Regnase-1 S513A mutant mice (S513A) every other day on days 0, 2, and 4. Auricle lesions were evaluated by serially measuring the thickness of the right ear using a digital thickness gauge (Ozaki Seisakusho) from before imiquimod application. The dorsal neck skin was evaluated by visually assessing the severity of erythema, thickening, and scaling on a 4-point scale, with the combined score calculated as a total of 12 points. As a result, in wild-type mice, application of imiquimod resulted in significant thickening of the ears (Fig. 22A). Furthermore, application of imiquimod induced psoriasis-like skin lesions, such as erythema, thickening, and scaling, in the skin of the back of the neck (Fig. 22B). In contrast, in Regnase-1 S513A mutant mice, ear thickening and psoriasis-like skin lesions (erythema, thickening, and scaling) were reduced compared to wild-type mice (Fig. 22A, 22B).

[0348] Evaluation of S513A mice (quantitation of various gene expression) The mice were euthanized, and the ears from the application sites were collected. RNA was extracted using standard methods with QIAZOL Lysis Reagent (QIAGEN, No. 79306) and the RNeasy 96 kit (QIAGEN, No. 74182). Complementary DNA was obtained by reverse transcription, and the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) on a LightCycler 480 II (Roche). The Taqman probes used are listed below. B2m (Applied Biosystems, Mm00437762_m1): Endogenous control Il6 (Applied Biosystems, Mm00446190_m1): Inflammatory cytokine Il1a (Applied Biosystems, Mm00439620_m1): Inflammatory cytokine Cxcl2 (Applied biosystems, Mm00436450_m1): Leukocyte migration factor Hbegf (Applied Biosystems, Mm00439306_m1): Cell growth factor Sprr2i (Applied Biosystems, Mm00726832_s1): keratinocyte marker Keratin 6A (Applied Biosystems, Mm00833464_g1): keratinocyte marker As a result, in S513A mice, the induction of keratinocyte markers, Sprr2i and Keratin6A, which are induced by the onset of pathology, was suppressed, revealing that the increase in keratinocytes, which is characteristic of the psoriasis model pathology, was suppressed. Furthermore, in wild-type mice, the expression of Regnase-1 target genes (Il6, Il1a, Cxcl2, and Hbegf) increased with the onset of pathology (Fig. 37). On the other hand, in S513A mutant mice, the expression of these genes was suppressed during pathology. This suggests that Regnase-1 AA mutant mice have an inhibitory effect on the production of inflammatory cytokines and epidermal cell proliferation associated with pathology.

[0349] Example 18. Pathological alleviation effect of Regnase-1 S513A mutant mice in an experimental autoimmune encephalomyelitis model (EAE model) Conventional EAE was induced by immunization with myelin oligodendrocyte glycoprotein (MOG) (35-55) peptide (AnaSpec). An emulsion of MOG (35-55) peptide (300 ng / mouse) mixed with complete Freund's adjuvant (CFA, InvivoGen) at a 1:1 ratio was subcutaneously injected into mice. After intraperitoneal injection of pertussis toxin (100 ng / mouse) on days 0 and 2, mice were monitored every 2 days and evaluated by clinical scoring between days 7 and 28 after immunization. Clinical scores were measured using a previously defined scale (Immunity 14, 471-481 (2001)). (statistical analysis) Unless otherwise stated, statistical analysis of differences between two groups was performed by Student's t-test (two-tailed). P < 0.05 was considered statistically significant. Regnase-1 S513A mutant mice showed a reduced increase in clinical score associated with the pathology and alleviated the pathology compared to wild-type mice (Figure 38).

[0350] Example 19. In vitro selection (panning) of target-binding polypeptides 19-1 Randomized double-stranded DNA library encoding a polypeptide library A DNA library was constructed according to the method described in patent document WO2013 / 100132. The library was prepared so that the triplet in the random region appeared 9 or 10 times.

[0351] 19-2 Cyclic Polypeptide Library Using the mRNA-puromycin linker ligation products prepared from the double-stranded DNA library and a cell-free translation solution, a cyclic polypeptide library was translationally synthesized according to the method described in WO 2013 / 100132. 18 natural amino acids, excluding methionine and cysteine, were randomly assigned to the random region of the cyclic polypeptides constituting the library.

[0352] 19-3 Panning Panning was performed using the aforementioned cyclic polypeptide library according to the method described in WO2013 / 100132. Biotinylated human Regnase-1 was used as the target molecule for panning. Multiple rounds of panning were repeated, and the enriched sequences were identified as cyclic polypeptide sequences that bind to the target molecule, Regnase-1. Among these, PP1 to PP6 were synthesized by the method described in this Example, which will be described later. PP7 to PP25 were also synthesized in the same manner.

[0353] Example 20. Synthesis of cyclic polypeptides The following abbreviations are used in the examples: AA Ammonium Acetate DBU 1,8-diazabicyclo[5.4.0]-7-undecene DCM dichloromethane DCE 1,2-dichloroethane DMF N,N-dimethylformamide DMSO dimethyl sulfoxide DIC N,N'-diisopropylcarbodiimide DIPEA N,N-Diisopropylethylamine FA formic acid MTBE Methyl tert-butyl ether NMP N-methyl-2-pyrrolidone TFA trifluoroacetic acid TFE 2,2,2-trifluoroethanol TIPS Triisopropylsilane HOAt 1-hydroxy-7-azabenzotriazole HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate

[0354] The reaction solvents used for peptide synthesis and solid-phase synthesis were those for peptide synthesis (purchased from Watanabe Chemical and Wako Pure Chemical Industries). Examples include DCM, DMF, NMP, 2% DBU in DMF, and TFA. For reactions that do not use water as a solvent, dehydrated solvents, ultra-dehydrated solvents, and anhydrous solvents (purchased from Kanto Chemical and Wako Pure Chemical Industries, etc.) were used.

[0355] The LC / MS analysis conditions are as shown in Table 6. [Table 6]

[0356] Chemical synthesis of peptide compounds Peptide elongation was performed according to the Fmoc peptide synthesis method described in WO2013 / 100132 using the following basic route. Specifically, the five steps involved: 1) Fmoc peptide elongation from the N-terminus of Asp, which was supported on a 2-chlorotrityl resin by the carboxylic acid of the Asp side chain; 2) peptide cleavage from the 2-chlorotrityl resin; 3) amide cyclization by condensation of the carboxylic acid of the Asp side chain, generated by cleavage from the 2-chlorotrityl resin during the cleavage process, with the amino group at the N-terminus (triangle unit) of the peptide chain; 4) deprotection of the protecting groups of the side chain functional groups contained in the peptide chain; and 5) purification of the compound by preparative HPLC. In this example, peptide compounds were synthesized according to this basic route (Figure 23), unless otherwise noted.

[0357] Fmoc-amino acids for peptide synthesis using a peptide synthesizer In the peptide synthesis described herein, the following Fmoc-amino acids were used in the synthesis using a peptide synthesizer: Fmoc-Ala-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Asn(Trt)-OH, Fmoc-Asp(OPis)-OH, Fmoc-D-MeAla-OH, Fmoc-Gln(Trt)-OH, Fmoc-Gly-OH, Fmoc-Glu(OtBu)-OH, Fmoc-His(Trt)-OH, Fmoc-Ile-OH, Fmoc-Leu-OH, Fmoc-Lys(Boc)-OH, Fmoc-MeAla- OH, Fmoc-Pro-OH, Fmoc-Phe-OH, Fmoc-Trp-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Val-OH, Fmoc-β-MeAla-OH (sometimes referred to as Fmoc-bMeAla-OH), Fmoc-Asp(OMpe)-OH, Fmoc-MePhe-OH, and the like were purchased from Tokyo Chemical Industry Co., Ltd., Watanabe Chemical Industry Co., Ltd., Chempep, Chem-Impex, or Amatek. Furthermore, Fmoc-Ser(THP)-OH and Fmoc-Thr(THP)-OH were synthesized by the following method.

[0358] Synthesis of (2S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-((tetrahydro-2H-pyran-2-yl)oxy)propanoic acid (compound 1, Fmoc-Ser(THP)-OH) Toluene (10 mL) was added to a mixture of (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-hydroxypropanoic acid (Fmoc-Ser-OH, purchased from Watanabe Chemical Co., Ltd., 1.0 g, 3.06 mmol) and pyridinium p-toluenesulfonate (PPTS, 0.038 g, 0.153 mmol), and the water content was removed by azeotropy. The resulting residue was added with ultra-dehydrated tetrahydrofuran (THF, 6.1 mL) and 3,4-dihydro-2H-pyran (1.9 mL, 21.3 mmol), and the mixture was stirred at 50°C under a nitrogen atmosphere for 4 hours. After con...

Claims

1. A pharmaceutical composition comprising a Regnase-1-binding molecule that inhibits phosphorylation by TBK1 or IKKβ of a Ser residue at at least one position selected from the group consisting of positions in Regnase-1 corresponding to positions 513 and 494 of SEQ ID NO: 1, wherein the Regnase-1-binding molecule is one of the following PP2 to PP10, PP13 to PP19, and PP22 to PP25: The pharmaceutical composition is a cyclic polypeptide that competes with at least one compound selected from the above for binding to Regnase-1, and the cyclic polypeptide has a total of 10 to 13 amino acids and amino acid analogs.

2. A composition for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB, comprising a Regnase-1-binding molecule that inhibits phosphorylation by TBK1 or IKKβ of at least one Ser residue in Regnase-1 selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1, wherein the Regnase-1-binding molecule is selected from the group consisting of the following PP2 to PP10, PP13 to PP19, and PP22 to PP25: The composition is a cyclic polypeptide that competes with at least one compound selected from the above for binding to Regnase-1, and the cyclic polypeptide has a total of 10 to 13 amino acids and amino acid analogs.

3. The composition of claim 1 or 2, wherein the positions corresponding to positions 513 and 494 of SEQ ID NO: 1, respectively, are (i) positions 513 and 494 of SEQ ID NO: 1; or (ii) positions 516 and 497 of SEQ ID NO:

2.

4. A Regnase-1 binding molecule that inhibits phosphorylation by TBK1 or IKKβ of a Ser residue at at least one position selected from the group consisting of positions in Regnase-1 corresponding to positions 513 and 494 of SEQ ID NO: 1, and is selected from the group consisting of the following PP2 to PP10, PP13 to PP19, and PP22 to PP25: The Regnase-1 binding molecule is a cyclic polypeptide that competes with at least one compound selected from the above for binding to Regnase-1, and is a cyclic polypeptide having a total of 10 to 13 amino acids and amino acid analogs.