DNA sequencing using hydrogel beads.

Abstract

To provide a system, a method and a composition for preparing beads that encapsulate long DNA fragments for creating a spatial index having high throughput.SOLUTION: A method and a system of the present invention include: encapsulating a sample of DNA fragments into hydrogel beads; loading hydrogel beads that encapsulate the sample of DNA fragments on a flow cell device; fabricating a library; releasing the fabricated library on a surface of the flow cell device; and clustering and sequencing a released library.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] Technical Field The systems, methods, and compositions described herein relate to hydrogel beads and methods for encapsulating long DNA sequences within hydrogel beads for use in polynucleotide sequencing and related library generation. [Background technology]

[0002] background Next-generation sequencers are powerful tools that generate large amounts of genomic data in a single sequencing run. Interpreting and analyzing this large amount of data can be challenging. Sequencing by synthesis (SBS) technology provides high-quality sequencing data. However, short reads (maximum read length of 2 × 300 bp) are a limitation of current SBS chemistry. Recently, it has become increasingly important to sequence longer DNA molecules to better capture single nucleotide variants (SNPs), insertions / deletions, and structural variations, and for improved genome discrimination. Summary of the Invention

[0003] overview Some embodiments described herein relate to hydrogel beads for carrying out DNA reactions. In some embodiments, the hydrogel beads comprise hydrogel polymer precursors, a crosslinker, and DNA disposed within the hydrogel beads. In some embodiments, the beads comprise pores that retain the DNA while allowing the diffusion of reactants from the beads. In some embodiments, the DNA is a DNA molecule of 50,000 base pairs or more.

[0004] Some embodiments described herein relate to a flow cell device for performing DNA sequencing. In some embodiments, the flow cell device includes a solid support. In some embodiments, the solid support includes a surface having a degradable hydrogel that encapsulates DNA disposed thereon. In some embodiments, the degradable hydrogel includes pores that allow diffusion of reactants from the hydrogel but are too small for the DNA to pass through.

[0005] Some embodiments described herein relate to a system for DNA sequencing. In some embodiments, the system includes a stage configured to hold a flow cell device, the flow cell device, and a detector for acquiring sequencing data.

[0006] Some embodiments described herein relate to a DNA sequencing method. In some embodiments, the method comprises obtaining beads encapsulating DNA as described herein. In some embodiments, the method comprises providing a flow cell device as described herein. In some embodiments, the method further comprises amplifying the DNA encapsulated in the hydrogel, tagmenting the DNA encapsulated in the hydrogel, or sequencing the DNA. In some embodiments, the method further comprises generating a DNA library encapsulated in the hydrogel. Further aspects of the present invention are described below: [Section 1] hydrogel polymer precursors; a cross-linking agent; and Hydrogel beads for carrying out DNA reactions, comprising DNA disposed within the hydrogel beads, wherein the beads comprise pores that allow diffusion of reactants through the beads while retaining the DNA. [Section 2] Item 1, the beads having a diameter of about 50 μm to about 150 μm. [Section 3] 3. The beads of paragraph 1 or 2, wherein the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), PEG / polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronic acid, pectin, carrageenan, gelatin, chitosan, cellulose, or collagen. [Section 4] Item 4. The beads according to any one of items 1 to 3, wherein the crosslinking agent comprises bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate. [Section 5] Item 5. The bead according to any one of items 1 to 4, wherein the DNA is a long DNA molecule of 50,000 base pairs or more. [Section 6] 6. The bead of any one of paragraphs 1 to 5, wherein the reaction reagents include an enzyme, a compound, and a primer having a size of less than 50 base pairs. [Section 7] The beads of any one of paragraphs 1 to 6, wherein the reactant comprises lysozyme, proteinase K, random hexamer, polymerase (Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (Tn5), primer (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation. [Section 8] A flow cell device for performing DNA sequencing, comprising a solid support including a surface having a degradable hydrogel encapsulating DNA disposed thereon, wherein the degradable hydrogel contains pores of a size that allows diffusion of reactants out of the hydrogel but is too small for the DNA to pass through. [Section 9] Item 9. The flow cell device of item 8, wherein the solid support is functionalized with a surface polymer. [Section 10] Item 10. The flow cell device of item 9, wherein the surface polymer is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM) or silane-free acrylamide (SFA). [Section 11] 11. The flow cell device of any one of paragraphs 8 to 10, wherein the flow cell comprises a patterned surface. [Section 12] Item 12. The flow cell device of Item 11, wherein the patterned surface comprises wells. [Section 13] Item 13. The flow cell device of item 12, wherein the wells have a diameter of about 10 μm to about 50 μm, for example, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, or 50 μm, or a diameter within a range defined by any two of said values, and a depth of 0.5 μm to about 1 μm, for example, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, or 1 μm, or a depth within a range defined by any two of said values. [Section 14] Item 13. The flow cell device according to Item 11 or 12, wherein the wells are made of a hydrophobic material. [Section 15] 15. The flow cell apparatus of paragraph 14, wherein the hydrophobic material comprises an amorphous fluoropolymer such as CYTOP, Fluoropel®, or Teflon®. [Section 16] 16. The flow cell device of any one of paragraphs 8 to 15, wherein the degradable hydrogel is a hydrogel bead or a hydrogel layer. [Section 17] Item 17. The flow cell device of item 16, wherein the hydrogel beads have a diameter of about 50 μm to about 150 μm. [Section 18] Hydrogels have been developed using polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, and Item 18. The flow cell device of any one of items 8 to 17, comprising heparin, sulfated alginate, dextran sulfate, hyaluronic acid, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, ethoxylated pentaerythritol tetraacrylate, or a combination or mixture thereof. [Section 19] 20. The flow cell device of paragraph 18, wherein the hydrogel comprises PEG-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / PPO. [Section 20] 20. The flow cell device according to any one of paragraphs 8 to 19, wherein the DNA is a long DNA molecule of 50,000 base pairs or more. [Section 21] 21. The flow cell apparatus of any one of paragraphs 8 to 20, wherein the reactants comprise an enzyme, a compound, and a primer having a size of less than 50 base pairs. [Section 22] 22. The flow cell device of any one of paragraphs 8 to 21, wherein the reactants include lysozyme, proteinase K, random hexamers, polymerase (Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (Tn5), primers (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphates, buffer, or divalent cations. [Section 23] a stage configured to hold the flow cell device according to any one of clauses 8 to 22; Item 23. The flow cell device according to any one of items 8 to 22; and Detectors for acquiring sequencing data A system for DNA sequencing, comprising: [Section 24] Obtaining beads encapsulating DNA according to any one of paragraphs 1 to 7 or providing a flow cell device according to any one of paragraphs 8 to 23; Amplifying DNA encapsulated within the hydrogel; performing tagmentation on the DNA encapsulated within the hydrogel; and sequencing the DNA, thereby creating a DNA library encapsulated within the hydrogel; DNA sequencing. [Section 25] 25. The method of claim 24, wherein the DNA is a long DNA molecule of 50,000 base pairs or more. [Section 26] 26. The method according to item 24 or 25, further comprising performing a DNA amplification reaction on the DNA encapsulated in the hydrogel before performing tagmentation. [Section 27] 27. The method of claim 26, wherein the DNA amplification reaction comprises multiple displacement amplification (MDA). [Section 28] 28. The method of any one of paragraphs 24 to 27, wherein tagmentation comprises contacting the genetic material with a transposase mixture comprising adapter sequences and transposomes. [Section 29] 29. The method of any one of paragraphs 24 to 28, further comprising seeding the DNA library onto a solid support. [Section 30] 30. The method of claim 29, wherein the seeding comprises cleaving the hydrogel to release the DNA library from the hydrogel. [Section 31] 31. The method of claim 30, wherein the hydrogel is cleaved to release the DNA library by contacting the hydrogel with a cleavage enzyme mix or by heating the hydrogel to about 90°C. [Section 32] 32. The method of claim 31, wherein the cleavage enzyme mix comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP). [Section 33] 33. The method of any one of paragraphs 29 to 32, wherein the solid support is a flow cell device. [Brief explanation of the drawings]

[0007] [Figure 1A] FIG. 1A is a schematic diagram showing one embodiment of spatial indexing of long DNA by library generation and seeding on a flow cell. [Figure 1B] Figure 1B is a schematic diagram showing spatial indexing using hydrogel beads encapsulating long DNA molecules. Reactive agents can be applied to the hydrogel beads to spatially generate libraries on the flow cell surface. [Figure 2]FIG. 2 is a flow chart showing how long DNA can be encapsulated within hydrogel beads and libraries can be created within the hydrogel beads that can be clustered and sequenced on a flow cell device. [Figure 3] Figure 3 is a schematic diagram showing the workflow for DNA sequencing of long DNA encapsulated within hydrogel beads, including DNA fragments of approximately 100 kb (either without a multiple displacement amplification (MDA) step (panel (a)) or with an MDA step before tagmentation (panel (b))) and DNA fragments of approximately 10-20 kb (panel (c)). [Figure 4] FIG. 4 is a graph showing strobed reads of long DNA hydrogel spatial indexing sequencing data from a 100 kb DNA fragment that does not contain MDA. [Figure 5] Figure 5 shows a line graph of linked reads of long DNA hydrogel spatial indexing of a 100 kb DNA fragment containing MDA. [Figure 6] Figure 6 shows a line graph of long reads of a long DNA hydrogel spatial indexing of a 10 kb DNA fragment containing MDA.

[0008] [Figure 7] Figures 7A and 7B show line graphs of spatial reads of long DNA encapsulated within hydrogel beads. Figure 7A shows the spatial read of cells encapsulated within hydrogel beads, with the inset being a micrograph showing cells within the hydrogel beads. Figure 7B shows the spatial read of long DNA fragments encapsulated within hydrogel beads, with the inset being a micrograph showing the fragments encapsulated within the beads. [Figure 8] Figure 8 shows micrographs demonstrating the identification of microbial species encapsulated within hydrogel beads. Hydrogel beads encapsulated various microbial species, and spatial sequencing reads were performed to identify the microbial species. [Figure 9]FIG. 9 shows a graph depicting the distribution of barcode reads for long DNA encapsulated within hydrogel beads. [Figure 10] Figure 10A shows a graph showing short and long reads from a single run of E. coli cells encapsulated in hydrogel beads. As shown, the long reads span repeat regions, allowing for improved de novo sequence assembly. Figure 10B shows a micrograph showing spatial long reads and interstitial short reads. DETAILED DESCRIPTION OF THE INVENTION

[0009] Detailed Description In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like symbols generally refer to like components unless otherwise stated. The illustrative embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter described herein. It will be readily understood that the aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein.

[0010] Several embodiments relate to compositions, systems, and methods for encapsulating long DNA fragments in beads and determining the nucleotide sequence of the DNA fragments. This, as described below, creates a reliable, high-throughput method for sequencing relatively long DNA fragments. The methods and systems described herein relate to sequencing long DNA fragments encapsulated in single beads, enabling improved sequencing and identification of genomic DNA. In some embodiments, the method includes encapsulating a sample of DNA fragments in hydrogel beads, loading the hydrogel beads encapsulating the sample of DNA fragments onto a flow cell device, creating a library, releasing the created library onto the surface of the flow cell device, and clustering and sequencing the released library.

[0011] In some embodiments, library generation involves tagmentation of the encapsulated DNA. Tagmentation of the encapsulated DNA involves cutting long DNA sequences into short tagmentation fragments, which are then used to create DNA clusters on the surface of the flow cell. The clusters are the product of the long DNA tagmentation fragments, each of which can be sequenced, for example, using SBS sequencing. A group of clusters from a single long DNA molecule is referred to herein as a long DNA island. In some embodiments, a single hydrogel bead can encapsulate a single long DNA molecule or multiple long DNA molecules. Each long DNA molecule produces a single long DNA island. A cluster of all long DNA islands within a single hydrogel bead is referred to herein as a cluster cloud. Thus, a cluster cloud represents all clusters within a single hydrogel bead and may contain many long DNA islands (each of which represents a single long DNA molecule), with each long DNA island containing multiple clusters.

[0012] The beads may comprise a hydrogel polymer and a crosslinker that are mixed in the presence of long DNA molecules or a source containing long DNA molecules to form hydrogel beads encapsulating the DNA molecules. In some embodiments, the source of long DNA is a cell. The hydrogel beads may contain pores that retain the long DNA within the beads while allowing the diffusion of reactants from the hydrogel beads, thereby allowing reactions to occur within each bead.

[0013] Some embodiments include methods for performing nucleic acid reactions using beads encapsulating long DNA, e.g., methods involving high-throughput spatial indexing of long DNA molecules. As shown in Figure 1A, libraries from long DNA molecules can be readily prepared by clustering and seeding multiple clusters from a single long DNA molecule as "cluster patches" on a surface, which can then be read out and spatially mapped. As used herein, the term "long DNA" may include DNA fragments longer than 300 base pairs. As used herein, long DNA fragments refer to DNA fragments of 1 kb, 2.5 kb, 5 kb, or more in length, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 kb or more, including lengths within the range defined by any two of the above numbers.

[0014] Theory aside, the methods, systems, and compositions described herein offer several advantages over current library generation technologies. For example, in some embodiments, this method allows for sample preparation using a single bead, fragmenting a genomic sample into a series of long DNA fragments. The single bead can then be attached to a specific location on a flow cell, positioning each long DNA fragment adjacent to one another on the flow cell surface. The system then determines the nucleotide sequence from each long DNA fragment. Because they are adjacent to one another on the flow cell surface, the system can use this spatial location data to more efficiently reconstruct the final sequence of the original genomic DNA. The system can deposit spatially co-located reads directly from single cells, long DNA fragments, or chromosomes. In some embodiments, this method reduces input for library generation and enables a PCR-free procedure. In some embodiments, this method can be performed without the need for molecular barcoding. In some embodiments, this method allows for simplified automation of the procedure. In some embodiments, this method is compatible with a variety of nucleic acid assays and procedures.

[0015] In some embodiments, the hydrogel beads encapsulating long DNA fragments are used to prepare hydrogel beads that encapsulate long DNA fragments. In some embodiments, the hydrogel beads encapsulating long DNA fragments contain single cells, allowing for processing of cellular genomic DNA and for full-length DNA library construction within the beads.

[0016] In some embodiments, the pore size of the hydrogel beads can be engineered to retain long nucleic acids (>300 bps) while allowing the diffusion of enzymes, chemical compounds, and small primers (<50 bp), so that long DNA fragments and the resulting DNA libraries can be retained within the hydrogel beads during processing. In some embodiments, specific primers can be chemically linked within the hydrogel bead matrix to hybridize and process specific genomic DNA. The DNA library from a single cell can then be released into a specific region, for example, onto the surface of a flow cell for library seeding. This then results in a spatial distribution of "DNA clusters" on the flow cell derived from the encapsulated long DNA fragments, simplifying read alignment during downstream processing.

[0017] As used herein, the term "reactant" describes a reactant or a mixture of two or more reactants useful for reacting, interacting, diluting, or adding to a sample, and can include, for example, reactants used in nucleic acid reactions, including buffers, compounds, enzymes, polymerases, primers less than 50 base pairs in size, template nucleic acids, nucleotides, labels, dyes, or nucleases. In some embodiments, the reactants include lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0018] Hydrogel beads encapsulating genetic material One embodiment includes beads comprising a hydrogel polymer and genetic material. As used herein, the term "hydrogel" refers to a material formed when organic polymers (natural or synthetic) are crosslinked by covalent, ionic, or hydrogen bonds to form a three-dimensional open lattice structure that traps water molecules to form a gel. In some embodiments, the hydrogel can be a biocompatible hydrogel. As used herein, the term "biocompatible hydrogel" refers to a polymer that forms a gel that is not toxic to living cells and allows sufficient diffusion of oxygen and nutrients to the trapped cells to maintain their viability. In some embodiments, the hydrogel polymer comprises 60-90% liquid, e.g., water, and 10-30% polymer. In some embodiments, the water content of the hydrogel is about 70-80%.

[0019] Hydrogels can be prepared by crosslinking hydrophilic biopolymers or synthetic polymers. Thus, in some embodiments, hydrogels may include a crosslinker. As used herein, the term "crosslinker" refers to a molecule that can form a three-dimensional network when reacted with an appropriate base monomer. Examples of hydrogel polymers that may include one or more crosslinkers include hyaluronic acid, chitosan, agar, heparin, sulfate, cellulose, alginate (sulfated alginate), and the like. sulfate), collagen, dextran (including dextran sulfate), pectin, carrageenan, polylysine, gelatin (including gelatin type A), agarose, (meth)acrylate-oligolactide-PEO-oligolactide-(meth)acrylate, PEO-PPO-PEO copolymer (Pluronics), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymer, poly(ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N Examples of suitable polymeric polymers include, but are not limited to, '-bis(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or a combination thereof.Thus, for example, a combination can include a polymer and a cross-linking agent, such as polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO).

[0020] In some embodiments, the crosslinker forms disulfide bonds in the hydrogel polymers, thereby connecting the hydrogel polymers. In some embodiments, the hydrogel polymers form a hydrogel matrix with pores (e.g., a porous hydrogel matrix). These pores can retain large enough genetic material, such as long DNA fragments, within the hydrogel beads, while allowing small materials, such as reagents, to pass through the pores, thereby allowing them to enter and exit the hydrogel beads. In some embodiments, the pores are fine-tuned by varying the ratio of the polymer concentration to the crosslinker concentration. In some embodiments, the ratio of polymer to crosslinker is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, or 1:30, or a ratio within a range defined by any two of the above ratios. In some embodiments, additional functional materials, such as DNA primers or charged chemicals, can be grafted onto the polymer matrix to meet the needs of various applications.

[0021] As used herein, the term "porosity" refers to the fractional volume (dimension-less) of a hydrogel that is composed of open space, e.g., open pores or other openings. Porosity therefore measures the void space within a material and is the ratio of void volume to total volume as a percentage between 0 and 100% (or between 0 and 1). The porosity of a hydrogel can be in the range of 0.5 to 0.99, in the range of about 0.75 to about 0.99, or in the range of about 0.8 to about 0.95.

[0022] The hydrogel can have any pore size. As used herein, the term "pore size" refers to the cross-sectional diameter or effective diameter of a pore. The term "pore size" can also refer to the average cross-sectional diameter or average effective diameter of a pore based on measurements of multiple pores. The effective diameter of a non-circular cross-section is equal to the diameter of a circular cross-section having the same cross-sectional area as the non-circular cross-section. In some embodiments, the hydrogel can swell when hydrated. The size of the pores can then change depending on the water content of the hydrogel. In some embodiments, the pores of the hydrogel can be of a size sufficient to retain genetic material within the hydrogel but allow reactants to pass through.

[0023] In some embodiments, the crosslinker is a reversible crosslinker. In some embodiments, the reversible crosslinker can reversibly crosslink hydrogel polymers and cleave the crosslinks in the presence of a cleaver. In some embodiments, the crosslinker can be cleaved in the presence of a reducing agent, by high temperature, or by an electric field. In some embodiments, the reversible crosslinker can be N,N'-bis(acryloyl)cystamine, a reversible crosslinker for polyacrylamide gels, whose disulfide bonds can be broken in the presence of an appropriate reducing agent. In some embodiments, contacting the crosslinker with a reducing agent cleaves the disulfide bonds of the crosslinker and degrades the hydrogel beads. The hydrogel beads degrade, releasing their contents, such as nucleic acids, held therein. In some embodiments, the crosslinker is cleaved by increasing the temperature to above 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C. In some embodiments, the crosslinker is cleaved by contacting the hydrogel beads with a reducing agent. In certain embodiments, the reducing agent includes phosphine compounds, water-soluble phosphines, nitrogen-containing phophines and their salts and derivatives, dithioerythritol (DTE), dithiothreitol (DTT) (cis and trans isomers, respectively, of 2,3-dihydroxy-1,4-dithiolbutane), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolic acid or thioglycolic acid, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP), or P-[tris(hydroxymethyl)phosphine]propionic acid (THPP).

[0024] In some embodiments, the encapsulated genetic material is released from the hydrogel beads by increasing the temperature to increase diffusion or by contact with a reducing agent that decomposes the crosslinker.

[0025] In some embodiments, crosslinking of the crosslinker establishes multiple pores within the hydrogel beads. In some embodiments, the size of the pores in the hydrogel beads is adjustable to encapsulate genetic material, e.g., DNA fragments of about 5,000 base pairs or more, but allow smaller particles, e.g., reactive agents, or small nucleic acids of less than about 50 base pairs, e.g., primers, to pass through the pores (shown in FIG. 1B). In some embodiments, the reactive agents include agents for processing genetic material, e.g., agents for isolating nucleic acids from cells, agents for amplifying, barcoding, or sequencing nucleic acids, or agents for producing nucleic acid libraries. In some embodiments, the reactive agents include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0026] In some embodiments, the long DNA comprises genomic DNA, viral nucleic acid, bacterial nucleic acid, or mammalian nucleic acid. In some embodiments, the hydrogel beads comprise a source of the long DNA, e.g., a cell. In some embodiments, the cell is a single cell, including a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a bacterial cell. Thus, as shown in Figures 7A and 7B, this method may be performed on a long DNA fragment or a cell, either or both of which are encapsulated in a hydrogel bead.

[0027] How to make beads Some embodiments provided herein relate to methods for producing beads encapsulating long DNA fragments. In some embodiments, the hydrogel beads are prepared by vortex emulsion. As used herein, vortex emulsion refers to vortexing a hydrogel polymer with long DNA fragments or a source of long DNA fragments in a container such as a tube, vial, or reaction vessel. The components can be mixed, for example, by manual or mechanical vortexing or shaking. In some embodiments, manual mixing results in hydrogel beads encapsulating genetic material having a diameter of 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a size range defined by any two of these values. In some embodiments, the beads are non-uniform in size, and therefore include beads of various diameters.

[0028] In some embodiments, the beads are prepared by microfluidic droplet formation. As shown in FIG. 1B, microfluidic droplet generation includes the use of a microfluidic device to assist in gel emulsion generation. In some embodiments, the microfluidic device includes microchannels configured to form hydrogel beads of a desired size and encapsulate a selected amount of genetic material per bead. In some embodiments, the microfluidic device has a height of 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a height within a range defined by any two of said values. In some embodiments, the microfluidic device includes one or more channels. In some embodiments, the microfluidic device includes a channel for aqueous solution flow and a channel for immiscible fluid flow. In some embodiments, the width of one or more channels is the same. In some embodiments, the width of one or more channels is different. In some embodiments, the width of one or more channels is 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 μm, or within a range defined by any two of these values. In some embodiments, the width of the aqueous solution channel is 75 μm. In some embodiments, the width of the immiscible fluid channel is 78 μm. Those skilled in the art will recognize that the width can be varied to fine-tune the size of the beads. In addition to the size of the microfluidic device and the width of the channels, the flow rate of the aqueous solution channel and the immiscible fluid channel can also affect the size of the hydrogel beads.

[0029] In some embodiments, the flow rate of the solution in the aqueous channel is 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 μL / min, or a flow rate within a range defined by any two of the foregoing values. In some embodiments, the flow rate of the immiscible fluid in the immiscible fluid channel is 20, 30, 50, 80, 100, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, or 400 μL / min, or a flow rate within a range defined by any two of the foregoing values. In some embodiments, the solution in the aqueous phase contains a hydrogel polymer, a crosslinker, and a genetic material, and flows through an aqueous channel into an immiscible fluid, such as a carrier oil, at a flow rate slower than the flow rate of the immiscible fluid, thereby forming droplets. In some embodiments, the immiscible fluid is an oil, such as mineral oil, hydrocarbon oil, silicone oil, or polydimethylsiloxane oil, or a mixture thereof. In some embodiments, the hydrogel droplets containing the genetic material are formulated with a uniform size distribution. In some embodiments, the size of the hydrogel beads is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate of either or both of the aqueous solution and the immiscible fluid. In some embodiments, the resulting hydrogel beads have a diameter in the range of 2 to 150 μm, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or within a range defined by any two of the foregoing values.

[0030] In certain embodiments, the size and uniformity of the hydrogel beads encapsulating the genetic material can be further controlled by contacting the hydrogel polymer with a fluid modifier, such as an alcohol, including isopropyl alcohol, prior to bead formation.

[0031] In some embodiments, the amount of long DNA fragments encapsulated within the beads can be controlled by diluting or concentrating the long DNA fragments in the input sample. The sample containing the long DNA fragments is mixed with a hydrogel polymer, and the hydrogel polymer containing the long DNA fragments is subjected to vortex emulsion or microfluidic droplet generation as described herein.

[0032] In some embodiments, the hydrogel beads are functionalized with nucleotides. In some embodiments, the nucleotides are oligonucleotides or poly-T nucleotides. In some embodiments, the nucleotides are bound to the hydrogel beads, and the functionalized beads can be used for targeted capture of the nucleotides of interest.

[0033] Method for processing long DNA fragments within hydrogel beads Some embodiments include methods for processing long DNA fragments within beads, as shown in FIG. 2, which illustrates a flow diagram for preparing and processing long DNA molecules in hydrogel beads. In the first step, a DNA sample, e.g., from genomic data or cells, is encapsulated within the hydrogel beads. In some embodiments, the long DNA fragments are retained within the hydrogel beads, allowing reactants to pass through the pores of the hydrogel beads. In some embodiments, the reactants may include lysis agents, nucleic acid purification agents, tagmentation agents, PCR reactants, or other reactants used in processing genetic material. Thus, the hydrogel beads provide a microenvironment for controlled reaction of the long DNA fragments within the hydrogel beads, retaining the long DNA fragments within the beads while providing a barrier for reactants to pass in and out of the hydrogel beads. Once the DNA is encapsulated within the beads, the process proceeds to the next stage, where the sample is loaded into a flow cell to generate long DNA fragments in a library creation process.

[0034] As used herein, the term "tagmentation" refers to the modification of DNA by a transposome containing a transposase enzyme linked to an adapter containing a transposon end sequence. Tagmentation results in the simultaneous fragmentation of the DNA and the ligation of adapters to the 5' ends of both strands of the double-stranded fragment. After a purification step to remove the transposase enzyme, additional sequences can be added to the ends of the compatible fragments by, for example, PCR, ligation, or any other suitable method known to those skilled in the art.

[0035] In some embodiments, the entire DNA library generation can be seamlessly performed inside hydrogel beads coupled to a flow cell, with multiple reactant exchanges, by passing the hydrogel through its porous media while retaining the gDNA and its library products within the hydrogel matrix. The hydrogel can withstand temperatures up to 95°C for several hours to support various biochemical reactions.

[0036] The next step in the process involves treating the hydrogel beads encapsulating the long DNA fragments from the library production to release, purify, and separate the long DNA fragments from the beads. Thus, for example, the hydrogel beads are contacted with a lysis buffer. As used herein, "lysis" refers to the perturbation or alteration of cell walls or viral particles that facilitates access to or release of cellular RNA or DNA. Complete destruction or degradation of the cell wall is not essential for lysis. The term "lysis buffer" refers to a buffer containing at least one lysis agent. Common enzymatic lysis agents include, but are not limited to, lysozyme, glucurase, zymolose, lyticase, proteinase K, proteinase E, and viral endolysins and exolysins. Thus, for example, lysis of cells in beads can be achieved by introducing lysis agents such as lysozyme and proteinase K into the hydrogel beads. Here, gDNA from the cells is contained within the beads. In some embodiments, after the lysis process, the isolated nucleic acids are retained within the hydrogel beads and can be used for further processing.

[0037] As used herein, the terms "isolated," "to isolate," "isolation," "purified," "to purify," "purification," and grammatical equivalents, unless otherwise specified, refer to the reduction of the amount of at least one contaminant (e.g., a protein and / or nucleic acid sequence) from a sample or source (e.g., a cell) from which the material is isolated. Purification therefore results in "enrichment," e.g., an increase in the amount of a desired protein and / or nucleic acid sequence in a sample.

[0038] In some embodiments, the encapsulated nucleic acid is fully or partially sequenced within the hydrogel bead. The encapsulated nucleic acid can be sequenced by any suitable sequencing method, for example, direct sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, nanopore sequencing, etc.

[0039] Some embodiments provided herein relate to sequencing-by-synthesis (SBS) methods that are effective for long DNA fragments. In SBS, the extension of a nucleic acid primer along a nucleic acid template (e.g., a target nucleic acid or its amplicon) is monitored to determine the sequence of nucleotides within the template. The underlying chemical process can be polymerization (e.g., catalyzed by a polymerase enzyme). In certain polymerase-based SBS embodiments, fluorescently labeled nucleotides are added to the primer (thereby extending the primer) in a template-dependent manner, such that detection of the order and type of nucleotides added to the primer can be used to determine the sequence of the template.

[0040] One or more amplified encapsulated nucleic acids can be subjected to SBS or other detection techniques involving repeated delivery of reactants in cycles. For example, to initiate the first SBS cycle, one or more labeled nucleotides, DNA polymerase, etc. can be flowed through or onto hydrogel beads containing one or more amplified nucleic acid molecules. The site at which the labeled nucleotide is incorporated by primer extension can be detected. Optionally, the nucleotide can further contain a reversible termination feature that terminates further primer extension once the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator moiety can be added to the primer so that subsequent extension does not occur until a deblocking agent is delivered to remove the moiety. Thus, in embodiments using reversible termination, a deblocking agent can be delivered to the flow cell (before and after detection). Washing can be performed between various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS methods, fluidic systems, and detection platforms that can be readily adapted for use with amplicons generated by the methods of the present invention are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO04 / 018497; U.S. Patent No. 7,057,026; WO91 / 06678; WO07 / 123744; U.S. Patent No. 7,329,492; U.S. Patent No. 7,211,414; U.S. Patent No. 7,315,019; U.S. Patent No. 7,405,281, and US2008 / 0108082, each of which is incorporated herein by reference.

[0041] Other sequencing methods using cyclic reactions can be used, such as pyrosequencing, which detects the release of inorganic pyrophosphate (PPi) as specific nucleotides are incorporated into nascent nucleic acid chains (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al. Science 281(5375), 363 (1998); U.S. Patent No. 6,210,891; U.S. Patent No. 6,258,568 and U.S. Patent No. 6,274,320, each of which is incorporated herein by reference). In pyrosequencing, the released PPi can be detected by its immediate conversion to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of purified ATP can be detected by the photons generated by luciferase. Therefore, the sequencing reaction can be monitored by a luminescence detection system. The excitation radiation source used in fluorescence-based detection systems is not required for pyrosequencing. Useful fluid systems, detectors, and procedures that can be adapted to the application of pyrosequencing to amplicons generated according to the present disclosure are described, for example, in WIPO Patent Application No. PCT / US11 / 57111, US 2005 / 0191698 A1, U.S. Patent No. 7,595,883, and U.S. Patent No. 7,244,559 (each of which is incorporated herein by reference).

[0042] Some embodiments may be useful in methods involving real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation can be detected by fluorescence resonance energy transfer (FRET) interaction between a polymerase carrying a fluorophore and a γ-phosphate-labeled nucleotide, or by using zero mode waveguides (ZMW). Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008) (the disclosures of which are incorporated herein by reference).

[0043] Some SBS embodiments include the detection of protons released during the incorporation of nucleotides into extension products. For example, sequencing based on the detection of released protons can use commercially available electrical detectors and related technologies. Examples of such sequencing systems include pyrosequencing (e.g., a platform available from 454 Life Sciences, a subsidiary of Roche), sequencing using γ-phosphate-labeled nucleotides (e.g., a platform available from Pacific Biosciences), and sequencing using proton detection (e.g., a platform available from Ion Torrent, a subsidiary of Life Technologies), or the sequencing methods and systems described in US 2009 / 0026082 A1; US ​​2009 / 0127589 A1; US ​​2010 / 0137143 A1; or US 2010 / 0282617 A1 (each of which is incorporated herein by reference). The methods described herein for amplifying target nucleic acids using kinetic exclusion can be readily applied to substrates used for proton detection. More specifically, the methods described herein can be used to generate clonal populations of amplicons used for proton detection.

[0044] Another sequencing technique is nanopore sequencing (see, e.g., Deamer et al. Trends Biotechnol. 18, 147-151 (2000); Deamer et al. Acc. Chem. Res. 35:817-825 (2002); Li et al. Nat. Mater. 2:611-615 (2003), the disclosures of which are incorporated herein by reference). In some nanopore embodiments, the target nucleic acid or individual nucleotides removed from the target nucleic acid pass through the nanopore. As nucleic acids or nucleotides pass through the nanopore, each nucleotide type can be identified by measuring the fluctuations in the electrical conductance of the pore (U.S. Pat. No. 7,001,792; Soni et al. Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2, 459-481 (2007); Cockroft et al. J. Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference).

[0045] Exemplary methods of array-based expression and genotyping analysis that can be applied to the detection described herein are described in U.S. Patent Nos. 7,582,420; 6,890,741; 6,913,884 or 6,355,431 or U.S. Patent Application Nos. 2005 / 0053980 A1; 2009 / 0186349 A1 or US 2005 / 0181440 A1, each of which is incorporated herein by reference.

[0046] In the methods for isolating, amplifying, and sequencing nucleic acids described herein, various reagents are used for nucleic acid isolation and purification. Such reagents may include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations. These reagents pass through the pores of the hydrogel beads, while the genetic material is retained within the hydrogel beads. An advantage of the methods described herein is that they provide an encapsulated microenvironment for nucleic acid processing within the hydrogel beads. This allows for rapid and efficient single-cell processing of target nucleic acids.

[0047] The adapter may include a sequencing primer site, an amplification primer site, and multiple index sequences. As used herein, an "index sequence" may include a nucleotide sequence that can be used to tag a nucleic acid as a molecular identifier and / or barcode and / or to identify the source of the nucleic acid. In some embodiments, the index sequence can be used to identify a single nucleic acid or a subpopulation of nucleic acids. In some embodiments, a nucleic acid library can be prepared within hydrogel beads. In some embodiments, single cells encapsulated within hydrogel beads can be used for combinatorial indexing of single cells, for example, using the continuous sequence of conserved transpositions (CPTSeq) method. In some embodiments, DNA from a single cell can be barcoded by encapsulating multiple single cells after WGA amplification with another bead carrying a barcoded transposon, which is then contacted with a reducing agent to dissolve the gel matrix, releasing the genomic DNA for barcoding, for example.

[0048] Embodiments of the "spatial indexing" methods and techniques described herein shorten data analysis and simplify the process of creating libraries from multiple single cells and long DNA molecules. Existing protocols for single-cell sequencing require efficient physical separation of cells, uniquely barcoding each isolated cell, and pooling and sequencing all of them together. Current methods for synthesized long reads also require a complex barcoding step, pooling and sequencing each barcoded fragment, and data analysis must allow for differentiation of genetic information from each barcoded cell. During these lengthy processes, genetic material is lost, resulting in sequence dropouts. Embodiments described herein not only shorten the process but also provide improved data resolution for multiple single cells. Furthermore, embodiments described herein simplify the assembly of genomes of new organisms. Embodiments described herein can be used to reveal the co-occurrence of rare genetic variations and mutations. In some embodiments, DNA libraries entrapped in hydrogel beads until release offer the opportunity to control the size of the fragments released onto the surface by controlling the release process and hydrogel fabrication.

[0049] In some embodiments, the surface is a flow cell device. In some embodiments, the flow cell is a custom flow cell device having wells, grooves, or patterns. In some embodiments, the flow cell comprises a patterned surface. In some embodiments, the patterned surface comprises a well. In some embodiments, the well has a diameter of about 10 μm to about 50 μm, e.g., 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, or 50 μm, or a diameter within a range defined by any two of the above values, and a depth of about 0.5 μm to about 1 μm, e.g., 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, or 1 μm, or a depth within a range defined by any two of the above values. In some embodiments, the well is made of a hydrophobic material. In some embodiments, the hydrophobic material includes an amorphous fluoropolymer, such as CYTOP, Fluoropel®, or Teflon®.

[0050] In some embodiments, the library can be amplified using the primer sites in the adapter sequence and sequenced using the sequencing primer sites in the adapter sequence. In some embodiments, the adapter sequence can include an indicator to identify the source of the nucleic acid. The efficiency of subsequent amplification steps can be reduced by the formation of primer dimers. To increase the efficiency of subsequent amplification steps, unligated single-stranded adapters can be removed from the ligation product.

[0051] Preparation of nucleic acid libraries using hydrogel beads Some embodiments of the systems, methods, and compositions described herein include methods in which an adapter is linked to a target nucleic acid. The adapter can include a sequencing primer binding site, an amplification primer binding site, and an index. For example, the adapter can include a P5 sequence, a P7 sequence, or their complements. As used herein, the P5 sequence includes the sequence defined by SEQ ID NO: 1 (AATGATACGGCGACCACCGA), and the P7 sequence includes the sequence defined by SEQ ID NO: 2 (CAAGCAGAAGACGGCATACGA). In some embodiments, the P5 or P7 sequence can further include a spacer polynucleotide, which is about 1 to 20 nucleotides in length, e.g., 1 to 15, or 1 to 10 nucleotides in length, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, e.g., a 10T spacer. The spacer nucleotide can be included at the 5' end of the polynucleotide, which can be attached to a suitable support by binding to the 5' end of the polynucleotide. The attachment can be achieved by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the polynucleotide can include a poly-T spacer and a 5' phosphorothioate group. Thus, in some embodiments, the P5 sequence is 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3', and in some embodiments, the P7 sequence is 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3'.

[0052] The index can be useful for identifying the source of the nucleic acid molecule. In some embodiments, the adapter can be modified to prevent the formation of concatemers, for example, by adding a blocking group at one or both ends that prevents the extension of the adapter. Examples of 3'-blocking groups include 3'-spacer C3, dideoxynucleotides, and attachment groups to the substrate. Examples of 5'-blocking groups include dephosphorylated 5'-nucleotides and attachment groups to the substrate.

[0053] Adapters can include nucleic acids, such as single-stranded nucleic acids. Adapters can be short nucleic acids with lengths less than, greater than, or equal to about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, or within any two of the above defined ranges. In some embodiments, the adapters are small enough to pass through the pores of the hydrogel beads. Target nucleic acids can include DNA, such as genomic or cDNA; RNA, such as mRNA, sRNA, or rRNA; or hybrids of DNA and RNA. Nucleic acids can be isolated from single cells encapsulated within hydrogel beads. Nucleic acids can contain phosphodiester linkages or other types of backbones, including phosphoramide, phosphorothioate, phosphorodithioate, O-methylphosphoramidite, and peptide nucleic acid backbones and linkages. Nucleic acids may contain any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthanine, hypoxanthanine, isocytosine, isoguanine, and base analogs such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In certain embodiments, nucleic acids may contain at least one promiscuous base. A promiscuous base can base pair with two or more different types of bases and may be useful, for example, when included in an oligonucleotide primer or insert used for random hybridization in a complex nucleic acid sample, such as a genomic DNA sample. Examples of promiscuous bases include inosine, which can pair with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyl 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. A non-specific base that can form base pairs with at least two, three, four or more types of bases can be used.

[0054] An example method includes dephosphorylating the 5' end of the target nucleic acid to prevent the formation of concatemers in a subsequent ligation step; ligating a first adaptor to the 3' end of the dephosphorylated target using a ligase, wherein the 3' end of the first adaptor is blocked; rephosphorylating the 5' end of the ligated target; and ligating a second adaptor to the 5' end of the dephosphorylated target using a single-stranded ligase, wherein the 5' end of the second adaptor is not phosphorylated.

[0055] Another example is partially digesting a nucleic acid with a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. An adaptor containing a 3' blocking group can be ligated to the 3' end of the double-stranded nucleic acid with the 3' overhang. The double-stranded nucleic acid with the ligated adaptor and the 3' overhang can be dehybridized to form a single-stranded nucleic acid. An adaptor containing an unphosphorylated 5' end can be ligated to the 5' end of the single-stranded nucleic acid.

[0056] Methods for dephosphorylating nucleic acids, such as the 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a phosphatase, such as calf intestinal phosphatase, shrimp alkaline phosphatase, antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).

[0057] Methods for ligating nucleic acids include contacting the nucleic acids with a ligase, such as T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRCLIGASE).

[0058] Methods for phosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a kinase. An example of a kinase is T4 polynucleotide kinase.

[0059] Embodiments described herein relate to the creation of nucleic acid libraries in hydrogel beads such that the libraries are prepared in a single reaction volume.

[0060] Embodiments of the systems and methods described herein include kits that include any one or more of a hydrogel polymer, a crosslinker, or a microfluidic device for producing hydrogel beads that encapsulate genetic material, and further include components useful for processing genetic material, including reagents for cell lysis and nucleic acid amplification and sequencing, or reagents for nucleic acid library generation, including lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations, as described herein and used in the respective processing of the genetic material. [Example]

[0061] Example Example 1 - Preparation of Hydrogel Beads This example demonstrates one embodiment of using a microfluidic droplet generator to prepare hydrogel beads encapsulating long DNA fragments.

[0062] Hydrogel beads were produced using a droplet generator. A sample containing long DNA fragments was mixed with a polymer precursor, and the mixture was loaded into the sample reservoir on the cartridge. Within 2 minutes, approximately 50,000 hydrogel beads containing long DNA were generated from each channel (each cartridge processes eight channels for eight independent samples). The long DNA hydrogel beads were loaded onto a flow cell, where they were fixed inside for hands-free library generation (100 μm-high channels and 120 μm-diameter hydrogel beads). Nextera enzymes and reagents were contacted with the flow cell, contacting the long DNA embedded within the hydrogel beads to form a library. The library was then seeded onto the flow cell. During library seeding, oil was added to fill the gaps between the beads, and the flow cell was heated to promote library diffusion. In the presence of oil, seeding occurred close to the footprint of each hydrogel bead (for hydrogel beads up to 120 μm in diameter, library seeding was confined to an area of ​​approximately 120 μm in diameter).

[0063] Long DNA molecules were loaded and captured in hydrogel beads (approximately 120 μm in diameter), and library construction was performed directly on these long DNA molecules embedded inside the hydrogel beads. As a result, all DNA libraries from a particular long DNA molecule were retained within the same hydrogel bead. The libraries were then released from the hydrogel beads onto the surface of a flow cell, where they were seeded as a group on the surface of the flow cell. Clusters were released from the long DNA molecules grouped together as "cluster patches" on the flow cell. Clusters containing a single patch from a single long DNA molecule within them facilitate genome reconstruction with high accuracy and fewer scaffolding gaps.

[0064] Example 2 - Long DNA Spatial Index This example demonstrates one embodiment of strobe reading of a 100 kb long DNA fragment encapsulated within hydrogel beads with or without MDA.

[0065] Hydrogel beads were prepared by mixing polymers in the presence of approximately 100 kb of Corriell genomic DNA and forming hydrogel beads using a microdroplet generator. The formed hydrogel beads encapsulating the DNA fragments were placed on a flow cell device, and spatially indexed sequencing of the DNA was performed by contacting the flow cell with reagents. The beads were disassembled and clusters were formed on the flow cell device. As shown in Figure 5, the average clusters per long DNA island were approximately 33, the average long DNA island size was 64,000 base pairs, and there were approximately 405 long DNA islands per bead.

[0066] A second set of hydrogel beads was prepared by mixing polymers in the presence of approximately 100 kb of Corriell genomic DNA and forming hydrogel beads using a microdroplet generator. The formed hydrogel beads encapsulating the DNA fragments were placed on a flow cell device, and spatially indexed sequencing of the DNA was performed by contacting the flow cell with reagents. MDA was performed before tagmentation. The beads were disassembled and clustered on the flow cell device. As shown in Figure 6, the average clusters per long DNA island increased to approximately 85, the average long DNA island size was 58,000 base pairs, and there were approximately 166 long DNA islands per bead.

[0067] A third set of hydrogel beads was prepared by mixing polymers in the presence of approximately 10 kb of Corriell genomic DNA and forming hydrogel beads using a microdroplet generator. Spatial index sequencing was performed by placing the formed hydrogel beads encapsulating DNA fragments on a flow cell device and contacting the flow cell with reagents. MDA was performed before tagmentation. The beads were disassembled and clustered on the flow cell device. As shown in Figure 7, there were approximately 57 clusters per long DNA island, the average long DNA island size was 10,461 base pairs, and approximately 85 long DNA islands per bead.

[0068] Example 3 - Metagenomics in a complex mixture of microbial species This example demonstrates one embodiment of identifying single-cell microorganisms encapsulated within a hydrogel.

[0069] Hydrogel beads were prepared using a microdroplet generator as described herein. The polymeric material was mixed with a sample containing multiple microorganisms, including L. gasseri, Staphylococcus aureus, Bacillus cereus, Bacteroides spp., Acinetobacter baumannii, Group A Streptococcus, and Propionibacterium acnes. The encapsulated cells were then lysed and subjected to library generation, which resulted in the degradation of the hydrogel beads and the deposition of the library on the surface. As shown in Figure 9, each microorganism could be identified by its spatial compartmentalization on the flow cell device. Thus, the encapsulation reaction and subsequent nucleic acid reaction enable strain-level identification of microbial species in complex mixtures using lead compartmentalization in mini-metagenomic assays.

[0070] Example 4 - Flow Cell Spatial Indexing This example demonstrates one aspect of spatial indexing on a flow cell.

[0071] The flow cell device was obtained and washed with 200 μl of PR2. The beads for processing were also washed with PR2. Diluted hydrogels were prepared in PR2. Increasing dilution increased the spacing between the hydrogels. The hydrogels were embedded on the flow cell to avoid introducing air bubbles into the flow cell. 200 μl of PR2 was flowed through the flow cell, allowing the process to be carried out while the beads remained immobilized. 100 μl of RSB was flowed through the flow cell.

[0072] The tagmentation mix was prepared by mixing 25 μl of tagmentation reagent, 23 μl of RSB, and 2 μl of enzyme. The tagmentation mix was introduced into a narrow channel to eliminate the possibility of air bubbles in the inlet. The tagmentation mix was then slowly poured into the inlet. The flow cell was sealed and incubated at 55°C for 10 minutes.

[0073] A reaction stop buffer mix was prepared by mixing 25 μl of tagmentation buffer, 25 μl of RSB, and 10 μl of stop buffer. The stop buffer mix was slowly poured onto the flow cell without generating bubbles and incubated at room temperature for 5 minutes. After incubation, 200 μl of PR2 was poured into the device.

[0074] NPM was prepared by mixing 175 μl of RSB and 75 μl of NPM. The NPM mix was slowly poured onto the flow cell device without creating bubbles and incubated at room temperature for 3 minutes. 200 μl of surfactant-containing oil was then poured into the flow cell device. Micrographs revealed that the hydrogel was surrounded by the NPM mix and oil. The flow cell was sealed and incubated at 72°C for 3 minutes for the gap-filling reaction.

[0075] 20-30 μl of surfactant-containing oil and DTT-containing oil (29 / 2 ratio) were flowed into the flow cell device, and the device was sealed. The initial temperature release process was 90°C for 3 minutes, 60°C for 5 minutes, 40°C for 2 minutes, and 20°C for 2 minutes. The flow cell was washed with 400 μl of PR2 and 200 μl of CLM. The flow cell was then washed with 400 μl of PR2. Here, phix seeding was desired, and Phix was prepared at a concentration of 2-3 pM. The phix library was flowed onto the device and incubated at room temperature for 5 minutes. The flow cell was washed with 200 μl of PR2. 100-200 μl of AMX was flowed for the first extension and incubated at 50°C for 5 minutes. The flow cell was washed with PR2, and 24 or 30 cycles of amplification were performed.

[0076] The embodiments, examples, and figures described herein provide compositions, methods, and systems for storing genetic material in a physically confined space during the process from lysis to library creation. Some embodiments provide libraries derived from single long DNA molecules or single cells when released onto the surface of a flow cell within a confined space. Once libraries from single DNA molecules or single cells in individual compartments are released onto the surface of the flow cell, the libraries from each compartment are seeded in close proximity to each other.

[0077] As used herein, the term "comprising" has a meaning similar to "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0078] This specification discloses several methods and materials of the present invention. The invention is susceptible to modifications in the methods and materials, and to changes in the manufacturing methods and equipment. Such modifications will be apparent to those skilled in the art from consideration of the detailed description or practice of the invention set forth herein. Therefore, it is not intended that the present invention be limited to the particular embodiments described herein, but rather, it is intended to cover all modifications and alterations within the true scope and spirit of the invention.

[0079] All documents cited herein, including, but not limited to, published and unpublished patent applications, patents, and references, are incorporated herein by reference in their entirety and are hereby made a part of this specification. In the event that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, the present specification supersedes and / or is intended to supersede such conflicting material.

Claims

1. a hydrogel polymer that is polyacrylamide; a reversible polymeric cross-linker N,N'-bis(acryloyl)cystamine (BACy) that is cleaved in the presence of a reducing agent; and DNA of 300 base pairs or more in length placed within hydrogel beads 1. A hydrogel bead for performing nucleic acid reactions comprising: a hydrogel bead; wherein the bead comprises pores that allow diffusion of reactants through the bead while retaining DNA.

2. 10. The bead of claim 1 having a diameter of 50 μm to 150 μm.

3. 3. The bead according to claim 1, wherein the DNA is a long DNA molecule of 50,000 base pairs or more.

4. 4. The bead of claim 1, wherein the reactive agents comprise an enzyme, a compound, and a primer having a size of less than 50 base pairs.

5. The bead of any one of claims 1 to 4, wherein the reactive agent comprises lysozyme, proteinase K, random hexamers, polymerase, transposase, primers having a size of less than 50 base pairs, ligase, catalytic enzyme, deoxynucleotide triphosphates, buffer, or divalent cations.

6. 6. Beads according to any one of claims 1 to 5, wherein the reducing agent is dithioerythritol (DTE), dithiothreitol (DTT), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol, glutathione, thioglycolic acid, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP) or P-[tris(hydroxymethyl)phosphine]propionic acid (THPP).

7. 10. A flow cell device for performing DNA sequencing, comprising a solid support comprising a surface having degradable hydrogel beads according to any one of claims 1 to 6 encapsulating DNA disposed thereon, wherein the degradable hydrogel beads contain pores of a size that allows diffusion of reactants from the hydrogel but is too small for the DNA to pass through.

8. 8. The flow cell device of claim 7, wherein the solid support is functionalized with a surface polymer.

9. 9. The flow cell device of claim 8, wherein the surface polymer is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM) or silane-free acrylamide (SFA).

10. 10. The flow cell device of claim 7, wherein the flow cell comprises a patterned surface.

11. The flow cell device of claim 10 , wherein the patterned surface comprises wells.

12. 12. The flow cell device of claim 11, wherein the wells have a diameter of about 10 μm to about 50 μm, e.g., 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, or 50 μm, or a diameter within a range defined by any two of said values, and a depth of 0.5 μm to about 1 μm, e.g., 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, or 1 μm, or a depth within a range defined by any two of said values.

13. 13. A flow cell device according to claim 11 or 12, wherein the wells are made of a hydrophobic material.

14. The hydrophobic material is CYTOP, Fluoropel （登録商標） , or Teflon （登録商標） 14. The flow cell device of claim 13, comprising an amorphous fluoropolymer such as

15. 15. A flow cell device according to any one of claims 7 to 14, wherein the hydrogel beads have a diameter of 50 μm to 150 μm.

16. 16. A flow cell device according to any one of claims 7 to 15, wherein the DNA is a long DNA molecule of 50,000 base pairs or more.

17. 17. The flow cell device of claim 7, wherein the reactants comprise an enzyme, a compound, and a primer having a size of less than 50 base pairs.

18. 18. The flow cell device of any one of claims 7 to 17, wherein the reactants comprise lysozyme, proteinase K, random hexamers, polymerase, transposase, primers having a size of less than 50 base pairs, ligase, catalytic enzyme, deoxynucleotide triphosphates, buffer, or divalent cations.

19. A stage configured to hold a flow cell device according to any one of claims 7 to 18; A flow cell device according to any one of claims 7 to 18; and Detectors for acquiring sequencing data A system for DNA sequencing, comprising:

20. Obtaining beads encapsulating DNA according to any one of claims 1 to 6; amplifying the DNA encapsulated within the hydrogel; performing tagmentation on the DNA encapsulated within the hydrogel; and Sequencing the DNA, thereby creating a DNA library encapsulated within the hydrogel. A method for determining DNA sequencing, comprising:

21. 21. The DNA sequencing method of claim 20, wherein the DNA is a long DNA molecule of 50,000 base pairs or more.

22. 22. The DNA sequencing method of claim 20 or 21, further comprising performing a step of amplifying the DNA encapsulated in the hydrogel before performing tagmentation.

23. 23. The DNA sequencing method of claim 22, wherein the step of amplifying the DNA comprises multiple displacement amplification (MDA).

24. 24. The DNA sequencing method of any one of claims 20 to 23, wherein tagmentation comprises contacting the DNA with a transposome complex comprising a transposase and an adapter sequence.

25. 25. The DNA sequencing method of any one of claims 20 to 24, further comprising seeding the DNA library onto a solid support.

26. 26. The DNA sequencing method of claim 25, wherein the seeding comprises cleaving the hydrogel to release the DNA library from the hydrogel.

27. 27. The DNA sequencing method of claim 26, wherein the hydrogel is cleaved to release the DNA library by contacting the hydrogel with a cleavage enzyme mix.

28. 28. The DNA sequencing method of claim 27, wherein the cleavage enzyme mix comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP).

29. 26. The DNA sequencing method of claim 25, wherein the solid support is a flow cell device.

Images