How to assess viral infection

Abstract

To provide a high-sensitivity detection method for an AAV neutralizing antibody, and a tool (DNA, cell or the like) used in the method.SOLUTION: A vector composition for detecting an AAV neutralizing antibody essentially consists of: (a) a vector including a DNA linked in the order of a 5' transposon-specific inverted terminal repeat sequence (5'ITR sequence), a promoter, a transcription termination STOP sequence removable by site-specific recombinant enzyme, a reporter gene, and a 3'ITR sequence, which is a reporter gene expression cassette arranged so as to be expressed by the promoter when the transcription termination STOP sequence is removed; (b) a vector including a DNA linked in the order of a 5'ITR sequence, a promoter, a selection marker gene and 3'ITR sequence, which is a selection marker gene expression cassette; and (c) a vector including a transposase gene expression cassette linked in the order of a promoter, and transposase genes recognizing the transposon ITR sequences included in the vectors of (a) and (b), which is a DNA arranged that can be expressed by a promoter.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for evaluating the infection efficiency of a virus used as a vector for gene therapy, and more specifically to a method for measuring the amount of neutralizing antibodies against adeno-associated virus (AAV). [Background technology]

[0002] When determining whether a patient is suitable for gene therapy, it is useful to evaluate the infection efficiency of the virus used as a vector, specifically, to measure the amount of neutralizing antibodies against the virus that the patient possesses. In recent years, as the application of AAV vector-based gene therapy has progressed, adverse events associated with systemic high-dose administration of AAV vectors have occurred frequently, making neutralizing antibody evaluation increasingly important to ensure safety and efficacy. It has been found that if a patient possesses neutralizing antibodies against AAV (i.e., antibodies that inhibit AAV infection of cells, hereinafter referred to as "AAV neutralizing antibodies"), the AAV neutralizing antibodies bind to the AAV vector administered to the patient, inhibiting AAV infection of cells (Non-Patent Document 1), resulting in an undesired therapeutic effect. In fact, if a patient is determined to be positive in the assessment of the presence or absence of AAV neutralizing antibodies, the patient is excluded from enrollment in clinical trials using AAV vectors. Therefore, accurate detection of AAV neutralizing antibodies is important in assessing the suitability of AAV vector-based gene therapy.

[0003] However, the methods for measuring AAV neutralizing antibodies vary among various clinical trial institutions and are not currently standardized. Currently, there are two main methods for detecting anti-AAV antibodies in vitro: ELISA-based methods and cell-based AAV transduction methods. ELISA-based methods are easy to set up and perform relatively easily. However, for example, ELISA methods using antibodies against AAV neutralizing antibodies have high cross-reactivity between AAV neutralizing antibodies of different serotypes and insufficient sensitivity, making it difficult to select appropriate cases for the test. On the other hand, cell-based methods involve incubating serum from a subject with an AAV vector, and then evaluating the transduction efficiency of the AAV vector into cells to determine the presence, amount, and neutralizing activity of AAV-neutralizing antibodies (Non-Patent Documents 2 and 3). Compared with ELISA-based methods, cell-based methods are superior in that they can directly detect the presence or absence of inhibition of AAV vector transduction, and a method has been reported that improves on the conventional problem of low detection sensitivity (Non-Patent Document 4).

[0004] As described above, conventional methods for measuring the amount of AAV neutralizing antibodies, particularly cell-based methods, have been improved in terms of sensitivity, but there is still room for further improvement, such as standardization of the measurement method. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Wang et al., Nature Reviews Drug Discovery 18: 358-378 2019. [Non-patent document 2] Kruzik et al., Human Gene Therapy Methods 30: 35-43 2019. [Non-patent document 3] Meliani et al., Human Gene Therapy Methods 26: 45-53 2015. [Non-patent document 4] Baatartsogt et al., Molecular Therapy Methods & Clinical development 22:162-171 2021. Summary of the Invention [Problem to be solved by the invention]

[0006] In view of the above circumstances, an object of the present invention is to provide a highly sensitive method for detecting AAV neutralizing antibodies and to provide tools (e.g., DNA, cells, etc.) to be used in the method. [Means for solving the problem]

[0007] The inventors have developed a system for detecting AAV infection with high sensitivity by generating cells in which multiple copies of a reporter gene are expressed using the ITR sequences of a transposon, and by using these cells, it is possible to detect AAV neutralizing antibodies in a sample with high sensitivity.

[0008] That is, the present invention includes the following (1) to (8). (1) A vector composition for detecting AAV (adeno-associated virus) neutralizing antibodies, comprising the following vectors (a), (b), and (c): (a) A vector comprising DNA (hereinafter referred to as a "reporter gene expression cassette") in which a 5' transposon-specific inverted terminal repeat (ITR) sequence (hereinafter referred to as the "5' ITR sequence"), a promoter, a transcription termination STOP sequence removable by a site-specific recombinase, one or more reporter genes, and a 3' transposon ITR sequence (hereinafter referred to as the "3' ITR sequence") are linked in this order, and the DNA is arranged so that when the transcription termination STOP sequence is removed, expression of one or more reporter genes can be expressed by the promoter; (b) a vector containing DNA in which a 5' ITR sequence, a promoter, a selection marker gene, and a 3' ITR sequence are linked in this order, and the selection marker gene is arranged so that it can be expressed by the promoter (hereinafter referred to as a "selection marker gene expression cassette"); (c) A vector containing DNA (hereinafter referred to as a "transposase gene expression cassette") in which a promoter and a transposase gene that recognizes the transposon ITR sequences contained in the vectors (a) and (b) are linked in this order, and the transposase gene is positioned so that it can be expressed by the promoter. (2) The vector composition according to (1) above, characterized in that the STOP sequence is positioned between site-specific recombinase recognition sequences positioned in the same direction. (3) The vector composition according to (2) above, wherein the site-specific recombinase recognition sequence is a loxP sequence and the transposon is piggyBac. (4) A cell having a reporter gene expression cassette, a selection marker gene expression cassette, and a transposase gene expression cassette according to any one of (1) to (3) above inserted into its genome. (5) A method for detecting AAV neutralizing antibodies in a sample, comprising: A step of adding a mixture of a recombinant AAV carrying a site-specific recombinase gene in an expressible state and a sample to the cells according to claim 4 to infect the cells with the AAV; and measuring the expression level of the reporter gene; The method comprising: (6) The method according to (5) above, wherein the site-specific recombinase is Cre recombinase. (7) A kit for detecting an AAV neutralizing antibody, comprising at least one vector selected from the group consisting of a vector containing a reporter gene expression cassette, a vector containing a selectable marker gene expression cassette, and a vector containing a transposase gene expression cassette. (8) A kit for detecting AAV neutralizing antibodies, comprising the cells described in (4) above. In this specification, the symbol "to" indicates a numerical range including the values ​​on either side of it. [Effects of the Invention]

[0009] The present invention provides a system for detecting AAV infection in cells with high sensitivity, which enables the highly sensitive and reproducible assessment of the amount of AAV-neutralizing antibodies present in a sample. According to the present invention, it is possible to provide highly sensitive receiver cells (cells for infection with AAV, which are used in assays for AAV neutralizing antibodies), thereby enabling highly sensitive and stable detection of AAV neutralizing antibodies. [Brief explanation of the drawings]

[0010] [Figure 1] FIG. 1 shows a schematic diagram of the configuration of a reporter gene expression cassette, a selection marker gene expression cassette, and a transposase gene expression cassette contained in a vector of the present invention. [Figure 2] 1 shows the results of confirming reporter gene expression using cells for highly sensitive AAV neutralizing antibody detection according to the present invention. Regarding the reporter gene expression state of the cells obtained as a result of screening, (A) shows the results of confirming GFP activity, and (B) shows the results of confirming luciferase activity. [Figure 3] The luciferase activity of T137-30 cells selected based on the results shown in Figure 2 was measured. T137-30 cells were transfected with serial 10-fold dilutions of self-replicating Cre-packaged AAV1 (SC-Cre-NaB), single-stranded Cre-packaged AAV1 (SS-Cre-Nab), or single-stranded luciferase-packaged AAV1 (Ss-Luc-Nab), and the luciferase activity was measured. DETAILED DESCRIPTION OF THE INVENTION

[0011] Hereinafter, an embodiment of the present invention will be described. The first embodiment is a vector composition for detecting AAV neutralizing antibodies (hereinafter also referred to as "the vector composition of this embodiment"), which comprises the following vectors (a), (b), and (c): (a) a vector (hereinafter referred to as a "reporter gene expression vector") comprising DNA in which a 5' transposon-specific inverted terminal repeat (ITR) sequence (hereinafter referred to as a "5' ITR sequence"), a promoter, a transcription termination STOP sequence removable by a site-specific recombinase, one or more reporter genes, and a 3' transposon ITR sequence (hereinafter referred to as a "3' ITR sequence") are linked in this order, and the DNA is arranged so that when the transcription termination STOP sequence is removed, expression of one or more reporter genes can be expressed by the promoter (hereinafter referred to as a "reporter gene expression cassette"); (b) a vector (hereinafter referred to as a "selection marker expression vector") containing DNA in which a 5' ITR sequence, a promoter, a selection marker gene, and a 3' ITR sequence are linked in this order, and the selection marker gene is arranged so that it can be expressed by the promoter (hereinafter referred to as a "selection marker gene expression cassette"); (c) A vector (hereinafter referred to as a "transposase expression vector") containing DNA in which a promoter and a gene encoding a transposase that recognizes the ITR sequences contained in the vectors (a) and (b) are linked in this order (hereinafter referred to as a "transposase gene expression cassette"), the vector being arranged so that the transposase gene can be controlled and expressed by the promoter.

[0012] In this embodiment, a transposon refers to a nucleic acid sequence that transposes by changing its location on the genome within a cell. In this embodiment, the term particularly refers to a DNA transposon (class II transposon). Each DNA transposon has a 5' ITR sequence and a 3' ITR sequence specific to that transposon at both ends. A transposase specific to that transposon recognizes the ITR sequences at both ends, excises the transposon DNA from the genome, and inserts the excised transposon DNA into another location on the genome. By utilizing the functions of the transposon and transposase, the location on the genome of DNA inserted between the two ITR sequences can be changed. Transposons that can be used in this embodiment include, but are not limited to, piggyBac, Sleeping Beauty, Tol2, and P element (Ivics et al., Nat Methods. 6:415-422 2009).

[0013] In this embodiment, site-specific recombination refers to the phenomenon of DNA recombination occurring between specific homologous nucleotide sequences (site-specific recombination sequences). This recombination is induced by a site-specific recombinase specific to the homologous nucleotide sequence. The Cre / loxP system, derived from phages, is a commonly used system for inducing site-specific recombination using a site-specific recombinase. Cre recombinase is a DNA recombinase derived from P1 phage that recognizes 34-bp site-specific recombination sequences called loxP sites and induces site-specific recombination. In addition to conventional loxP sequences, mutant loxP sequences such as lox511, lox2272, and loxFAS also exist. The Cre / loxP system is widely used to modify gene structures in genomic DNA, such as by deleting, replacing, or inverting the DNA region between two loxP sequences or mutant loxP sequences. When two loxP sequences are oriented in the same direction, Cre recombinase excises the DNA between the loxP sequences and circularizes it. Furthermore, when two loxP sequences are arranged in opposite directions, the direction of the DNA between the loxP sequences is inverted by the action of Cre recombinase. In addition to the Cre / loxP system, examples of site-specific recombination systems include the Flp / FRT system derived from yeast plasmid 2μ, the Dre / rox system derived from Enterobacteriaceae phage D6, and the R / RS system derived from soy sauce yeast, and these can also be used in this embodiment. When a site-specific recombination system is used in this embodiment, the site-specific recombination sequences are arranged in the same direction in the reporter gene expression cassette.

[0014] In this embodiment, the transcription termination STOP sequence is a sequence containing a stop codon and a polyA addition signal, and is not particularly limited as long as it exhibits the effect of terminating transcription, and a portion of DNA contained in a commercially available vector, etc. Furthermore, the promoter is not particularly limited and can be appropriately selected by a person skilled in the art, and examples thereof include the CAG promoter and the PKG promoter.

[0015] In this embodiment, a selectable marker gene is a gene that confers a selectable phenotype to cells into which the selectable marker gene has been introduced, and those skilled in the art can easily select a selectable marker suitable for this embodiment. Suitable selectable marker genes are not particularly limited, and examples include genes that affect cell proliferation, such as the Neo gene (selected with G418), the Hyg gene (selected with hygromycin), the hisD gene (selected with histidinol), the Gpt gene (selected with 6-thioxanthine), and the Ble gene (selected with bleomycin).

[0016] The reporter gene used in this embodiment is not particularly limited, and examples include genes encoding fluorescent proteins such as EGFP and mCherry, as well as luciferase and β-galactosidase. The reporter gene expression cassette according to this embodiment may contain one or more reporter genes. When multiple reporter genes are included, they are preferably contained in the reporter gene cassette in an arrangement that allows expression of the multiple reporter genes (polycistronic expression). To enable polycistronic expression of reporter genes, for example, a DNA sequence encoding a 2A self-cleaving peptide may be inserted between each reporter gene. If a DNA encoding a 2A peptide is inserted between two reporter genes, for example, the translated 2A peptide inhibits the peptidyltransferase activity of ribosomes during translation of these reporter genes, preventing the joining of polypeptide chains ("ribosomal skipping"). Ribosomal skipping results in the translation of all reporter genes into proteins. The coding sequence for the 2A peptide used in this embodiment is not particularly limited, but may include, for example, sequences encoding T2A, P2A, E2A, and F2A (Ziqing et al., Sci Rep. 7: 2193. doi: 10.1038 / s41598-017-02460-2 2017).

[0017] The second embodiment is a cell (a cell according to the second embodiment; sometimes referred to herein as a receiver cell) in which the reporter gene expression cassette, the selectable marker gene expression cassette, and the transposase gene expression cassette according to the first embodiment have been inserted into the genome. The cells according to the second embodiment can be obtained by transfecting the cells with the vector composition for detecting AAV neutralizing antibodies according to the first embodiment (the vector composition according to this embodiment) and selecting using a selection marker. Here, the constituent ratio (molar ratio) of the reporter gene expression vector, selection marker gene expression vector, and transposase expression vector contained in the vector composition according to this embodiment is not particularly limited, but for example, the reporter gene expression vector is 5 to 35, preferably 10 to 30, and more preferably 15 to 25, and the transposase gene expression vector is 1 to 5, relative to the selection marker gene expression vector being 1.

[0018] The reporter gene expression vector, selectable marker gene expression vector, and transposase gene expression vector according to this embodiment can be prepared by constructing each expression cassette on a known vector based on conventional techniques in the art. The known vectors used here are not particularly limited, but examples thereof include pUC-based plasmids and pBR322-based plasmids that can be amplified using Escherichia coli. Furthermore, the cells according to the second embodiment are not particularly limited, but may be prepared using, for example, HEK293 cells, CHO cells, 3T3 cells, or the like.

[0019] The third embodiment is a method for detecting AAV-neutralizing antibodies. More specifically, a method for detecting AAV neutralizing antibodies present in a sample (e.g., a blood-derived sample (such as serum)), comprising: A step of adding a mixture of a recombinant AAV carrying a site-specific recombinase gene in an expressible state (hereinafter also referred to as "recombinase-expressing AAV") and a sample to the cells according to the second embodiment, thereby infecting the cells with the AAV; and measuring the expression level of the reporter gene; The method includes:

[0020] Recombinase-expressing AAV is an AAV that carries a site-specific recombinase (e.g., Cre recombinase (Cre), flippase (Flp), Dre recombinase (Dre), and R enzyme (R)) gene and a promoter that controls the expression of the gene. In the cell according to the second embodiment, a reporter gene expression cassette, a selection marker gene expression cassette, and a transposase gene expression cassette are inserted into the genome, and the selection marker gene and transposase gene can be expressed by a promoter (i.e., the selection marker gene and transposase gene are placed in each expression cassette so that they can each be expressed by the promoter located on the 5' side). The reporter gene is not expressed in this state because a transcription termination STOP sequence is present between the promoter and the reporter gene. After the cells according to the second embodiment are infected with a recombinase-expressing AAV, the site-specific recombinase is expressed in the cells, and the action of this enzyme induces homologous recombination between two site-specific recombination sequences (e.g., loxP sequences) inserted in the same direction into the genome of the cells, thereby removing the transcription termination STOP sequence from the genome of the cells. As a result, the reporter gene on the genome becomes expressible under the control of the promoter in the reporter gene expression cassette. Therefore, when a cell according to the second embodiment is infected with a recombinant enzyme-expressing AAV, the reporter gene becomes expressible, enabling detection of a reporter signal (e.g., a fluorescent signal, a luminescent signal, or enzyme activity). By detecting this reporter signal, it becomes possible to detect infection of the cell with the recombinant enzyme-expressing AAV.

[0021] If AAV neutralizing antibodies are present when the recombinase-expressing AAV infects cells, AAV infection is inhibited, and the expression of site-specific recombinase within the cells is also inhibited. As a result, the reporter signal is reduced. This decrease in reporter signal can be used as an indicator to detect the presence or absence of AAV neutralizing antibodies in a sample and to evaluate the amount of AAV neutralizing antibodies present. The recombinase-expressing AAV used in the third embodiment may be any AAV, as long as it retains a site-specific recombinase in an expressible manner, and may be any AAV of any serotype (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9). For example, if the serotype of the recombinase-expressing AAV is AAV1, neutralizing antibodies against AAV1 present in a sample can be detected, and the amount of such antibodies present can be evaluated. The same applies to other serotypes.

[0022] The fourth embodiment is a kit for detecting AAV neutralizing antibodies, which includes at least one vector selected from the group consisting of a vector containing a reporter gene expression cassette, a vector containing a selectable marker gene expression cassette, and a vector containing a transposase gene expression cassette. The kit for detecting AAV neutralizing antibodies according to the fourth embodiment may also include the cells according to the second embodiment. Furthermore, the kit may further include one or more additional reagents, including, but not limited to, a dilution buffer, a reconstitution solution, a wash buffer, a nucleic acid transfer reagent, a protein transfer reagent, and a control reagent. Typically, the kit comes with an instruction manual.

[0023] Where this specification is translated into English and includes the singular words "a," "an," and "the," this shall include the plural as well as the singular, unless the context clearly indicates otherwise. The present invention will be further explained below by showing examples, but these examples are merely illustrative of embodiments of the present invention and are not intended to limit the scope of the present invention. [Example]

[0024] 1. Preparation of various vectors 1-1. Reporter gene expression vector The structure of the reporter gene expression cassette used in this example is shown in Figure 1 (YT103). EGFP, LacZ, and Luc were used as reporter genes, and the CAG promoter was used as the promoter. The coding sequence for the P2A peptide was inserted between each reporter gene. The Cre / loxP system was used to remove the transcription termination STOP sequence. The ITR sequence of the transposon was the piggyBac ITR sequence. To generate the YT103 plasmid (a reporter gene expression vector), pLR5-CAG-floxSTOP-EGFP was digested with BsrG1, and the fragment amplified by PCR using Primers YT198 and YT199 with pAAV-CAG-Luc (Hayashita-Kinoh et al., Mol Ther Methods & Clinical Dev 20:133-141 2021) as a template, and the fragment amplified by PCR using Primers YT200 and YT201 with pAAV-CAG-LacZ (Ishii et al., Mol Ther Methods & Clinical Dev 18:44-49 2020) as a template, were inserted using the In-Fusion Cloning Kit (TAKARA). The primers used for PCR amplification are as follows: PrimerYT198: CTCTCGGCATGGACGAGCTGTACAAGgctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacctGTCGTTTTACAACGTCGT (SEQ ID NO: 1) PrimerYT199: GGGTCCTGGATTTTCCTCAACATCTCCACAAGTAAGCAAAGAGCCCCTTCCTTCTTTTTGACACCAGACCAACTG (SEQ ID NO: 2) PrimerYT200: TTGAGGAAAATCCAGGACCCatggaagacgccaaaaacat (SEQ ID NO: 3) PrimerYT201: AGAGTCGCGGCCGCTTTACTTttacaatttggactttccgc (SEQ ID NO: 4) The pLR5-CAG-floxSTOP-EGFP plasmid was prepared according to the method previously described (Fujita et al., Nat Cell Biol. 22:26-37 2020). The sequence of the reporter gene expression cassette used in this example is shown in the sequence listing as SEQ ID NO: 5.

[0025] 1-2.Selection marker expression vector The structure of the selection marker expression cassette used in this example is shown in Figure 1 (pLR PKG-Neo). The Neo gene was used as the selection marker gene, and the PKG promoter was used as the promoter. The ITR sequence of the transposon was the piggyBac ITR sequence. The nucleic acid sequence of the selection marker expression cassette used in this example is shown in the sequence listing as SEQ ID NO: 6. The pLR5-PKG-Neo plasmid was constructed by cleaving pLR5-CAG-EGFP (Fujita et al., Nat Cell Biol. 22:26-37 2020) with SalI / BsRGI and then inserting the PCR-amplified sequence using an infusion kit.

[0026] 1-3. Transposase expression vector The structure of the transposase expression cassette used in this example is shown in Figure 1 (pCAG-hPB). The piggyBac transposase gene was used as the transposase gene, and the CAG promoter was used as the promoter. The pCAG-hPB plasmid was prepared by digesting pCAG-EGFP (Tsunekawa et al., The EMBO Journal 31:1879-1891 2012) with EcoRI / BsRGI and then inserting the PCR-amplified sequence using an infusion kit. The nucleic acid sequence of the transposase gene expression cassette used in this example is shown in the sequence listing as SEQ ID NO:7.

[0027] 2. Preparation of Cells for AAV Neutralizing Antibody Detection Cells (cells according to the second embodiment) in which a reporter gene expression cassette, a selection marker gene expression cassette, and a transposase gene expression cassette were inserted into the genome were screened for cells exhibiting highly sensitive reporter activity (highly sensitive receiver cells). 293A cells were transfected with pLR5-CAG-floxSTOP-EGFP, pLR5-PKG-Neo, and pCAG-hPB plasmids at a molar ratio of 20:1:2 using PEI-MAX. After transfection, the cells were cultured in G418-containing medium for 2 weeks and then plated into 96-well plates at single cells per well using a BD FACSMelody. After culturing, cell clones from each well were split into 96-well plates and infected with AAV1-CAG-Cre (an AAV vector for Cre recombinase expression). AAV1-CAG-Cre was prepared by transfecting 293AAV cells with three plasmids (pHelper, pR2C1, and pAAV-CAG-Cre) for 11 days and then concentrating the culture supernatant using a TAKARA AAVpro Concentrator. Three days after infection, luciferase assays were performed.

[0028] 3. Selection of receiver cells for highly sensitive AAV neutralizing antibody detection The T137 cell clone was selected from the 100 clones obtained as the clone that gave the strongest signal in the luciferase assay performed by the method described in 2 above. Next, T137 cells were plated in 12-well and 96-well plates at a cell density of approximately 1 × 10 5 cells / well and approximately 1 x 10 4 The cells were seeded at 100 cells / well. The seeded cells were cultured in DMEM containing 10% FCS, penicillin / streptomycin, and 200 ng / mL G418 at 37°C and 5% CO2. After 24 hours of culture, the medium was replaced with a G418-free medium, and AAV1-CAG-Cre was transfected into the cells at approximately 1 × 10 5 The cells were transfected to give gc / cell and cultured at 37°C and 5% CO2. Four days after transfection, GFP expression in cells seeded in 12-well plates was observed under a fluorescence microscope, and fluorescent images were obtained. The medium for cells seeded in 96-well plates was removed, and fresh medium was added (40 μL / well). Luciferase activity was measured using a plate reader with the Bright-Glo Luciferase Assay System (Promega). Figure 2A shows a GFP fluorescence image, and Figure 2B shows the results of a luciferase assay. Figure 2 shows that T137 clone 30 exhibited the highest reporter activity. T137 clone 30 (T137-30) was used in subsequent experiments.

[0029] T137-30 was placed in a 96-well plate, approximately 1 x 10 4 Cells were seeded at 5 × 10 cells / well in DMEM containing 10% FCS and penicillin / streptomycin. The cells were cultured at 37°C and 5% CO2 for 3 days until they reached approximately 90% confluence. After 3 days of culture, 5 × 10 cells were transfected with self-replicating Cre-packaged AAV1 (SC-Cre), single-stranded Cre-packaged AAV1 (SS-Cre), or single-stranded luciferase-packaged AAV1 (Ss-Luc) in the presence of sodium butyrate. 8 5 x 10 from gc / well 4The cells were transfected with serial 10-fold dilutions of the antibody up to 10 ... These results demonstrate that when cells containing the reporter gene expression cassette, selectable marker gene expression cassette, and transposase gene expression cassette of the present invention inserted into their genomes are infected with AAV expressing a site-specific recombinase (e.g., Cre recombinase), extremely high reporter activity can be detected. Therefore, this reporter activity detection system can be used to detect even minute amounts of AAV neutralizing antibodies present in a sample. [Industrial Applicability]

[0030] The present invention provides a highly sensitive method for detecting the presence and amount of AAV neutralizing antibodies in a sample, which is useful for evaluating the efficacy and safety of disease treatments using AAV vectors and is expected to be used in the medical field.

Claims

1. A vector composition for detecting AAV (adeno-associated virus) neutralizing antibodies, comprising the following vectors (a), (b), and (c): (a) A vector comprising DNA (hereinafter referred to as a "reporter gene expression cassette") in which a 5' transposon-specific inverted terminal repeat (ITR) sequence (hereinafter referred to as the "5' ITR sequence"), a promoter, a transcription termination STOP sequence removable by a site-specific recombinase, one or more reporter genes, and a 3' transposon ITR sequence (hereinafter referred to as the "3' ITR sequence") are linked in this order, and the DNA is arranged so that when the transcription termination STOP sequence is removed, expression of one or more reporter genes can be expressed by the promoter; (b) a vector containing DNA in which a 5' ITR sequence, a promoter, a selection marker gene, and a 3' ITR sequence are linked in this order, and the selection marker gene is arranged so that it can be expressed by the promoter (hereinafter referred to as a "selection marker gene expression cassette"); (c) A vector containing DNA (hereinafter referred to as a "transposase gene expression cassette") in which a promoter and a transposase gene that recognizes the transposon ITR sequences contained in the vectors (a) and (b) are linked in this order, and the transposase gene is positioned so that it can be expressed by the promoter.

2. A vector composition for detecting AAV infection, comprising the following vectors (a), (b) and (c): (a) A vector comprising DNA (hereinafter referred to as a "reporter gene expression cassette") in which a 5' transposon-specific inverted terminal repeat (ITR) sequence (hereinafter referred to as the "5' ITR sequence"), a promoter, a transcription termination STOP sequence removable by a site-specific recombinase, one or more reporter genes, and a 3' transposon ITR sequence (hereinafter referred to as the "3' ITR sequence") are linked in this order, and the DNA is arranged so that when the transcription termination STOP sequence is removed, expression of one or more reporter genes can be expressed by the promoter; (b) a vector containing DNA in which a 5' ITR sequence, a promoter, a selection marker gene, and a 3' ITR sequence are linked in this order, and the selection marker gene is arranged so that it can be expressed by the promoter (hereinafter referred to as a "selection marker gene expression cassette"); (c) A vector containing DNA (hereinafter referred to as a "transposase gene expression cassette") in which a promoter and a transposase gene that recognizes the transposon ITR sequences contained in the vectors (a) and (b) are linked in this order, and the transposase gene is positioned so that it can be expressed by the promoter.

3. 3. The vector composition according to claim 1, wherein the STOP sequence is located between site-specific recombinase recognition sequences located in the same direction.

4. The vector composition according to claim 3, wherein the site-specific recombinase recognition sequence is a loxP sequence and the transposon is piggyBac.

5. A cell having the reporter gene expression cassette, the selectable marker gene expression cassette, and the transposase gene expression cassette according to any one of claims 1 to 4 inserted into its genome.

6. 1. A method for detecting AAV neutralizing antibodies in a sample, comprising: A step of adding a mixture of a recombinant AAV carrying a site-specific recombinase gene in an expressible state and a sample to the cells according to claim 5 to infect the cells with the AAV; and measuring the expression level of the reporter gene; The method comprising:

7. The method of claim 6, wherein the site-specific recombinase is Cre recombinase.

8. A kit for detecting AAV neutralizing antibodies, comprising the cells of claim 5.

Images