Compositions and methods for enhancing gene expression

Abstract

The present disclosure generally relates to nucleic acid molecules used for regulating gene expression. Disclosed herein is a nucleic acid molecule comprising one or more structural elements of viral capsid enhancer operably linked to the coding sequence of target gene. In some embodiments, viral capsid enhancer comprises the downstream loop (DLP) from viral capsid protein or a variant of DLP. [Selected Figure] Figure 1

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 430,250, filed December 5, 2016, U.S. Provisional Patent Application No. 62 / 486,361, filed April 17, 2017, and U.S. Provisional Patent Application No. 62 / 587,954, filed November 17, 2017. The contents of the above-referenced applications are expressly incorporated herein by reference in their entireties.

[0002] Sequence Listing The material in the attached sequence listing is incorporated into this application by reference. The attached sequence listing text file (filename SGI012WO_SeqListing.txt) was created on December 4, 2017 (169 KB).

[0003] The present disclosure relates to the fields of molecular biology and genetic engineering, including nucleic acid molecules useful for regulating gene expression, and the use of nucleic acid molecules for the production of desired products in suitable host cells, e.g., in cell culture or in a subject, and to confer beneficial characteristics on host cells or subjects. [Background technology]

[0004] Advances in biotechnology and molecular biology have provided many opportunities for developing recombinant cells and organisms with commercially desirable characteristics or traits. In particular, modern genetic engineering techniques have greatly accelerated the introduction of genes, and therefore new traits, into recombinant cells and organisms. For example, appropriate expression levels of desirable genes in host cells or transgenic organisms can help achieve this goal.

[0005] However, despite the availability of many molecular tools, the genetic modification of host cells and organisms is often limited by the insufficient expression level of target gene or uncontrolled expression.Therefore, there is still a need for regulatory elements that can enhance the expression of transgenes in host cells and organisms.Identifying new molecular tools, such as regulatory elements, expression vectors and expression systems that function in various types of organisms, can be useful for the development of genetically enhanced cells and organisms. Summary of the Invention [Means for solving the problem]

[0006] This section provides an overview of the application and does not encompass its entire scope or all of its features.

[0007] The present disclosure generally relates to methods and compositions useful for regulating, e.g., increasing, gene expression in vitro, ex vivo, or in vivo. Gene expression can be, for example, in animal cells and other eukaryotic cells. The gene can be, for example, a heterologous gene encoding a protein of interest.

[0008] In one aspect, some embodiments disclosed herein relate to a nucleic acid molecule comprising: (i) a first nucleic acid sequence encoding one or more RNA stem-loops of a viral capsid enhancer or variants thereof; and (ii) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence comprises a coding sequence of a gene of interest (GOI).

[0009] Implementations of nucleic acid molecule embodiments according to the present disclosure may include one or more of the following features: In some embodiments, a first nucleic acid sequence is operably linked upstream of a coding sequence for a GOI. In some embodiments, the nucleic acid molecule further comprises a promoter operably linked upstream of the first nucleic acid sequence. In some embodiments, the nucleic acid molecule further comprises a 5'UTR sequence operably linked upstream of the first nucleic acid sequence. In some embodiments, the 5'UTR sequence is operably linked downstream of the promoter and upstream of the first nucleic acid sequence. In some embodiments, the nucleic acid molecule further comprises a coding sequence for an autoprotease peptide operably linked upstream of a second nucleic acid sequence. In some embodiments, the coding sequence for the autoprotease peptide is operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the nucleic acid molecule further comprises a 3' UTR sequence operably linked downstream of the nucleic acid sequence of the second sequence.

[0010] In some embodiments, the viral capsid enhancer is derived from a capsid gene of a viral species that belongs to the Togaviridae family. In some embodiments, the viral species belongs to the Alphavirus genus of the Togaviridae family. In some embodiments, the Alphavirus species is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GEV), and others. T), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus. In some embodiments, the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, wherein the DLP motif comprises at least one of one or more RNA stem loops. In some embodiments, the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46-52. In some embodiments, the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46-52.

[0011] In some embodiments, the coding sequence of the GOI encodes a polypeptide. In some embodiments, the polypeptide is a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or a combination thereof. In some embodiments, the polypeptide is an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or a combination thereof.

[0012] In some embodiments, the nucleic acid molecule of the present disclosure further comprises a third nucleic acid sequence encoding one or more RNA stem-loops of a second viral capsid enhancer or variant thereof, and a fourth nucleic acid sequence operably linked to the third nucleic acid sequence, wherein the fourth nucleic acid sequence comprises a coding sequence for a second gene of interest (GOI). In some embodiments, the nucleic acid molecule further comprises a coding sequence for a second autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the fourth nucleic acid sequence.

[0013] In some embodiments, the nucleic acid molecule of the present disclosure is an mRNA molecule or an RNA replicon. In some embodiments, the nucleic acid molecule is an expression vector or a transcription vector. In some embodiments, the expression vector or transcription vector further comprises one or more additional transcription regulatory sequences. In some embodiments, the expression vector or transcription vector further comprises one or more additional transcription regulatory sequences. In some embodiments, the expression vector or transcription vector further comprises one or more additional translation regulatory sequences. In some embodiments, the nucleic acid molecule is a plasmid, a bacteriophage vector, a cosmid, a fosmid, a viral replicon, a shuttle vector, or a combination thereof. In some embodiments, the nucleic acid molecule is a prokaryotic vector or a eukaryotic vector. In some embodiments, the nucleic acid molecule is produced by de novo synthesis.

[0014] Also disclosed in some embodiments is a method for producing a polypeptide of interest in a cell, the method comprising introducing into the cell a nucleic acid molecule according to the present disclosure, thereby producing in the cell a polypeptide encoded by a GOI. In yet another related aspect, some embodiments disclosed herein relate to a method for producing a polypeptide of interest in a cell, the method comprising introducing into the cell an RNA molecule, the RNA molecule comprising one or more RNA stem loops of a viral capsid enhancer or a variant thereof and a coding sequence for the polypeptide of interest, thereby producing the polypeptide of interest in the cell.

[0015] In some embodiments, the RNA molecule is a messenger RNA (mRNA) molecule or a replicon RNA molecule. In some embodiments, the RNA molecule is produced by de novo synthesis and / or in vitro transcription before being introduced into a cell. In some embodiments, the RNA molecule comprises a downstream loop (DLP) motif of a viral species, wherein the DLP motif comprises at least one of one or more RNA stem loops of a viral capsid enhancer. In some embodiments, the RNA molecule further comprises a coding sequence for an autoprotease peptide downstream of at least one of the one or more RNA stem loops and upstream of the coding sequence for the polypeptide of interest. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the polypeptide is a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or a combination thereof. In some embodiments, the polypeptide is an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or a combination thereof. In some embodiments, the cell is present in a tissue, an organ, or a subject. In some embodiments, the subject is a human, horse, pig, primate, mouse, ferret, rat, cotton rat, cow, wild boar, sheep, rabbit, cat, dog, bird, fish, goat, donkey, hamster, or buffalo.

[0016] Some embodiments disclose a method for producing messenger RNA (mRNA) in a cell. In some embodiments, the method comprises administering to a cell a nucleic acid molecule comprising a first nucleic acid sequence encoding one or more RNA stem-loops of a viral capsid enhancer or variants thereof and a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence comprises a coding sequence for a gene of interest (GOI), thereby producing mRNA of the GOI.

[0017] In some embodiments, the first nucleic acid sequence is operably linked upstream of the coding sequence for the GOI. In some embodiments, the nucleic acid molecule further comprises a promoter operably linked upstream of the first nucleic acid sequence. In some embodiments, the nucleic acid molecule further comprises a 5'UTR sequence operably linked upstream of the first nucleic acid sequence. In some embodiments, the 5'UTR sequence is operably linked downstream of the promoter and upstream of the first nucleic acid sequence. In some embodiments, the nucleic acid molecule further comprises a coding sequence for an autoprotease peptide operably linked upstream of a second nucleic acid sequence. In some embodiments, the coding sequence for the autoprotease peptide is operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the nucleic acid molecule further comprises a 3' UTR sequence operably linked downstream of the nucleic acid sequence of the second sequence.

[0018] In some embodiments disclosed herein, the viral capsid enhancer is derived from a capsid gene of a viral species belonging to the Togaviridae family. In some embodiments, the viral species belongs to the Alphavirus genus of the Togaviridae family. In some embodiments, the Alphavirus species is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GE), and others. T), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus. In some embodiments, the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, wherein the DLP motif comprises at least one of one or more RNA stem loops. In some embodiments, the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46-52. In some embodiments, the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46-52.

[0019] In some embodiments disclosed herein, the coding sequence of a GOI encodes a polypeptide. In some embodiments, the polypeptide is selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and combinations thereof. In some embodiments, the polypeptide is an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or a combination thereof. In some embodiments of the method for producing messenger RNA (mRNA) according to the present disclosure, the nucleic acid molecule further comprises a third nucleic acid sequence encoding one or more RNA stem-loops of a second viral capsid enhancer or a variant thereof, and a fourth nucleic acid sequence operably linked to the third nucleic acid sequence, wherein the fourth nucleic acid sequence comprises a coding sequence of a second gene of interest (GOI). In some embodiments, the nucleic acid molecule further comprises a coding sequence of a second autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the fourth nucleic acid sequence.

[0020] In some embodiments, the nucleic acid molecule of the present disclosure can be an RNA replicon. In some embodiments, the nucleic acid molecule is an expression vector or a transcription vector. In some embodiments, the nucleic acid molecule further comprises one or more additional transcriptional regulatory sequences. In some embodiments, the nucleic acid molecule further comprises: In some embodiments, one or more additional translational regulatory sequences. In some embodiments, the nucleic acid molecule is an expression vector selected from the group consisting of a plasmid, a bacteriophage vector, a cosmid, a fosmid, a viral replicon, a shuttle vector, and combinations thereof. In some embodiments, the nucleic acid molecule is a prokaryotic or eukaryotic expression vector. In some embodiments, the cell is present in a tissue, an organ, or a subject. In some embodiments, the subject is a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, or a buffalo. In some embodiments of the methods for producing messenger RNA (mRNA) according to the present disclosure, the method further comprises producing in the cell a polypeptide encoded by the mRNA of the GOI. In some embodiments, the method comprises obtaining the produced mRNA of the GOI and introducing the obtained mRNA into a second cell to express the polypeptide encoded by the mRNA of the GOI in the second cell.

[0021] In one aspect, some embodiments of the present disclosure relate to a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, the modified viral RNA replicon comprising: (i) a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; and (ii) a second nucleic acid sequence encoding at least one nonstructural viral protein or a portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence.

[0022] In some embodiments, at least one of the one or more structural elements of the viral capsid enhancer comprises one or more RNA stem loops. In some embodiments, the viral capsid enhancer is derived from a capsid gene of a viral species belonging to the Togaviridae family. In some embodiments, the viral species belongs to the Alphavirus genus of the Togaviridae family. In some embodiments, the Alphavirus species is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getau virus (FV), and others. The viral capsid enhancer may be selected from the group consisting of GET, Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), and Buggy Creek virus. In some embodiments, the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, wherein the DLP motif comprises at least one of one or more RNA stem loops. In some embodiments, the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46-52. In some embodiments, the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46-52.

[0023] In some embodiments, the nucleic acid sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie disease virus 2A (BmIFV2A), or a combination thereof. In some embodiments, the first nucleic acid sequence is operably positioned within a region of approximately 1 to 1,000 nucleotides downstream of the 5' end of the modified viral RNA replicon. The second nucleic acid sequence comprises substantially all of the coding sequence for a native viral nonstructural protein of the corresponding unmodified viral RNA replicon.

[0024] In some embodiments disclosed herein, the modified viral RNA replicon comprises a modified RNA replicon derived from a viral species belonging to the genus Alphavirus in the family Togaviridae or the genus Arterivirus in the family Arteriviridae.

[0025] In some embodiments, the arterivirus species is equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), or simian hemorrhagic fever virus (SHFV). In some embodiments, the first nucleic acid sequence is operably positioned upstream of a second nucleic acid sequence encoding a portion or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. In some embodiments, the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises one or more expression cassettes, at least one of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). In some embodiments, the modified arterivirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding a portion or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. In some embodiments, at least one of the one or more expression cassettes is operably positioned downstream of a transcriptional regulatory sequence (TRS) of the modified arterivirus RNA replicon, wherein the TRS is TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, or TRS7. In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, wherein the third nucleic acid sequence is operably linked upstream of the coding sequence of the GOI.

[0026] In some embodiments, the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. In some embodiments, the coding sequence for the GOI encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof. In some embodiments, the coding sequence for the GOI encodes an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or any combination thereof.

[0027] In some embodiments, the modified viral RNA replicon is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus The modified alphavirus RNA replicon comprises a modified RNA replicon derived from an alphavirus species selected from the group consisting of alphaviruses (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), and Buggy Creek virus. In some embodiments, the first nucleic acid sequence is operably positioned upstream of a second nucleic acid sequence encoding one or more nonstructural proteins nsp1-4, or a portion thereof, of the modified alphavirus RNA replicon. In some embodiments, the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence for a gene of interest (GOI). In some embodiments, the modified alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1-4, or portions thereof, of the modified alphavirus RNA replicon.In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, the third nucleic acid sequence being operably linked upstream of the coding sequence for the GOI. In some embodiments, the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. In some embodiments, the coding sequence for the GOI encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or a combination thereof. In some embodiments, the coding sequence for the GOI encodes an antibody, an antigen, an immunomodulator, an enzyme, a cytokine, or a combination thereof.

[0028] In one aspect, some embodiments of the present disclosure relate to nucleic acid molecules comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, wherein the modified non-alphavirus RNA replicon comprises a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or variants thereof. In some embodiments, the nucleic acid sequence encoding the modified non-alphavirus RNA replicon further comprises a second nucleic acid sequence encoding at least one nonstructural viral protein or a portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. In some embodiments, the nucleic acid sequence encoding the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), or a combination thereof. In some embodiments, the nucleic acid sequence encoding a modified non-alphaviral RNA replicon comprises a modified RNA replicon derived from a positive-strand RNA virus. In some embodiments, the positive-strand RNA virus is a virus species belonging to a family selected from the group consisting of Togaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, and Paramyxoviridae. In some embodiments, the positive-strand RNA virus is a virus species belonging to the genus Arterivirus in the family Arteriviridae.

[0029] In some embodiments disclosed herein, the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence for a gene of interest (GOI). In some embodiments, the modified non-alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof. In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, the third nucleic acid sequence being operably linked upstream of the coding sequence for the GOI. In some embodiments, the nucleic acid sequence encoding the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. In some embodiments, the nucleic acid molecule is produced by de novo synthesis.

[0030] In one aspect, some embodiments disclosed herein relate to recombinant cells, such as the nucleic acid molecules disclosed herein. In some embodiments, the recombinant cells are prokaryotic or eukaryotic cells. In some embodiments, the recombinant cells are animal cells. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a modified RNA replicon, and expression of the modified replicon RNA confers resistance to innate immune responses in the recombinant cell. In a related aspect, some embodiments disclosed herein relate to a cell culture comprising at least one recombinant cell disclosed herein.

[0031] In some aspects, some embodiments disclosed herein relate to a method for conferring resistance to the innate immune system in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, wherein the modified viral RNA replicon comprises: (i) a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; and (ii) a second nucleic acid sequence encoding at least one nonstructural protein or a portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence, and wherein expression of the modified replicon RNA encoded by the nucleic acid molecule confers resistance to the innate immune response in the subject. In some embodiments, the subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo.

[0032] In some aspects, some embodiments disclosed herein relate to a method for producing a polypeptide of interest in a subject, comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, wherein the modified viral RNA replicon comprises: (i) a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; and (ii) a second nucleic acid sequence encoding at least one nonstructural protein or a portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. In some embodiments, the subject is a human, horse, pig, primate, mouse, ferret, rat, cotton rat, cow, wild boar, sheep, rabbit, cat, dog, bird, fish, goat, donkey, hamster, or buffalo.

[0033] In some aspects, some embodiments disclosed herein relate to a method for producing a polypeptide of interest, comprising culturing a host cell containing a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, wherein the modified viral RNA replicon comprises: (i) a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; and (ii) a second nucleic acid sequence encoding at least one nonstructural protein or a portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence.

[0034] In some embodiments of the method for producing a polypeptide of interest according to the present disclosure, the subject is selected from the group consisting of humans, horses, pigs, primates, mice, ferrets, rats, cotton rats, cattle, wild boars, sheep, rabbits, cats, dogs, birds, fish, goats, donkeys, hamsters, and buffalo. In some embodiments, at least one of the one or more structural elements of the viral capsid enhancer comprises one or more RNA stem loops. In some embodiments, the viral capsid enhancer is derived from a capsid gene of a viral species belonging to the Togaviridae family. In some embodiments, the viral species belongs to the Alphavirus genus of the Togaviridae family. In some embodiments, the alphavirus species is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getau virus (GETA). The viral capsid enhancer may be selected from the group consisting of GET, Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), and Buggy Creek virus. In some embodiments, the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, wherein the DLP motif comprises at least one of one or more RNA stem loops. In some embodiments, the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46-52. In some embodiments, the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46-52.

[0035] In some embodiments disclosed herein, the nucleic acid sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie disease virus 2A (BmIFV2A), or a combination thereof. In some embodiments, the first nucleic acid sequence is operably positioned within a region of about 1 to 1,000 nucleotides downstream of the 5' end of the modified viral RNA replicon. The second nucleic acid sequence comprises substantially all of the coding sequences for the native viral nonstructural proteins of the corresponding unmodified viral RNA replicon.

[0036] In some embodiments, the modified viral RNA replicon comprises a modified RNA replicon derived from a virus species belonging to the genus Alphavirus in the family Togaviridae or the genus Arterivirus in the family Arteriviridae, hi some embodiments, the Arterivirus virus species is equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), or simian hemorrhagic fever virus (SHFV).

[0037] In some embodiments disclosed herein, the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises one or more expression cassettes, at least one of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). In some embodiments, the viral species is an arterivirus, and the first nucleic acid sequence is operably positioned upstream of the nucleic acid sequence encoding a portion or all of the pp1ab nonstructural proteins of the modified arterivirus RNA replicon. In some embodiments, the modified arterivirus RNA replicon further comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding a portion or all of the pp1ab nonstructural proteins of the modified arterivirus RNA replicon. In some embodiments, at least one of the one or more expression cassettes is located downstream of a transcriptional regulatory sequence (TRS) of the modified arterivirus RNA replicon, where the TRS is TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, or TRS7. In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, where the third nucleic acid sequence is operably linked upstream of the coding sequence of the GOI. In some embodiments, the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence of the GOI. In some embodiments, the coding sequence of the GOI encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof. In some embodiments, the coding sequence of the GOI encodes an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or any combination thereof.

[0038] In some embodiments, the modified viral RNA replicon is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus In some embodiments, the modified alphavirus RNA replicon comprises a modified RNA replicon derived from an alphavirus species selected from the group consisting of alphavirus genotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 110, 111, 112,

[0039] In some embodiments, the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence for a gene of interest (GOI). In some embodiments, the modified alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1-4, or a portion thereof, of the modified alphavirus RNA replicon. In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, the third nucleic acid sequence being operably linked upstream of the coding sequence for the GOI. In some embodiments, the modified alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. In some embodiments, the coding sequence of the GOI encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof, hi some embodiments, the coding sequence of the GOI encodes an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or any combination thereof.

[0040] In another aspect, some embodiments disclosed herein relate to a method for conferring resistance to the innate immune system in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, wherein the modified non-alphavirus RNA replicon comprises a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer, and expression of the modified non-alphavirus RNA replicon encoded by the nucleic acid molecule confers resistance to the innate immune response in the subject. In some embodiments, the subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo.

[0041] Also disclosed herein is a method for producing a polypeptide of interest in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, the modified non-alphavirus RNA replicon comprising a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer. In some embodiments, the subject is a human, horse, pig, primate, mouse, ferret, rat, cotton rat, cow, wild boar, sheep, rabbit, cat, dog, bird, fish, goat, donkey, hamster, or buffalo.

[0042] Some embodiments disclosed herein relate to a method for producing a polypeptide of interest, the method comprising culturing a host cell containing a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, the modified non-alphavirus RNA replicon comprising a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer.

[0043] In some embodiments according to the above aspects of the present disclosure, the modified non-alphavirus RNA replicon further comprises a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. In some embodiments, the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the modified non-alphavirus RNA replicon comprises a modified RNA replicon derived from a positive-strand RNA virus. In some embodiments, the modified non-alphavirus RNA replicon comprises a modified RNA replicon derived from a virus species belonging to the Togaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, or Paramyxoviridae families. In some embodiments, the modified non-alphavirus RNA replicon comprises a modified RNA replicon derived from a virus species belonging to the Arterivirus genus of the Arteriviridae family. In some embodiments, the sequence encoding the non-alphavirus modified RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). In some embodiments, the modified non-alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof of the modified non-alphavirus RNA replicon.In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer, wherein the third nucleic acid sequence is operably linked upstream of the coding sequence for the GOI. In some embodiments, the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI.

[0044] In some aspects, some embodiments disclosed herein relate to recombinant polypeptides produced by a method according to one or more embodiments described herein.

[0045] Some embodiments disclosed herein relate to compositions comprising a recombinant polypeptide described herein and a pharmaceutically acceptable carrier.

[0046] Some embodiments disclosed herein relate to compositions comprising a nucleic acid molecule disclosed herein and a pharmaceutically acceptable carrier.

[0047] In some embodiments, the compositions and / or molecules of the present application, such as one or more of nucleic acid molecules, RNA replicons, and polypeptides, are further formulated into a pharmaceutical formulation. In some embodiments, one or more of the compositions and / or molecules of the present application are formulated into a pharmaceutical formulation with a covalent compound, a non-covalent compound, a physical composition, or a pharmaceutically acceptable buffer.

[0048] In some embodiments disclosed herein, the compositions and / or molecules, e.g., one or more of the nucleic acid molecules, RNA replicons, and polypeptides, of the present application are further formulated for use as protective compositions (e.g., vaccines) or therapeutic compositions. In particular, the protective compositions produced in accordance with the present disclosure have a variety of uses, including, but not limited to, use as vaccines and other therapeutics, use as diagnostics, and use as antigens in the production of polyclonal or monoclonal antibodies.

[0049] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the exemplary embodiments and features described herein, further aspects, embodiments, objects and features of the present application will become more fully apparent from the drawings and detailed description, and from the claims. [Brief explanation of the drawings]

[0050] [Figure 1] FIG. 1 is a graphical representation showing non-limiting exemplary stem-loop RNA structures of alphavirus capsid enhancers. [Figure 2A]

[0023] Figures 2A-2D show graphical representations of four non-limiting exemplary nucleic acid molecules of the present disclosure. Each of the nucleic acid molecules comprises a coding sequence for an alphavirus capsid enhancer (e.g., a DLP motif) and a coding sequence for a gene of interest (GOI), e.g., a red firefly (rFF) reporter gene. Figure 2A: rEx-DLP-rFF; Figure 2B: rEx-DLP-pp1ab-rFF; Figure 2C: rEx-DLP-2A-pp1ab-rFF; and Figure 2D: rEx-DLP-2A-pp1ab-DLP-rFF. DLP: downstream loop sequence; 2A: autoprotease peptide; pp1ab: nonstructural polypeptide sequence; and rFF: coding sequence for the red firefly reporter gene. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above. [Figure 3A]

[0023] Figures 3A-3D show graphical representations of four non-limiting exemplary nucleic acid molecules of the present disclosure. Each of the nucleic acid molecules comprises a coding sequence for an alphavirus capsid enhancer (e.g., a DLP motif) and a coding sequence for a gene of interest (GOI), e.g., a red firefly (rFF) reporter gene. Figure 3A: alpha-R-rFF; Figure 3B: alpha-R-DLP-rFF; Figure 3C: alpha-R-DLP-2A-nsp-rFF; and Figure 3D: alpha-R-DLP-2A-nsp-DLP-rFF. DLP: downstream loop sequence; 2A: autoprotease peptide; nsp1-4: nonstructural polypeptide sequence; and rFF: coding sequence for the red firefly reporter gene. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 4A]

[0023] Figures 4A-4B show graphical representations of two other non-limiting exemplary nucleic acid molecules of the present disclosure. Each of the nucleic acid molecules comprises a coding sequence for an alphavirus capsid enhancer (e.g., a DLP motif) and a coding sequence for a gene of interest (GOI), e.g., a red firefly (rFF) reporter gene. Figure 4A: alpha-R-DLP-2A-rFF; and Figure 4B: alpha-R-DLP-2A-nsp-DLP-2A-rFF. DLP: downstream loop sequence; 2A: autoprotease peptide; nsp1-4: nonstructural polypeptide sequence; and rFF: coding sequence for the red firefly reporter gene. [Figure 4B] Same as above. [Figure 5A] The results of the flow cytometry and bulk luciferase analyses performed are graphically summarized, demonstrating that incorporating a DLP motif upstream of nucleic acid sequences encoding either EAV nonstructural protein genes or genes of interest located in the subgenomic RNA, i.e., the rFF reporter gene, did not adversely affect genomic RNA replication. In these experiments, FACS analysis (Figure 5A) and bulk cell luciferase assays (Figure 5B) were performed on electroporated cells. [Figure 5B] Same as above. [Figure 6A] Figure 6 graphically summarizes the results of another exemplary flow cytometry analysis and bulk luciferase analysis conducted to demonstrate that modified altereplicon RNAs with DLP motifs incorporated upstream of sequences encoding nonstructural protein genes can replicate and be efficiently expressed in host cells treated with IFN to induce the cells' innate immune system. In these experiments, FACS analysis (Figure 6A) and bulk cell luciferase assay (Figure 6B) were performed on electroporated cells. IFN was added to the cell culture medium 5 hours after electroporation. Samples were collected in triplicate 18 hours after electroporation for analysis. [Figure 6B] Same as above. [Figure 7A] Figure 7 graphically summarizes the results of another exemplary bulk luciferase assay performed to demonstrate that modified alphavirus replicon RNAs with DLP motifs incorporated upstream of sequences encoding nonstructural protein genes can replicate and efficiently express in host cells treated with IFN to induce the cellular innate immune system. In these experiments, bulk cell luciferase assays were performed on electroporated cells. IFN was added to the cell culture medium immediately after electroporation or 3 hours after electroporation. Samples were harvested in triplicate at 18 hours after electroporation for analysis. Figure 7A: α-rFF vs. alpha-R-rFF construct; Figure 7B: α-rFF vs. α-DLP-2A-nsp-rFF; and Figure 7C: α-rFF vs. alpha-R-DLP-2A-nsp-rFF construct. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 8]Figure 1 graphically summarizes the results of exemplary in vivo experiments conducted to demonstrate that modified alphavirus replicon RNAs with DLP motifs incorporated upstream of sequences encoding nonstructural protein genes can replicate and be efficiently expressed in Balb / c mice. In these experiments, whole-body imaging of animals injected with modified alphavirus replicon RNAs was performed. Each animal received an intramuscular injection of 7.5 μg of replicon RNA. Individual animals were imaged on days 1, 3, and 7. Original: mice injected with the alpha-R-rFF construct; DLP: mice injected with the alpha-R-DLP-2A-nsp-rFF construct. [Figure 9] Figure 1 shows a schematic representation of non-limiting exemplary alphavirus genome structure and expression (adapted from Straus et al., Microbiological Reviews, pp. 491-562, September 1994). The genome organization of Sindbis virus (SINV) is shown. The nonstructural and structural protein genes are named. References to gene and protein nomenclature can be found in Strauss et al. (supra, 1994). The 49S genomic RNA is shown schematically in the center, with translated ORFs indicated by open boxes. Small black boxes are conserved sequence elements. Open diamonds represent leaky opal stop codons. The nonstructural polyproteins and their processed products are shown above. Termination at the opal codon produces P123, whose primary replication function is thought to be as a proteinase acting in trans to process the polyprotein into an active RNA replicase. This proteinase domain is found within the nsP2 region. Read-through of the opal stop codon produces P1234, which allows for the formation of an active replicase. The 26S subgenomic mRNA is expanded at the bottom to show the structural ORF and its translation product. Polypeptides present in virions are shaded. vcRNA is the minus-strand complement of the genomic RNA. [Figure 10]This is a schematic representation of the EAV genome structure and genome expression strategy. The replicase and structural protein genes are named (references to gene and protein nomenclature can be found in Snijder et al., 2005). Below the genome organization, the structural relationship between the genome and the sg mRNA is depicted. The leader sequences and TRSs found at the 5' ends of EAV mRNAs are shown in blue and orange boxes, respectively. The ribosomal frameshift elements (RFSs) found in genome-length mRNA1 are indicated. The translated region of each mRNA is highlighted with a green line, and translationally silent regions are indicated with a red line. For each mRNA, only the translated open reading frame is shown. The right panel shows the typical pattern of EAV mRNA isolated from infected cells, visualized by hybridizing with a probe complementary to the 3' end of the genome, thus recognizing all viral mRNA species. [Figure 11A] Figures 11A-11B are schematic diagrams showing the predicted stem-loop RNA structure of the 5' CDS region of alphavirus mRNA 26S with a valley-peak topology. Two-dimensional (2D) models of the underlying RNA structures for the first 70-140 nucleotides of the CDS of seven representative alphavirus mRNAs (SINV, SFV, RRV, SAGV, GETV, MIDV, UNAV, BEBV, MAYV, and AURAV) are shown. Sequences are numbered from the start codon (AUGi), with A at position +1. The predicted structures are constructed based on SHAPE (Alternative 2'-Hydroxyl Acylation and Primer Extension) data (Toribio et al., 2016). [Figure 11B] Same as above. [Figure 12A]This figure graphically summarizes the results of an exemplary in vivo experiment conducted to demonstrate the effect of modified alphavirus replicon RNA on immunogenicity in Balb / c mice. In this experiment, 6- to 8-week-old BALB / c animals were primed with various doses of replicon RNA on days 0 and 42. Spleens and serum were collected on day 56. (a) Flow cytometry analysis using dextran (H-2Kd)IYSTVASSL; SEQ ID NO: 44) of HA-specific memory T cells (CD8+CD44+CD62LLoKLRG-1LoIL-7RaHiCXCR3Hi) and (b, c) IFN-γ ELISpot analysis quantifying CD8+ and CD4+ T cell effector responses are shown. Statistics were performed using a one-way analysis of variance (ANOVA) with multiple comparisons between matched doses. Figure 12A: A significant increase in memory precursor effector cells (MPECs) was observed with the DLP motif-containing constructs compared to comparable doses of unmodified replicons. Figure 12B: Effector T cell responses were measured by the number of antigen-specific HA cells secreting IFN-γ after stimulation with CD8+ T cells peptides. Figure 12C: Effector T cell responses were measured by the number of antigen-specific HA cells secreting IFN-γ after stimulation with CD4+ T cells peptides. [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 13]This figure graphically summarizes the results of an exemplary in vivo experiment conducted to demonstrate that a modified alphavirus replicon RNA with a DLP motif incorporated upstream of the sequence encoding a nonstructural protein gene effectively prevents immune response suppression upon pretreatment with an agent simulating viral infection in BALB / c mice. To simulate ongoing viral infection, 6- to 8-week-old BALB / c animals were pretreated with 20 μg of poly(I:C) or saline via hydrodynamic tail vein injection 24 h prior to vaccination. Mice were then primed on day 0 and boosted on day 28 with a 1.5 μg dose of HA-encoding RNA replicon. Serum was collected on day 42, and HA-specific antibodies were measured in the serum. Serum antibody concentrations were calculated by interpolation of dilution versus optical density in a four-parameter logistic regression using 8D2 HA-specific monoclonal antibody as a standard. Statistics between individual groups were performed using the Mann-Whitney (nonparametric) test. [Figure 14A]Figure 14A graphically summarizes the results of an in vivo experiment conducted to demonstrate that DLP-containing replicons according to the present disclosure are compatible with LNP (cationic lipid nanoparticle) formulations. In this experiment, 6-8 week-old BALB / c animals were primed on day 0 and boosted on day 28 with various doses of HA-encoding RNA replicon. Spleens and serum were collected on day 42. Figure 14A: HA-specific antibodies were measured in serum. Serum antibody titers were calculated as the reciprocal of EC20% by interpolation of dilution versus optical density in a four-parameter logistic regression. Figure 14B: IFN-γ ELISpot was used to quantify CD8+ cell effector responses. To detect antigen-specific CD8+ T cells, splenocytes were incubated with H-2 Kd (IYSTVASSL; SEQ ID NO: 44) peptide. Figure 14C: IFN-γ ELISpot was used to quantify CD4+ T cell effector responses. To detect antigen-specific CD4+ T cells, splenocytes were incubated with the H2-D-restricted CD4 T cell epitope KSSFFRNVVWLIKKN (SEQ ID NO: 45). Statistics between individual groups were performed using the Mann-Whitney (non-parametric) test. [Figure 14B] Same as above. [Figure 14C] Same as above. [Figure 15]

[0023] Figure 1 shows a non-limiting exemplary configuration of a DLP-containing mRNA in which a Sindbis virus DLP element is placed upstream of the coding sequence of a gene of interest (GOI; dsGFP), and a 5'UTR sequence is placed immediately downstream of a T7 promoter and upstream of the Sindbis virus DLP sequence. The coding sequence of dsGFP is linked to the DLP element via the P2A signal, an autocatalytic self-cleaving peptide (e.g., autoprotease peptide) derived from porcine teschovirus-1. The bottom of the figure also shows another non-limiting exemplary configuration of a DLP-containing mRNA in which the coding sequence of a destabilized form of the EGFP reporter gene (dsGFP) used as the GOI is operably linked to the proteolytic PEST degradation signal derived from the mouse ornithine decarboxylase gene (MODC). [Figure 16A] Figure 16 graphically summarizes the results of experiments conducted to demonstrate that DLP-containing modified mRNA can confer interferon resistance. Figure 16A: Inclusion of DLP in mRNA statistically significantly increases the frequency of GFP-positive cells in the presence of IFN. Mean values ​​with 95% confidence intervals in a Kruskai-Wallist test (nonparametric). Figure 16B: Unmodified mRNA is sensitive to IFN treatment (mean values ​​with 95% confidence intervals in a two-way ANOVA). Interaction: p=0.0083. Row: p=<0.0001. Column: p=0.0273. *Sidak's multiple comparison test with p=0.0217 and #p=<0.0241. Figure 16C: DLP-modified mRNA results in a statistically significant 30% increase in protein production per cell compared to unmodified mRNA in the presence of IFN (Sidak's multiple comparison test with means at 95% confidence intervals in a two-way ANOVA: p=<0.0001, ***p=<0.0002, and ****p=<0.0001, respectively). Figure 16D: DLP-modified mRNA in the presence of IFN produces equal amounts of protein compared to unmodified mRNA in the absence of IFN treatment (Sidak's multiple comparison test with means at 95% confidence intervals in a two-way ANOVA: interaction: p=<0.0001, row: p=<0.0001, column: p=0.0023, respectively). [Figure 16B] Same as above. [Figure 16C] Same as above. [Figure 16D] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0051] These and other features of the present disclosure will become more fully apparent from the following description and appended claims, taken in conjunction with the accompanying drawings. It should be understood that these drawings illustrate only some embodiments according to the present disclosure and should not be considered limiting of its scope. The present disclosure will be described with additional specificity and detail through the use of the accompanying drawings.

[0052] The present disclosure generally relates to compositions and methods for use in regulating gene expression in cells. Some embodiments of the present disclosure relate to expression systems, such as virus-based expression systems, that have excellent expression capabilities in recombinant cells and are suitable for expressing heterologous molecules, such as vaccines and therapeutic polypeptides. For example, some embodiments of the present disclosure relate to nucleic acid molecules comprising one or more structural elements of a viral capsid enhancer or variants thereof. In some embodiments, at least one of the one or more structural elements comprises an RNA stem-loop. In some embodiments, at least one of the one or more structural elements is operably linked to a coding sequence of a gene of interest. Some embodiments of the present disclosure relate to nucleic acid molecules, such as transcription and / or expression constructs and vectors, comprising a nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer. Also disclosed herein in some embodiments are transcription vectors and expression vectors, such as virus-based vectors, that comprise a coding sequence of a gene of interest. In some embodiments, the nucleic acid molecules of the present disclosure, such as messenger (mRNA) and RNA replicons, are generated by de novo synthesis and / or in vitro transcription. Recombinant cells genetically engineered to contain one or more of the nucleic acid molecules disclosed herein, as well as biological materials and recombinant products derived from such cells, are within the scope of this application. Further provided herein are compositions and kits comprising one or more of the nucleic acid molecules and / or recombinant cells disclosed herein, as well as methods for conferring resistance to the innate immune system in host cells.

[0053] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, like symbols generally identify like components unless the context dictates otherwise. The illustrative alternatives set forth in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects generally described herein and illustrated in the figures can be arranged, substituted, combined, and designed in a variety of different configurations, all of which are expressly contemplated and made a part of this application.

[0054] Unless otherwise defined, all technical terms, notations, and other scientific or technical terms used herein are intended to have the meaning commonly understood by those skilled in the art to which this application pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or ease of reference. The inclusion of such definitions herein should not necessarily be interpreted as representing a substantial difference from what is commonly understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly used by those skilled in the art using conventional methodology.

[0055] definition The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof.

[0056] As used herein, the term "about" has its ordinary meaning of approximately. Unless the degree of approximation is otherwise clear from the context, "about" means either within ±10% of the provided value, or, in all cases, rounded to the nearest significant figure inclusive of the provided value. When a range is provided, the range includes the boundary values.

[0057] As used herein, the terms "cell," "cell culture," "cell line," "recombinant host cell," "recipient cell," and "host cell" include the primary subject cell and any progeny thereof, regardless of the number of transfers. In some cases, the progeny may not be completely identical to the parent cell (due to deliberate or inadvertent mutations or differences in environment). However, such modified progeny are included within these terms so long as the progeny retain the same or substantially similar functionality as the originally transformed cell.

[0058] As used herein, the term "construct" is intended to mean any recombinant nucleic acid molecule, such as an expression cassette, plasmid, cosmid, fosmid, viral replicon, shuttle vector, autonomously replicating polynucleotide molecule, bacteriophage, or linear or circular single-stranded or double-stranded DNA or RNA polynucleotide molecule, including nucleic acid molecules derived from any source and capable of genomic integration or autonomous replication and in which nucleic acid sequences are linked in a functionally operating manner, e.g., operably linked.

[0059] As used herein, the term "derived from" refers to origin or source and can include naturally occurring, recombinant, unpurified, or purified molecules. The molecules of the present disclosure can be derived from viral or non-viral molecules. A protein or polypeptide derived from an original protein or polypeptide can partially or entirely comprise the original protein or polypeptide, and can be a fragment or variant of the original protein or polypeptide.

[0060] The term "gene" is used broadly to refer to any segment of a nucleic acid molecule that encodes a protein or can be transcribed into functional RNA. A gene may include sequences that are transcribed but are not part of the final RNA transcript, the mature RNA transcript, and / or the functional RNA transcript, and a protein-encoding gene may further include sequences that are transcribed but not translated, such as 5' untranslated regions, 3' untranslated regions, introns, etc. Furthermore, genes may optionally further include regulatory sequences required for their expression, and such sequences may be, for example, untranscribed or untranslated sequences. Genes can be obtained from various sources, such as by cloning from a desired source or by synthesis from known or predicted sequence information, and may include sequences designed to have desired parameters.

[0061] The term "native" is used herein to refer to a nucleic acid sequence or amino acid sequence that is naturally present in a host. The term "non-natural" is used herein to refer to a nucleic acid sequence or amino acid sequence that is not naturally present in a host or is not located as it is naturally located in a host. A nucleic acid sequence or amino acid sequence that has been removed from a host cell, subjected to laboratory manipulation, and introduced or reintroduced into a host cell is considered "non-natural." A synthetic or partially synthetic gene introduced into a host cell or organism is "non-natural." Non-native genes also include genes endogenous to a host cell that are operably linked to one or more heterologous regulatory sequences recombined into the host genome, or genes endogenous to a host cell or organism at a genomic locus other than where they naturally occur.

[0062] As used herein, the terms "naturally occurring" and "wild-type" refer to a form found in nature. For example, a naturally occurring or wild-type nucleic acid molecule, nucleic acid sequence, or protein is present in, and may be isolated from, a natural source and is not intentionally modified by human manipulation. As described in more detail below, nucleic acid molecules according to some embodiments of the present disclosure are non-naturally occurring nucleic acid molecules.

[0063] The term "heterologous" when used with respect to a polynucleotide, gene, or nucleic acid molecule refers to a polynucleotide, gene, or nucleic acid molecule that is not native to the host species. For example, as used herein, a "heterologous gene" or "heterologous nucleic acid sequence" refers to a gene or nucleic acid sequence derived from a species different from that of the host organism into which it is introduced. For example, when referring to a gene regulatory sequence such as an enhancer sequence, or an auxiliary nucleic acid sequence (e.g., a 5' untranslated region, a 3' untranslated region, a polyA addition sequence, etc.) used to manipulate the expression of a gene sequence, or a nucleic acid sequence encoding a protein domain, or a protein localization sequence, "heterologous" means that the regulatory or auxiliary sequence, or the sequence encoding the protein domain, or the localization sequence is derived from a source different from the gene, and that the regulatory or auxiliary nucleic acid sequence, or the nucleic acid sequence encoding the protein domain, or the localization sequence is juxtaposed within the genome. Thus, a promoter operably linked to a gene to which it is not operably linked in its natural state (e.g., in the genome of a non-genetically engineered organism) is referred to herein as a "heterologous promoter," even if the promoter is derived from the same species (or, in some cases, the same organism) as the linked gene. For example, in some embodiments disclosed herein, the coding sequence of a heterologous gene of interest (GOI) is not, in its natural state, linked to a recombinant RNA replicon sequence. In some embodiments, the coding GOI sequence is derived from another organism, such as another virus, a bacterium, a fungus, a human cell (tumor Ag), a parasite (malaria), etc.

[0064] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to both RNA and DNA molecules, including cDNA, genomic DNA, synthetic DNA, and nucleic acid analogs, including DNA or RNA molecules. Nucleic acid molecules can have any three-dimensional structure. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense or antisense). Non-limiting examples of nucleic acid molecules include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, siRNA, microRNA, tracrRNA, crRNA, guide RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, nucleic acid probes, and nucleic acid primers. Nucleic acid molecules may contain unconventional or modified nucleotides. As used herein, the terms "polynucleotide sequence" and "nucleic acid sequence" interchangeably refer to the sequence of a polynucleotide molecule. The nucleotide base nomenclature set forth in 37 C.F.R. § 1.822 is used herein. Nucleic acid molecules of the present disclosure can be synthesized ex vitro by any means known in the art, for example, using one or more chemical or enzymatic techniques (e.g., by using chemical nucleic acid synthesis or by using enzymes for replication, polymerization, exonuclease digestion, endonuclease digestion, ligation, reverse transcription, transcription, base modification (e.g., methylation), or recombination (e.g., homologous and site-specific recombination) of nucleic acid molecules). In some embodiments, nucleic acid molecules of the present disclosure are generated from de novo synthesis. In some embodiments, nucleic acid molecules can be synthesized in whole or in part de novo using known chemical methods, known enzymatic techniques, or any combination thereof. For example, component nucleic acid sequences can be synthesized by solid-phase techniques, removed from the resin, purified by preparative high performance liquid chromatography, and then chemically coupled and / or enzymatically ligated to form chimeric nucleic acid molecules. The composition of the synthetic nucleic acid molecules can be confirmed by nucleic acid analysis or sequencing.In some embodiments, the nucleic acid molecules of the present disclosure can be enzymatically assembled from chemically synthesized oligonucleotides using techniques known in the art.

[0065] Nucleic acid molecules of the present disclosure can be of any length, for example, from about 0.5 Kb to about 1000 Kb, from about 0.5 Kb to about 500 Kb, from about 1 Kb to about 100 Kb, from about 2 Kb to about 50 Kb, or from about 5 Kb to about 20 Kb. In some embodiments, the nucleic acid molecule is 0.5Kb, 1Kb, 2Kb, 3Kb, 4Kb, 5Kb, 6Kb, 7Kb, 8Kb, 9Kb, 10Kb, 15Kb, 20Kb, 25Kb, 30Kb, 40Kb, 50Kb, 100Kb, 200Kb, 500Kb, 1Mb, or about 0.5Kb, 1Kb, 2Kb, 3Kb, 4Kb, 5Kb, 6Kb, 7Kb, 8Kb, 9Kb, 10Kb, 15Kb, 20Kb, 25Kb, 30Kb, 40Kb, 50Kb, 100Kb, 200Kb, 500Kb, 1Mb, or more, or a range between any two of these values.

[0066] Polynucleotides of the present disclosure can be "biologically active" with respect to either a structural attribute, such as the ability of the nucleic acid to hybridize with another nucleic acid, or the ability of the polynucleotide sequence to be recognized and bound by one or more of a transcription factor, a ribosome, and a nucleic acid polymerase.

[0067] As used herein, the term "recombinant" or "engineered" nucleic acid molecule refers to a nucleic acid molecule that has been modified through human intervention. As a non-limiting example, cDNA is a recombinant DNA molecule, as is any nucleic acid molecule produced by ex vitro polymerase reaction(s), or to which a linker has been attached, or which has been incorporated into a vector (such as a cloning vector or an expression vector). As a non-limiting example, a recombinant nucleic acid molecule is: 1) synthesized or modified ex vitro, for example, using chemical or enzymatic techniques (e.g., by using chemical nucleic acid synthesis or by using enzymes for replication, polymerization, exonuclease digestion, endonuclease digestion, ligation, reverse transcription, transcription, base modification (e.g., methylation), or recombination (such as homologous and site-specific recombination) of nucleic acid molecules; 2) contains essentially unlinked linked nucleotide sequences; 3) has been engineered using molecular cloning techniques to delete one or more nucleotides from a naturally occurring nucleic acid molecule sequence; and / or 4) has been engineered using molecular cloning techniques to have one or more sequence changes or rearrangements from a naturally occurring nucleic acid sequence. As a non-limiting example, a cDNA is a recombinant DNA molecule, as is any nucleic acid molecule produced by ex vitro polymerase reaction(s), or to which a linker is attached, or which is incorporated into a vector, such as a cloning vector or an expression vector. In some embodiments disclosed herein, the recombinant nucleic acid molecules of the present application are produced from de novo synthesis.

[0068] The term "variant" of a protein as used herein refers to a polypeptide having an amino acid sequence that is identical or essentially identical to that of a reference protein, except that at least one amino acid has been modified, for example, deleted, inserted, or substituted, respectively. The amino acid substitution may be a conservative amino acid substitution, preferably at a non-essential amino acid residue in the protein. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are known in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). A variant of a protein can have an amino acid sequence that is at least about 80%, 90%, 95%, or 99%, preferably at least about 90%, more preferably at least about 95%, identical to the amino acid sequence of the protein. Preferably, the variant is a functional variant of the protein that retains the same function as the protein. The term "variant" when used in reference to nucleic acid sequence refers to a nucleic acid sequence that differs from another by one or more nucleotides, usually a related nucleotide sequence.Therefore, the term "variant" can refer to one or more nucleotides of a reference nucleic acid that have been changed, such as the insertion of one or more new nucleotides, the deletion of one or more nucleotides, and the substitution of one or more existing nucleotides.A "mutation" is the difference between two different nucleotide sequences, and typically one sequence is a reference sequence.Generally, the term "nucleotide mutation" used herein includes point mutation, multiple mutation, single nucleotide polymorphism (SNP), deletion, insertion, and translocation.The term "reference nucleic acid" is used herein to describe a nucleotide sequence that has a known reference sequence of interest.

[0069] As used herein, the term "identical" or percent "identity" in the context of two or more nucleic acid or polypeptide sequences refers to two or more sequences or subsequences that are identical or have a specified percentage (percentage) of amino acid residues or nucleotides that are identical when compared and aligned for maximum matching within a comparison window. Unless otherwise specified, the comparison window for a selected sequence (e.g., "SEQ ID NO: X") is the entire length of SEQ ID NO: X; for example, the comparison window for "100 bp of SEQ ID NO: X" is the stated 100 bp. The degree of amino acid or nucleic acid sequence identity can be determined by various computer programs for aligning the sequences being compared based on the specified program parameters. For example, sequences can be aligned and compared using the local homology algorithm of Smith & Waterman Adv. Appl. Math. 2:482-89, 1981, using the homology alignment algorithm of Needleman & Wunsch J. Mol. Biol. 48:443-53, 1970, or using the search for similarity method of Pearson & Lipman Proc. Nat'l. Acad. Sci. USA 85:2444-48, 1988, can be aligned and compared based on visual inspection, or can use computer programs (e.g., GAP, BESTFIT, FASTA, and TFASTA (Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI)) for analysis.

[0070] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-87, 1993). The minimum sum probability (P(N)) provides an indication of the probability that a match between two nucleotide or amino acid sequences may occur by chance. For example, if the minimum sum probability in the comparison between the test nucleic acid and the reference nucleic acid is less than about 0.1, preferably less than about 0.01, more preferably less than about 0.001, the nucleic acid is considered to be similar to the reference sequence.

[0071] As used herein, the term "vector" refers to a recombinant polynucleotide construct designed for transfer into or between host cells and used for transformation, e.g., introducing heterologous DNA into a host cell. A vector can be a replicon, such as a plasmid, bacteriophage, or cosmid, into which another DNA segment can be inserted to cause replication of the inserted segment. Generally, a vector is capable of replication when associated with appropriate control elements. The term "vector" includes cloning and expression vectors, as well as viral and integrating vectors. An "expression vector" is a vector containing a regulatory region, thereby allowing expression of DNA sequences and fragments thereof, for example, ex vitro, ex vivo, and in vivo. In some embodiments, the vector is a plasmid, bacteriophage vector, cosmid, fosmid, viral replicon, or a combination thereof. In some embodiments, the vector is a eukaryotic vector, a prokaryotic vector (e.g., a bacterial plasmid), or a shuttle vector. The expression system can be, for example, an expression vector or an expression cassette. In some embodiments, the vector is a transcription vector. The term "transcription vector" refers to a vector that can be transcribed but not translated. For example, transcription vectors can be used to amplify their inserts.

[0072] Viral-based "replicon" expression vectors can be used, for example, as vaccines and therapeutic compositions. Replicon vectors can be used in several formats, including DNA, RNA, and recombinant viral particles. The effectiveness of viral replicon vectors in applications such as vaccines has now been demonstrated in various publications. Furthermore, these terms are sometimes collectively referred to as vectors, vector constructs, or gene delivery vectors.

[0073] As will be understood by those skilled in the art, for any and all purposes, including those relating to providing a written description, all ranges disclosed herein encompass any and all possible subranges and combinations of those subranges. Any recited range can be readily recognized as fully describing and allowing for at least one-half, one-third, one-quarter, one-fifth, one-tenth, etc., of that same range. As a non-limiting example, each range discussed herein can be readily subdivided into a lower third, middle third, and upper third, etc. As will also be understood by those skilled in the art, language such as "up to," "at least," "greater than," and "less than" all refer to ranges that are inclusive of the recited numbers and that can then be subdivided into subranges as described above. Finally, as will be understood by those skilled in the art, a range includes each individual element. Thus, for example, a group having 1 to 3 entities refers to a group having 1, 2, or 3 entities. Similarly, a group having 1 to 5 entities refers to a group having 1, 2, 3, 4, or 5 entities.

[0074] Viral Capsid Enhancer Some viruses possess sequences capable of forming one or more stem-loop structures that regulate (e.g., increase) capsid gene expression. The term "viral capsid enhancer" is used herein to refer to a regulatory element containing a sequence capable of forming such a stem-loop structure. In some instances, the stem-loop structure is formed by a sequence within the coding sequence of a capsid protein and is referred to as a downstream loop (DLP) sequence. As disclosed herein, these stem-loop structures or variants thereof can be used to regulate, e.g., increase, the expression level of a gene of interest. For example, these stem-loop structures or variants thereof can be used in recombinant vectors (e.g., heterologous viral genomes) to enhance the transcription and / or translation of a coding sequence operably linked downstream thereof. As an example, members of the alphavirus genus can resist the activation of antiviral RNA-activated protein kinase (PKR) due to a prominent RNA structure present in viral 26S transcripts, which allows eIF2-independent initiation of translation of these mRNAs. This structure, called the downstream loop (DLP), is located downstream from the AUG in SINV26S mRNA and other members of the Alphavirus genus. In Sindbis virus, the DLP motif is found in the first approximately 150 nt of the Sindbis subgenomic RNA. The hairpin is located downstream of the Sindbis capsid AUG start codon (the AUG is located at nt 50 of the Sindbis subgenomic RNA). Previous sequence comparison and structural RNA analysis studies have revealed the evolutionary conservation of the DLP in SINV and predicted the existence of equivalent DLP structures in many members of the Alphavirus genus (see, e.g., Ventoso, J. Virol. 9484-9494, Vol. 86, September 2012).

[0075] PKR phosphorylates eukaryotic translation initiation factor 2α (eIF2α). Phosphorylation of eIF2α blocks mRNA translation initiation, thereby preventing the virus from completing a productive replication cycle. PKR is activated by interferon and double-stranded RNA. Alphavirus replication in host cells is known to induce double-stranded RNA-dependent protein kinase (PKR). For example, Sindbis virus infection of cells induces PKR, leading to the phosphorylation of eIF2α, resulting in efficient translation of viral subgenomic mRNAs while restricting translation of all other cellular mRNAs. Sindbis virus subgenomic mRNAs contain a stable RNA hairpin loop located downstream of the wild-type AUG initiator codon of the viral capsid protein (e.g., capsid enhancer). This hairpin loop RNA structure, also known as a stem-loop, is often referred to as the downstream loop structure (or DLP motif). DLP structures can stall ribosomes at wild-type AUGs, which has been reported to support the translation of subgenomic mRNAs without the need for functional eIF2α. Thus, the subgenomic mRNAs of Sindbis virus (SINV) and other alphaviruses are efficiently translated even in cells with highly active PKR, resulting in the complete phosphorylation of eIF2α.

[0076] Structure of alphavirus DLP DLP structures were first characterized in Sindbis virus (SINV) 26S mRNA and were also detected in Semliki Forest virus (SFV). Similar DLP structures have been reported to exist in at least 14 other species of the alphavirus genus, including members of the New World (e.g., MAYV, UNAV, EEEV(NA), EEEV(SA), AURAV) and Old World (SV, SFV, BEBV, RRV, SAG, GETV, MIDV, CHIKV, and ONNV). The predicted structures of these alphavirus 26S mRNAs were constructed based on SHAPE (selective 2'-hydroxyl acylation and primer extension) data (Toribio et al., Nucleic Acids Res. May 19;44(9):4368-80, 2016, the contents of which are incorporated herein by reference). Stable stem-loop structures were detected in all viruses except CHIKV and ONNV, whereas MAYV and EEEV exhibited less stable DLPs (Figure 11A-B and see Toribio et al., 2016, supra). The highest DLP activity was reported in alphaviruses, which contain the most stable DLP structures. In some cases, DLP activity depends on the distance between the DLP motif and the initiation codon AUG (AUGi). The AUG-DLP spacing in alphavirus 26S mRNAs is adjusted to the topology of the ES6S region of the ribosomal 18S rRNA in a manner that allows AUGi to be positioned at the P site of the stalled 40S subunit by DLP, thereby enabling the incorporation of Met-tRNA without the involvement of eIF2. Two main topologies were detected: a compact and stable structure in the SFV clade and a more elongated structure in the SINV group. In both cases, the DLP structures were observed to be preceded by a region of strong SHAPE reactivity, suggesting the single-stranded nature of the AUG-DLP stretch. This region therefore exhibits a low propensity to form secondary structures with a high A content and a low G content when compared at equivalent positions in the whole mouse mRNA transcriptome or in DLP-depleted alphavirus mRNAs.These results, reported by Toribio et al. (2016, supra), suggest that the occurrence of DLPs in alphaviruses is probably associated with flattening of the preceding region, resulting in the valley-peak topology of this mRNA region.

[0077] In the case of Sindbis virus, the DLP motif is found in the first approximately 150 nt of the Sindbis subgenomic RNA. A hairpin is placed downstream of the Sindbis capsid AUG start codon (AUG at nt 50 of the Sindbis subgenomic RNA) to stall the ribosome so that the correct capsid gene AUG is used to initiate translation. This is because the hairpin causes the ribosome to pause, eliminating the need for eIF2α to assist in translation initiation. Without being bound by any particular theory, it is believed that placing a DLP motif upstream of the coding sequence of any GOI typically results in a fusion protein of the N-terminal capsid amino acids encoded in the hairpin region to the GOI-encoded protein. This is because initiation occurs at the capsid AUG rather than the GOI AUG. In some embodiments disclosed herein, the porcine teschovirus-1 2A (P2A) peptide sequence was engineered in-frame immediately after the DLP sequence and immediately upstream of all GOIs. Incorporation of the P2A peptide into the modified viral RNA replicon of the present disclosure allows for release of nearly intact GOI proteins from the capsid-GOI fusion, with a single proline residue added to all GOI proteins.

[0078] Without being bound by any particular theory, it is believed that DLPs can enable translation to occur in an eIF2α-independent manner, resulting in increased functionality of engineered nucleic acid molecules and expression vectors (e.g., RNA replicon vectors) used to initiate translation of nonstructural proteins in cells with activated innate immune systems. Therefore, DLP-engineered nucleic acid molecules and expression vectors (e.g., RNA replicon vectors) are also contemplated to function more uniformly in different cells, individuals, or populations of individuals. This is, of course, due to the variability caused by differences in the level of innate immune activation in each individual. In some embodiments, the translation and replication of RNA replicon vectors (and expression of GOIs) may be less affected by pre-existing innate immune responses, and DLPs may help eliminate this variability. One of the significant values ​​of the compositions and methods disclosed herein is that they may enhance vaccine efficacy in individuals with chronic or acute immune activation. Causes of chronic or acute immune activation are found in individuals who are asymptomatic or suffering from clinical infections, or who are undergoing medical treatment for cancer or other diseases (e.g., diabetes, malnutrition, hypertension, heart disease, Crohn's disease, muscular sclerosis, etc.).

[0079] As described herein, the DLP-containing nucleic acid molecules (e.g., transcription vectors and expression vectors (e.g., RNA viral replicons)) disclosed herein can be useful for conferring resistance to the innate immune system in a subject. Unmodified RNA replicons are sensitive to the initial innate immune system state of the cell into which they are introduced. When a cell / individual has a highly active innate immune system state, RNA replicon performance (e.g., replication and expression of a GOI) can be adversely affected. By engineering DLPs to control the initiation of translation of proteins, particularly nonstructural proteins, the influence of the existing activation state of the innate immune system to affect efficient RNA replicon replication is eliminated or reduced. The result is more consistent and / or enhanced GOI expression, which can affect the efficacy of a vaccine or the therapeutic impact of a treatment.

[0080] Arteriviruses Arteriviruses (family Arteriviridae, genus Arterivirus) encompass an important group of enveloped, single-stranded, positive-sense RNA viruses that infect domestic and wild animals. Arteriviruses share similar genome organization and replication strategies with members of the Coronaviridae family (genera Coronavirus and Torovirus), but differ significantly in their genetic complexity, genome length, biophysical properties, size, structure, and structural protein composition of virus particles (e.g., virions). The Arterivirus genus is currently believed to include equine arteritis virus (EAV), porcine reproductive and respiratory syndrome virus (PRRSV), lactate dehydrogenase-elevating virus of mice (LDV), simian hemorrhagic fever virus (SHFV), and wobbly possum disease virus (WPDV).

[0081] Typical arterivirus genomes vary in length from 12.7 to 15.7 kb, but their genome organization is relatively consistent with some minor variations. An exemplary genome organization and virion structure of an arterivirus is shown in Figure 10. The arterivirus genome is a polycistronic + RNA with 5' and 3' untranslated regions (NTRs) flanking an array of 10 to 15 known ORFs. The large replicase ORFs 1a and 1b occupy the 5' proximal three-quarters of the genome, with the size of ORF 1a being much more variable than that of ORF 1b. Translation of ORF 1a produces replicase polyprotein (pp) 1a, while ORF 1b is expressed by a -1 programmed ribosomal frameshift (PRF), extending pp1a to pp1ab at the C-terminus. Additionally, a short trans-frame ORF, overlapping the nsp2 coding region of ORF 1a in the +1 frame, has been reported to be expressed by a -2 PRF. The 3'-proximal genome region has a compact organization, containing 8-12 relatively small genes, most of which overlap with adjacent genes. These ORFs encode structural proteins and are expressed from a set of nested sg mRNAs at the 3' end. While the organization of these ORFs is conserved, downstream of ORF1b, SHFV and all recently identified SHFV-like viruses contain 3-4 ORFs (approximately 1.6 kb) that are likely derived from the ancient duplication of ORF2-4. Together with the variation in the size of ORF1a, these inferred duplications explain the differences in genome size among arteriviruses.

[0082] Regarding equine arteritis virus (EAV), the wild-type EAV genome is approximately 12.7 kb in size. The 5' three-quarters of the genome encodes two large replicase proteins, 1a and 1ab. The amino acid sequences of these two proteins are identical at the N-terminus, but due to ribosomal frameshifting, the amino acid sequence of the C-terminal region of 1ab is unique. The 3' one-quarter of the EAV genome encodes the viral structural protein genes, all of which are expressed from subgenomic RNAs. The subgenomic RNAs form a set of nested 3' coterminal RNAs generated via a discontinuous transcription mechanism. The subgenomic RNAs are composed of sequences that are not adjacent to the genomic RNA. All EAV subgenomic RNAs share a common 5' leader sequence (156-221 nt in length) that is identical to the genomic 5' sequence. The leader and body portions of the subgenomic RNAs are connected by a conserved sequence called the transcriptional regulatory sequence (TRS). TRSs are found at the 3' end of the leader (leader TRS) and in the subgenomic promoter regions (body TRSs) located upstream of each structural protein gene. Subgenomic RNAs are generated each time a minus-strand replication intermediate RNA is transcribed. As transcription occurs, the replication complex pauses at each body TRS, and the nascent minus-strand RNA then associates with the complementary plus-strand leader TRS, followed by minus-strand RNA transcription. This discontinuous transcription mechanism results in subgenomic RNAs with both 5' and 3' EAV-conserved sequences. The minus-strand subgenomic RNA then serves as a template for producing subgenomic plus-sense mRNAs.

[0083] Infectious cDNA clones representing the entire EAV genome have been reported, and these clones have been used for nearly 20 years to study EAV RNA replication and transcription. Furthermore, infectious clones containing the chloramphenicol acetyltransferase (CAT) gene inserted in place of ORF2 and ORF7 have been generated, and the CAT protein has been shown to be expressed in cells electroporated with these RNAs. Modification of infectious clones by site-directed mutagenesis and deletion of structural protein gene regions has been used to determine whether each structural gene is required to support RNA replication (Molenkamp 2000). The study reported by Molenkamp 2000 concluded that the structural genes are not required to support RNA replication. Analysis of the sequence homology requirements for TRS activity in the production of subgenomic RNAs has been performed and used to better define how discontinuous transcription occurs mechanistically (van Marle 1999, Pasternak 2000, Pasternak 2001, Pasternak 2003, van den Born 2005), and defective interfering RNAs have been used to understand the minimal genomic sequence required for RNA replication and packaging into viral particles (Molenkamp 2000a).

[0084] Alphaviruses Alphaviruses are a genus of genetically, structurally, and serologically related viruses in the Togaviridae family of group IV, including at least 30 members. Each member possesses a single-stranded RNA genome of positive polarity enclosed in a nucleocapsid surrounded by an envelope containing viral spike proteins. Currently, the alphavirus genus includes, among others, Sindbis virus (SIN), Semliki Forest virus (SFV), Ross River virus (RRV), Venezuelan equine encephalitis virus (VEEV), and Eastern equine encephalitis virus (EEEV). These viruses are all closely related and can infect a variety of vertebrates, including mammals, rodents, fish, and birds, as well as larger mammals such as humans or horses, as well as invertebrates such as insects. Transmission between species and individuals occurs primarily via mosquitoes, making alphaviruses a part of the arbovirus, or arthropod-borne, collection of viruses. Sindbis and Semliki Forest viruses, in particular, have been extensively studied, and their life cycles, replication modes, and other aspects have been well characterized. In particular, alphaviruses have been shown to replicate very efficiently in animal cells, making them valuable vectors for producing proteins and nucleic acids in such cells.

[0085] Alphavirus particles are enveloped, tend to be spherical (although slightly polymorphic), and have an isometric nucleocapsid of approximately 40 nm. Figure 9 shows a typical alphavirus genome structure and expression. The alphavirus genome is a single-stranded RNA of positive polarity, approximately 11-12 kb in length, containing a 5' cap, a 3' polyA tail, and two open reading frames. The first open reading frame encodes nonstructural proteins with enzymatic functions, and the second encodes viral structural proteins (e.g., capsid protein C, E1 glycoprotein, E2 glycoprotein, E3 protein, and 6K protein).

[0086] The 5' two-thirds of the alphavirus genome encodes numerous nonstructural proteins required for viral RNA transcription and replication. These proteins are translated directly from RNA and, together with cellular proteins, form the RNA-dependent RNA polymerase, essential for viral genome replication and subgenomic RNA transcription. Four nonstructural proteins (nsP1-4) are produced as a single polyprotein that constitutes the viral replication machinery. Polyprotein processing occurs in a highly regulated manner, and cleavage at the P2 / 3 junction affects the use of RNA templates during genome replication. This site is located at the base of a narrow cleft and is not easily accessible. Once cleaved, nsP3 creates a ring structure surrounding nsP2. These two proteins have an extensive interface. Mutations in nsP2 that produce noncytopathic viruses or temperature-sensitive phenotypes are concentrated in the P2 / P3 interface region. P3 mutations opposite the location of nsP2 noncytopathic mutations prevent efficient P2 / 3 cleavage. This in turn can affect RNA infectivity and alter the level of viral RNA production.

[0087] The 3' third of the genome contains a subgenomic RNA that serves as a translation template for all structural proteins required for viral particle formation (core nucleocapsid protein C and envelope proteins P62 and E1, which assemble as a heterodimer). Viral membrane-anchored surface glycoproteins are involved in receptor recognition and membrane fusion for entry into target cells. The subgenomic RNA is transcribed from the p26S subgenomic promoter, located at the 3' end of the RNA sequence encoding the nsp4 protein. Proteolytic cleavage of P62 into E2 and E3 triggers changes in the viral surface. E1, E2, and sometimes E3 glycoprotein "spikes" combine to form E1 / E2 dimers or E1 / E2 / E3 trimers. E2 extends from the center to the vertices, E1 fills the space between the vertices, and, when present, E3 resides at the tips of the spikes. Upon exposure of the virus to acidic endosomes, E1 dissociates from E2 to form the E1 homotrimer, which is required for driving the cellular and viral membranes together during the fusion step. The alphavirus glycoprotein E1 is a class II viral fusion protein, structurally distinct from the class I fusion proteins found in influenza virus and HIV. The E2 glycoprotein functions to interact with the nucleocapsid via its cytoplasmic domain, and its ectodomain is involved in cellular receptor binding. While the peripheral protein E3 has been lost in most alphaviruses, it remains associated with the viral surface in Semliki virus.

[0088] Alphavirus replication has been reported to occur on the membrane surface within host cells. In the first step of the infection cycle, the 5' end of the genomic RNA is translated into polyproteins (nsPs 1-4) with RNA polymerase activity, resulting in the production of a minus-strand complementary to the genomic RNA. In the second step, the minus-strand serves as a template for the production of two RNAs: (1) a plus-genomic RNA corresponding to the genome of a secondary virus, which translates to produce other nsp proteins and acts as the viral genome, and (2) a subgenomic RNA encoding the viral structural proteins that form the infectious particle. The plus-to-subgenomic RNA ratio is regulated by proteolytic self-cleavage of the polyprotein into nsp1, nsp2, nsp3, and nsp4. In reality, viral gene expression occurs in two phases. In the first phase, the primary synthesis of the plus- and minus-strands occurs. During the second phase, the synthesis of subgenomic RNA is virtually exclusive, resulting in the production of large amounts of structural proteins.

[0089] innate immunity Because innate immune activation can occur through many different stimuli, vaccine approaches that rely on self-amplifying RNA replicons to express antigens or therapeutic GOIs may be adversely affected by global host protein shutdown associated with PKR phosphorylation of eIF2α. Engineering RNA replicons to function in cellular environments where host protein translation is repressed provides them with significant advantages over standard RNA replicon systems.

[0090] Therefore, RNA replicon systems that are adversely affected by the innate immune response, such as those derived from alphaviruses and arteriviruses, can be more effective at expressing their encoded GOIs when engineered to contain DLP motifs. DLP motifs allow efficient mRNA translation in cellular environments where cellular mRNA translation is inhibited. When DLPs are coupled to the translation of the replicon vector's nonstructural protein genes, replicase and transcriptase proteins can initiate functional replication in a PKR-activated cellular environment. When DLPs are coupled to the translation of subgenomic mRNAs, robust GOI expression is possible even when cellular mRNAs are restricted by innate immune activation. Therefore, engineered replicons containing DLP structures to help promote the translation of both nonstructural protein genes and subgenomic mRNAs offer yet another powerful method for overcoming innate immune activation.

[0091] Some embodiments of the present disclosure relate to DLP structures engineered to support the translation of viral nonstructural genes in replicon vectors derived from two different viruses, Venezuelan Equine Encephalitis Virus (VEEV) and Equine Arteritis Virus (EAV), thus conferring evasion of the innate immune response to the system. As described in more detail below, the incorporation of DLP structures into replicon vectors renders them resistant to interferon (IFN) treatment and, unexpectedly, results in an overall increased ability to express GOIs. The DLPs are engineered to combine the IFN resistance conferred by their incorporation into an RNA replicon system with superior protein expression capabilities, making them suitable for use in individuals or populations where innate immune activation is acute or chronic.

[0092] Disclosed Nucleic Acid Molecules Some aspects of the present disclosure relate to nucleic acid molecules, such as synthetic or recombinant nucleic acid molecules, that comprise one or more DLP motifs, coding sequences for one or more DLP motifs, or combinations thereof. In some embodiments, the nucleic acid molecules of the present disclosure may comprise a coding sequence for a gene of interest (GOI) operably linked to a DLP motif(s) and / or a coding sequence for a DLP motif.

[0093] In one aspect, a nucleic acid molecule disclosed herein comprises (i) a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof; and (ii) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence comprises a coding sequence for a gene of interest (GOI). In some embodiments, at least one of the one or more structural elements of the viral capsid enhancer comprises one or more RNA stem loops. In some embodiments, at least one of the one or more RNA stem loops is constituted by a DLP motif present in the first nucleic acid sequence. In some embodiments, at least one of the one or more structural elements of the viral capsid enhancer does not comprise any RNA stem loops.

[0094] As described above, a viral capsid enhancer comprises a sequence within a 5' non-coding and / or 5' coding sequence (preferably a 5' coding sequence) that enhances the expression (e.g., transcription and / or translation) of an operably linked sequence. In some embodiments of the present disclosure, one or more structural elements of the viral capsid enhancer comprise one or two RNA stem loops of the viral capsid enhancer. In some embodiments, the viral capsid enhancer of the present disclosure comprises a sequence comprising a 26S subgenomic promoter. In some embodiments, the viral capsid enhancer of the present disclosure comprises a 5' coding sequence at about nucleotides 20-250, about nucleotides 20-200, about nucleotides 20-150, about nucleotides 20-100, or about nucleotides 50-250, about nucleotides 100-250, about nucleotides 50-200, about nucleotides 75-250, about nucleotides 75-200, about nucleotides 75-150, about nucleotides 77-139, or about nucleotides 100-250, about nucleotides 150-250, about nucleotides 100-150, or about nucleotides 100-200 of the viral 26S RNA, thereby enabling the formation of a hairpin structure. In some embodiments, the first nucleic acid sequence encodes one or more structural elements of the viral capsid enhancer that are important for enhancing expression of an operably linked heterologous sequence. In some embodiments, the first nucleic acid sequence comprises a coding sequence for one or more RNA stem-loops of the viral capsid enhancer. In some embodiments, the first nucleic acid sequence encodes one or more structural elements of a viral capsid enhancer that are important for enhancing translation of an operably linked heterologous sequence. In some embodiments, the first nucleic acid sequence encodes one or more structural elements of a viral capsid enhancer that are important for enhancing transcription of an operably linked heterologous sequence.

[0095] In some embodiments, the first nucleic acid sequence of the nucleic acid molecule comprises at least about 50, about 75, about 100, about 150, about 200, about 300, or more nucleotides from the 5' coding sequence of the viral capsid protein. In some embodiments, the first nucleic acid sequence of the nucleic acid molecule comprises about 50, about 75, about 100, about 150, about 200, about 300, or more nucleotides from the 5' coding sequence of the viral capsid protein, or a range between any two of these values. In some embodiments, the viral capsid enhancer is selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), The viral capsid enhancer is derived from the capsid gene of an alphavirus species selected from the group consisting of Getah virus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), and Buggy Creek virus. In some embodiments, the viral capsid enhancer is derived from the capsid gene of a Sindbis virus or Semliki Forest virus. In some specific embodiments, the viral capsid enhancer is derived from the capsid gene of a Sindbis virus. Furthermore, one of skill in the art will understand that modifications can be made to the 5' coding sequence from a viral capsid protein without substantially reducing its enhancing activity. Further information on this can be found, for example, in Frolov et al., J. Virology 70:1182, 1994; Frolov et al., J. Virology 68:8111, 1994.In some embodiments, it may be advantageous for such mutations to substantially preserve the RNA hairpin structure formed by the 5' capsid coding sequence.

[0096] In some embodiments, the viral capsid enhancer disclosed herein does not include one or more or all of the 5' coding sequence of the capsid protein upstream of the hairpin structure. In some embodiments, the viral capsid enhancer disclosed herein does not include all of the 5' coding sequence of the viral capsid protein upstream of the hairpin structure. In some embodiments, the viral capsid enhancer sequence may encode all or a portion of the capsid protein. Thus, in some embodiments disclosed herein, the capsid enhancer region does not encode the entire viral capsid protein. In some embodiments, the viral capsid enhancer sequence encodes an amino-terminal fragment from the viral capsid protein. In embodiments in which an otherwise functional capsid protein is encoded by the capsid enhancer sequence, it may be desirable to eliminate capsid autoprotease activity. Capsid mutations that reduce or eliminate the autoprotease activity of capsid proteins are known in the art (see, e.g., WO 1996 / 37616). Additionally or alternatively, one or more amino acid residues in the capsid protein may be altered to reduce capsid protease activity.

[0097] As mentioned above, previous studies of sequence comparison and structural RNA analysis have revealed the evolutionary conservation of the DLP motif in many members of the Alphavirus genus (see, e.g., Ventoso, 2012, supra). Thus, in some further embodiments, the viral capsid enhancer sequence of the present disclosure can be any other variant sequence, such as a synthetic or heterologous sequence, that can form an RNA hairpin functionally or structurally equivalent to one or more of the RNA stem-loops predicted for viral capsid enhancers and can act to enhance the translation of an RNA sequence (e.g., a coding sequence for a gene of interest) operably linked downstream thereof. Non-limiting examples of RNA stem-loops that can act as transcriptional and / or translational enhancers include those shown in Figures 11A and 11B. In some embodiments, nucleic acid molecules of the present disclosure include those described in Toribio et al. (2016, supra), the entire contents of which are incorporated herein by reference, including Sindbis virus (SINV; NC 001547.1), Aura virus (AURAV; AF126284), Chikungunya virus (CHIKV; NC 004162), O'nyong-nyong virus (ONNV; NC 001512), Eastern equine encephalitis virus (EEEV(SA); AF159559 and EEEV(NA); U01558), Mayaro virus (MAYV; DQ001069), Semliki Forest virus (SFV; NC 003215), Ross River virus (RRV; DQ226993 and Sagiyama virus (SAGV; AB032553), Getah virus (GETV; NC 001547.1), and the like. 006558), Midleburg virus (MIDV; EF536323), Unavirus (UNAV; AF33948), or Bebaru virus (BEBV; AF339480), or variants thereof.

[0098] Nucleic acid molecules having high sequence identity (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the coding sequence of a viral capsid enhancer of the present disclosure can be synthesized using the sequences described herein (e.g., SEQ ID NO: 1), or any other alphavirus capsid protein known in the art, such as Sindbis virus (SINV; NC 001547.1), Aura virus (AURAV; AF126284), Chikungunya virus (CHIKV; NC 004162), O'nyong-nyong virus (ONNV; NC 001512), Eastern equine encephalitis virus (EEEV(SA); AF159559 and EEEV(NA); U01558), Mayaro virus (MAYV; DQ001069), Semliki Forest virus (SFV; NC 003215), Ross River virus (RRV; DQ226993 and Sagiyama virus (SAGV; AB032553), Getah virus (GETV; NC By using the sequences of alphaviruses (e.g., 006558), Midleburg virus (MIDV; EF536323), Unavirus (UNAV; AF33948), and Bebaru virus (BEBV; AF339480), viral capsid enhancers can be identified and / or isolated by genomic sequence analysis, hybridization, and / or PCR using degenerate or gene-specific primers from sequences identified in the respective alphavirus genomes. For example, the viral capsid enhancer comprises or consists of a DLP motif derived from a viral species belonging to the Togaviridae family, such as an Alphavirus or Rubivirus species. In some embodiments, the nucleic acid molecules of the present disclosure comprise a viral capsid enhancer having a nucleic acid sequence exhibiting at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the 5' CDS portion of an alphavirus capsid protein.In some embodiments, the 5' CDS portion of the alphavirus capsid protein comprises at least the first 25, 50, 75, 80, 100, 150, or 200 nucleotides of the coding sequence of the alphavirus capsid protein. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence exhibiting at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 1 and 46-52. In some embodiments, a nucleic acid molecule comprises a viral capsid enhancer having a nucleic acid sequence that exhibits 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a range between any two of these values, sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 1 and 46-52. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence exhibiting at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of the sequences set forth in Figures 11A-11B and / or Figure 1A in the publication by Toribio et al. (2016, supra), the contents of which are incorporated herein by reference in their entireties.

[0099] Thus, in some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 46-52 disclosed herein. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 46 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 47 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 48 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 49 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 50 of the present disclosure.In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 51 of the present disclosure. In some embodiments, a nucleic acid molecule of the present disclosure comprises a viral capsid enhancer having a nucleic acid sequence that exhibits at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 52 of the present disclosure.

[0100] In some embodiments of the nucleic acid molecule of the present disclosure, one or more RNA stem-loops are operably positioned upstream of the coding sequence of a GOI in the second nucleic acid sequence. In some embodiments, the one or more RNA stem-loops are operably positioned about 1 to about 50 nucleotides, about 10 to about 75 nucleotides, about 30 to about 100 nucleotides, about 40 to about 150 nucleotides, about 50 to about 200 nucleotides, about 60 to about 250 nucleotides, about 100 to about 300 nucleotides, or about 150 to about 500 nucleotides upstream of the coding sequence of the GOI. In some embodiments, the one or more RNA stem loops are operably positioned about 1, about 2, about 5, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500 nucleotides, or a range between any two of these values, upstream of the coding sequence of the GOI. In some embodiments, the one or more RNA stem loops are operably positioned immediately upstream of the coding sequence of the GOI.

[0101] In some embodiments, the nucleic acid molecule further comprises a 5'-untranslated region (5'-UTR) sequence operably positioned upstream of the first nucleic acid sequence. In some embodiments, the 5'-UTR sequence is operably positioned about 1 to about 50, about 10 to about 75, about 30 to about 100, about 40 to about 150, about 50 to about 200, about 60 to about 250, about 100 to about 300, or about 150 to about 500 nucleotides upstream of the first nucleic acid sequence. In some embodiments, the 5'-UTR sequence is positioned about 1, about 2, about 5, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or 100 nucleotides upstream of the first nucleic acid sequence. In some embodiments, the 5'-UTR sequence is operably positioned immediately upstream of the first nucleic acid sequence.

[0102] In some embodiments, the 5'-UTR sequence is operably positioned downstream of the promoter. In some embodiments, the 5'-UTR sequence is operably positioned about 1 to about 50, about 10 to about 75, about 30 to about 100, about 40 to about 150, about 50 to about 200, about 60 to about 250, about 100 to about 300, or about 150 to about 500 nucleotides downstream of the promoter sequence. In some embodiments, the 5'-UTR sequence is operably positioned about 1, about 2, about 5, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or 100 nucleotides downstream of the promoter sequence. In some embodiments, the 5'-UTR sequence is operably positioned immediately downstream of the promoter sequence. In some embodiments, the 5'UTR sequence is operably positioned downstream of the promoter and upstream of the first nucleic acid sequence.

[0103] In some embodiments, the nucleic acid molecule comprises a 3' untranslated region (3'UTR) sequence operably positioned downstream of a second nucleic acid sequence. In some embodiments, the 3'UTR sequence is operably positioned about 1 to about 50 nucleotides, about 10 to about 75 nucleotides, about 30 to about 100 nucleotides, about 40 to about 150 nucleotides, about 50 to about 200 nucleotides, about 60 to about 250 nucleotides, about 100 to about 300 nucleotides, or about 150 to about 500 nucleotides downstream of the second nucleic acid sequence. In some embodiments, the 3'UTR sequence is operably positioned about 1, about 2, about 5, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500 nucleotides downstream of the second nucleic acid sequence, or a range between any two of these values. In some embodiments, the 3'UTR sequence is operably positioned immediately downstream of the second nucleic acid sequence.

[0104] In some embodiments disclosed herein, the coding sequence of a GOI is transcribed into messenger RNA (mRNA) or a portion of an mRNA. As used herein, the term "mRNA" or "messenger RNA" refers to a single-stranded RNA molecule synthesized during transcription, complementary to one strand of double-stranded DNA, and responsible for transmitting the genetic information contained in the DNA to ribosomes for protein synthesis. mRNA can be spliced, partially spliced, or unspliced ​​and can be eukaryotic or prokaryotic. As noted above, mRNA molecules according to some embodiments of the present disclosure can be produced by de novo synthesis. In some embodiments disclosed herein, the coding sequence of a GOI encodes a polypeptide. In some embodiments, the polypeptide is a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof. In some embodiments, the polypeptide is an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or any combination thereof.

[0105] In some embodiments, the nucleic acid molecule of the present disclosure further comprises a coding sequence for an autoprotease peptide (e.g., an autocatalytic self-cleaving peptide). The coding sequence for the autoprotease is optionally operably linked upstream of a second nucleic acid sequence. Generally, any proteolytic cleavage site known in the art can be incorporated into the nucleic acid molecule of the present disclosure, and can also be, for example, a proteolytic cleavage sequence that is cleaved after production by a protease. Further suitable proteolytic cleavage sites also include proteolytic cleavage sequences that can be cleaved after the addition of an external protease. As used herein, the term "autoprotease" refers to a "self-cleaving" peptide that has autoproteolytic activity and can cleave itself from a larger polypeptide moiety. Initially identified in the picornavirus family member foot-and-mouth disease virus (FMDV), several autoproteases (e.g., equine rhinitis A virus (E2A), porcine teschovirus-1 (P2A), and "2A-like" peptides from Thesa asigna virus (T2A)) have since been identified, and their proteolytic cleavage activity has been demonstrated in various ex vitro and in vivo eukaryotic systems. Thus, the concept of autoproteases is accessible to those skilled in the art, and many naturally occurring autoprotease systems have been identified. Well-studied autoprotease systems include, for example, viral proteases, developmental proteins (e.g., HetR, Hedgehog proteins), the RumA autoprotease domain, and UmuD. Non-limiting examples of autoprotease peptides suitable for the compositions and methods of the present disclosure include peptide sequences derived from porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), or combinations thereof.

[0106] In some embodiments, a coding sequence for an autoprotease peptide is operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the autoprotease peptide comprises or consists of a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the autoprotease peptide comprises the peptide sequence of porcine teschovirus-1 2A (P2A).

[0107] Those skilled in the art will understand that different configurations of viral capsid enhancer sequences, sequences encoding autoprotease peptides, and sequences encoding gene of interest can be used, so long as the capsid enhancer sequence increases expression of the heterologous nucleic acid sequence(s) (e.g., coding sequence for a GOI) compared to levels seen in the absence of the capsid enhancer sequence. These sequences are typically configured such that the polypeptide encoded by the gene of interest can be released from the protease and any capsid protein sequences after cleavage by the autoprotease.

[0108] Non-limiting lists of exemplary combinations of autoprotease peptides described herein (such as P2A, F2A, E2A, T2A, BmCPV2A, and BmIFV2A) with one or more viral capsid enhancer sequences described herein are provided in Tables 1 and 2. Table 1 provides the short name of each viral capsid enhancer (e.g., "CE01") and the short name of each autoprotease peptide (e.g., "AP01"). Each numbered "X" peptide in Table 2 has a corresponding autoprotease peptide provided in Table 1. Similarly, each numbered "Y" enhancer in Table 2 has a corresponding viral capsid enhancer provided in Table 1. Thus, each "X:Y" entry in Table 2 provides an example of a viral capsid enhancer and autoprotease peptide combination that can be used in the molecules, compositions, and methods of the present disclosure. For example, the combination shown in Table 2 as "AP01:CE16" provides a combination of the viral capsid enhancer from Sindbis virus (SINV) with the autoprotease peptide from porcine teschovirus-1 2A (P2A). [Table 1] [Table 2]

[0109] In one aspect, disclosed herein is a novel nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, the modified viral RNA replicon comprising: a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer (e.g., a DLP motif) or variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; and a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence.

[0110] The terms "replicon RNA" and "RNA replicon," used interchangeably herein, refer to RNA that contains all of the genetic information necessary to direct its own amplification or self-replication within permissive cells. To direct its own replication, the RNA molecule 1) encodes a polymerase, replicase, or other protein that can interact with viral or host cell-derived proteins, nucleic acids, or ribonucleoproteins to catalyze the RNA amplification process, and 2) contains cis-acting RNA sequences necessary for the replication and transcription of the subgenomic replicon-encoded RNA. These sequences may bind to its own encoded proteins, or non-self-encoded cell-derived proteins, nucleic acids, or ribonucleoproteins, or complexes between any of these components during the replication process. In some embodiments of the present disclosure, modified viral replicon RNA molecules typically contain 5' viral or deleted interfering RNA sequence(s) required in cis for replication, sequences encoding biologically active nonstructural proteins, a promoter for the subgenomic RNA, 3' viral sequences required in cis for replication, and an ordered polyadenylate tract. Furthermore, the term replicon RNA generally refers to a molecule of positive polarity, or "message" sense, and the replicon RNA may vary in length from that of any known naturally occurring RNA virus. In some embodiments of the present disclosure, the replicon RNA does not include the coding sequence for at least one of the structural viral proteins. In these examples, the sequence encoding the structural gene can be replaced with one or more heterologous sequences, such as, for example, the coding sequence for a gene of interest (GOI). In these examples where the replicon RNA is packaged into recombinant alphavirus particles, it must contain one or more sequences, so-called packaging signals, that serve to initiate interactions with the alphavirus structural proteins that result in particle formation.

[0111] As used herein, "subgenomic RNA" refers to an RNA molecule that is shorter in length or size than the genomic RNA from which it is derived. Viral subgenomic RNA may be transcribed from an internal promoter whose sequence is present within the genomic RNA or its complementary strand. Transcription of the subgenomic RNA may be mediated by virally encoded polymerase(s) associated with host cell-encoded proteins, ribonucleoprotein(s), or a combination thereof. In some embodiments of the present disclosure, the subgenomic RNA is generated from a modified replicon RNA disclosed herein and encodes or expresses one or more genes of interest (GOIs). Instead of a native subgenomic promoter, the subgenomic RNA may be placed under the control of an internal ribosome entry site (IRES) derived from encephalomyocarditis virus (EMCV), bovine viral diarrhea virus (BVDV), poliovirus, foot-and-mouth disease virus (FMD), enterovirus 71, or hepatitis C virus.

[0112] In some embodiments, the second nucleic acid sequence of the modified viral RNA replicon comprises coding sequences for at least one, at least two, at least three, or at least four nonstructural viral proteins. In some embodiments, the second nucleic acid sequence of the modified viral RNA replicon comprises coding sequences for a portion of at least one nonstructural viral protein. For example, the second nucleic acid sequence of the modified viral RNA replicon may comprise about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% of the coding sequence of at least one nonstructural viral protein, or a range between any two of these values. In some embodiments, the second nucleic acid sequence of the modified viral RNA replicon may comprise coding sequences for a substantial portion of at least one nonstructural viral protein. As used herein, a "substantial portion" of a nucleic acid sequence encoding a nonstructural viral protein includes enough of the nucleic acid sequence encoding the nonstructural viral protein to allow putative identification of that protein by manual evaluation of the sequence by one of skill in the art or by computer-automated sequence comparison and identification using algorithms such as BLAST (e.g., "Basic Local Alignment Search Tool"; Altschul SF et al., J. Mol. Biol. 215:403-410, 1993). In some embodiments, the second nucleic acid sequence of the modified viral RNA replicon may include the entire coding sequence of at least one nonstructural protein. In some embodiments, the second nucleic acid sequence includes substantially all of the coding sequence of a native viral nonstructural protein.

[0113] The molecular techniques and methods by which these new nucleic acid molecules were constructed and characterized are more fully described in the Examples section of the present application, in which, by way of non-limiting example, Venezuelan equine encephalitis virus (VEEV) and equine arteritis virus (EAV) are used to illustrate the compositions and methods disclosed herein.

[0114] In some embodiments, the nucleic acid molecules disclosed herein are recombinant nucleic acid molecules. As used herein, the term "recombinant" refers to any molecule (e.g., DNA, RNA, etc.) that is indirectly or indirectly produced by human manipulation of polynucleotides. As a non-limiting example, cDNA is a recombinant DNA molecule, as is any nucleic acid molecule produced by ex vitro polymerase reaction(s), or to which a linker is attached, or which is incorporated into a vector, such as a cloning vector or an expression vector. By way of non-limiting example, a recombinant nucleic acid molecule is: 1) synthesized or modified ex vitro, for example, using chemical or enzymatic techniques (e.g., by the use of chemical nucleic acid synthesis or by the use of enzymes for replication, polymerization, exonuclease digestion, endonuclease digestion, ligation, reverse transcription, transcription, base modification (e.g., methylation, etc.), or recombination (such as homologous and site-specific recombination) of nucleic acid molecules); 2) contains essentially unlinked linked nucleotide sequences; 3) has been engineered using molecular cloning techniques to have one or more nucleotide deletions relative to a naturally occurring nucleic acid sequence; and / or 4) has been engineered using molecular cloning techniques to have one or more sequence changes or rearrangements relative to a naturally occurring nucleic acid sequence.

[0115] Nucleic acid molecules containing variants of naturally occurring nucleic acid sequences can be produced using several methods known to those skilled in the art. The sequence of a nucleic acid molecule can be modified relative to the naturally occurring sequence from which it is derived using a variety of techniques, including, but not limited to, classical mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, PCR amplification and / or mutagenesis of selected regions of a nucleic acid sequence, recombination cloning, and chemical synthesis (such as chemical synthesis of a mixture of oligonucleotides and ligation of the mixture to "assemble" a mixture of nucleic acid molecules), and combinations thereof. Nucleic acid molecule homologs can be selected from a mixture of modified nucleic acid molecules by screening for the function of the protein or replicon encoded by the nucleic acid molecule, and / or by hybridization with a wild-type gene or fragment thereof, or by PCR using primers homologous to the target or wild-type nucleic acid molecule or sequence.

[0116] In various embodiments disclosed herein, the nucleic acid molecules disclosed herein may include one or more of the following features.

[0117] In some embodiments, the modified viral RNA replicon comprises a modified RNA replicon derived from a virus species belonging to the Alphavirus genus of the Togaviridae family or the Arterivirus genus of the Arteriviridae family. Suitable arterivirus species include equine arteriitis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), simian hemorrhagic fever virus (SHFV), and wobbly possum disease virus (WPDV). Both pathogenic and non-pathogenic arterivirus strains are suitable. Non-limiting examples of preferred arterivirus strains include, but are not limited to, EAV pathogenic Bucyrus strain (VBS), LDV-Plagemann, LDV-C, PRRSV type 1, and PRRSV type 2. Exemplary preferred EAV strains include, but are not limited to, EAV VB53, EAV ATCC VR-796, EAV HK25, EAV HK116, EAV ARVAC MLV, EAV Bucyrus strain (Ohio), modified EAV Bucyrus, avirulent strain CA95, Red Mile (Kentucky), 84KY-A1 (Kentucky), Wroclaw-2 (Poland), Wibna (Switzerland), and Vienna (Australia). Non-limiting preferred examples of PRRSV strains include PRRSV LV4.2.1, PRRSV 16244B, PRRSV HB-1(sh) / 2002, PRRSV HB-2(sh) / 2002, PRRSV HN1, PRRSV SD01-08, PRRSV SD0802, PRRSV SD0803, PRRSV, and VR2332. Non-limiting preferred examples of SHFV strains and variants include SHFV variants SHFV-krtg1a and -krtg1b (SHFV-krtg1a / b), SHFVkrtg2a / b (GenBank accession numbers JX473847 to JX473850), SHFV-LVR, SHFV prototype variant LVR-42-0 / M6941 (NC_003092), SHFV-krc1 and SHFVkrc2 (HQ845737 and HQ845738, respectively) (Kibale red colobus).Other non-limiting examples of preferred arteriviruses include PRRSV-Lelystad, a European (type 1) strain (M96262); PRRSVVR2332, a North American (type 2) strain (U87392), EAV-Bucyrus (NC_002532), EAV-s3685 (GQ903794), LDV-P, a Plagemann strain (U15146), and LDV-C, a neurovirulent type C strain (L13298).

[0118] In some embodiments, the first nucleic acid sequence is positioned upstream of the nucleic acid sequence encoding a portion or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. In some embodiments, the first nucleic acid sequence is operably positioned within a region of about 1 to 1,000 nucleotides downstream of the 5' end of the modified viral RNA replicon. In some embodiments, the first nucleic acid sequence is operably positioned within a region of about 1 to 25, about 1 to 40, about 10 to 25, 10 to 50, about 10 to 100, about 20 to 50, about 20 to 75, about 25 to 100, or about 25 to 100 nucleotides downstream of the 5' end of the modified viral RNA replicon. In some embodiments, the first nucleic acid sequence is operably positioned in a region of about 1, 2, 5, 10, 15, 20, 25, 30, 40, 50, 75, 100, 125, 150, 200, 250, 300, or more nucleotides downstream of the 5' end of the modified viral RNA replicon, or a range between any two of these values. In some embodiments, the first nucleic acid sequence is operably positioned in a region of about 1 to 100, about 1 to 500, about 25 to 800, about 50 to 900, about 50 to 300, about 25 to 200, about 25 to 100, about 50 to 400, about 100 to 500, about 100 to 300, about 100 to 200, about 200 to 500, about 200 to 600, about 200 to 400, about 150 to 700, about 150 to 400, or about 500 to 1000 nucleotides downstream of the 5' end of the modified viral RNA replicon.

[0119] Without being bound by any particular theory, it is believed that the translation-enhancing activity of a viral DLP motif may, in some embodiments, depend on the distance between the viral DLP motif and the initiation AUGi codon (Toribio et al., 2016, supra). Thus, in some embodiments, the first nucleic acid sequence is operably positioned in a region of about 10-100 nucleotides downstream of the initiation AUGi codon of the modified viral RNA replicon. In some embodiments, the first nucleic acid sequence is operably positioned within a region of about 10-75, about 10-50, about 10-25, 15-75, about 15-50, about 15-25, about 25-75, about 25-50, or about 25-100 nucleotides downstream of the initiation AUGi codon of the modified viral RNA replicon. In some embodiments, the first nucleic acid sequence is operably positioned in a region of about 25, 28, 31, 34, 37, 37, 40, 43, 46, 49, 50, or a range between any two of these values, nucleotides downstream of the start codon AUGi of the modified viral RNA replicon.

[0120] In some embodiments, the sequence encoding the modified viral RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to the coding sequence of a gene of interest (GOI). As used herein, the term "expression cassette" refers to a construct of genetic material containing a coding sequence and sufficient regulatory information to direct the proper transcription and / or translation of the coding sequence in a recipient cell, in vivo and / or ex vivo. The expression cassette can be inserted into a vector and / or subject to targeting to a desired host cell. Furthermore, the term expression cassette can be used synonymously with the term "expression construct." As used herein, the term "expression cassette" refers to a nucleic acid construct encoding a protein or functional RNA operably linked to expression control elements, such as a promoter, and optionally any other nucleic acid sequence, or combination of other nucleic acid sequences, that affect the transcription or translation of a gene.

[0121] As used herein, the term "operably linked" refers to a functional linkage between two or more sequences. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional linkage that allows expression of the polynucleotide of interest. In this sense, the term "operably linked" refers to a regulatory region and a coding sequence to be transcribed being positioned such that the regulatory region is effective to regulate the transcription or translation of the coding sequence of interest. In some embodiments disclosed herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately relative to a sequence encoding a polypeptide or functional RNA so that the control sequence directs or regulates the expression or cellular localization of the mRNA, polypeptide, and / or functional RNA encoding the polypeptide. Thus, a promoter is operably linked to a nucleic acid sequence if the promoter is capable of mediating transcription of the nucleic acid sequence. Operable linked elements can be contiguous or non-contiguous.

[0122] Basic techniques for operably linking two or more sequences of DNA together are well known to those of skill in the art, and such methods are described in many books on standard molecular biological procedures (see, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and Gibson et al., Nature Methods 6:343-45, 2009).

[0123] In some embodiments disclosed herein, the nucleic acid molecules disclosed herein may include two or more expression cassettes. In principle, the nucleic acid molecules disclosed herein may generally include any number of expression cassettes. In some specific embodiments, the modified viral RNA replicon includes at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably positioned downstream of a transcriptional regulatory sequence (TRS) of the modified arterivirus RNA replicon, and the TRS may be TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, TRS7, or a combination thereof. In some specific embodiments, at least one of the one or more expression cassettes is operably positioned downstream of TRS7 of the modified arterivirus RNA replicon.

[0124] The nucleic acid molecules provided herein can find use, for example, as expression or transcription vectors when operably linked to a heterologous nucleic acid sequence, such as the coding sequence of a gene of interest (GOI), and can affect the expression of the GOI. In some embodiments, the coding sequence of the GOI is optimized for expression at a level higher than that of a reference coding sequence. In some embodiments, the reference coding sequence is not codon-optimized. In some embodiments, the GOI coding sequence comprises codon optimization. With regard to codon optimization of nucleic acid sequences, the degeneracy of the genetic code provides the possibility of replacing at least one base in the protein-coding sequence of a gene with a different base without causing a change in the amino acid sequence of the polypeptide produced from the gene. Thus, the nucleic acid molecules of the present disclosure can also have one or more nucleotide substitutions in accordance with the degeneracy of the genetic code. References describing codon usage are readily publicly available. In some further embodiments of the present disclosure, variants of the polynucleotide sequence can be produced for various reasons, such as to optimize codon expression for a particular host (e.g., changing codons in an arterivirus mRNA to those preferred by other organisms such as humans, hamsters, mice, or monkeys).

[0125] In some embodiments disclosed herein, the sequence of a GOI encodes a polypeptide. The type of polypeptide can vary depending on the specific application. For example, the polypeptide can be a therapeutic polypeptide, a preventative polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof. In some embodiments, the polypeptide is an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, or a combination thereof.

[0126] In some embodiments, the nucleic acid molecule disclosed herein can further include a third nucleic acid sequence encoding one or more structural elements of a second viral capsid enhancer (e.g., a DLP motif), wherein the third nucleic acid sequence is operably linked upstream of the coding sequence of the GOI. The second DLP motif can be identical to or different from the first DLP motif located upstream of the coding sequence of the nonstructural protein. Thus, in some embodiments, the second DLP motif is identical to the first DLP motif located upstream of the coding sequence of the nonstructural protein. In some embodiments, the second DLP motif is different from the first DLP motif located upstream of the coding sequence of the nonstructural protein.

[0127] In some embodiments, the sequence encoding the modified viral RNA replicon further comprises a coding sequence for a proteolytic cleavage site operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence of the GOI. Generally, any proteolytic cleavage site known in the art can be incorporated into the nucleic acid molecule of the present disclosure and can also be a proteolytic cleavage sequence that is cleaved after production, for example, by a protease. Further suitable proteolytic cleavage sites also include proteolytic cleavage sequences that can be cleaved after the addition of an external protease. In some embodiments, the sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence of the GOI. In some embodiments, the autoprotease peptide includes a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the autoprotease peptide comprises a peptide sequence derived from porcine teschovirus-1 2A (P2A).

[0128] Those skilled in the art will understand that different configurations of viral capsid enhancer sequences, nonstructural protein coding sequences, autoprotease peptide coding sequences, and gene of interest coding sequences can be used, so long as the capsid enhancer sequence increases expression of the heterologous nucleic acid sequence(s) compared to levels seen in the absence of the capsid enhancer sequence. These sequences are typically configured such that the polypeptide encoded by the gene of interest can be released from the protease and any capsid protein sequences after cleavage by the autoprotease.

[0129] In some embodiments, the sequences of the nucleic acid molecules disclosed herein comprise a modified RNA replicon of an alphavirus virus species. In some embodiments, the modified alphavirus RNA replicon is of an alphavirus belonging to the VEEV / EEEV group, the SF group, or the SIN group. Non-limiting examples of SF group alphaviruses include Semliki Forest virus, O'nyong-nyong virus, Ross River virus, Midleburg virus, Chikungunya virus, Barmah Forest virus, Getah virus, Mayaro virus, Sagiyama virus, Bebaru virus, and Una virus. Non-limiting examples of SIN group alphaviruses include Sindbis virus, Girdwood SA virus, South African arbovirus No. 86, Ockelbo virus, Aura virus, Babanki virus, Wataroa virus, and Kyzylagach virus. Non-limiting examples of VEEV / EEEV group alphaviruses include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Pixuna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), and Una virus (UNAV).

[0130] Non-limiting examples of alphavirus species include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getawi virus (GETA). Examples of suitable alphaviruses include Rus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), and Buggy Creek virus. Both pathogenic and non-pathogenic alphavirus strains are suitable. In some embodiments, the modified alphavirus RNA replicon is from Sindbis virus (SIN), Semliki Forest virus (SFV), Ross River virus (RRV), Venezuelan equine encephalitis virus (VEEV), or Eastern equine encephalitis virus (VEEV). In some embodiments, the modified alphavirus RNA replicon is of Venezuelan equine encephalitis virus (VEEV).

[0131] In some examples where the nucleic acid molecules disclosed herein comprise a modified RNA replicon of an alphavirus virus species, a first nucleic acid sequence is positioned upstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1-4, or portions thereof, of the modified alphavirus RNA replicon. Thus, in some embodiments, the first nucleic acid sequence is positioned upstream of a nucleic acid sequence encoding nonstructural proteins nsp1, nsp1-2, nsp1-3, nsp1-4, nsp2-4, nsp3-4, nsp2-3, nsp2, nsp3, nsp4, or portions thereof of the modified alphavirus RNA replicon. In some embodiments, the sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence for a gene of interest (GOI). In some embodiments, the modified alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1-4, or portions thereof, of a modified alphavirus RNA replicon. Thus, in some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding nonstructural proteins nsp1, nsp1-2, nsp1-3, nsp1-4, nsp2-4, nsp3-4, nsp2-3, nsp2, nsp3, nsp4, or portions thereof, of a modified alphavirus RNA replicon.

[0132] In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a second viral capsid enhancer (e.g., a DLP motif), wherein the third nucleic acid sequence is operably linked upstream of the coding sequence for the GOI. The second DLP motif may be identical to or different from the first DLP motif located upstream of the coding sequence for at least the nonstructural proteins nsp1-4, or a portion thereof. Thus, in some embodiments, the second DLP motif is identical to the first DLP motif located upstream of the coding sequence for the nonstructural protein. In some embodiments, the second DLP motif is different from the first DLP motif located upstream of the coding sequence for the nonstructural protein.

[0133] In some embodiments, the nucleic acid sequence of the present disclosure further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. The autoprotease peptide can be any autoprotease peptide generally known in the art. Non-limiting examples of autoprotease peptides include peptide sequences derived from porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and any combination thereof.

[0134] In a further aspect, some embodiments disclosed herein relate to nucleic acid molecules comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, wherein the modified non-alphavirus RNA replicon comprises a first nucleic acid sequence encoding a viral capsid enhancer (e.g., a DLP motif). In some embodiments, the modified non-alphavirus RNA replicon further comprises a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence.

[0135] In some embodiments, the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. In some embodiments, the modified non-alphavirus RNA replicon comprises a modified RNA replicon of a positive-strand RNA virus. In some embodiments, the modified non-alphavirus RNA replicon comprises a modified RNA replicon of a negative-strand RNA virus.

[0136] Non-limiting examples of modified non-alphavirus RNA replicons include the modified RNA replicons of virus species belonging to the Togaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, or Paramyxoviridae families.Therefore, in some embodiments, modified non-alphavirus RNA replicons include the modified RNA replicons of negative-strand RNA viruses.Suitable negative-strand RNA virus species include, but are not limited to, virus species belonging to the Orthomyxoviridae, Rhabdoviridae, and Paramyxoviridae families.In some embodiments, modified non-alphavirus RNA replicons include the modified RNA replicons of positive-strand virus species belonging to the Togaviridae or Flaviviridae families.In some embodiments, modified non-alphavirus RNA replicons include the modified RNA replicons of positive-strand virus species belonging to the Arterivirus genus of the Arteriviridae family. Suitable arterivirus species include, but are not limited to, species of equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), simian hemorrhagic fever virus (SHFV), and wobbly possum disease virus (WPDV).

[0137] In some embodiments, the non-alphavirus modified RNA replicon encoding sequence further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence for a gene of interest (GOI). In some embodiments, the modified non-alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. In some embodiments, at least one of the one or more expression cassettes is operably linked downstream of a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof. In some embodiments, at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, the third nucleic acid sequence being operably linked upstream of the coding sequence for the GOI. In some embodiments, the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI.

[0138] Some embodiments of the present disclosure relate to nucleic acid molecules comprising a nucleic acid sequence encoding a modified viral RNA replicon, the nucleic acid molecule comprising, in a 5' to 3' direction, a first nucleic acid sequence encoding a capsid enhancer from Sindbis virus, a second nucleic acid sequence encoding an autoprotease peptide, and a third nucleic acid sequence encoding all of the viral nonstructural proteins. Some embodiments of the present disclosure relate to nucleic acid molecules comprising a nucleic acid sequence encoding a modified viral RNA replicon, the modified viral RNA replicon comprising the viral capsid enhancer, and the sequence of the modified viral RNA replicon exhibits at least 80% sequence identity to at least one of SEQ ID NOs: 15-18 and 27-29.

[0139] Contemplated within the scope of the present disclosure are variants of the polynucleotides provided herein. Such variants may be naturally occurring, such as homologous polynucleotides from the same or different species, or may be unnatural variants, such as polynucleotides synthesized using chemical synthesis methods or polynucleotides produced using recombinant DNA technology. With respect to nucleic acid sequences, the degeneracy of the genetic code allows for the substitution of at least one base in the protein-coding sequence of a gene with a different base without causing a change in the amino acid sequence of the polypeptide produced from the gene. Thus, nucleic acid molecules of the present disclosure may also have any base sequence that is altered from any polynucleotide sequence disclosed herein by substitution in accordance with the degeneracy of the genetic code. References describing codon usage are readily publicly available. In further embodiments, variants of polynucleotide sequences can be produced for various reasons, such as optimizing codon expression for a particular host (e.g., changing codons in viral mRNA to those preferred by other organisms, such as mammalian or fish species).

[0140] In some embodiments, a nucleic acid molecule of the present disclosure comprises, in the 5'->3' direction, a nucleic acid sequence encoding a capsid enhancer from Sindbis virus, a nucleic acid sequence encoding an autoprotease peptide, and a nucleic acid sequence encoding all of the viral nonstructural proteins of a modified viral RNA replicon. In some embodiments, the nucleic acid molecule comprises, in the 5'->3' direction, a 5-UTR sequence, a first capsid enhancer from Sindbis virus, the autoprotease peptide, a sequence encoding all of the viral nonstructural proteins of a modified viral RNA replicon, one or more expression cassettes, and a 3'UTR sequence, wherein at least one of the one or more expression cassettes comprises a second capsid enhancer from Sindbis virus operably linked upstream of a coding sequence for a gene of interest (GOI).

[0141] Thus, in some embodiments, a nucleic acid molecule of the present disclosure comprises a nucleic acid sequence encoding a modified viral RNA replicon, which sequence exhibits at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to at least one of SEQ ID NOs: 15-18 and 27-29.

[0142] In some embodiments, the nucleic acid molecule of the present disclosure is an expression vector. In some embodiments, the expression vector further comprises one or more additional regulatory sequences, which may be transcriptional or translational regulatory elements. The terms "regulatory element" and "regulatory region," used interchangeably in this disclosure, refer to nucleic acid sequences that affect the initiation and rate of transcription or translation, as well as the stability and / or mobility of the transcriptional or translational product. Such regulatory elements need not be native sequences. Regulatory sequences include, but are not limited to, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3' untranslated regions (UTRs), transcription initiation sites, termination sequences, polyadenylation sequences, introns, and combinations thereof. In some embodiments, the expression vector of the present disclosure further comprises one or more of an origin of replication, one or more sequences for facilitating integration of the expression cassette into the host genome, and a terminator sequence.

[0143] In some embodiments, an expression vector comprises at least one origin of replication ("ORI") sequence for replicating within a cell. The vector may optionally further comprise one or more selectable markers under the control of one or more eukaryotic promoters, one or more selectable markers under the control of one or more prokaryotic promoters, and / or one or more sequences that mediate recombination of the exogenous nucleic acid sequence into the genome of the target cell.

[0144] An ORI is a sequence in a DNA molecule from which replication begins. The ORI serves as the assembly base for pre-replication complexes. Depending on the ORI, such replication can proceed unidirectionally or bidirectionally. The expression vectors provided herein can contain an ORI for replicating the expression vector in a cloning host such as E. coli or yeast, and / or can contain an ORI for replicating the expression vector in a target cell (which may be, for example, a mammalian cell). The structural biology of ORIs is widely conserved among prokaryotes, eukaryotes, and viruses. Most ORIs have simple tri-, tetra-, or higher nucleotide repeat patterns. Most are AT-rich and contain inverted repeats. Those skilled in the art will be familiar with more common ORIs, such as the ORIs of P15A and pUC.

[0145] In some embodiments, the expression vector may also carry a selection marker. As an example, a vector containing an expression cassette may contain, as a selection marker, a gene that confers resistance to a toxic substance such as an antibiotic, herbicide, or some other toxin, allowing transformants to be selected by exposing the cells to the toxin and selecting for cells that survive the encounter with the toxin. In some embodiments, the selection marker may be under the control of a promoter. In some embodiments, the promoter regulating the expression of the selection marker may be conditional or inducible. In some embodiments, the promoter regulating the expression of the selection marker may preferably be constitutive and may be, for example, any promoter described herein or another promoter.

[0146] In some embodiments, the expression vector is a plasmid, a bacteriophage vector, a cosmid, a fosmid, a viral replicon, a shuttle vector, or a combination thereof. In some embodiments, the expression vector is an RNA replicon. In some embodiments, the expression vector is a prokaryotic expression vector. In some embodiments, the expression vector is a eukaryotic expression vector. In some embodiments, the nucleic acid molecules of the present disclosure are produced by de novo synthesis. In some embodiments of the present disclosure, de novo synthesis can be used to generate synthetic mRNA molecules.

[0147] Recombinant cells In one aspect, some embodiments disclosed herein relate to a method for transforming a cell, including introducing a nucleic acid molecule provided herein into a host cell, such as an animal cell, and selecting or screening for transformed cells. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that these terms refer not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in subsequent generations, either due to mutation or environmental influences, such progeny may not actually be identical to the parent cell, but are still included within the scope of the term as used herein. In some embodiments, the nucleic acid molecule is introduced into the host cell by electroporation or biolistic procedures.

[0148] In a related aspect, some embodiments relate to recombinant host cells, such as recombinant animal cells, comprising the nucleic acid molecules described herein. The nucleic acid molecules can be stably integrated into the host genome, or can replicate episomally, or can exist in the recombinant host cell as a minicircle expression vector for stable or transient expression. Thus, in some embodiments disclosed herein, the nucleic acid molecules are maintained and replicated in the recombinant host cell as episomal units. In some embodiments, the nucleic acid molecules are stably integrated into the genome of the recombinant cell. Stable integration can be accomplished using classical random genome recombination techniques or more sophisticated genome editing techniques, such as guide RNA-directed CRISPR / Cas9, or DNA-guided endonuclease genome editing NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-like effector nuclease). In some embodiments, the nucleic acid molecules exist in the recombinant host cell as a minicircle expression vector for stable or transient expression.

[0149] In some embodiments, host cells can be genetically engineered (e.g., transduced, or transformed, or transfected) with, for example, the vector constructs of the present application, which can be, for example, vectors for homologous recombination containing nucleic acid sequences homologous to a portion of the genome of the host cell, or can be expression vectors for expression of any or a combination of genes of interest. Vectors can be, for example, in the form of a plasmid, a viral particle, a phage, etc. In some embodiments, vectors for expression of a polypeptide of interest can also be designed for integration into the host, for example, by homologous recombination. Suitable host cells can be transformed with vectors containing nucleic acid molecules comprising the polynucleotide sequences described herein, e.g., a modified alphavirus genome or replicon RNA, and optionally, a selectable marker or reporter gene.

[0150] The methods and compositions disclosed herein can be deployed for genetic manipulation of any species, including, but not limited to, prokaryotic and eukaryotic species. Suitable host cells modified using the compositions and methods of the present disclosure can include, but are not limited to, algal cells, bacterial cells, heterokonts, fungal cells, chytrid cells, microfungi, microalgae, and animal cells. In some embodiments, the animal cells are invertebrate cells. In some embodiments, the vertebrate cells are mammalian cells. Host cells can be either untransformed cells or cells that have already been transfected with at least one nucleic acid molecule.

[0151] The methods and compositions disclosed herein can be used with subjects and / or host cells that are important or interesting for therapeutic and medical applications, including, for example, aquaculture, agriculture, animal husbandry, and / or the production of polypeptides used in the manufacture of vaccines, pharmaceuticals, industrial products, chemicals, etc. In some embodiments, the compositions and methods disclosed herein can be used with host cells from species that are natural hosts for alphaviruses, such as rodents, mice, fish, birds, and large mammals, such as humans, horses, pigs, monkeys, and apes, as well as invertebrate host cells. In some embodiments of the present application, particularly preferred species are vertebrate and invertebrate species. In principle, any animal species can generally be used, such as humans, dogs, birds, fish, horses, pigs, primates, mice, cotton rats, ferrets, cattle, wild boars, sheep, rabbits, cats, goats, donkeys, hamsters, or buffalo. Non-limiting examples of suitable bird species include chicken, duck, goose, turkey, ostrich, emu, swan, peafowl, pheasant, partridge, and guinea fowl. In some particular embodiments, the fish is any species of the salmonidae family. Primary mammalian cells and continuous / immortalized cell types are also suitable. Non-limiting examples of suitable animal host cells include, but are not limited to, pulmonary equine artery endothelial cells, equine dermal cells, baby hamster kidney (BHK) cells, rabbit kidney cells, mouse muscle cells, mouse connective tissue cells, human cervical cells, human epidermoid laryngeal cells, Chinese hamster ovary cells (CHO), human HEK-293 cells, mouse 3T3 cells, Vero cells, Madin-Darby canine kidney epithelial cells (MDCK), primary chicken fibroblasts, HuT78 cells, A549 lung cells, HeLa cells, PER.C6® cells, WI-38 cells, MRC-5 cells, FRhL-2 cells, and CEM T cells. In some embodiments, the host cells are baby hamster kidney cells. In some embodiments, the baby hamster kidney cells are BHK-21 cells.

[0152] Techniques for transforming the various host cells and species described above are known in the art and described in technical and scientific literature. Therefore, cell cultures comprising at least one recombinant cell disclosed herein are also within the scope of this application. Methods and systems suitable for producing and maintaining cell cultures are known in the art.

[0153] Heterologous Nucleic Acid Sequences According to some embodiments of the present disclosure, various nucleic acid sequences can be carried by the nucleic acid molecules of the present disclosure. In some embodiments, the nucleic acid molecules described herein do not contain any additional heterologous nucleic acid sequences. In some embodiments, the nucleic acid molecules of the present disclosure contain one or more additional heterologous or foreign nucleic acid sequences. In some embodiments, the one or more additional heterologous or foreign nucleic acid sequences include a coding sequence for a gene of interest (GOI). In some embodiments disclosed herein, the coding sequence for the GOI encodes a polypeptide or functional RNA. In some embodiments, the coding sequence for the GOI encodes a functional RNA selected from ribosomal RNA, tRNA, ribozyme, trans-activating (tr)RNA of a CRISPR system, crispr (cr)RNA of a CRISPR system, chimeric guide RNA of a CRISPR system, microRNA, interfering RNA (RNAi) molecule, short hairpin (sh)RNA, or antisense RNA molecule. In some embodiments, the coding sequence of the GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, or any combination thereof. In some embodiments, the coding sequence of the GOI encodes a polypeptide selected from the group consisting of an antibody, an antigen, an immunomodulator, and a cytokine.

[0154] In some embodiments, the heterologous nucleic acid sequence is at least about 100 bases, 2 kb, 3.5 kb, 5 kb, 7 kb, or 8 kb in length. The heterologous RNA or heterologous nucleic acid sequence can be selected from a variety of sequences derived from viruses, prokaryotes, or eukaryotes. Examples of categories of heterologous sequences include, but are not limited to, immunogens (such as natural, modified, or synthetic antigenic proteins, peptides, epitopes, or immunogenic fragments), cytokines, toxins, therapeutic proteins, enzymes, antisense sequences, and immune response modulators.

[0155] A variety of GOIs can be included in the nucleic acid molecules of the present disclosure to express a polypeptide of the GOI, including, but not limited to, cytokines, toxins, prodrugs, antigens that stimulate an immune response, ribozymes, and proteins that assist or inhibit an immune response, as well as antisense sequences (or sense sequences for "antisense applications"). As noted above, within various embodiments of the present disclosure, the modified RNA replicons provided herein can include coding regions for two or more polypeptides of interest (and in some embodiments, two or more polypeptides of interest are expressed).

[0156] 1) Cytokines In some embodiments disclosed herein, the GOI encodes a cytokine. Generally, cytokines act to proliferate, activate, and / or differentiate immune effector cells. Examples of cytokines include, but are not limited to, macrophages, B lymphocytes, T lymphocytes, endothelial cells, fibroblasts, lymphokines such as gamma interferon, tumor necrosis factor, interleukins, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1, IL-12, IL-13, IL-14, IL-15, GM-CSF, CSF-1, and G-CSF.

[0157] In some related embodiments, the GOI encodes an immunomodulatory cofactor. As used within the context of the present disclosure, "immunomodulatory cofactor" refers to a factor that, when produced by one or more cells involved in an immune response or exogenously added to a cell, causes the immune response to differ in quality or potency from that which would have occurred in the absence of the cofactor. The quality or potency of the response can be measured by various assays known to those skilled in the art, such as ex vitro assays measuring cell proliferation (e.g., H-thymidine incorporation) and ex vitro cytotoxicity assays (e.g., measuring Cr release) (see Warner et al., AIDS Res. and Human Retroviruses 7:645-655, 1991).

[0158] Examples of immunomodulatory cofactors include, but are not limited to, alpha interferon, gamma interferon, G-CSF, GM-CSF, TNF, interleukin-2 (IL-2), IL-4, IL-6, IL-12, IL-15, ICAM-1, ICAM-2, LFA-1, LFA-3, MHC class I molecules, MHC class II molecules, 2-microglobulin, chaperones, CD3, B7 / BB1, MHC-binding transporter proteins, and analogs thereof.

[0159] The selection of which immunomodulatory cofactor to include in the nucleic acid molecule of the present disclosure can be based on the known therapeutic effect of the cofactor or can be determined experimentally. For example, in chronic hepatitis B infection, alpha interferon has been found to be effective in compensating for the patient's immunological deficiency, thereby aiding in recovery from the disease. In some situations, the appropriate immunomodulatory cofactor can be determined experimentally. Briefly, a blood sample is first collected from a patient with liver disease. Peripheral blood lymphocytes (PBLs) are restimulated ex vitro with autologous or HLA-matched cells (e.g., EBV-transformed cells) and transduced with a modified arterivirus genome or a replicon RNA of the present disclosure that directs the expression of an immunogenic portion of a hepatitis antigen and an immunomodulatory cofactor. The stimulated PBLs are used as effectors in a CTL assay using HLA-matched transduced cells as targets. An increase in the CTL response over that seen in the same assay performed using an HLA-matched stimulator and target cells transduced with a vector encoding the antigen alone indicates a useful immunomodulatory cofactor. In some embodiments, the immunomodulatory cofactor gamma interferon is particularly preferred.

[0160] Another non-limiting example of an immunomodulatory cofactor is the B7 / BB1 costimulator. Two signals are required to fully activate T cell functional activity. One signal is provided by the interaction of an antigen-specific T cell receptor with a peptide bound to a major histocompatibility complex (MHC) molecule, and a second signal, termed costimulation, is delivered to T cells by antigen-presenting cells. The second signal is required for T cell production of interleukin-2 (IL-2) and is thought to involve the interaction of the B7 / BB1 molecule on antigen-presenting cells with the CD28 and CTLA-4 receptors on T lymphocytes. In some embodiments, B7 / BB1 may be introduced into tumor cells to induce costimulation of CD8+ T cells so that they produce enough IL-2 to proliferate and become fully activated. These CD8+ T cells are able to kill tumor cells that do not express B7, since costimulation is not required for further CTL function. Vectors expressing both the costimulatory B7 / BB1 factor and, for example, the immunogenic HBV core protein can be constructed using the methods described herein. Cells transduced with these vectors become more effective antigen-presenting cells. HBV core-specific CTL responses are enhanced from CD8+ T cells fully activated by the costimulatory ligand B7 / BB1.

[0161] 2) Toxin In some embodiments disclosed herein, the GOI encodes a toxin. In some embodiments, the toxin acts to directly inhibit cell growth. Examples of toxins include, but are not limited to, ricin, abrin, diphtheria toxin, cholera toxin, gelonin, pokeweed, antiviral protein, tritin, Shigella toxin, Pseudomonas exotoxin A, herpes simplex virus thymidine kinase (HSVTK), and Escherichia coli guanine phosphoribosyltransferase.

[0162] 3) Prodrugs In some embodiments disclosed herein, the GOI encodes a "prodrug." As used within the context of this disclosure, "prodrug" refers to a gene product that activates a compound with little or no cytotoxicity to the toxic product. Representative examples of such gene products include HSVTK and VZVTK (and their analogs and derivatives), which selectively monophosphorylate certain purine arabinoside and substituted pyrimidine compounds, converting them into cytotoxic or cytostatic metabolites. More specifically, exposure of the drugs ganciclovir, acyclovir, or any of their analogs (e.g., FIAU and DHPG) to HSVTK results in the phosphorylation of the drug to the corresponding active nucleotide triphosphate form.

[0163] Non-limiting examples of prodrugs that may be utilized within the context of the present disclosure include: Escherichia coli guanine phosphoribosyltransferase, which converts thioxanthine to the toxic thioxanthine monophosphate; alkaline phosphatase, which converts inactive phosphorylated compounds such as mitomycin phosphate and doxorubicin phosphate to the toxic dephosphorylated compounds; fungal (e.g., Fusarium oxysporum) and bacterial cytosine deaminases, which can convert 5-fluorocytosine to the toxic compound 5-fluorouracil; carboxypeptidase G2, which cleaves glutamic acid from para-N-bis(2-chloroethyl)aminobenzoylglutamic acid, thereby producing the toxic benzoic acid mustard; and penicillin V amidase, which converts phenoxyacetabidic derivatives of doxorubicin and melphalan to toxic compounds.

[0164] 4) Antisense sequence In some embodiments disclosed herein, the coding sequence of the GOI is an antisense sequence. Antisense sequences are designed to bind to RNA transcripts, thereby preventing the cellular synthesis of a specific protein or the use of that RNA sequence by cells. Non-limiting examples of such sequences include antisense thymidine kinase, antisense dihydrofolate reductase, antisense HER2, antisense ABL, antisense Myc, antisense ras, and antisense sequences that block any enzyme in the nucleotide biosynthesis pathway. Furthermore, according to some embodiments disclosed herein, antisense sequences against interferon and 2-microglobulin can be used to reduce immune responses.

[0165] In some embodiments, antisense RNA can be used as an antitumor agent to induce a strong class I-restricted response. In addition to binding to RNA and thereby preventing the translation of specific mRNAs, high levels of specific antisense sequences are believed to induce increased expression of interferons (such as gamma interferon) through the formation of large amounts of double-stranded RNA. Increased expression of gamma interferon promotes the expression of MHC class I antigens. Preferred antisense sequences for use in this regard include actin RNA, myosin RNA, and histone RNA. Antisense RNA that forms mismatches with actin RNA is particularly preferred.

[0166] 5) Ribozymes Some embodiments disclosed herein provide nucleic acid molecules containing one or more RNA stem-loop structures that produce ribozymes upon infection of host cells. Ribozymes are used to cleave specific RNAs, thereby designed to affect a specific RNA sequence. Typically, the substrate binding sequence of a ribozyme is 10 to 20 nucleotides in length. This sequence length is sufficient to allow hybridization with the target RNA and dissociation of the ribozyme from the cleaved RNA. Representative examples for producing ribozymes include those described in U.S. Patent Nos. 5,116,742, 5,225,337, and 5,246,921.

[0167] 6) Proteins and other cellular components In some embodiments disclosed herein, various proteins or other cellular components may be carried by the nucleic acid molecules of the present disclosure, including, but not limited to, natural or modified cellular components, as well as foreign proteins or cellular components found in, for example, viruses, bacteria, parasites, fungi, or animals, such as mammals.

[0168] Methods for producing polypeptides The host cells of the present disclosure, such as prokaryotic or eukaryotic host cells, can be used to produce (e.g., express) a molecule of interest, such as, for example, a polypeptide, encoded in the open reading frame of a gene of interest (GOI) disclosed herein. Accordingly, the present application further provides methods for producing a molecule of interest, such as, for example, a polypeptide, using the host cells and / or nucleic acid molecules of the present disclosure. The host cells can be, for example, isolated cells, cells in cell culture, cells in vivo, or a combination thereof.

[0169] Some embodiments disclosed herein provide a method for producing a polypeptide of interest. The method may include introducing a nucleic acid molecule according to any one of the aspects and embodiments of the present disclosure into a host cell, thereby producing a polypeptide encoded by the GOI in the host cell. In some embodiments, the introduced nucleic acid molecule is an RNA molecule, such as an mRNA molecule or an RNA replicon. The RNA molecule can be generated by any method known in the art, for example, entirely or partially by de novo synthesis. For example, but not limited to, RNA molecules, such as mRNA molecules and RNA replicons, can be produced using chemical methods, enzymatic techniques, or any combination thereof, for example, by chemical synthesis by de novo assembly (e.g., using oligonucleotides) or by an in vitro transcription reaction (using appropriate enzymes, buffers, nucleotides, etc.). In some examples where the introduced nucleic acid molecule is mRNA, the mRNA can be delivered directly to cells in vivo to produce a polypeptide of interest (e.g., a drug, antigen, etc.) within the cell. The cell may be an isolated cell, a cell in cell culture, a tissue, an organ, and / or a cell within a subject, or any combination thereof. In some embodiments, no new mRNA copies are made within the cell. As disclosed herein, incorporating one or more RNA stem loops of a viral capsid enhancer (e.g., a DLP motif) into chemically synthesized RNA can confer enhanced expression of a gene of interest once the DLP-containing mRNA is introduced into a cell.

[0170] In some embodiments, where the introduced nucleic acid molecule is a vector, such as an RNA replicon, a new mRNA copy can be generated that contains the coding sequence of the gene of interest operably linked to one or more DLP motifs. Incorporation of one or more DLP motifs into a vector, e.g., an RNA replicon, can confer enhanced expression of the intended gene once the DLP-containing vector or replicon is introduced into a cell.

[0171] In some embodiments disclosed herein, a method for producing a polypeptide of interest in a host cell is provided. Such a method includes culturing a recombinant host cell, such as a nucleic acid molecule according to any one of the aspects and embodiments of the present disclosure. In some embodiments, the method includes culturing a host cell of the present disclosure (in which a recombinant expression vector encoding the molecule of interest has been introduced) in a suitable medium, so that the molecule of interest is produced. In some embodiments, the method further includes isolating the molecule of interest from the medium or the host cell.

[0172] Also disclosed is a method for producing a polypeptide of interest in a subject, comprising administering to the subject a nucleic acid molecule according to any one of the aspects and embodiments.

[0173] Suitable host cells and / or subjects for use in the methods and compositions disclosed herein include, but are not limited to, prokaryotic and eukaryotic species. Suitable host cells to be modified using the compositions and methods of the present disclosure may include, but are not limited to, algal cells, bacterial cells, heterokonts, fungal cells, chytrid cells, microfungi, microalgae, and animal cells. In some embodiments, the animal cells are invertebrate cells. In some embodiments, the vertebrate cells are mammalian cells. The host cells can be either untransformed cells or cells that have already been transfected with at least one nucleic acid molecule. Thus, biological samples, biomass, and progeny of recombinant cells according to any one of the aspects and embodiments are also within the scope of the present application. Thus, as discussed in more detail below, polypeptides produced by the methods according to this aspect of the present application are also within the scope of the present application.

[0174] In some embodiments, the recombinant cell is an animal cell. Proteins produced in animal cells are generally believed to have proper processing, post-translational modifications, and therefore sufficient activity for treating physiological conditions, so small- and large-scale production of therapeutic proteins is an important area of ​​development in the pharmaceutical industry. In principle, any animal species can be used, such as humans, dogs, birds, fish, horses, pigs, primates, mice, cotton rats, ferrets, cattle, wild boars, sheep, rabbits, cats, goats, donkeys, hamsters, or buffalo. Non-limiting examples of suitable bird species include chickens, ducks, geese, turkeys, ostriches, emus, swans, peacocks, pheasants, partridges, and guinea fowl. In some specific embodiments, the fish is any species of salmonid. Primary mammalian cells and continuous / immortalized cell types are also suitable. Non-limiting examples of suitable animal host cells include, but are not limited to, pulmonary equine artery endothelial cells, equine dermal cells, baby hamster kidney (BHK) cells, rabbit kidney cells, mouse muscle cells, mouse connective tissue cells, human cervical cells, human epidermoid laryngeal cells, Chinese hamster ovary cells (CHO), human HEK-293 cells, mouse 3T3 cells, Vero cells, Madin-Darby canine kidney epithelial cells (MDCK), primary chicken fibroblasts, HuT78 cells, A549 lung cells, HeLa cells, PER.C6® cells, WI-38 cells, MRC-5 cells, FRhL-2 cells, and CEM T cells. In some embodiments, the host cells are baby hamster kidney cells. In some embodiments, the baby hamster kidney cells are BHK-21 cells.

[0175] Recombinant Polypeptides Some embodiments disclosed herein relate to recombinant polypeptides produced by the methods according to one or more embodiments described herein. The recombinant polypeptides of the present application may generally be any recombinant polypeptide, such as one or more of a therapeutic polypeptide, a preventative polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, and a reporter polypeptide. In some embodiments, the recombinant polypeptide may be one or more of an antibody, an antigen, an immunomodulator, and a cytokine. In some embodiments, the polypeptide of interest may have therapeutic or preventive activity.

[0176] Compositions and Formulations Some embodiments disclosed herein relate to compositions comprising any of the recombinant polypeptides described herein. The compositions may be, for example, nutritional supplement compositions, prophylactic compositions, pharmaceutical compositions containing a pharmaceutically acceptable carrier, or mixtures thereof. In some embodiments, the compositions of the present application may be used as vaccines.

[0177] Some embodiments disclosed herein relate to compositions, such as any of the nucleic acid molecules (e.g., expression vectors) described herein. The compositions can be, for example, nutritional supplement compositions, prophylactic compositions, pharmaceutical compositions including a pharmaceutically acceptable carrier, or mixtures thereof. In some embodiments, the compositions of the present application can be used as vaccines.

[0178] Some embodiments disclosed herein relate to compositions, such as any of the recombinant cells described herein. The compositions can be, for example, nutritional supplement compositions, prophylactic compositions, pharmaceutical compositions including a pharmaceutically acceptable carrier, or mixtures thereof. In some embodiments, the compositions of the present application can be used as vaccines.

[0179] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier that is generally safe, non-toxic, and not biologically or otherwise undesirable and useful for preparing pharmaceutical compositions or formulations, including carriers acceptable for veterinary and human pharmaceutical use. In some embodiments, a pharmaceutically acceptable carrier can be as simple as water, but can also include, for example, a solution of physiological salt concentration. In some embodiments, a pharmaceutically acceptable carrier can be or include stabilizers, diluents, and buffers. Suitable stabilizers are, for example, SPGA, carbohydrates (e.g., powdered milk, serum albumin, or casein), or their degradation products. Suitable buffers are, for example, alkali metal phosphates. Diluents include water, aqueous buffers (e.g., buffered saline), alcohols, and polyols (e.g., glycerol). For administration to animals or humans, the compositions of the present application can be administered by any enteral or parenteral route, such as intranasal, spray, intradermal, subcutaneous, oral, aerosol, intramuscular, or any combination thereof, among others.

[0180] In some embodiments, the nucleic acid molecules (e.g., mRNA and / or expression vectors), protein molecules, and / or compositions of the present disclosure are in a suitable formulation, such as a pharmaceutical formulation. Provided herein are pharmaceutical formulations comprising one or more of the molecules and / or compositions disclosed herein in a pharmaceutically acceptable vehicle. Some embodiments of the present disclosure relate to pharmaceutical formulations comprising one or more of the expression vectors disclosed herein. Some embodiments of the present disclosure relate to pharmaceutical formulations containing one or more of the nucleic acid molecules disclosed herein. Some embodiments of the present disclosure relate to pharmaceutical formulations containing one or more of the polypeptides disclosed herein. Some embodiments of the present disclosure relate to pharmaceutical formulations containing one or more of the recombinant cells disclosed herein.

[0181] The molecules (e.g., proteins and nucleic acid molecules) and compositions disclosed herein can be in various formulations, e.g., pharmaceutical formulations. For example, the nucleic acid molecules (e.g., replicons, mRNAs, and expression vectors), protein molecules, and / or compositions of the present disclosure can be formulated, for example, into pharmaceutical formulations with one or more covalent compounds (e.g., by direct conjugation), non-covalent compounds (e.g., by charge-based association from LNPs or cationic nanoemulsions), physical compositions (e.g., vault proteins, uncharged lipid encapsulation), pharmaceutically acceptable buffers (e.g., saline, lactated Ringer's solution), and any combination thereof. Many methods, reagents, and systems suitable for producing the aforementioned pharmaceutical formulations are known in the art.

[0182] In some embodiments, the molecules and / or compositions disclosed herein are formulated in saline or a lipid formulation, which may be selected from, but is not limited to, liposomes, lipoplexes, copolymers such as PLGA, and lipid nanoparticles.

[0183] Particles and Nanoparticles In some embodiments, one or more of the nucleic acid molecules, polypeptide molecules, and / or compositions disclosed herein can be incorporated into particles or nanoparticles. Particles comprising one or more of the molecules and compositions disclosed herein can be polymer particles, lipid particles, solid lipid particles, self-assembled particles, composite nanoparticles of conjugated phospholipids, surfactants, proteins, polyamino acids, inorganic particles, or combinations thereof (e.g., lipid-stabilized polymer particles). In some embodiments, the molecules and / or compositions disclosed herein are substantially encapsulated or partially encapsulated within the particle. In some embodiments, the molecules and / or compositions disclosed herein are deposited and / or adsorbed onto the surface of the particle. In some embodiments, the molecules and / or compositions disclosed herein are incorporated into the particle. In some embodiments, the molecules and / or compositions disclosed herein are part of or a component of the particle. In some embodiments, the molecules and / or compositions disclosed herein can be attached to the surface of the particle by covalent or non-covalent interactions. In some embodiments, the molecules and / or compositions disclosed herein self-assemble into the particle.

[0184] As used herein, the term "encapsulate" means to surround, enclose, or encase. Encapsulation can be substantial, complete, or partial as it relates to the formulation of molecules and / or compositions of the present disclosure. The term "substantially encapsulated" means that at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or more than 99.999% of the molecules and / or compositions of the present disclosure may be enclosed, surrounded, or enclosed within the particle. "Partial encapsulation" means that less than 10%, 15%, 20%, 30%, 40%, or 50% of the molecules and / or compositions of the present disclosure may be enclosed, surrounded, or enclosed within the particle. For example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or 99.999% of the molecules and / or compositions of the disclosure are encapsulated within the particles. Encapsulation can be determined by any known method.

[0185] In some embodiments, the particles are polymer particles or comprise a polymer matrix. The particles can generally contain any polymer known in the art. The particles generally contain one or more biocompatible polymers. The polymers can be biodegradable polymers. The polymers can be hydrophobic, hydrophilic, or amphiphilic polymers. In some embodiments, the particles comprise one or more polymers having additional targeting moieties attached thereto. In some embodiments, the particles are inorganic particles, such as, but not limited to, gold nanoparticles and iron oxide nanoparticles.

[0186] The size of the particles can be tailored to the intended use. The particles can be nanoparticles or microparticles. The particles can have a diameter of about 10 nm to about 10 microns, about 10 nm to about 1 micron, about 10 nm to about 500 nm, about 20 nm to about 500 nm, or about 25 nm to about 250 nm. In some embodiments, the particles are nanoparticles having a diameter of about 25 nm to about 250 nm. In some embodiments, the particles are nanoparticles having a diameter of about 50 nm to about 150 nm. In some embodiments, the particles are nanoparticles having a diameter of about 70 nm to about 130 nm. In some embodiments, the particles are nanoparticles having a diameter of about 100 nm. As will be understood by those skilled in the art, particles can have a range of sizes, and the diameter is understood to be the median diameter of the particle size distribution.

[0187] In some embodiments, the molecules and / or compositions disclosed herein may be incorporated into particles that are responsive to temperature, pH, and ionic conditions. For example, the particles may comprise an ionized network of covalently crosslinked homopolymeric ionized monomers, the ionized network covalently attached to a single terminal region of an amphiphilic copolymer to form multiple "dangling chains," which form immobilized intra-network aggregates in aqueous solution, as disclosed in U.S. Patent No. 7,204,997.

[0188] Liposomes, lipoplexes, and lipid nanoparticles (LNPs) The molecules and / or compositions of the present disclosure may be formulated using one or more liposomes, lipoplexes, and / or lipid nanoparticles. In one embodiment, pharmaceutical formulations of the molecules and / or compositions of the present disclosure include liposomes. Liposomes are artificially prepared vesicles, which may be composed primarily of lipid bilayers and may be used as delivery vehicles for administering nutrients and pharmaceutical compounds. Liposomes can be of different sizes, including, but not limited to, multilamellar vesicles (MLVs), which may be hundreds of nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments; small unilamellar vesicles (SUVs), which may be 50 nm or less in diameter; and large unilamellar vesicles (LUVs), which may be 50-500 nm in diameter. Liposome designs may include, but are not limited to, opsonins or ligands to improve liposome adhesion to unhealthy tissues or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or high pH to improve delivery of pharmaceutical compounds.

[0189] The formation of liposomes may depend on physicochemical properties such as, but not limited to, the entrapped pharmaceutical compound and liposome components, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during application and / or delivery of the vesicles, optimized size, polydispersity and effective shelf life of the vesicles for the intended use, and the possibility of batch-to-batch reproducibility and large-scale production of a safe and efficient liposome product.

[0190] In some embodiments, the molecules and / or compositions of the present disclosure may be formulated in lipid vesicles, which may have crosslinks between functionalized lipid bilayers. In some embodiments, the molecules and / or compositions of the present disclosure may be formulated in lipid-polycation complexes. Formation of lipid-polycation complexes may be achieved by methods known in the art. By way of non-limiting example, polycations may include, but are not limited to, cationic peptides or polypeptides such as polylysine, polyornithine, and / or polyarginine, as well as cationic peptides. In some embodiments, the nucleic acid molecules and / or compositions disclosed herein may be formulated in lipid-polycation complexes, which may further include, but are not limited to, neutral lipids such as cholesterol or dioleoylphosphatidylethanolamine (DOPE). Liposome formulations may be influenced by biophysical parameters, including, but not limited to, the choice of cationic lipid component, the degree of cationic lipid saturation, the nature of PEGylation, the ratio of all components, and size.

[0191] In some embodiments, the proportion of PEG in lipid nanoparticle (LNP) formulations can be increased or decreased, and / or the carbon chain length of the PEG lipid can be changed from C14 to C18 to alter the pharmacokinetics and / or biodistribution of the LNP formulation. As a non-limiting example, an LNP formulation can contain 1-5% lipid molar ratio of PEG-c-DOMG relative to the cationic lipid, DSPC, and cholesterol. In another embodiment, PEG-c-DOMG can be replaced with a PEG lipid, such as, but not limited to, PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol) or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The cationic lipid can be selected from any lipid known in the art, such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200, and DLin-KC2-DMA.

[0192] In some embodiments, the LNP formulations described herein can include a polycationic composition. In some embodiments, LNP formulations including a polycationic composition can be used to deliver the modified RNA described herein in vivo and / or ex vitro. In some embodiments, the LNP formulations described herein can additionally include a permeability enhancer molecule. The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and a modified nucleic acid molecule (e.g., mRNA). By way of non-limiting example, the carbohydrate carrier can include, but is not limited to, anhydrous-modified phytoglycogen or glycogen-type materials, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, and anhydrous-modified phytoglycogen beta-dextrin.

[0193] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly eliminated lipid nanoparticles (reLNPs). Ionizable cationic lipids, such as, but not limited to, DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and can be a potential source of toxicity. Rapid metabolism of rapidly eliminated lipids can improve the tolerability and therapeutic index of lipid nanoparticles by an order of magnitude, from a 1 mg / kg dose to a 10 mg / kg dose in rats. The inclusion of enzymatically degradable ester linkages can improve the degradation and metabolic profile of the cationic components while maintaining the activity of reLNP formulations. The ester linkages can be placed internally within the lipid chain or terminally at the end of the lipid chain. Internal ester linkages can replace any carbon in the lipid chain.

[0194] Further information regarding cationic lipids that are suitable for LNP formulations can be found, for example, in U.S. Patent Application Publication No. 2017 / 0151339, which is incorporated by reference in its entirety.

[0195] The molecules and / or compositions of the present disclosure may also be formulated as nanoparticles using combinations of polymers, lipids, and / or other biodegradable agents, such as, but not limited to, calcium phosphate. Components can be combined in core-shell, hybrid, and / or interlayer architectures to allow for fine tuning of the nanoparticles, which may enhance delivery of the molecules and / or compositions of the present disclosure.

[0196] As used herein, the pharmaceutical formulations of the present disclosure may further comprise one or more pharmaceutically acceptable excipients, such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening and emulsifying agents, preservatives, solid binders, lubricants, etc., as appropriate for the desired specific dosage form. Further information in this regard can be found in Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006), which discloses various excipients used in formulating pharmaceutical compositions and known techniques for their preparation. Unless any conventional excipient vehicle is incompatible with the substance or its derivatives, for example, by causing any undesirable biological effects or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition, its use is intended to be within the scope of the present disclosure. [Example]

[0197] Example Further alternatives are disclosed in more detail in the following examples, which are not intended to limit the scope of the claims in any way.

[0198] Example 1 General experimental procedure Preparation of DNA templates Plasmid DNA templates were purified (Qiagen catalog no. 12163) from 300 mL of saturated E. coli TransforMax Epi300 (Epicentre catalog no. 300105) cultures grown in LB broth (Teknova catalog no. L8000 06) supplemented with 50 ng / ml carbamicillin (Teknova catalog no. NC9730116). Plasmid DNA was linearized by NotI digestion (New England Biolabs NEB catalog no. R3189S) at 37°C for 1 hour. Linear template DNA was repurified (Zymo catalog no. D4003) and analyzed on a 0.8% agarose gel (Life Technologies catalog no. G5018-08) against a commercially available 2-log DNA ladder (New England Biolabs, NEB catalog no. N3200S). The presence of a single band was confirmed in each sample, corresponding to the expected fragment size of the linear DNA template before proceeding with ex vitro transcription.

[0199] Ex vitro transcription Ex vitro transcription (IVT) reactions were performed using 1 μg of DNA template prepared as described above in a 20 μl reaction, incubated at 37°C for 1 hour (NEB catalog no. E2065S). One unit of DNase I, provided by the supplier, was then added directly to the IVT reaction and incubated at 37°C for an additional 15 minutes. The reaction was then placed on ice and purified using the manufacturer's suggested method (Qiagen catalog no. 74104). The purified RNA was then quantified using a NanoDrop 2000c UV-Vis spectrophotometer. Before proceeding with electroporation, RNA was visualized by electrophoresis on a 0.8% agarose gel (Life Technologies catalog no. G5018-08) and compared to the Millennium RNA Marker (Ambion catalog no. AM7150).

[0200] Transfection and analysis In a typical cell transfection experiment, replicon RNA was introduced into BHK-21 cells by electroporation using the SF Cell Line Nucleofector™ Kit for the 4D-Nucleofector™ System (Lonza). BHK-21 cells were harvested with 0.25% trypsin and washed once with cold PBS. Cells were transfected at a cell density of 1 x 10 cells per 20 μL electroporation reaction. 6 Cells were resuspended in SF buffer. Three micrograms of RNA was electroporated into triplicate cells in 16-well cuvette strips and incubated at room temperature for 10 minutes. Electroporated cells were harvested in plates containing Dulbecco's modified Eagle's medium with 10% fetal bovine serum and subsequently incubated for 16-18 hours under standard cell culture conditions.

[0201] Intracellular analysis of replicon transfection efficiency and protein production was performed by flow cytometry. For these assays, transfected BHK-21 cells were fixed and permeabilized using Fixation / Perm Concentrate and Permeabilization Buffer (eBioscience). The cells were then incubated with an antibody for double-stranded RNA production (J2 anti-dsRNA IgG2A monoclonal antibody, English & Scientific Company) conjugated with R-phycoerythrin (Innova Biosciences). Antigen production was assessed by further incubation with antigen-specific antibodies (e.g., red firefly, green Renilla, HA, or RSV-F0 (Abcam)) conjugated with PE-Cy5 (Innova Biosciences). The cells were then washed once and analyzed using a FACSAria™ Fusion Cell Sorter (BD Biosciences) or a FACSAria™ II Cell Sorter (BD Biosciences). Transfected BHK-21 cells stained with a single color for compensation controls were run prior to sample collection. Data were collected using FACSDiva (BD Biosciences) and further analyzed using FlowJo software. Initial gating was performed using forward and side scatter plots to exclude dead cells and debris. Further gating was performed to identify cell populations positive for both dsRNA (R-PE positive) and protein expression (PE-Cy5 positive or FITC positive for GFP expression). Frequency and mean fluorescence intensity were collected and used for construct comparison and optimization.

[0202] Example 2 Construction of DLP-containing EAV replicon design This example describes the generation of multiple arterivirus RNA replicon-based expression vectors with DLP motifs operably positioned upstream of the polyprotein gene / nonstructural protein gene and / or reporter gene. These arterivirus RNA replicon-based expression vectors were then characterized and analyzed in flow cytometry and bulk luciferase assays as described in Example 4.

[0203] A. Design The design features of each of the four EAV-based DLP replicon constructs are described below.

[0204] (1)rEX-DLP-rFF In this construct, a DLP motif placed immediately upstream of rFF and downstream of TRS7 drives transcription of rFF.

[0205] (2)rEX-DLP-pp1ab-rFF In this construct, a DLP motif was placed immediately upstream of the pp1ab gene, with several careful design changes described below, to maintain a stem-loop structure in the 5′UTR of the replicon, which is known to be essential for replication and transcription of subgenomic mRNAs. (i) The first 79 nucleotides of the nonstructural viral gene 1a overlap with its start codon mutated from ATG to TAG, and are shown as the "ATG shift region" (bold in the sequence of SEQ ID NO:2 below). (ii) The corresponding nucleotides located upstream of the 1a gene, which base pair with its initiation codon ATG to form a stem, were also changed from CAT to CTA (underlined in the sequence of SEQ ID NO: 2 below). (iii) DLP (shown in italics in the sequence below) was placed immediately downstream of the "ATG shift region" and upstream of the polyprotein 1ab gene (start codon ATG shown in the sequence SEQ ID NO:2 below). [ka]

[0206] This construct is essentially identical to the second construct, with the exception that a 2A protease sequence (SEQ ID NO: 3) was added immediately to the 3' end of the DLP, with the DLP positioned according to the same three design changes, allowing the polyprotein to be released from the DLP-derived peptides by selective cleavage by the protease upon translation. Comparative analysis of the performance of replicon constructs 2 (above) and 3 provides information on whether the 2A protease is required for a functional replicon (see Example 4 below). SEQ ID NO: 3 GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT

[0207] (4)rEX-DLP-2A-pp1ab-DLP-rFF This construct was essentially identical to the third construct described above, except that another DLP was placed immediately upstream of the reporter rFF gene (in the same manner as the DLP motif was placed in construct 1). Comparative analysis of the performance with replicon construct 3 (described above) and construct 4 provides information on whether the additional DLP placed upstream of the reporter gene has added value to reporter gene expression.

[0208] B.Construction rEx-DLP-rFF was constructed by the 3-piece Gibson Assembly® procedure described by Gibson et al. (Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345, 2009) using rEx-rFF (c4; SEQ ID NO: 34) digested with SphI and EcoRI as the vector and a DLP-containing g-block as the insert. The nucleic acid sequence of the g-block used in the construction of rEx-DLP-rFF is set forth in SEQ ID NO: 4 in the Sequence Listing.

[0209] The following primers were designed to amplify the corresponding fragments required to construct the three new EAV-based DLP replicon constructs described above. [Table 3]

[0210] Construction of rEx-DLP-pp1ab-rFF For construction of the rEx-DLP-pp1ab-rFF vector, three nucleic acid fragments were generated by using the 3-piece Gibson Assembly® procedure as follows.

[0211] Fragment 1 was generated using primers RP114 and RP115 and the template backbone rEx-rFF.

[0212] Fragment 2 was generated using primers RP116 and RP117 and the template backbone rEx-rFF.

[0213] Fragment 3 was the g block of rEx-DLP-pp1ab-rFF having the nucleic acid sequence set forth in SEQ ID NO: 10 in the Sequence Listing.

[0214] Construction of rEx-DLP-2A-pp1ab-rFF For construction of the rEx-DLP-2A-pp1ab-rFF vector, three nucleic acid fragments were generated by using the 3-piece Gibson Assembly® procedure as follows.

[0215] Fragment 4 was generated using primers RP118 and RP115 and the template backbone rEx-rFF.

[0216] Fragment 5 was generated using primers RP116 and RP117 and the template backbone rEx-rFF.

[0217] Fragment 6 was the g block of rEx-DLP-2A-pp1ab-rFF having the nucleic acid sequence set forth in SEQ ID NO: 11 in the Sequence Listing.

[0218] Construction of rEx-DLP-2A-pp1ab-DLP-rFF For construction of the rEx-DLP-2A-pp1ab-DLP-rFF vector, three nucleic acid fragments were generated by using the 3-piece Gibson Assembly® procedure as follows.

[0219] Fragment 7 was generated using primers RP118 and RP115 and the template backbone rEx-DLP-rFF.

[0220] Fragment 8 was generated using primers RP116 and RP117 and the template backbone rEx-DLP-rFF.

[0221] Fragment 9 was the g block of rEx-DLP-2A-pp1ab-DLP-rFF having the nucleic acid sequence set forth in SEQ ID NO: 12 in the Sequence Listing.

[0222] Assembly of the constructs was performed using the 3-piece Gibson Assembly® procedure described in Gibson et al. (2009, supra). Specifically, the rEx-DLP-pp1ab-rFF construct was constructed using fragments 1, 2, and 3. The rEx-DLP-2A-pp1ab-rFF construct was constructed using fragments 4, 5, and 6. The rEx-DLP-2A-pp1ab-DLP-rFF construct was constructed using fragments 7, 8, and 9. The assembled products were then transformed into EPI300 cells (Epicenter). For each transformation, a total of 144 colonies were screened using primers RP126 (SEQ ID NO: 13) and RP127 (SEQ ID NO: 14), yielding four PCR-positive clones for rEx-DLP-pp1ab-rFF. Three PCR-positive clones were obtained for rEx-DLP-2A-pp1ab-rFF, and two PCR-positive clones were obtained for rEx-DLP-2A-pp1ab-DLP-rFF. Subsequent MiSeq results revealed that clones 4, 3, and 15, and clones 18 and 20 were completely sequence-correct for rEx-DLP-pp1ab-rFF, rEx-DLP-2A-pp1ab-rFF, and rEx-DLP-2A-pp1ab-DLP-rFF, respectively. [Table 4]

[0223] Maps of rEx-DLP-rFF, rEx-DLP-pp1ab-rFF, rEx-DLP-2A-pp1ab-rFF, and rEx-DLP-2A-pp1ab-DLP-rFF are also shown in Figures 2A-2D.

[0224] The sequences of the resulting replicons are disclosed in the Sequence Listing along with a T7 promoter and a 65A polyA tail as follows: rEx-DLP-rFF (SEQ ID NO: 15), rEx-DLP-pp1ab-rFF (SEQ ID NO: 16), rEx-DLP-2A-pp1ab-rFF (SEQ ID NO: 17), and rEx-DLP-2A-pp1ab-DLP-rFF (SEQ ID NO: 18).

[0225] Example 3 Design and construction of DLP-containing alphavirus replicons This example describes the generation of multiple alphavirus RNA replicon-based expression vectors with DLP motifs positioned upstream of the polyprotein gene / nonstructural protein gene and / or reporter gene. These alphavirus RNA replicon-based expression vectors were then characterized and analyzed in flow cytometry and bulk luciferase assays as described in Example 5. A. Design

[0226] The design features of each of the three alphavirus-based DLP replicon constructs are described below.

[0227] (1) alpha-R-DLP-rFF In this construct, DLP was placed immediately upstream of the start codon of the reporter gene rFF.

[0228] (2) Alpha-R-DLP-2A-nsp-rFF In this construct, the sequence encoding the DLP motif and 2A peptide sequence (which was the same sequence used in the rEx-DLP-2A-pp1ab-rFF replicon described in Example 2 above) was placed within the 5' end of the replicon, with several careful design changes described below to potentially maintain the sequence structural requirements for replication and subgenomic mRNA transcription. (i) The first 195 nucleotides of the nsp1 gene overlap with the start codon mutated from ATG to TAG (shown in bold in the sequence SEQ ID NO: 19 below). (ii) This 195 nucleotide overlapping sequence was placed immediately after the 5'UTR of the wild-type alphavirus (shown underlined in the sequence of SEQ ID NO:19 below), followed by the DLP-2A sequence (shown in italics in the sequence). (iii) The start codon of the nsp1 gene after the DLP-2A sequence was removed (shown by a strikethrough in the sequence of SEQ ID NO: 19 below). [ka]

[0229] (3) Alpha-R-DLP-2A-nsp-DLP-rFF This construct is essentially identical to construct 2 after the same three design changes, except that an additional DLP motif was placed immediately upstream of the reporter rFF gene (in the same manner that the DLP motif was placed in construct 1). Comparative analysis of the performance of replicon constructs 2 and 3 will provide information on whether the additional DLP placed upstream of the reporter gene has added value to reporter gene expression (see Example 5 below).

[0230] B.Construction Construction of alpha-R-DLP-rFF Alpha-R-DLP-rFF was constructed by the Gibson Assembly® procedure using EcoRI / SapI as the vector and alpha-R-eGFP (c6; SEQ ID NO:35) as the insert, which had been amplified by PCR from template rEx-DLP-rFF (c2, SEQ ID NO:15) and digested with EcoRI / SapI, replacing eGFP with DLP-rFF, with primers rP112 (SEQ ID NO:20) and RP113 (SEQ ID NO:21). Clones 2 and 3 were confirmed to have the correct sequence by MiSeq sequencing. [Table 5]

[0231] Construction of alpha-R-DLP-2A-nsp-rFF and alpha-R-DLP-2A-nsp-DLP-rFF Alpha-R-DLP-2A-nsp-rFF (construct 2) and alpha-R-DLP-2A-nsp-DLP-rFF (construct 3) were constructed by the Gibson Assembly® procedure using the respective g-blocks as inserts, vectors PCR-amplified from the respective templates alpha-R-rFF (c6; SEQ ID NO:35) and alpha-R-DLP-rFF (c2; SEQ ID NO:26) with primers RP124 and RP125 (SEQ ID NO:23). Clones 1 and 3 of alpha-R-DLP-2A-nsp-rFF and clones 8 and 32 of alpha-R-DLP-2A-nsp-DLP-rFF were sequence-confirmed to be completely correct by MiSeq. [Table 6]

[0232] The sequence of the g-block used in the construction of alpha-R-DLP-2A-nsp-rFF is provided in the Sequence Listing as SEQ ID NO: 24. The sequence of the g-block used in the construction of alpha-R-DLP-2A-nsp-DLP-rFF is provided in the Sequence Listing as SEQ ID NO: 25.

[0233] Maps of alpha-R-rFF, alpha-R-DLP-rFF, alpha-R-DLP-2A-nsp-rFF, and alpha-R-DLP-2A-nsp-DLP-rFF are shown in Figures 3A to 3D.

[0234] The sequences of the resulting replicons are also provided in the sequence listing with a T7 promoter and a 40A polyA tail as follows: alpha-R-rFF (SEQ ID NO: 26), alpha-R-DLP-rFF (SEQ ID NO: 27), alpha-R-DLP-2A-nsp-rFF (SEQ ID NO: 28), and alpha-R-DLP-2A-nsp-DLP-rFF (SEQ ID NO: 29).

[0235] Construction of alpha-R-DLP-2A-rFF and alpha-R-DLP-2A-nsp-DLP-2A-rFF Without being bound by any particular theory, it is believed that placing the DLP motif immediately upstream of the reporter gene rFF without the 2A protease sequence in between may have a negative effect on protein expression of the GOI. This negative effect may be due to the presence of the DLP sequence, translated into a peptide, at the 5' end of rFF, making rFF a "fusion" protein. Therefore, two new constructs were designed and constructed, including alpha-R-DLP-rFF and alpha-R-DLP-2A-nsp-DLP, between the DLP motif and the rFF gene for two alphavirus-replicon constructs, generating alpha-R-DLP-2A-rFF and alpha-R-DLP-2A-nsp-DLP-2A-rFF, respectively. The inclusion of the 2A protease peptide sequence allows for cleavage of the peptide encoded by the DLP sequence from rFF (see Example 5 below).

[0236] For this purpose, two g-block fragments were synthesized (SEQ ID NOs: 30 and 31) and cloned into the respective EcoRV / SbfI-digested vectors via Gibson Assembly. The alpha-R-DLP-2A-rFF clone 1 and the alpha-R-DLP-2A-nsp-DLP-2A-rFF clones 8 and 9 were confirmed to be completely correct sequences by Sanger sequencing using RP123 (SEQ ID NO: 32) and RP96 (P89; SEQ ID NO: 96). [Table 7]

[0237] Schematic maps of alpha-R-DLP-2A-rFF and alpha-R-DLP-2A-nsp-DLP-2A-rFF are provided in Figures 4A and 4B.

[0238] Example 4 Expression analysis of replicon-containing EAV-based DLPs As shown in Examples 2 and 3 above, multiple EAV-based DLP-containing replicons were constructed to determine the effect of engineering DLP motifs positioned upstream of either the replicon nonstructural protein genes or the GOI gene on the subgenomic mRNA (Table 8). [Table 8]

[0239] Initial characterization of the DLP replicon construct was performed ex vitro. RNA was produced as described in Example 1 above and used to electroporate BHK cells. After electroporation, cells were analyzed for protein expression by FACS analysis, Western blot, or bulk luciferase assay.

[0240] A graphical summary of the results of experiments performed to measure the expression levels of an exemplary gene of interest (GOI), the rFF luciferase reporter, derived from an EAV-based DLP replicon is shown in Figure 5. Both FAC analysis and bulk luciferase data are presented. In these experiments, four different EAV DLP replicons were analyzed as follows: 1) rEx-DLP-rFF: EAV-based replicon with DLP motif located upstream of the subgenomic mRNA rFF transcript; 2) rEx-DLP-pp1ab-rFF: an EAV-based replicon with DLP located upstream of the nonstructural pp1ab gene; 3) rEx-DLP-2A-pp1ab-rFF: an EAV-based replicon with a DLP motif positioned upstream of the nonstructural proteins and a 2A protease peptide positioned between the DLP and pp1ab regions; and 4) rEx-DLP-2A-pp1ab-DLP-rFF: an EAV-based replicon in which the first DLP motif was positioned upstream of the nonstructural proteins, the 2A protease peptide was positioned between the DLP and pp1ab regions, and the second DLP motif was positioned upstream of the rFF subgenomic mRNA transcript.

[0241] The results shown in Figures 5A-5B demonstrate that engineering a DLP motif upstream of either the EAV nonstructural protein genes (e.g., rEx-DLP-pp1ab-rFF, rEx-DLP-2A-pp1ab-rFF, or rEx-DLP-2A-pp1ab-DLP-rFF) or the rFF reporter gene subgenomic RNA (e.g., rEx-DLP-rFF and rEx-DLP-2A-pp1ab-DLP-rFF) did not adversely affect genomic RNA replication, as all four constructs exhibited nearly identical electroporation efficiencies (Figure 5A). Interestingly, bulk luciferase activity analysis demonstrated that the rEx-DLP-pp1ab-rFF replicon expressed significantly less luciferase than the other three replicon designs (Figure 5B). As mentioned above, incorporating a DLP motif upstream of any GOI results in an N-terminal fusion of Sindbis capsid amino acids encoded by in-frame codons found in the DLP sequence. Fusion proteins generated using the DLP-encoding amino acids and the EAV nsP1 protein likely affect the EAV replication complex's ability to efficiently produce subgenomic RNA, resulting in the noted reduction in rFF GOI expression levels. One of the most notable results from this study was that EAV replicon constructs containing DLP, which controls the translation of nonstructural protein genes (rEx-DLP-pp1ab-rFF, rEx-DLP-2A-pp1ab-rFF, and rEx-DLP-2A-pp1ab-DLP-rFF), were translated as efficiently as replicon RNAs lacking the DLP at this position (rEx-DLP-rFF). This result was unexpected from studies conducted by other researchers. It has been previously reported that the integration of the 5' Sindbis virus subgenomic RNA sequence (containing the DLP region) results in efficient translation only in virus-infected cells. In other words, mRNA containing the DLP motif associated with a reporter gene was reported to be poorly translated in cells not infected with Sindbis virus.In these cells, the lack of innate immune activation puts DLP-modified mRNA at a distinct translational disadvantage compared to the translation of mRNA without DLP modifications (all cellular mRNAs). Because the innate immune system was not activated in these cells at the time the DLP-containing replicon vector was introduced, these DLP-containing mRNAs (capable of self-amplification) should be translated very inefficiently. Surprisingly, this was not supported by the experiments presented herein.

[0242] We next examined the rEx-DLP-2A-pp1ab-rFF EAV replicon in cells treated with IFN to induce the cellular innate immune system. IFN treatment of BHK cells induces PKR activation and eIF2α phosphorylation, which subsequently leads to global cellular mRNA translation cessation. Arteriviruses have previously been reported to be highly sensitive to IFN treatment (Luo et al., Antiviral Res. Aug;91(2):99-101, 2011). Therefore, IFN treatment of BHK cells, which are responsive to IFN exposure and induce the innate immune system, halts arterivirus replication. A representative example of the expression capacity of the DLP-modified EAV replicon in the presence of innate immune system activation is shown in Figure 6. The rEx-DLP-2A-pp1ab-rFF replicon exhibited significant resistance to innate immune system activation compared with an EAV replicon lacking the DLP motif, i.e., rEx-rFF. Compared with the control rEx-rFF replicon, both replication (Figure 6A) and expression (Figure 6B) of rEx-DLP-2A-pp1ab-rFF were significantly higher in IFN-treated cells. These data demonstrate that DLP-modified EAV replicons can overcome innate immune system shutdown and that this replicon vector represents a significant advance in self-amplifying RNA technology.

[0243] Example 5 Expression analysis of DLP-containing VEEV replicons As shown in Examples 2 and 3 above, multiple VEEV-based DLP-containing replicons were constructed to determine the impact of engineering DLP motifs positioned upstream of either the replicon nonstructural protein genes or the GOI gene on the subgenomic mRNA.

[0244] VEEV alphavirus replicon vectors were engineered to contain one or more DLP motifs by using a strategy similar to the construction of EAV-based replicon vectors. Importantly, unlike other members of the alphavirus genus (mostly Old World viruses), the VEEV genome does not contain DLP motifs associated with the translation of its subgenomic mRNA. Initial analysis of the VEEV DLP replicon was performed in BHK-21 cells, as described in Example 1 above. Although BHK-21 cells do not secrete IFN in response to RNA replication, these cells can induce innate immune activation in response to exogenous IFN. In this experiment, four different alphavirus replicon constructs were tested. The experimental data, shown in Figure 7, demonstrate replication of the DLP-containing alphavirus replicon and expression of the rFF luciferase gene in BHK cells treated either with electroporation (0 h) or 3 h after electroporation with 1000 U / ml of exogenous IFN. The replicon RNAs tested were: 1) alpha-R-rFF: a control VEEV-based replicon in the absence of DLP; 2) alpha-R-DLP-rFF: a VEEV-based replicon in which the DLP motif is located upstream of the subgenomic mRNA rFF transcript; 3) alpha-R-DLP-2A-nsp-rFF: a VEEV-based replicon in which the DLP motif is located upstream of the nonstructural proteins and the 2A protease is located between the DLP and nsp regions; and 4) alpha-R-DLP-2A-nsp-DLP-rFF: A VEEV-based replicon in which the first DLP motif is located upstream of the nonstructural proteins, the 2A protease is located between the DLP and nsp regions, and the second DLP motif is located upstream of the rFF subgenomic mRNA transcript.

[0245] The results of luciferase expression normalized to the number of positive cells detected by FAC analysis are shown in Figure 7. We observed that the presence of the DLP motif, which controls the translation of VEEV nonstructural protein genes, resulted in higher reporter gene expression both in the absence and presence of IFN treatment after electroporation (Figures 7A-7C). Although the increase in rFF expression may not be considered statistically significant, the trend across all conditions was due to increased protein expression. As noted above in Example 4 for the DLP-containing EAV replicon, the DLP motif might be expected to have a negative effect on mRNA translation in cells that are not in an activated innate immune response state. Directly contrary to that expectation, in these experiments, BHK cells not treated with IFN (Figure 7A) represented the sample with the greatest benefit from DLP motif incorporation.

[0246] Next, we tested the two RNA replicons, alpha-R-rFF and alpha-DLP-2A-nsp-rFF, in Balb / c mice in vivo. Groups of 10 mice were tested in this experiment. Equal doses of RNA were injected intramuscularly, and whole-body IVIS (in vivo imaging system) analysis was performed over a one-week period. Whole-body imaging was performed on days 1, 3, and 7 postinjection. Total flux measured at the injection site is shown in Figure 8. Although a slight increase in protein expression was evident ex vitro compared with the DLP-modified VEEV replicon (Figure 8), statistically significantly higher protein expression was detected with the DLP-modified VEEV replicon RNA at all time points measured (Figure 8). This observation represents an important advantage, as unmodified VEEV replicon vectors are capable of very high protein expression, which can reach up to 20% of total cellular protein (Pussko et al., 1997). The DLP-modified VEEV replicon exceeded even this expression capacity and demonstrated superior protein expression. For this reason, DLP-modified alphavirus replicon vectors represent a significant advance over existing alphavirus replicon RNA technology.

[0247] There are at least three unexpected results that can be drawn from the experimental data presented in the above examples. First, DLP motifs have been shown to adversely affect mRNA translation when cells are not in an activated state of the innate immune system. The DLP-containing replicon RNAs disclosed herein were found to have no adverse effects in cells in a basal state of innate activation. Second, the expression levels of DLP-containing VEEV replicons in particular were found to be even higher in vivo than unmodified replicons. This observation demonstrates that expression levels can be increased from previously high historical levels, even from alphavirus replicons. Third, all positive-strand RNA viruses have considerable sequence conservation at both the 5' and 3' ends of their genomes. The fact that both VEEV and EAV replicons are flexible enough to accommodate the incorporation of stem-loop structures (DLPs) into the 5' ends of their RNAs is unexpected.

[0248] Example 6 In vivo immunogenic response using the DLP replicon expression system Alphavirus replicon vectors were engineered to contain one or more DLP motifs, as described above. The RNA replicon containing the DLP sequence, alpha-R-gDLP-HA, was further analyzed in vivo in Balb / c mice. In this experiment, mice were injected at 6-week intervals with 15 μg, 1.5 μg, or 0.15 μg of RNA encoding hemagglutinin from influenza A / Vietnam / 1203 / 2004 (H5N1). 14 days after the final boost, spleens and serum were collected to analyze the immune response to HA. A summary of the results of these experiments is shown in Figures 12A-12C. In Figure 12A, a significant increase in memory precursor effector cells (MPECs) was observed with the DLP motif-containing construct compared to a comparable dose of the unmodified replicon. HA-specific MPECs were analyzed using dextramers (H-2 Kd(IYSTVASSL; SEQ ID NO: 44)) to identify other population-specific markers (CD8 + CD44 + CD62L LoKLRG-1 Lo IL-7Ra Hi CXCR3 Hi ) was detected. Notably, this benefit was observable even at low doses. In Figures 12B and 12C, effector T cell responses were observed in CD4 + T cells or CD8 + Animals immunized with the DLP motif-containing replicon showed significantly higher frequencies of cytokine-expressing CD4 T cells at doses of 15 μg and 1.5 μg, as measured by the number of antigen-specific HA cells secreting IFN-γ after stimulation with the T cell peptide. + and CD8 + Taken together, these data demonstrate a significant increase in both effector and memory T cell responses in response to immunization with antigens expressed by replicons containing DLP motifs compared to unmodified versions.

[0249] The DLP-containing replicons described above were further analyzed in vivo in Balb / c mice for compatibility with LNP formulations. In this experiment, mice were injected with 2 μg or 0.2 μg of RNA encoding hemagglutinin from influenza A / Vietnam / 1203 / 2004 (H5N1) at 4-week intervals. 14 days after the final booster immunization, spleens and serum were collected to analyze the immune response to HA. A summary of these experiments is presented in Figures 14A-14C. In Figures 14A-14C, increased T and B cell responses were observed using constructs containing the DLP motif when combined with LNP (cationic lipid nanoparticle) formulations. In Figure 14A, HA-specific total IgG titers were significantly higher in all dose groups using the LNP formulation compared to the group receiving the replicon in saline. Furthermore, Figures 14B and 14C show that HA-specific CD8+ and CD4+ T cells were also significantly higher in all dose groups administered with the LNP formulation compared to the saline-administered replicon group. Collectively, this data demonstrates that the replicon construct containing the DLP motif is compatible with representative formulations.

[0250] Example 7 Preventing suppression of immune responses using DLP-containing replicons The DLP-containing replicons constructed as described above were further evaluated in vivo for their ability to prevent the suppression of immune responses in BALB / c mice. In these experiments, mice were injected at 4-week intervals with 1.5 μg of mRNA carrying the coding sequence for hemagglutinin from influenza A / Vietnam / 1203 / 2004 (H5N1), with or without the DLP motif. Approximately 24 h prior to injection, 6- to 8-week-old BALB / c mice were pretreated with 20 μg of poly(I:C) or saline via hydrodynamic tail vein injection to simulate viral infection. 14 days after the final booster immunization, serum from these mice was collected to analyze the immune response to hemagglutinin (HA). A summary of these experiments is shown in Figure 13. Figure 13 demonstrates a significant decrease in serum concentrations of HA-specific antibodies in mice pretreated with poly(I:C) and receiving a dose of the unmodified replicon. Levels in the poly(I:C) group were never significantly above background. In contrast, animals pretreated with poly(I:C) and administered the DLP motif-containing construct did not show a significant decrease in serum antigen-specific total IgG concentrations. Collectively, these data indicate that the DLP motif protects against suppression of serum antibody levels in response to vaccination following pseudovirus infection, compared with the unmodified form.

[0251] Example 8 Construction of DLP-containing expression cassettes This example describes the construction of a plasmid vector for ex vitro transcription of mRNA containing a Sindbis virus DLP element upstream of a gene of interest, e.g., a reporter gene, according to some embodiments of the present disclosure. The 5' and 3' untranslated regions (UTRs) (SEQ ID NO: 36 and SEQ ID NO: 41, respectively) used in these experiments were derived from the human beta globin gene. The 5' UTR sequence was placed immediately downstream of the T7 promoter (SEQ ID NO: 37) and upstream of the Sindbis virus DLP sequence (SEQ ID NO: 38). In some experiments, the coding sequence of the gene of interest (GOI) was linked to the DLP via the P2A signal, an autocatalytic self-cleaving peptide (e.g., autoprotease peptide) derived from porcine teschovirus-1. In some experiments, the coding sequence of a destabilized form of the EGFP reporter gene (dsGFP), used as the GOI in this case, was operably linked to the proteolytic PEST degradation signal derived from the mouse ornithine decarboxylase gene (MODC). In some other experiments, the coding sequence of the gene reported for red firefly luciferase was used as the gene of interest (see also Example 9 below). However, it is contemplated that the coding sequence of any gene of interest can be arranged in this configuration. Also, as shown in Figure 15, the 3'UTR sequence from human beta globin, a polyA tail consisting of 120 adenine residues, and a T7 terminator were inserted adjacent to the downstream stop codon of dsGFP. The nucleic acid sequences of each of the above components are as follows: [Table 9-1] [Table 9-2]

[0252] The above experiments used a DLP sequence from Sindbis virus. Additional experiments will be performed to incorporate DLP sequences from other Old World alphaviruses, such as SV, SFV, BEBV, RRV, SAG, GETV, MIDV, CHIKV, and ONNV, into the nucleic acid molecules of the present disclosure. The linkage of the DLP to the gene of interest can be configured with or without a self-cleaving peptide, such as P2A. Without being bound by any particular theory, it is believed that the need for a P2A sequence or other self-cleaving peptide depends on the individual gene inserted into the gene cassette or whether the additional amino acids added by the inclusion of the DLP affect the function of the translated protein. It is further contemplated that the 5' and 3' UTR sequences used herein can be modified for any other set of functional UTRs, regardless of origin.

[0253] Example 9 Ex vivo evaluation of gene expression in DLP-containing expression cassettes mRNA derived from DLP-containing expression cassettes engineered to contain one or more DLP motifs, as described above, was evaluated ex vivo in BHK-21 cells for its ability to enhance gene expression. As a control, an mRNA sample lacking the DLP sequence but otherwise identical to the DLP-containing mRNA was assayed in parallel under the same conditions. In these experiments, BHK-21 cells were pretreated for 2 hours with 300, 600, or 1000 U / mL of pan-type I interferon or vehicle control. After pretreatment, cells were electroporated in triplicate with 2.5 μg of mRNA containing or not containing the DLP motif. Cells were returned to medium containing the same concentration of interferon as used during pretreatment. The frequency and mean fluorescence intensity (MFI) of GFP-positive cells were assayed by flow cytometry 2, 4, and 24 hours after electroporation. Compared with non-DLP-containing mRNA, DLP-containing mRNA was observed to generate a significantly higher frequency of GFP-positive cells in the presence of interferon (FIG. 16A).

[0254] Furthermore, when the MFI of GFP was normalized to the frequency of GFP-positive cells and plotted against time, unmodified mRNA was observed to be highly sensitive to interferon treatment, as indicated by a statistically significant 30% decrease in total protein produced over the course of 24 hours (Figure 16B). In contrast, DLP-containing modified mRNA exhibited resistance to interferon treatment, as indicated by a statistically significant 30% increase in total protein produced over the control unmodified mRNA during the same 24-hour period (Figure 16C). The resistance to interferon treatment conferred by the presence of the DLP motif was further strengthened by the finding that cells treated with interferon and electroporated with DLP-containing mRNA produced the same amount of protein as untreated cells electroporated with unmodified mRNA (Figure 16C).

[0255] Example 10 In vivo evaluation of gene expression in DLP-containing expression cassettes The mRNA derived from the DLP-containing expression cassette, engineered to contain one or more DLP motifs as described above, was further evaluated in vivo for its ability to enhance gene-of-interest expression in Balb / c mice. In this experiment, mice were injected with 30 μg, 15 μg, or 1.5 μg of DLP-containing mRNA encoding red firefly luciferase at 6-week intervals. Red luciferase expression was then monitored by IVIS (in vivo imaging system) analysis at days 1, 3, 7, 10, 14, 21, and 28 post-injection. A significant increase in luciferase expression was observed in mice receiving the DLP-containing mRNA compared to control animals receiving mRNA without the DLP motif.

[0256] Example 11 Preventing suppression of immune responses using DLP-containing mRNA The DLP-containing mRNA described above will be further evaluated in vivo in Balb / c mice for its ability to enhance gene expression. In this experiment, mice will be injected at 4-week intervals with 30 μg, 15 μg, or 1.5 μg of mRNA carrying the hemagglutinin coding sequence from influenza A / Vietnam / 1203 / 2004 (H5N1), with or without the DLP motif. Approximately 24 h before injection, mice will be pretreated with 20 μg of poly(I:C) or saline via hydrodynamic tail vein injection to simulate viral infection. 14 days after the final booster immunization, serum from these mice will be collected to analyze the immune response to hemagglutinin (HA). A significant decrease in serum concentrations of HA-specific antibodies is expected in mice pretreated with poly(I:C) and receiving a dose of mRNA without the DLP sequence. In contrast, animals pretreated with poly(I:C) and administered mRNA containing the DLP motif are not expected to show a significant decrease in serum antigen-specific total IgG concentrations.

[0257] While certain alternative forms of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. Accordingly, no limitations to the precise summary and disclosure presented herein are intended.

[0258] All references disclosed herein, including but not limited to journal articles, textbooks, publications, patents, and patent applications, are incorporated by reference in their entirety to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference.

[0259] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. Although several sources of information are mentioned herein, such as scientific journal articles, patent documents, and textbooks, it will be expressly understood that any discussion and comments in a particular source should in no way be taken as an admission that such comments are widely accepted general opinion in the field.

[0260] The discussion of general compositions and methods presented herein is intended for illustrative purposes only. It is not intended to be exhaustive or to limit the disclosure. Individual aspects or features of a particular embodiment are generally not limited to that particular embodiment, but are interchangeable, where applicable, and may be used in selected embodiments even if not specifically shown or described. It is expressly contemplated that any aspect or feature of the present disclosure can be combined with any other aspect, feature, or combination of aspects and features disclosed herein. Other alternative compositions, methods, and embodiments will be apparent to those of skill in the art upon review of this disclosure and are intended to be included within the spirit and scope of this application. The inventions described in the original claims are listed below. [Invention 1] a first nucleic acid sequence encoding one or more RNA stem-loops of a viral capsid enhancer or variants thereof; a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence comprises a coding sequence for a gene of interest (GOI). [Invention 2] 2. The nucleic acid molecule according to claim 1, wherein the first nucleic acid sequence is operably linked upstream of the coding sequence of the GOI. [Invention 3] 3. The nucleic acid molecule according to claim 1 or 2, further comprising a promoter operably linked upstream of the first nucleic acid sequence. [Invention 4] 4. The nucleic acid molecule according to any one of Inventions 1 to 3, further comprising a 5'UTR sequence operably linked upstream of the first nucleic acid sequence. [Invention 5] The nucleic acid molecule according to invention 4, wherein the 5'UTR sequence is operably linked downstream of the promoter and upstream of the first nucleic acid sequence. [Invention 6] 6. The nucleic acid molecule according to any one of Inventions 1 to 5, further comprising a coding sequence for an autoprotease peptide operably linked upstream of the second nucleic acid sequence. [Invention 7] 7. The nucleic acid molecule according to claim 6, wherein the coding sequence for the autoprotease peptide is operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 8] 8. The nucleic acid molecule according to any one of Inventions 6 to 7, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. [Invention 9] 9. The nucleic acid molecule according to any one of Inventions 1 to 8, further comprising a 3'UTR sequence operably linked downstream of the second nucleic acid sequence. [Invention 10] 10. The nucleic acid molecule according to any one of Inventions 1 to 9, wherein the viral capsid enhancer is derived from a capsid gene of a virus species belonging to the Togaviridae family. [Invention 11] 11. The nucleic acid molecule according to claim 10, wherein the virus species belongs to the genus Alphavirus of the family Togaviridae. [Invention 12] The alphavirus species include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), and Sagi virus. 12. The nucleic acid molecule of claim 11, wherein the nucleic acid molecule is selected from the group consisting of Yama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), and Buggy Creek virus. [Invention 13] A nucleic acid molecule according to any one of inventions 10 to 12, wherein the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, and the DLP motif comprises at least one of the one or more RNA stem loops. [Invention 14] 12. The nucleic acid molecule according to any one of inventions 1 to 11, wherein the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 15] 15. The nucleic acid molecule according to invention 14, wherein the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 16] 16. The nucleic acid molecule according to any one of inventions 1 to 15, wherein said coding sequence of said GOI encodes a polypeptide. [Invention 17] 17. The nucleic acid molecule according to any one of inventions 1 to 16, wherein the polynucleotide is selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and combinations thereof. [Invention 18] 17. The nucleic acid molecule according to any one of inventions 1 to 16, wherein the polypeptide is selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and combinations thereof. [Invention 19] a third nucleic acid sequence encoding one or more RNA stem-loops of a second viral capsid enhancer or variant thereof; 19. The nucleic acid molecule according to any one of Inventions 1 to 18, further comprising a fourth nucleic acid sequence operably linked to the third nucleic acid sequence, wherein the fourth nucleic acid sequence comprises a coding sequence for a second gene of interest (GOI). [Invention 20] 20. The nucleic acid molecule of claim 19, further comprising a coding sequence for a second autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the fourth nucleic acid sequence. [Invention 21] 21. The nucleic acid molecule according to any one of Inventions 1 to 20, wherein the nucleic acid molecule is an mRNA molecule or an RNA replicon. [Invention 22] 21. The nucleic acid molecule according to any one of Inventions 1 to 20, which is an expression vector or a transcription vector. [Invention 23] 23. The nucleic acid molecule according to claim 22, further comprising one or more additional transcriptional regulatory sequences. [Invention 24] 24. The nucleic acid molecule according to claim 22 or 23, further comprising one or more additional translational regulatory sequences. [Invention 25] 25. The nucleic acid molecule according to any one of inventions 22 to 24, which is a plasmid, a bacteriophage vector, a cosmid, a fosmid, a viral replicon, a shuttle vector, or a combination thereof. [Invention 26] 26. The nucleic acid molecule according to any one of inventions 22 to 25, which is a prokaryotic vector or a eukaryotic vector. [Invention 27] 27. The nucleic acid molecule according to any one of Inventions 1 to 26, which is produced by de novo synthesis. [Invention 28] A method for producing a polypeptide of interest in a cell, comprising introducing into the cell a nucleic acid molecule according to any one of inventions 16 to 27, thereby producing in the cell a polypeptide encoded by the GOI. [Invention 29] 1. A method for producing a polypeptide of interest in a cell, comprising introducing into the cell an RNA molecule comprising one or more RNA stem loops of a viral capsid enhancer or a variant thereof and a coding sequence for the polypeptide of interest, thereby producing the polypeptide of interest in the cell. [Invention 30] 30. The method of claim 29, wherein the RNA molecule is a messenger RNA (mRNA) molecule or a replicon RNA molecule. [Invention 31] 31. The method of claim 29 or 30, wherein the RNA molecule is produced by de novo synthesis and / or in vitro transcription before being introduced into the cell. [Invention 32] A method according to any one of inventions 29 to 31, wherein the RNA molecule comprises a downstream loop (DLP) motif of a viral species, and the DLP motif comprises at least one of the one or more RNA stem loops of the viral capsid enhancer. [Invention 33] 33. The method according to any one of inventions 29 to 32, wherein the RNA molecule further comprises a coding sequence for an autoprotease peptide downstream of at least one of the one or more RNA stem-loops and upstream of the coding sequence for the polypeptide of interest. [Invention 34] 34. The method of claim 33, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Infection Virus 2A (BmIFV2A), and combinations thereof. [Invention 35] 35. The method of any one of claims 29 to 34, wherein the polynucleotide is selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and combinations thereof. [Invention 36] 35. The method according to any one of claims 29 to 34, wherein the polypeptide is selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and combinations thereof. [Invention 37] 37. The method according to any one of claims 29 to 36, wherein the cell is present in a tissue, an organ, or a subject. [Invention 38] 38. The method of claim 37, wherein said subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo. [Invention 39] 1. A method for producing messenger RNA (mRNA) in a cell, comprising administering to the cell a nucleic acid molecule comprising: a first nucleic acid sequence encoding one or more RNA stem-loops of a viral capsid enhancer or variants thereof; and a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence comprises a coding sequence for a gene of interest (GOI), thereby producing mRNA for the GOI. [Invention 40] 40. The method according to claim 39, wherein said first nucleic acid sequence is operably linked upstream of said coding sequence of said GOI. [Invention 41] 41. The method of invention 39 or 40, further comprising a promoter operably linked upstream of the first nucleic acid sequence. [Invention 42] 42. The method according to any one of Inventions 39 to 41, further comprising a 5'UTR sequence operably linked upstream of the first nucleic acid sequence. [Invention 43] 43. The method of claim 42, wherein the 5'UTR sequence is operably linked downstream of the promoter and upstream of the first nucleic acid sequence. [Invention 44] 44. The method according to any one of Inventions 39 to 43, further comprising a coding sequence for an autoprotease peptide operably linked upstream of the second nucleic acid sequence. [Invention 45] 45. The method of claim 44, wherein the coding sequence for the autoprotease peptide is operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 46] 46. ​​The method of claim 44 or 45, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), flacherie virus 2A (BmIFV2A), and combinations thereof. [Invention 47] 47. The nucleic acid molecule according to any one of Inventions 39 to 46, further comprising a 3'UTR sequence operably linked downstream of the second nucleic acid sequence. [Invention 48] 48. The method according to any one of Inventions 39 to 47, wherein the viral capsid enhancer is derived from a capsid gene of a virus species belonging to the Togaviridae family. [Invention 49] 49. The method according to any one of Inventions 39 to 48, wherein the virus species belongs to the Alphavirus genus of the Togaviridae family. [Invention 50] The alphavirus species include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), and Sagi virus. 50. The method of claim 49, wherein the virus is selected from the group consisting of Yama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), and Buggy Creek virus. [Invention 51] A method according to any one of inventions 48 to 50, wherein the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, and the DLP motif comprises at least one of the one or more RNA stem loops. [Invention 52] 52. The method of claim 51, wherein the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 53] 53. The nucleic acid molecule according to invention 52, wherein the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 54] 54. The method according to any one of inventions 39 to 53, wherein said coding sequence of said GOI encodes a polypeptide. [Invention 55] 55. The method of claim 54, wherein said polypeptide is selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and combinations thereof. [Invention 56] 55. The method of claim 54, wherein said polypeptide is selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and combinations thereof. [Invention 57] a third nucleic acid sequence encoding one or more RNA stem-loops of a second viral capsid enhancer or variant thereof; 57. The method according to any one of Inventions 39 to 56, further comprising a fourth nucleic acid sequence operably linked to the third nucleic acid sequence, wherein the fourth nucleic acid sequence comprises a coding sequence for a second gene of interest (GOI). [Invention 58] 58. The method of claim 57, further comprising a coding sequence for a second autoprotease peptide operably linked downstream of said third nucleic acid sequence and upstream of said fourth nucleic acid sequence. [Invention 59] 59. The method according to any one of Inventions 39 to 58, wherein the nucleic acid molecule is an RNA replicon. [Invention 60] 59. The method according to any one of Inventions 39 to 58, wherein the nucleic acid molecule is an expression vector or a transcription vector. [Invention 61] 61. The method of claim 59 or 60, wherein the nucleic acid molecule further comprises one or more additional transcriptional regulatory sequences. [Invention 62] 62. The nucleic acid molecule of claim 60 or 61, further comprising one or more additional translational regulatory sequences. [Invention 63] 63. The method according to any one of Inventions 60 to 62, wherein the nucleic acid molecule is an expression vector selected from the group consisting of a plasmid, a bacteriophage vector, a cosmid, a fosmid, a viral replicon, a shuttle vector, or a combination thereof. [Invention 64] 63. The method according to any one of claims 60 to 62, wherein the nucleic acid molecule is a prokaryotic expression vector or a eukaryotic expression vector. [Invention 65] 65. The method according to any one of claims 39 to 64, wherein the cell is present in a tissue, an organ, or a subject. [Invention 66] 66. The method of claim 65, wherein said subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo. [Invention 67] 67. The method according to any one of inventions 39 to 66, further comprising producing in said cell a polypeptide encoded by said mRNA of said GOI. [Invention 68] obtaining the produced mRNA of the GOI; 67. The method according to any one of Inventions 39 to 66, comprising introducing the obtained mRNA into a second cell and expressing the polypeptide encoded by the mRNA of the GOI in the second cell. [Invention 69] A nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, said modified viral RNA replicon comprising: a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; a second nucleic acid sequence encoding at least one nonstructural viral protein or portion thereof; A nucleic acid molecule wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. [Invention 70] 70. The nucleic acid molecule of claim 69, wherein at least one of the one or more structural elements of the viral capsid enhancer comprises one or more RNA stem loops. [Invention 71] 71. The nucleic acid molecule according to claim 69 or 70, wherein the viral capsid enhancer is derived from a capsid gene of a virus species belonging to the Togaviridae family. [Invention 72] 72. The nucleic acid molecule of claim 71, wherein the viral species belongs to the genus Alphavirus of the family Togaviridae. [Invention 73] The alphavirus species include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (G), and others. ET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), and Buggy Creek virus. [Invention 74] A nucleic acid molecule described in any one of inventions 71 to 73, wherein the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, and the DLP motif comprises at least one of the one or more RNA stem loops. [Invention 75] 71. The nucleic acid molecule of claim 69 or 70, wherein the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 76] 76. The nucleic acid molecule according to invention 75, wherein the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 77] 77. The nucleic acid molecule according to any one of Inventions 69 to 76, wherein the nucleic acid sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 78] 78. The nucleic acid molecule of claim 77, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Infection Virus 2A (BmIFV2A), or a combination thereof. [Invention 79] A nucleic acid molecule according to any one of inventions 69 to 78, wherein the first nucleic acid sequence is operably positioned within a region of approximately 1 to 1000 nucleotides downstream of the 5' end of the modified viral RNA replicon. [Invention 80] 80. The nucleic acid molecule according to any one of inventions 69 to 79, wherein said second nucleic acid sequence comprises substantially all of said coding sequences for native viral nonstructural proteins of the corresponding unmodified viral RNA replicon. [Invention 81] 81. The nucleic acid molecule according to any one of Inventions 69 to 80, wherein the modified viral RNA replicon is a modified RNA replicon derived from a virus species belonging to the genus Alphavirus in the family Togaviridae or the genus Arterivirus in the family Arteriviridae. [Invention 82] 82. The nucleic acid molecule of invention 81, wherein said Arterivirus species is selected from the group consisting of equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase elevating virus (LDV), and simian hemorrhagic fever virus (SHFV). [Invention 83] 83. The nucleic acid molecule of claim 82, wherein the first nucleic acid sequence is operably positioned upstream of a second nucleic acid sequence encoding a portion or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. [Invention 84] 84. The nucleic acid molecule of claim 82 or 83, wherein the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises one or more expression cassettes, at least one of the one or more expression cassettes comprising a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 85] 85. The nucleic acid molecule of claim 84, wherein the modified arterivirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. [Invention 86] A nucleic acid molecule described in invention 84 or 85, wherein at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding part or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. [Invention 87] 87. The nucleic acid molecule of any one of inventions 84 to 86, wherein at least one of the one or more expression cassettes is operably positioned downstream of a transcription regulatory sequence (TRS) of the modified arterivirus RNA replicon, and the TRS is selected from the group consisting of TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, and TRS7. [Invention 88] 88. A nucleic acid molecule according to any one of inventions 84 to 87, wherein at least one of said one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, said third nucleic acid sequence being operably linked upstream of said coding sequence of said GOI. [Invention 89] 89. The nucleic acid molecule of claim 88, wherein the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. [Invention 90] 90. The nucleic acid molecule according to any one of inventions 84 to 89, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and any combination thereof. [Invention 91] 90. The nucleic acid molecule according to any one of inventions 84 to 89, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and any combination thereof. [Invention 92] The modified viral RNA replicons include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), 92. The nucleic acid molecule of any one of inventions 69 to 91, comprising a modified RNA replicon derived from an alphavirus species selected from the group consisting of Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), and Buggy Creek virus. [Invention 93] A nucleic acid molecule described in Invention 92, wherein the first nucleic acid sequence is operably positioned upstream of a second nucleic acid sequence encoding one or more nonstructural proteins nsp1 to 4 or a portion thereof of the modified alphavirus RNA replicon. [Invention 94] A nucleic acid molecule described in invention 92 or 93, wherein the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 95] 95. The nucleic acid molecule of claim 94, wherein said modified alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. [Invention 96] A nucleic acid molecule described in Invention 94 or 95, wherein at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1 to 4 or a portion thereof of the modified alphavirus RNA replicon. [Invention 97] 97. A nucleic acid molecule according to any one of inventions 94 to 96, wherein at least one of said one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, said third nucleic acid sequence being operably linked upstream of said coding sequence of said GOI. [Invention 98] A nucleic acid molecule according to invention 97, wherein the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. [Invention 99] 99. The nucleic acid molecule according to any one of inventions 94 to 98, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, and a reporter polypeptide. [Invention 100] 99. The nucleic acid molecule according to any one of inventions 94 to 98, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of an antibody, an antigen, an immunomodulator, an enzyme, and a cytokine. [Invention 101] A nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, wherein the modified non-alphavirus RNA replicon comprises a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof. [Invention 102] A nucleic acid molecule described in invention 101, wherein the nucleic acid sequence encoding the modified non-alphavirus RNA replicon further comprises a second nucleic acid sequence encoding at least one nonstructural viral protein or a portion thereof, and the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. [Invention 103] A nucleic acid molecule according to invention 101 or 102, wherein the nucleic acid sequence encoding the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 104] 104. The nucleic acid molecule of claim 103, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Infection Virus 2A (BmIFV2A), or a combination thereof. [Invention 105] 105. The nucleic acid molecule according to any one of inventions 101 to 104, wherein said nucleic acid sequence encoding said modified non-alphavirus RNA replicon comprises a modified RNA replicon derived from a positive-strand RNA virus. [Invention 106] The nucleic acid molecule according to invention 105, wherein the positive-strand RNA virus is a virus species belonging to a family selected from the group consisting of Togaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, and Paramyxoviridae. [Invention 107] 107. The nucleic acid molecule according to claim 106, wherein the viral species belongs to the genus Arterivirus of the family Arteriviridae. [Invention 108] A nucleic acid molecule described in any one of inventions 101 to 107, wherein the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 109] 109. A nucleic acid molecule according to any one of inventions 101 to 108, wherein the nucleic acid sequence encoding the modified non-alphavirus RNA replicon comprises at least two, three, four, five, or six expression cassettes. [Invention 110] 109. A nucleic acid molecule according to any one of claims 101 to 109, wherein at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding the at least one nonstructural viral protein or a portion thereof. [Invention 111] 111. The nucleic acid molecule according to any one of inventions 101 to 110, wherein at least one of said one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, said third nucleic acid sequence being operably linked upstream of said coding sequence of said GOI. [Invention 112] A nucleic acid molecule according to invention 111, wherein the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. [Invention 113] A nucleic acid molecule according to any one of inventions 1 to 26 and 69 to 112, which is produced by de novo synthesis. [Invention 114] A recombinant cell comprising the nucleic acid molecule according to any one of inventions 1 to 27 and 69 to 113. [Invention 115] 115. The recombinant cell according to claim 114, wherein the recombinant cell is a prokaryotic or eukaryotic cell. [Invention 116] 115. The recombinant cell according to claim 114, wherein the recombinant cell is an animal cell. [Invention 117] A recombinant cell according to any one of inventions 114 to 116, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding a modified RNA replicon, and expression of the modified replicon RNA confers resistance to innate immune responses in the recombinant cell. [Invention 118] A cell culture comprising the recombinant cell according to any one of inventions 114 to 117. [Invention 119] 1. A method for conferring resistance to the innate immune system in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, the modified viral RNA replicon comprising: a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; a second nucleic acid sequence encoding at least one nonstructural protein or portion thereof; The method, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence, and expression of the modified replicon RNA encoded by the nucleic acid molecule confers resistance to innate immune responses in the subject. [Invention 120] 1. A method for producing a polypeptide of interest in a subject, said method comprising administering to said subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, said modified viral RNA replicon comprising: a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; a second nucleic acid sequence encoding at least one nonstructural protein or portion thereof; The method, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. [Invention 121] 1. A method for producing a polypeptide of interest, said method comprising culturing a host cell comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, said modified viral RNA replicon comprising: a first nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer or a variant thereof, wherein the viral capsid enhancer is heterologous to the viral RNA replicon; a second nucleic acid sequence encoding at least one nonstructural protein or portion thereof; The method, wherein the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. [Invention 122] 121. The method of claim 119 or 120, wherein said subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo. [Invention 123] 123. The method of any one of inventions 119 to 122, wherein at least one of said one or more structural elements of said viral capsid enhancer comprises one or more RNA stem-loops. [Invention 124] 124. The method according to any one of Inventions 119 to 123, wherein the viral capsid enhancer is derived from a capsid gene of a virus species belonging to the Togaviridae family. [Invention 125] 125. The method of claim 124, wherein the viral species belongs to the genus Alphavirus of the family Togaviridae. [Invention 126] The alphavirus species include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (G), and others. ET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), and Buggy Creek virus. [Invention 127] A method according to any one of inventions 124 to 126, wherein the viral capsid enhancer comprises a downstream loop (DLP) motif of the viral species, and the DLP motif comprises at least one of the one or more RNA stem loops. [Invention 128] 128. The method of any one of inventions 119 to 127, wherein the viral capsid enhancer comprises a nucleic acid sequence exhibiting at least 80% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 129] 129. The method of claim 128, wherein the nucleic acid sequence exhibits at least 95% sequence identity to at least one of SEQ ID NOs: 1 and 46 to 52. [Invention 130] 130. The method according to any one of inventions 119 to 129, wherein the nucleic acid sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 131] 131. The method of claim 130, wherein said autoprotease peptide comprises a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Infection Virus 2A (BmIFV2A), or a combination thereof. [Invention 132] The method according to any one of Inventions 119 to 131, wherein the first nucleic acid sequence is operably positioned within a region of approximately 1 to 1000 nucleotides downstream of the 5' end of the modified viral RNA replicon. [Invention 133] 133. The method according to any one of inventions 119 to 132, wherein said second nucleic acid sequence comprises substantially all of said coding sequences for native viral nonstructural proteins of the corresponding unmodified viral RNA replicon. [Invention 134] The method according to any one of Inventions 119 to 133, wherein the modified viral RNA replicon is a modified RNA replicon derived from a virus species belonging to the genus Alphavirus in the family Togaviridae or the genus Arterivirus in the family Arteriviridae. [Invention 135] 135. The method according to any one of claims 119 to 134, wherein the Arterivirus species is selected from the group consisting of equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), and simian hemorrhagic fever virus (SHFV). [Invention 136] The method of invention 134 or 135, wherein the viral species is an arterivirus, and the first nucleic acid sequence is operably positioned upstream of a nucleic acid sequence encoding part or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. [Invention 137] 137. The method of claim 136, wherein the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises one or more expression cassettes, at least one of the expression cassettes comprising a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 138] 138. The method of claim 137, wherein the modified arterivirus RNA replicon further comprises at least two, three, four, five, or six expression cassettes. [Invention 139] The method of invention 137, wherein at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding part or all of the pp1ab nonstructural protein of the modified arterivirus RNA replicon. [Invention 140] The method of any one of inventions 137 to 139, wherein at least one of the one or more expression cassettes is operably positioned downstream of a transcriptional regulatory sequence (TRS) of a modified arterivirus RNA replicon, and the TRS is selected from the group consisting of TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, and TRS7. [Invention 141] 141. The method according to any one of inventions 137 to 140, wherein at least one of said one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, said third nucleic acid sequence being operably linked upstream of said coding sequence of said GOI. [Invention 142] 142. The method of claim 141, wherein the nucleic acid sequence encoding the modified arterivirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. [Invention 143] 143. The nucleic acid molecule according to any one of inventions 137 to 142, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and any combination thereof. [Invention 144] 143. The method according to any one of inventions 137 to 142, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and any combination thereof. [Invention 145] The modified viral RNA replicons include those derived from Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Geta virus, and the like. 135. The method of any one of inventions 119 to 134, comprising a modified RNA replicon derived from an alphavirus species selected from the group consisting of GET, Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), and Buggy Creek virus. [Invention 146] The method of invention 145, wherein the first nucleic acid sequence is operably positioned upstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1 to 4 or a portion thereof of the modified alphavirus RNA replicon. [Invention 147] A method according to any one of inventions 145 or 146, wherein the nucleic acid sequence encoding the modified alphavirus RNA replicon further comprises one or more expression cassettes, each of which comprises a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 148] 148. The method of claim 147, wherein said modified alphavirus RNA replicon further comprises at least two, three, four, five, or six expression cassettes. [Invention 149] The method described in invention 147 or 148, wherein at least one of the one or more expression cassettes is operably linked downstream of a nucleic acid sequence encoding one or more nonstructural proteins nsp1 to 4 or a portion thereof of the modified alphavirus RNA replicon. [Invention 150] 149. The method of any one of inventions 147 to 149, wherein at least one of said one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer, said third nucleic acid sequence being operably linked upstream of said coding sequence of said GOI. [Invention 151] The method of invention 150, wherein the modified alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence for the GOI. [Invention 152] 152. The nucleic acid molecule according to any one of inventions 147 to 151, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and any combination thereof. [Invention 153] 152. The method according to any one of inventions 147 to 151, wherein said coding sequence of said GOI encodes a polypeptide selected from the group consisting of an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and any combination thereof. [Invention 154] A method for conferring resistance to the innate immune system in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, the modified non-alphavirus RNA replicon comprising a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer, and expression of the modified non-alphavirus RNA replicon encoded by the nucleic acid molecule confers resistance to the innate immune response in the subject. [Invention 155] A method for producing a desired polypeptide in a subject, the method comprising administering to the subject a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, the modified non-alphavirus RNA replicon comprising a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer. [Invention 156] A method for producing a desired polypeptide, comprising culturing a host cell containing a nucleic acid molecule comprising a nucleic acid sequence encoding a modified non-alphavirus RNA replicon, wherein the modified non-alphavirus RNA replicon comprises a first nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer. [Invention 157] 156. The method of claim 154 or 155, wherein the subject is selected from the group consisting of a human, a horse, a pig, a primate, a mouse, a ferret, a rat, a cotton rat, a cow, a wild boar, a sheep, a rabbit, a cat, a dog, a bird, a fish, a goat, a donkey, a hamster, and a buffalo. [Invention 158] A method according to any one of inventions 154 to 157, wherein the modified non-alphavirus RNA replicon further comprises a second nucleic acid sequence encoding at least one nonstructural viral protein or a portion thereof, and the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence. [Invention 159] A method described in any one of inventions 154 to 158, wherein the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence. [Invention 160] 160. The method of claim 159, wherein the autoprotease peptide comprises a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Infection Virus 2A (BmIFV2A), and combinations thereof. [Invention 161] 161. The method according to any one of inventions 154 to 160, wherein said modified non-alphavirus RNA replicon comprises a modified RNA replicon derived from a positive-strand RNA virus. [Invention 162] 162. The method of claim 161, wherein the positive-strand RNA virus is a viral species belonging to a family selected from the group consisting of Togaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, and Paramyxoviridae. [Invention 163] The method according to Invention 161, wherein the positive-strand RNA virus is a virus species belonging to the genus Arterivirus of the family Arteriviridae. [Invention 164] A method according to any one of inventions 154 to 163, wherein the sequence encoding the modified non-alphaviral RNA replicon further comprises one or more expression cassettes, each of said expression cassettes comprising a promoter operably linked to a coding sequence of a gene of interest (GOI). [Invention 165] 165. The method of any one of claims 154 to 164, wherein said modified non-alphavirus RNA replicon further comprises at least two, three, four, five, or six expression cassettes. [Invention 166] A method according to any one of inventions 154 to 165, wherein at least one of the one or more expression cassettes is operably linked downstream of the second nucleic acid sequence encoding at least one nonstructural viral protein or a portion thereof of the modified non-alphavirus RNA replicon. [Invention 167] A method according to any one of inventions 154 to 166, wherein at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of an alphavirus capsid enhancer, the third nucleic acid sequence being operably linked upstream of the coding sequence of the GOI. [Invention 168] The method of invention 167, wherein the modified non-alphavirus RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence of the GOI. [Invention 169] A recombinant polypeptide produced by the method according to any one of inventions 121 to 153 and 155 to 168. [Invention 170] 169. A composition comprising a recombinant polypeptide according to invention 169 and a pharmaceutically acceptable carrier. [Invention 171] A composition comprising the nucleic acid molecule according to any one of inventions 1 to 27 and 69 to 113 and a pharmaceutically acceptable carrier. [Invention 172] A composition comprising the recombinant cell according to any one of inventions 114 to 117 and a pharmaceutically acceptable carrier. [Invention 173] 173. The composition according to any one of inventions 170 to 172, wherein the composition is incorporated into a pharmaceutical formulation. [Invention 174] 174. The composition according to any one of claims 170 to 173, wherein the composition is formulated into a pharmaceutical formulation using a covalent compound, a non-covalent compound, a physical composition, or a pharmaceutically acceptable buffer.

Claims

1. A nucleic acid molecule comprising a nucleic acid sequence encoding a modified viral RNA replicon, said modified viral RNA replicon comprising: a first nucleic acid sequence encoding a viral capsid enhancer comprising one or more RNA stem loops, said viral capsid enhancer being heterologous to said viral RNA replicon, said first nucleic acid sequence being operably positioned within a region of about 1 to 300 nucleotides downstream of the 5' end of said viral RNA replicon, said region comprising a 5'-untranslated region (5'-UTR) operably linked to the first nucleic acid sequence; a second nucleic acid sequence comprising at least 95% of the coding sequence of a native viral nonstructural protein of the corresponding unmodified viral RNA replicon; the first nucleic acid sequence is operably linked upstream of the second nucleic acid sequence; Furthermore, the modified viral RNA replicon is derived from a virus species belonging to the Togaviridae family or from a virus species belonging to the Arterivirus genus of the Arteriviridae family, and the viral capsid enhancer is derived from a species of the Togaviridae family and / or comprises a nucleic acid sequence exhibiting at least 95% sequence identity to an RNA sequence corresponding to the nucleotide sequence of one of SEQ ID NOs: 1 and 46-52. The nucleic acid molecule.

2. The nucleic acid molecule of claim 1 , wherein the viral capsid enhancer is derived from a capsid gene of a viral species belonging to the genus Alphavirus of the family Togaviridae.

3. The nucleic acid molecule of claim 2, wherein the viral capsid enhancer comprises an RNA sequence corresponding to the nucleotide sequence of one of SEQ ID NOs: 1 and 46-52.

4. The nucleic acid molecule according to any one of claims 1 to 3, wherein the nucleic acid sequence encoding the modified viral RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the first nucleic acid sequence and upstream of the second nucleic acid sequence.

5. The nucleic acid molecule according to any one of claims 1 to 4, wherein the native viral nonstructural proteins of the corresponding unmodified viral RNA replicon are derived from Venezuelan equine encephalitis virus (VEEV) or equine arteritis virus (EAV).

6. The virus species belonging to the Alphavirus genus of the Togaviridae family include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixna virus (PIXV), Midleburg virus (MIDV), Chikungunya virus (CHIKV), O'nyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (G ET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Wataroa virus (WHAV), Babanki virus (BABV), Kiziraga virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu (NDUV), Salmonid alphavirus (SAV), and Buggy Creek virus; or the viral species belonging to the genus Arterivirus in the family Arteriviridae is selected from the group consisting of equine arteritis virus (EAV), porcine respiratory and reproductive syndrome virus (PRRSV), lactate dehydrogenase-elevating virus (LDV), and simian hemorrhagic fever virus (SHFV).

7. the modified RNA replicon is derived from VEEV; The nucleic acid molecule comprises, in order from the 5' end to the 3' end: (1) 5'-untranslated region (5'-UTR), (2) a nucleotide sequence encoding the amino-terminal fragment of nsp1 of VEEV; (3) a downstream loop (DLP) motif from Sindbis virus (SINV); (4) a nucleotide sequence encoding the 2A protease sequence (P2A), and (5) A nucleotide sequence encoding a polyprotein containing the sequences of VEEV nonstructural proteins nsp1, nsp2, nsp3, and nsp4. Including, The nucleic acid molecule of claim 1.

8. the modified RNA replicon is derived from EAV, The nucleic acid molecule comprises, in order from the 5' end to the 3' end: (1) 5'-untranslated region (5'-UTR), (2) a nucleotide sequence encoding the amino-terminal fragment of the nonstructural pp1ab of EAV; (3) a downstream loop (DLP) motif from Sindbis virus (SINV); (4) a nucleotide sequence encoding the 2A protease sequence (P2A), and (5) A nucleotide sequence encoding a polypeptide comprising the sequence of the nonstructural pp1ab of EAV. Including, The nucleic acid molecule of claim 1.

9. 9. The nucleic acid molecule of any one of claims 1 to 8, wherein the modified RNA replicon further comprises one or more expression cassettes, at least one of the one or more expression cassettes comprising a promoter operably linked to a coding sequence of a gene of interest (GOI).

10. 10. The nucleic acid molecule of claim 9, wherein the modified RNA replicon is a modified arterivirus RNA replicon, and at least one of the one or more expression cassettes is operably positioned downstream of a transcription regulatory sequence (TRS) of the modified arterivirus RNA replicon, wherein the TRS is selected from the group consisting of TRS1, TRS2, TRS3, TRS4, ​​TRS5, TRS6, and TRS7.

11. 11. The nucleic acid molecule of claim 9 or 10, wherein at least one of the one or more expression cassettes further comprises a third nucleic acid sequence encoding one or more structural elements of a viral capsid enhancer comprising one or more RNA stem loops, the third nucleic acid sequence being operably linked upstream of the coding sequence of the GOI, and optionally the nucleic acid sequence encoding the modified RNA replicon further comprises a coding sequence for an autoprotease peptide operably linked downstream of the third nucleic acid sequence and upstream of the coding sequence of the GOI.

12. 12. The nucleic acid molecule of any one of claims 9 to 11, wherein the coding sequence of the GOI encodes a polypeptide selected from the group consisting of a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, a nutraceutical polypeptide, an industrial enzyme, a reporter polypeptide, and any combination thereof (e.g., an antibody, an antigen, an immunomodulator, a cytokine, an enzyme, and any combination thereof).

13. A recombinant cell comprising the nucleic acid molecule of any one of claims 1 to 12.

14. A composition comprising the nucleic acid molecule of any one of claims 1 to 12 or the recombinant cell of claim 13 and a pharmaceutically acceptable carrier.

15. 13. The nucleic acid molecule of claim 12 for use in regulating gene expression in a cell.

16. 13. A method for producing a polypeptide of interest, said method comprising culturing a host cell comprising a nucleic acid molecule according to any one of claims 9 to 12, wherein said polypeptide of interest is produced.

Images