Autologous cell replacement therapy for Parkinson's disease

Abstract

Methods for generating midbrain dopamine (mDA) neural progenitor cells useful for autologous cell therapy in Parkinson's disease, compositions comprising the cells, and methods of use thereof are provided.

Description

[Technical Field]

[0001] Priority claims This application claims the benefit of U.S. Provisional Patent Application No. 62 / 852,008, filed May 23, 2019, and U.S. Provisional Patent Application No. 62 / 949,906, filed December 18, 2019, the entire contents of which are incorporated herein by reference.

[0002] Federally sponsored research or development This invention was made with government support under Grant No. NS070577 awarded by the National Institutes of Health. The U.S. Federal Government has certain rights in this invention.

[0003] Described herein are methods for generating midbrain dopamine (mDA) neural progenitor cells useful for autologous cell therapy in Parkinson's disease (PD), compositions comprising the cells, and methods of use thereof. [Background technology]

[0004] Parkinson's disease (PD), characterized by both motor and non-motor pathology, is the second most common neurodegenerative disorder after Alzheimer's disease. Approximately 1% of people over the age of 60 are affected, and its prevalence represents an increasing social burden. As the population ages, it is predicted that more than 14 million people worldwide will suffer from PD by 2030 (1). Since its introduction in the 1960s, dopamine (DA) replacement therapy (e.g., L-DOPA and DA agonists) has remained the gold standard of pharmacological treatment. While significantly improving the quality of life of PD patients, prolonged use of these medications commonly (>80%) results in undesirable side effects, such as movement disorders and motor fluctuations (2). Summary of the Invention [Means for solving the problem]

[0005] Parkinson's disease (PD) is a common neurodegenerative disorder associated with loss of striatal dopamine secondary to degeneration of midbrain dopamine (mDA) neurons in the substantia nigra, making cell transplantation a promising therapeutic strategy. To establish human induced pluripotent stem cell (hiPSC)-based autologous cell therapy for PD, we developed a core technology platform for generating mDA progenitor cells as a safe and effective therapeutic agent. First, by combining metabolically regulated microRNAs with reprogramming factors, we developed a more efficient method for generating clinical-grade iPSCs, as evidenced by their genomic integrity and unbiased pluripotency potential. Second, we established a "spotting"-based in vitro differentiation method that produces functional, healthy mDA cells in a scalable manner with significantly reduced cell loss. Third, we developed a chemical method that efficiently and safely eliminates potentially neoplastic undifferentiated cells from the final product. The dopaminergic cells generated in this way express high levels of characteristic mDA markers, produce and secrete dopamine, and exhibit electrophysiological characteristics typical of mDA cells. Furthermore, transplantation of these cells into rodent models of PD resulted in significant reinnervation of the host brain, while showing no evidence of tumor formation or redistribution of the implanted cells, and robustly restored ataxia. In addition, implantation of cells derived using this method into humans with PD appears to halt and possibly reverse the disease process (see Example 10). Therefore, this platform is suitable for the successful implementation of personalized, autologous, cell replacement therapy for PD.

[0006] Thus, provided herein are methods for generating a population of differentiated cells, e.g., neurons, e.g., midbrain dopaminergic progenitor cells (mDAPs). The methods include providing a population of induced pluripotent stem cells (iPSCs), preferably human iPSCs; seeding the cell population into discrete areas, preferably substantially circular areas ("spots"), within a biological matrix hydrogel support at a density of about 5,000-20,000 cells per area, e.g., about 10,000 cells per area, with sufficient distance between the areas to maintain separation; and maintaining the cells under conditions sufficient for the iPSCs to differentiate into, e.g., neurons, e.g., mDAPs.

[0007] In some embodiments, the biological matrix hydrogel support is a basement membrane extract or a synthetic matrix.

[0008] In some embodiments, the cells are suspended in, for example, about 10 μl of gel prior to seeding.

[0009] In some embodiments, the region is about 2-10 mm in diameter, for example, about 5 mm.

[0010] In some embodiments, the distance between the regions is 1-3 cm.

[0011] In some embodiments, the iPSCs express alkaline phosphatase (AP) and TRA-1-60.

[0012] In some embodiments, mDAPs express one, two, or more markers, including FOXA2, OTX2, LMX1A, and / or EN1, preferably at least FOXA2 and LMX1A; optionally, mDAPs are TH+ cells that co-express FOXA2, LMX1A, and NURR1.

[0013] In some embodiments, iPSCs are produced by a method comprising obtaining a population of primary cells from a subject, where preferably the primary cells are fibroblasts, hair keratinocytes, blood cells, or bone marrow mesenchymal stem cells (MSCs); inducing expression of at least OCT4, KLF4, and SOX2, and / or L-MYC and / or C-MYC in the cells; and maintaining the cells under conditions sufficient for the primary cells to become iPSCs.

[0014] In some embodiments, the step of inducing expression of at least OCT4, KLF4, and SOX2, and / or L-MYC and / or C-MYC includes transfecting primary cells with a polycistronic episomal vector comprising coding sequences for human Oct4, KLF4, and SOX2 linked to a foot-and-mouth disease virus 2A sequence (OCT4-F2A), and a porcine teschovirus 2A sequence (SOX2-P2A), and / or L-MYC, and / or C-MYC.

[0015] In some embodiments, iPSCs are produced by a method comprising expressing in the cells one or more exogenous microRNAs (miRNAs) selected from the group consisting of miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and miR-371 / 373. miR-302s refers to the miR-302 cluster, which includes five miRNAs, including 302a, 302b, 302c, 302d, and 367.

[0016] In some embodiments, the miRNA comprises one or both of miR-302s and miR-200c.

[0017] In some embodiments, the method comprises introducing into the cell an episomal vector comprising sequences encoding miR-302s and miR-200c.

[0018] In some embodiments, iPSCs are produced by a method comprising expressing in primary cells all of OCT4, KLF4, SOX2, miR-302s, and miR-200c; or OCT4, KLF4, SOX2, L-MYC / C-MYC, miR-302s, and miR-200c.

[0019] In some embodiments, the method includes introducing into a cell one or more of the following: (i) a viral vector (e.g., a lentivirus, adenovirus, or AAV vector) or a polycistronic episomal vector comprising human Oct4 linked to a foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to a porcine teschovirus 2A sequence (SOX2-P2A), a coding sequence for L-MYC, and a coding sequence for C-MYC, or the mature RNA or corresponding protein of any one or more of Oct4, KLF4, SOX2, L-MYC / C-MYC, and (ii) miR-302s and miR-200c, or sequences encoding mature miR-302s and mature miR-200c.

[0020] In some embodiments, the cell is a human cell. In some embodiments, C-MYC is used in place of L-MYC and / or vice versa.

[0021] In some embodiments, the methods described herein preferably involve the reduction of undifferentiated iPSCs by inhibiting the BIRC5 gene.

[0022] Also provided herein are cell populations comprising mDAP and compositions comprising the cells produced by the methods described herein. In some embodiments, the cells have one or more somatic mutations that are not present in the primary cells and / or do not have somatic mutations known to be causally associated with cancer.

[0023] Further, a method of using cells to treat a subject with or at risk of developing Parkinson's disease (PD) is provided herein. The method may include the steps of: obtaining primary somatic cells from a subject with or at risk of developing PD, or from an autologous transplant subject; and generating iPSCs from the primary cells; treating the iPSCs with quercetin, preferably for a time sufficient to reduce the number of SOX1-positive cells, KI67-positive cells, SOX1 / KI67 double-positive cells, SOX1 / PAX6 double-positive cells, and SOX1 / PAX6 / KI67 triple-positive cells; generating a cell population containing mDAP by the method described herein; and administering the cell population to the subject. In some embodiments, the cells are administered by implanting them directly into or near the affected region of the subject's brain, preferably bilaterally, into one or more of the caudate nucleus, putamen, and substantia nigra, optionally using magnetic resonance imaging-guided stereotaxic surgery.

[0024] In some embodiments, cells are administered via injection, preferably with a device (e.g., as described in Schweitzer et al., Oper Neurosurg (Hagerstown) 2019), preferably with a single injection point in the superior parasagittal region of the cerebral cortex, preferably with three injection channels, creating a column spanning the sagittal extent of the putamen. In some embodiments, a dose of about 1 million, 2 million, 3 million, 4 million, 5 million, 6 million, 7 million, or 8 million cells is administered, preferably with the cells split evenly between the three injection channels. In some embodiments, cells are administered in a single treatment. In some embodiments, cells are administered in two or more treatments.

[0025] In some embodiments, both hemispheres of the brain are treated, and cells are administered to one hemisphere in a first treatment and to the other hemisphere in a second treatment. In some embodiments, the time between the first treatment and the second treatment is about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 48 ​​months, 54 months, or 60 months.

[0026] In some embodiments, at least one antibiotic agent is administered before, during, and / or after surgery.

[0027] Also provided herein are culture dishes for culturing cells, e.g., for use in the methods described herein, having a grid on the underside of the dish with a distance between grid lines of 1.5 to 2.5 cm, e.g., a grid of approximately 2 cm, e.g., a 2 x 2 cm grid. In some embodiments, the grid is formed as part of the dish, printed or etched onto the underside. In some embodiments, the dish comprises a thermoplastic resin such as polystyrene, polyethylene, polypropylene, polycarbonate, or polyvinyl. In some embodiments, the dish comprises a layer of a biological matrix hydrogel support, preferably a basement membrane extract or a synthetic matrix, disposed therein.

[0028] Appendices 1 and 2, and all publications, patent applications, patents, sequences, database entries, and other references mentioned therein, are incorporated by reference herein in their entirety for any and all purposes.

[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. For use in the present invention, the methods and materials described herein are used, although other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0030] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]

[0031] [Figures 1A-1D]Figure 1 shows an improved reprogramming method combining Y4F with metabolically regulated miRNAs. (A-D) Screening for miRNAs that enhance hiPSC-like colony generation from hDFs by Y3F (A), Y4F (B), Y3F+3 (C), or Y4F+3 (D) compared with empty vector (mock) controls. Mean ± standard deviation, n = 5, *p < 0.05; **p < 0.01, one-way ANOVA with Tukey's post-hoc test. (E-F) Time course of OCR (E) and ECAR (F) in hDFs infected with Y4F, miR-302s, and / or miR-200c. Mean ± standard deviation, n = 3, *p < 0.05; **p < 0.01; ***p < 0.005, two-way ANOVA with Tukey's post-hoc test. (G) Percentage of TRA-1-60+ colonies among AP+ colonies after infection with lentiviruses encoding Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 6, ***p < 0.005, two-way ANOVA with Tukey's post-hoc test. (H) Percentage of TRA-1-60+ colonies among AP+ colonies after transfection with episomal vectors encoding Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 4, **p < 0.01, two-way ANOVA with Tukey's post-hoc test. [Figures 1E-1H] (As mentioned above.) [Figure 2A-2B]Figures show high-quality hiPSC cell lines generated from our improved reprogramming method. (A) Heatmap depicting gene expression levels of pluripotency markers in established hiPSC cell lines compared to the original hDF and hESC cell lines (H9) (n=3). (B) Immunostaining of hiPSC cell lines generated with different combinations with specific antibodies against pluripotency markers (e.g., OCT4, NANOG, TRA-1-60, and SOX2) along with nuclear staining with Hoechst 33342 (inset). Scale bar: 100 μm. (C) Immunostaining for lineage-specific markers for ectoderm (OTX2), mesoderm (BRACHYURY), and endoderm (SOX17) after 7 days of spontaneous differentiation. Scale bar: 100 μm. (D) Heatmap depicting gene expression levels of early differentiation markers of ectoderm (PAX6 and MAP2), endoderm (FOXA2, SOX17, and CK8), and mesoderm (MSX1, MYL2A, and COL6A2) in hiPSC cell lines generated with pY4F, pY4F+3, or pY4F+3+2 (n=2). [Figure 2C-2D] (As mentioned above.) [Figure 3A-3B]Genomic integrity of hiPSC cell lines derived from skin biopsies of sporadic PD patients. (A) Somatic mutations found in four hiPSC cell lines. The bar graphs show the number of singleton mutations in each hiPSC cell line (different colors for each hiPSC cell line) and the number of unique mutations found in two or more hiPSC cell lines (black bar). A dotted line connecting the ends of each bar indicates hiPSC cell lines that share a mutation. The bottom left bar represents the total number of mutations, including both singleton mutations and mutations found in two or more hiPSC cell lines. C4 had the lowest number of somatic mutations (n ​​= 92), of which 80 were singletons and 12 were found in C4 and the other hiPSC cell lines. (B) Mutation burden in coding regions and cancer-related genes was compared with published datasets. The number of nonsynonymous mutations in our hiPSC cell lines was significantly smaller than that in our hESC cell lines. On average, the number of nonsynonymous mutations in the iPSC cell lines from the HipSci Project was similar to that in our hiPSC cell lines. Overall, C4 showed the lowest mutation burden (red). Regarding somatic mutations in cancer-related genes, no somatic mutations were found in two widely used hESC cell lines (H1 and H9, blue) and the C4 hiPSC cell line (red) (right panel). (C) Distribution of minor allele frequencies (MAFs) for all somatic mutations in the four hiPSC cell lines. The peak near a MAF of 0.5 represents clonal somatic mutations. The second peak with a lower MAF of 0.1 represents subclonal mutations. For each plot, a density curve with two peaks indicates the distribution of MAFs of somatic mutations, and the color of the curve matches (A) for each hiPSC cell line; the curve with a different color (peaking near a MAF of 0.0) is the curve for somatic mutations detected by other hiPSC cell lines. [Figure 3C] (As mentioned above.) [Figure 4A-4B]This figure shows that spotting-based in vitro differentiation improves the yield and quality of the resulting dopamine cells. (A) Experimental scheme for finding optimized physical culture conditions. From days 0 to 15, all cells, regardless of viability, were quantified by FACS and / or manual cell counting, as indicated by the arrows. On day 15, cells were either replated onto coverslips for immunocytochemical analysis or harvested for quantitative real-time PCR. (B-C) Comparison of the conventional monolayer-based method and the spotting-based method for the extent of cell loss (due to detachment) from days 1 to 14 and cell harvest at day 15 (B), as well as the percentage of dead cells at day 15 (C), for both hESCs (H9 and H7) and hiPSCs (C4 and N3). Cell densities of 11,000 cells per cm and 10,000 cells per spot were used for the conventional and spotting-based methods, respectively. Data presented reflect experiments with measurable outcomes (see caption for Figure 13A). Mean ± standard deviation, n = 4, one-way ANOVA. (D) Quantification of dying cells from the final harvested cells on day 15 using immunocytochemistry analysis. An antibody against cleaved caspase 3 was used to detect apoptotic cells. Hoechst 33342 staining visualized nuclear condensation to detect dead or dying cells. Cells seeded by spotting showed a significant reduction in the number of cleaved caspase 3-positive cells. Scale bar: 100 μm. [Figure 4C] (As mentioned above.) [Figure 4D] (As mentioned above.) [Figures 5A-5C]Figure 1 shows the effects of quercetin treatment on undifferentiated and differentiated cells. (A) Screening to determine optimal quercetin treatment conditions. After treatment with different quercetin concentrations and durations, viable hiPSCs were counted using a hemocytometer. (B-C) Dopaminergic cell viability (B) and total cell number (C) on day 11 after quercetin treatment on day 9. Cultures were treated with 5, 10, 20, 40, and 100 μM for 16 hours. Mean ± standard deviation, n = 4, one-way ANOVA. (D) Colony formation by 10-fold serially diluted hiPSCs at 105 to 1 with a constant number of fibroblasts (105). Cells were treated with 40 μM quercetin (QC) for 16 hours or left untreated, then cultured for 6 days and stained for alkaline phosphatase activity. Representative results from two separate experiments. (E) The final number of colonies counted is plotted against the original input number of hiPSCs. (F) A standard curve for OCT4 copy number versus input number of hiPSCs was generated by qRT-PCR. OCT4 copy number was measured by qRT-PCR and calculated from 10-fold serially diluted hiPSCs at 10-10 cells. (G) The number of OCT4-positive cells in mDA cells differentiated from hiPSCs at various time points with or without QC treatment was measured using OCT4 qRT-PCR. Mean ± standard deviation, n = 2, ***p < 0.005, two-way ANOVA. [Figure 5D-5E] (As mentioned above.) [Figure 5F-5G] (As mentioned above.) [Figure 6A]Figure 1 shows the molecular, cellular, and physiological characterization of in vitro differentiated C4 hiPSCs. (A) Schematic diagram of the mDA differentiation method based on the spotting protocol. Numbers represent concentrations in ng / ml, and numbers in parentheses represent concentrations in μM. AA: ascorbic acid; β-mer: beta-mercaptoethanol; BDNF: brain-derived neurotrophic factor; CHIR: CHIR99021; dbcAMP: dibutyl cyclic adenosine monophosphate; FGF-8, fibroblast growth factor 8; GDNF: glial cell line-derived neurotrophic factor; KSR: knockout serum replacement; LDN: LDN193189; L-Glu: L-glutamine; NEAA: non-essential amino acids; PMN: purmorphamine; QC: quercetin; SB: SB431542; SHH: sonic hedgehog; TGF-β3, transforming growth factor beta 3. (B) Heatmap of gene expression of stage-specific neural markers in mDA-differentiated cells. (C) Progressive increase in gene expression of FOXA2, LMX1A, NURR1, and TH during differentiation. (D) Immunofluorescence staining for neural progenitor marker (NESTIN), mDAP marker (FOXA2 / LMX1A / TH), mDAN marker (MAP2, NURR1 / TH), and proliferation marker PAX6 / SOX1 / KI67 in differentiated D28 cells. Scale bar: 100 μm. (E) Percentage of NESTIN+ cells, MAP2+ cells, TH+ cells, and NURR1+ cells among total D28 cells (n = 6). (F) Percentage of FOXA2+ cells, LMXA1+ cells, and FOXA2+ / LMX1A+ cells among total D28 cells (n = 6). (G) Percentage of FOXA2+ / LMX1A+ and NURR1+ cells among TH+ D28 cells (n=6). (H) Percentage of PAX6+, SOX1+, and PAX6+ / SOX1+ / KI67+ cells among total D28 cells (n=6). ND: Not detected. (I) HPLC analysis of KCl-induced release of dopamine and a dopamine metabolite (3,4-dihydroxyphenylacetic acid (DOPAC)) at day 47. Data are presented as mean ± SEM. [Figures 6B-6D](As mentioned above.) [Figures 6E-6I] (As mentioned above.) [Figure 7A-7C] Figure 1 shows the safety of C4-derived mDA cells in NOD-SCID mice in vivo. (A) H&E staining of NOD-SCID mouse brains after intrastriatal transplantation of C4 iPS cells (day 0, left) or C4-derived mDA progenitor cells on day 14 (center) or day 28 (right). Open circles in the D14 group identify rosette-like structures. (B) Quantification of the percentage of teratoma formation without quercetin (n=4), day 0 (n=4), and day 14, and with quercetin treatment on days 14 (n=19) and 28 (n=23). QC = quercetin. (C) Quantification of rosette formation on day 14 of differentiation without quercetin, and on days 14 and 28 with quercetin treatment. (D) Immunohistochemistry for vimentin in the D14 and D28 groups. (E-F) Immunofluorescence staining for SOX1, PAX6, and KI67 in groups D14 (E) and D28 (F). (G) Quantification of the SOX1+, KI67+, SOX1+ / KI67+, SOX1+ / PAX6+, and SOX1+ / PAX6+ / KI67+ populations in groups D14 and D28. Data are presented as mean ± SEM, n = 4, ***p < 0.001, Student's t-test. (H) Biodistribution assay. RT-PCR for human- or mouse-specific gene expression in the "brain mix" (a mixture of olfactory bulb and cerebellum), spinal cord, lung, heart, spleen, kidney, and liver of NOD SCID mice that had received intrastriatal hiPSC-derived D28 dopaminergic progenitor cell transplants for 6 months. hiPSCs were used as a positive control. The human-specific gene is located on chromosome 10, at positions 29125650-29125967. The mouse-specific gene is part of mouse TNFα. ND: Not detected. All scale bars indicate 100 μm unless otherwise specified. [Figure 7D-7E] (As mentioned above.) [Figures 7F-7H] (As mentioned above.) [Figure 8A-8B] Figure 1 shows the survival and function of C4 hiPSC-derived mDA cells in vivo. (A-D) Behavioral assessments (n=9) in the D28 and cryopreserved ("frozen") D28 groups using the drug-induced rotational behavior test (A), the corridor test (B), the cylinder test (C), and the stepping test (D). (E-F) Overview of graft-derived hNCAM+ and TH+ innervation in the host brain. (G-L) Innervation of the STR, NAc, and PFC by graft-derived hNCAM+ neurons (G-I) or TH+ neurons (J-L) in the intact, transplanted, and lesioned non-transplanted host. (M) High-magnification images showing graft-derived innervation. (N) Immunofluorescence staining for human-specific synaptic markers, synaptophysin, TH, and DARPP32, within transplanted neurons. All graft analysis data (E-M) were obtained 26 weeks after transplantation. AC: anterior commissure; cc: corpus callosum; dSTR: dorsal striatum; LV: lateral ventricle; NAc: nucleus accumbens; PFC: prefrontal cortex; T: transplant. Data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, Student's t-test. Scale bars: 500 μm (G-L); 100 μm (M-N). [Figures 8C-8F] (As mentioned above.) [Figure 8G-8L] (As mentioned above.) [Figure 8M-8N] (As mentioned above.) [Figures 9A-9C]Figure 1 shows an improved reprogramming method based on the identification of microRNAs regulating metabolic reprogramming and their combination with Y4F. (A-B) Using the XFp analyzer, the oxygen consumption rate (OCR) (A) and extracellular acidification rate (ECAR) (B) of hDFs transfected with microRNA mimics were assessed 3 days after transfection for control (Scr) or miR-200c (200c). Mean ± standard deviation, n = 3, *p < 0.05, unpaired two-tailed t-test. (C) OXPHOS capacity of hDFs transfected with Scr or miR-200c 3 days after transfection. Mean ± standard deviation (n = 3). (D-E) Basal respiration, ATP turnover, maximal respiration, oxidative reserve capacity (D), or relative OCR change (E) after FCCP injection. Mean ± standard deviation, n = 3, *p < 0.05, unpaired two-tailed t-test. (F–G) OCR is shown for hDFs infected with lentivirus expressing Y4F and / or miR-200c (200c) 3 (F) or 8 (G) days after transduction. Mean ± standard deviation (n = 3). (H–I) Basal respiration, ATP turnover, maximal respiration, and oxidative reserve capacity (OCR) for hDFs 3 (H) or 8 (I) days after transduction, as shown in Figure 9F–G. Mean ± standard deviation, n = 3. *p < 0.05; **p < 0.01; ***p < 0.005, one-way ANOVA with Tukey's post-hoc test. (J–K) OCR / ECAR ratio (J) or relative OCR change (K) for transduced hDFs after FCCP injection, as shown in Figure 9F–G. Mean ± standard deviation, n = 3, *p < 0.05; **p < 0.01, two-way ANOVA with Tukey's post-hoc test. (L-M) OCR (L) and ECAR (M) in hDFs transduced with lentiviruses expressing individual miRNAs 3 days after transduction. Mean ± standard deviation, n = 9, *p < 0.05; **p < 0.01; ***p < 0.005, one-way ANOVA with Tukey's post-hoc test. (N) OCR / ECAR ratios, as shown in Figure 9L-M.Mean ± standard deviation, n=9, ***p<0.005, one-way ANOVA with Tukey's post-hoc test. [Figure 9D-9G] (As mentioned above.) [Figures 9H-9K] (As mentioned above.) [Figures 9L-9N] (As mentioned above.) [Figure 10A] Figure 1. Identification of the Y4F+3+2 reprogramming protocol. (A) Representative photographs of TRA-1-60+ colonies (top) or AP-positive colonies (bottom) 14 days after transduction. (B) Percentage of TRA-1-60+ colonies among AP+ colonies after lentiviral transduction of human adult fibroblasts (GM03529) with Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 6, **p < 0.01, two-way ANOVA with Tukey's post-hoc test. (C-D) Maps of plasmids encoding pY4F (OCT4, SOX2, KLF4, and L-MYC) (C) and miR-302s and miR-200c (p3+2) (D). (E) Schematic diagram of the episome system-based reprogramming method established by the present inventors, which uses a single transfection of pY4F and pY3+2. [Figure 10B] (As mentioned above.) [Figures 10C-10E] (As mentioned above.) [Figure 11A] Figure 1 shows immunocytochemical staining of hiPSC cell lines generated by our improved reprogramming method. Immunocytochemical staining of human iPSCs generated by our episome method from diverse human adult fibroblasts derived from multiple sources, including nine fibroblast cell lines from the Coriell Institute (three familial PD, three sporadic PD, and three healthy subjects: A) and four samples from fresh skin biopsies (three healthy subjects and one sporadic PD patient: B). [Figure 11B] (As mentioned above.) [Figure 12A]Figure 1 shows the characterization of hiPSC cell lines generated by our improved reprogramming method. (A) Standard curve for the detection of the EBNA-1-specific sequence (EB-01) by qRT-PCR. (B) No residual plasmid DNA was detected in the cytoplasm of any hiPSC cell line. Samples derived from the original fibroblasts (Fib), the human ESC cell line (H9), and a negative control (distilled water: DW) were also examined. Plasmid-specific primers based on the EBNA sequence (EB-01) were used for qRT-PCR analysis. (C) Detection of plasmid DNA integrated into the host genome. One cell line (N17) was found to have integrated the plasmid DNA sequence into the host chromosomal DNA. (D) qRT-PCR analysis of the integrated plasmid sequence. Mean ± standard deviation, n = 3, ***p < 0.005, one-way ANOVA. (E) Chromosomal genotype analysis of a hiPSC cell line (MCL540) derived from a skin biopsy of a sporadic PD patient. The patterns were compared with samples derived from the original fibroblasts (Fib) and hESC cell line (H9) as positive and negative controls, respectively. DW: distilled water. (F) Representative images of normal karyotypes of C4 and N3. (G) Representative images of teratoma formation from WiCell's 19-9-11T hiPSC cell line (top), C4 (middle), and N3 (bottom), and the three germ layer tissues derived from them. Scale bar: 100 μm. [Figures 12B-12E] (As mentioned above.) [Figure 12F] (As mentioned above.) [Figure 12G] (As mentioned above.) [Figure 13A]Figure 1 shows a schematic diagram of the spotting-based differentiation protocol. (A) Successful differentiation rates of hESCs and hiPSCs using the monolayer-based or spotting-based method (n=76 for hESCs and n=48 for hiPSCs). In vitro differentiation was considered successful if 1) cells could survive at >50% confluency on day 15, and 2) cells could be harvested and seeded onto coverslips for further characterization by immunocytochemistry. (B-C) Spotting schematic diagrams for a 6 cm culture plate with 6 spots and a 10 cm culture plate with 12 spots. [Figures 13B-13C] (As mentioned above.) [Figure 14A] Figure 1 shows a comparison of spotting-based and monolayer-based in vitro differentiation. (A) Comparison of the ratio of cell loss to cell yield at day 15 of differentiation for C4 and H9 (n=4) using the monolayer-based and spotting-based in vitro differentiation methods. Cell loss and cell harvest were obtained by FACS. (B) Comparison of the pH values ​​of supernatants collected at different time points for both C4 and H9 (n=4). (C) Comparison of morphological features for C4 at days 4, 8, 12, and 15. Scale bars represent 20 μm. Data are presented as mean ± SEM, *p<0.05; ***p<0.005. Statistical significance was determined using a paired two-tailed t-test (A) and one-way ANOVA with Tukey's multiple comparison test (B). [Figure 14B] (As mentioned above.) [Figure 14C] (As mentioned above.) [Figure 15A]Figure 1 shows the elimination of undifferentiated hiPSCs by quercetin treatment. (A) FACS analysis of undifferentiated hiPSCs serially diluted 10-fold with fibroblasts in 100 × 10 total cells with anti-SSEA-4 and anti-TRA-1-60. (B) Plot of the number of input hiPSCs versus the percentage of resulting SSEA-4+ / TRA-1-60+ cells. (C) Immunostaining for NANOG in D14 cells with or without quercetin treatment. Scale bar: 100 μm. [Figures 15B-15C] (As mentioned above.) [Figures 16A-16B] Characterization of in vitro differentiated C4 hiPSCs. (A) Brightfield images of differentiated cells at days 3 to 40. (B) Immunofluorescence staining and percentages of neural progenitor (NESTIN), mDAP (FOXA2 / LMX1A), mDAN (MAP2 and TH), GABAergic neuron (GABA), and serotonergic neuron (5-HT) positive cells at days 14, 21, 28, and 50 of mDA differentiation. Scale bar: 100 μm. Data are presented as mean ± SEM (n = 6). [Figures 17A-17B] Figure 1 shows cell fate analysis of in vitro differentiated C4 hiPSCs. (A) Immunofluorescence staining of electrophysiologically recorded D70 cells co-expressing TH, MAP2, SYP (synaptophysin), DAT (dopamine transporter), VMAT2 (vesicular monoamine transporter 2), and PITX3. Scale bar: 100 μm. (B) Immunofluorescence staining for ALDH1A1, GIRK2, and calbindin with TH-positive cells. Scale bar: 100 μm. [Figures 18A-18C]Electrophysiological characteristics of in vitro differentiated C4 hiPSCs. (A) Representative voltage traces for action potentials induced by depolarizing current injection (500 ms) at day 70. (B) Representative current traces evoked by voltage pulses in voltage-clamp mode. Left: Transient inward currents and sustained outward currents (100 ms duration) induced by voltage pulses from -70 mV to +40 mV in 10 mV increments. Middle: Inward currents were completely blocked by TTX (1 μM). Right: Traces recorded in the presence of TTX were subtracted from those recorded under control conditions to isolate voltage-dependent Na+ currents at different membrane potentials. (C) Spontaneous postsynaptic currents recorded at -70 mV in voltage-clamp mode. (D) Spontaneous firing of a differentiated cell at a resting membrane potential in current-clamp mode. (E) Immunofluorescence staining of an individual recorded cell. Neurobiotin-filled cells (red) indicate TH positivity (green). Scale bar: 100 μm. (F) Cumulative activity maps and spiking activity of in vitro differentiated C4 hiPSCs at days 30, 37, and 44 using a multi-electrode array. (G-H) Average spike counts (G) and active electrode counts (H) of D44-differentiated C4 hiPSCs with or without treatment with a combination of glutamate receptor antagonist NBQX+AP5 and GABAA receptor antagonist picrotoxin. Data are presented as mean ± SEM (n = 4). [Figure 18D-18E] (As mentioned above.) [Figure 18F] (As mentioned above.) [Figures 18G-18H] (As mentioned above.) [Figure 19A]Figure 1 shows an analysis of transplantation outcomes in an in vivo athymic rat model of PD. (A) Amphetamine-induced rotational behavior testing of 6-hydroxydopamine-lesioned Taconic rats before and 4, 8, 12, and 16 weeks after transplantation of C4-derived D28 DA progenitor cells (100,000 or 300,000 cells). Data are presented as mean ± SEM. ** denotes p<0.01, and *** denotes p<0.001. (B) H&E staining of athymic rat brains 6 months after D28 cell transplantation. (C) Immunohistochemistry for hNCAM reveals extensive fiber extension to multiple regions throughout the host brain in serial coronal sections. (D-G) High-magnification hNCAM staining illustrates the outgrowth pattern of the graft into the prefrontal cortex (D), septal nuclei (E), nucleus accumbens (F), and corpus callosum (G). (H-J) Histological analysis of TH+ dopaminergic neurons within grafts generated from D28 DA progenitor cells 6 months after transplantation. Note the A9-like neuron shape (I) with its large, angular cell body, as well as the small, spherical A10-like neuron (J). (K) Schematic of an in vivo experiment in athymic rats from Charles River. (L) Comparison of cell viability and the number of FOXA2-, LMX1A-, and TH-positive cells between freshly prepared D28 cells and frozen D28 cells thawed after 1 week in liquid nitrogen (n = 3-4). (M) Amphetamine-induced rotational behavior test 24–52 weeks after transplantation of D28 cells and frozen D28 cells (n=3–4). Data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, Student's t-test. AC: anterior commissure; cc: corpus callosum; NAc: nucleus accumbens; PFC: prefrontal cortex. All scale bars indicate 100 μm unless otherwise noted. [Figures 19B-19C] (As mentioned above.) [Figures 19D-19K] (As mentioned above.) [Figures 19L-19M] (As mentioned above.) [Figure 20A] Figure 1 shows functional and innervation analyses of in vivo transplants. (A) Amphetamine-induced rotational behavior test after transplantation of H9 hESC-derived D28 cells and C4 hiPSC-derived D28 cells (n = 5-8). (B) Representative images of 6-hydroxydopamine-lesioned brains from each group. (C) High-magnification images of innervation of the grafts to the STR and NAc. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, Student's t-test. STR: striatum; NAc: nucleus accumbens. [Figures 20B-20C] (As mentioned above.) [Figures 21A-21C]Graft analysis after transplantation of C4-derived mDA cells. (A) Immunostaining for TH+ neurons (both A9-like and A10-like neurons) in D28 grafts and frozen D28 grafts. (B) Estimation of the number of surviving TH+ neurons in D28 grafts and frozen D28 grafts (n=4). (C) Estimation of graft volume in D28 grafts and frozen D28 grafts (n=4). (D-F) Immunofluorescent co-staining for FOXA2, LMX1A (D), and NURR1 (E) with TH in D28 grafts (n=4). (F) Quantification of TH+ neurons co-expressing FOXA2, LMX1A, both of these markers, or NURR1 in D28 grafts and frozen D28 grafts (n=4). (G) Immunofluorescent co-staining for DAT and TH. (H) Immunofluorescent staining for PAX6, SOX1, and Ki67 in transplanted neurons. (I) Quantification of PAX6+, SOX1+, and Ki67+ cells in D28 and frozen D28 grafts (n=4). (J-L) Immunofluorescent co-staining of GIRK2+ neurons (J) and calbindin+ neurons (K) with TH in D28 and frozen D28 grafts (n=4). (L) Quantification of calbindin+ and GIRK2+ neurons in D28 and frozen D28 grafts. (M-O) Immunofluorescent co-staining for TH+, ALDH1A1+, and SOX6+ (M), TH+, ALDH1A1+, and GIRK2+ (N), TH+, ALDH1A1+, and calbindin+ (O) in D28 grafts. For Taconic rats, all graft analysis data were obtained 18 weeks after transplantation. For Charles River rats, all graft analysis data were obtained 26 weeks after transplantation. AC: anterior commissure; cc: corpus callosum; NAc: nucleus accumbens; PFC: prefrontal cortex; SNpc: substantia nigra pars compacta; STR: striatum; T: transplant; VTA: ventral putamen area. Scale bars: 50 μm (A); 100 μm (D-O). [Figures 21D-21L] (As mentioned above.) [Figures 21M-21O] (As mentioned above.) [Figure 22A] Figure 1 shows an overview and quality control results for the GMP differentiation protocol. (A) Schematic diagram for the GMP differentiation protocol, with cell yield at each stage shown in red. QC indicates quality control. (B) D0 immunocytochemistry QC staining for OCT4 and SSEA-4. (C) D0 QC for mRNA expression levels of Oct4 and Nanog using qRT-PCR. (D) DNA fingerprinting QC for C4 D26 shows the original fibroblasts in the same pattern, while the negative control has a different pattern, confirming that C4 iPS cells from the working cell bank are derived from patient fibroblasts. Fib: fibroblasts. M: DNA marker. (E) D26 QC for mRNA expression levels of FOXA2, LMX1A, and TH using qRT-PCR. (F) D26 immunocytochemistry QC staining for FOXA2, LMX1A, and Nurr1, using D0 undifferentiated cells as a negative control. (G) Quantification of FOXA2, LMX1A, and Nurr1 expression by (F). (H) D26 immunocytochemistry quality control staining for TH, 5-HT, TPH, OCT4, and SSEA-4, using staining for OCT4 and SSEA-4 of D0 undifferentiated cells as a negative control. (I) Quantification of TH, 5-HT, TPH, OCT4, and SSEA-4 expression by (H). Some cells were harvested on day 26 for immunocytochemistry QC to allow cells to adhere to coverslips and complete staining and analysis before final harvest on day 28. Scale bar: 100 μm. n = 3 for each experiment. [Figures 22B-22D] (As mentioned above.) [Figures 22E-22F] (As mentioned above.) [Figures 22G-22I] (As mentioned above.) [Figures 23A-23C]Figure 1 shows the immunogenicity of mDA progenitor cells in humanized mice. (A) and (B) show mouse brain sections stained with antibodies against hNCAM (A) and TH / hNCAM (B) 2 weeks after autologous and allogeneic mDAP transplantation to detect the presence of viable grafts and dopaminergic differentiation. (C) Anti-CD4 staining confirms significant cell loss and T cell infiltration only in the allografts transferred to patient-humanized animals. All scale bars indicate 100 μm. NSG: NOD / SCID / IL2rγ null mice; C4-hu: NSG mice humanized with patient-derived PBMCs; K1-hu: NSG mice humanized with volunteer-derived PBMCs. C4-mDAP: patient-derived mDAP; H9-mDAP: human embryonic cell line-derived mDAP. [Figures 24A-24B] Figure 1. Imaging. (A) Axial 18F-DOPA PET images in the basal ganglia reference plane at the indicated time points: baseline (4 months before the first surgery), 3 months after left-side implantation, 6 months after right-side implantation and 12 months after left-side implantation, and 24 months after left-side implantation and 18 months after right-side implantation. An initial, transient decrease in 18F-DOPA uptake 3 months after left-side implantation was followed by a small, progressive increase in dopamine uptake (greater on the right side than on the left side) bilaterally, primarily in the posterior putamen near the implantation site. (B) T2-blade MR images 18 months after left-side implantation and 12 months after right-side implantation. Arrows indicate the location of the implant. [Figures 25A-25B] Longitudinal clinical assessment of motor and non-motor function and quality of life associated with Parkinson's disease. Time points for the first hemispheric implant (left) and the second hemispheric implant (right) are indicated by vertical dotted lines. (A) MDS-UPDRS Part III motor scores after an overnight levodopa withdrawal ("off") and at the peak levodopa dose ("on"). (B) Time course for the indicated PDQ rating scale; lower numbers indicate less severe symptoms. DETAILED DESCRIPTION OF THE INVENTION

[0032] Because selective degeneration of A9 mDA neurons (mDANs) within the substantia nigra (SN) is a key pathological feature of Parkinson's disease and directly correlates with the disease's primary motor symptoms, dopaminergic cell transplantation has been proposed as a potential therapeutic strategy (3). Previous interventions using fetal cell transplants have provided "proof of concept," supporting this, with many grafts successfully reinnervating the target area with varying degrees of functional recovery, including some patients showing remarkable recovery lasting for 20 years or more (4-7). Despite these promising results, tissue derived from aborted human fetuses has fundamental ethical, practical, and medical limitations as a source of viable cells for the treatment of PD.

[0033] In 2006, Yamanaka et al. published a groundbreaking study demonstrating that mammalian fibroblasts could be converted into embryonic stem cell (ESC)-like induced pluripotent stem cells (iPSCs) by introducing four transcription factors: Oct4, Sox2, Klf4, and c-Myc (hereafter referred to as Y4F (Yamanaka four factors)) (8). Subsequently, Yamanaka's research group and two other research groups achieved this feat with human somatic cells by reprogramming them into human iPSCs (hiPSCs) (9-11), opening the possibility of generating patient-specific stem cells. Despite this initial excitement, it remains uncertain whether hiPSC technology can be readily used for autologous cell therapy. Indeed, the primary goal of most hiPSC research has shifted from personalized cell therapy to mechanistic studies of human disease and pathogenesis (12). Several major obstacles exist to the implementation of hiPSC-based cell therapy for PD. First, likely due to our limited understanding of the reprogramming process, there is wide variability among the differentiation potential of individual hiPSC cell lines (13, 14). Second, the safety of hiPSC-based cell therapies has not yet been fully established. In particular, any hiPSCs that remain undifferentiated or harbor subclonal tumorigenic mutations have neoplastic potential (15, 16), so it is crucial to completely eliminate such cells from therapeutics. As exemplified by one of two patients in the first hiPSC-based human trial (17), safe clinical use requires that the genomic integrity of hiPSCs be confirmed by whole genome / exome sequencing (WGS / WES). Third, despite numerous studies by multiple laboratories, in vitro differentiation protocols for hiPSCs into functional mDNA remain suboptimal, increasing the variability of the final product (7, 18). Finally, long-term cost-effectiveness and reproducibility will also be necessary to benefit as many patients as possible.

[0034] This disclosure addresses these challenges and makes hiPSC-based personalized cell therapy a viable option for the treatment of PD. First, we identified multiple microRNAs (miRNAs) that directly regulate metabolic changes during the reprogramming process and showed that optimal combinations of these miRNAs (miR-302s and miR-200c) with canonical reprogramming factors can efficiently and reliably generate high-quality iPSCs. This novel episomal reprogramming method has been successfully applied to generate multiple hiPSCs using adult human fibroblasts derived from 13 different sources. Whole-exome sequencing (WES) and karyotyping of hiPSCs generated as a result of using fibroblasts derived from a skin biopsy of a single sporadic PD patient demonstrated stable chromosomal and genomic integrity without any known oncogenic mutations. Second, we established a chemical method (the quercetin method) that can efficiently and reliably eliminate undifferentiated hiPSCs and avoid tumor formation after transplantation. See, for example, U.S. Patent No. 20160002604. Third, we established an efficient in vitro differentiation protocol based on a novel "spotting" method, which resulted in dramatically reduced cell loss and increased yield of healthy cells compared with conventional monolayer methods. Fourth, transplantation of mDA cells generated by this in vitro differentiation protocol, whether using fresh or cryopreserved cells, robustly corrected ataxia in an athymic rat model of PD and demonstrated significant reinnervation of the host brain. Finally, we successfully implemented our platform in a Good Manufacturing Practice (GMP)-compliant facility and produced large quantities of high-quality mDA cells. Thus, the core techniques described herein provide a protocol suitable for the successful implementation of personalized, autologous, cell replacement therapy for PD.

[0035] PD is a particularly promising target for cell replacement therapy because selective degeneration of a well-characterized cell type (A9 mDAN) is a primary cause of ataxia-related conditions. Numerous researchers have investigated cell therapies for PD using diverse cell sources, including fetal tissue, adult autologous stem cells, and allogeneic mDA cells (5-7, 54). We focus on hiPSC-derived autologous cell replacement methods because of their inherent advantages in addressing ethical, practical, and medical issues. To help realize the potential of personalized autologous cell therapy for PD, we sought to address the current technical and scientific obstacles to implementing this treatment strategy.

[0036] Because personalized cell therapy requires the generation of clinical-grade hiPSCs derived from each patient, establishing reprogramming technologies that enable the efficient and reliable generation of such cell lines is crucial. We found that the combination of two metabolically modulating miRNAs (miR-302s and miR-200c) with the canonical Yamanaka factor (Y4F) facilitates the generation of hiPSCs that meet strict quality standards: First, our hiPSC cell lines showed expression levels of bona fide pluripotency markers, including OCT4, SOX2, NANOG, ESRRB, REX1, GDF3, ECAT1, GBX2, and TRA-1-60, similar to those of H9 (Figures 2A and 2B). Second, as determined by immunostaining and gene expression for three germ layer-specific markers, H9 hESC and hiPSC cell lines generated by Y4F+3+2 (our final method) differentiated well and evenly into all three germ layer cell lineages, whereas cell lines generated by Y4F or Y4F+3 did not (Figures 2C and 2D). Third, our hiPSC cell lines derived from multiple hDFs displayed well-defined, typical hESC-like condensed colony morphology (Figures 10A and 11A). The robustness of this method was verified by the successful generation of multiple hiPSC cell lines from 13 different adult hDF sources. Further studies are needed to determine the performance of this same combination using alternative delivery methods (e.g., mature RNA / miRNA or Sendai virus) and other cell types (e.g., blood and urine cells).

[0037] Before hiPSCs can be used for therapy, their genomic integrity must be established. For example, Merkle et al. reported that some hESC cell lines, including H9, develop mutations in the TP53 gene, which encodes the tumor suppressor P53, a mutation commonly found in human cancers (28). Notably, in the first hiPSC-based human trial, hiPSCs derived from one of two patients were found to have a minor oncogenic mutation, resulting in the discontinuation of cell treatment for the second patient (17). To confirm genomic integrity, we analyzed five independent hiPSC cell lines (MCL540 in Table C) derived from a sporadic PD patient by karyotyping, qRT-PCR, and WES analysis. We found that four of the five clones (C4, N3, C11, and C5) contained no integrated plasmid DNA and no somatic mutations causally implicated in cancer, indicating that our reprogramming method reliably generates clinically usable hiPSC cell lines (Table 2). These four hiPSC clones contained significantly fewer mutations per cell line than the 140 hESC cell lines studied by Merkle et al. (28). Notably, these four hiPSC clones contained significantly fewer coding mutations within genes reported in the COSMIC database (Figure 3). Another critical safety issue facing hiPSC-based therapies is the need to eliminate residual undifferentiated cells with neoplastic potential. In this study, we established a chemical method using quercetin to target hPSC-specific BIRC5 (40), which eliminated undifferentiated PSCs with >99.99% efficiency (Figure 5). Theoretical calculations based on qRT-PCR analysis of OCT4 expression predict 0.0017 undifferentiated cells per 10 million D28 cells after quercetin treatment. Thus, the risk of tumor formation compares favorably with the spontaneous incidence of glioma, given that the spontaneous incidence of all types of glioma ranges from 4.67 to 5.73 cases per 100,000 people (55).This method is simple, effective, and readily meets GMP standards because it does not require additional manipulations such as cell sorting or gamma irradiation (45, 56). However, quercetin treatment did not directly abolish neural outgrowth from rosette-forming epithelial cells, highlighting the importance of combining quercetin treatment with sufficient in vitro differentiation (e.g., 28 days) (Figure 7).

[0038] This method provides an efficient in vitro differentiation protocol based on the "spotting" method, in which a small number of primary cells are allowed to proliferate and differentiate using physical separation into high-cell-density spots. This results in significantly reduced cell loss and the production of healthy mDA cells, with significantly fewer dead or dying cells, compared with the conventional confluent monolayer method (Figure 4). Importantly, monolayer culture medium significantly acidifies regardless of the frequency of medium changes (Figure 14B), likely contributing to poor cell health in monolayer cultures, whereas spotting culture medium does not. When these D28 cells were further differentiated in vitro, they matured, significantly releasing dopamine (3.1 ng / ml) at day 47 and exhibiting electrophysiological properties characteristic of mDANs by day 70. These data indicate that cultures at day 28 of this differentiation protocol consisted largely of bona fide mDANs and represent a promising source for transplantation. We successfully scaled up this protocol in a GMP facility to produce clinically relevant quantities of high-quality mDAP (Figures 22A-22F).

[0039] Although numerous studies have demonstrated highly efficient differentiation of hESCs / hiPSCs into the mDA phenotype, their in vivo efficacy has been variable at best and often poorly correlated with in vitro data (7). In some previous clinical trials, transplantation of DA-producing cells without first undergoing extensive functional validation in appropriate animal models failed to provide clinical benefit (5, 6). The efficacy of the cell grafts described herein has been confirmed using in vivo animal models of PD, for example, by several criteria: (1) sufficient mDA cells differentiate within the graft and survive long-term; (2) these mDA cells extensively reinnervate target regions within the host striatum; and (3) substantial improvement of ataxia in multiple appropriate behavioral tests. When D28 C4 cells were transplanted into Taconic or Charles River athymic rats unilaterally lesioned with 6-hydroxydopamine, DA yields were high, and the grafts displayed extensive and adequate reinnervation of host structures. Transplantation resulted in complete recovery of pharmacologically induced rotational behavior. The DA yield (ratio of surviving DA neurons to the number of transplanted cells) and the degree of behavioral recovery in this study were significantly higher than in comparable hiPSC-based studies (Table 4) (44, 45, 57-64). Notably, recovery of rotational behavior was maintained for up to 52 weeks (Figure 19M). Significant recovery was also observed in several tests, including the corridor test, cylinder test, and stepping test, which are spontaneous and not pharmacologically stimulated and therefore may mimic clinical PD symptoms (Figure 8).

[0040] To establish the clinical validity of hiPSC-based personalized cell therapy, it is important to compare therapeutic agents with an established "gold standard." In the stem cell field, H9 hESCs represent this standard for human pluripotent stem cells, and human fetal VM cells have become the gold standard as a transplantable cell source for PD. Parmar et al. performed a detailed comparison of the efficacy of H9-derived mDA cells with human fetal VM cells in restoring motor function in vivo, confirming that H9-derived dopamine cells are as effective as human fetal VM cells (53). This animal transplantation study confirmed the same extent and time course of recovery of rotational behavior whether sourced from H9 (hESC) or C4 (hiPSC) (Figure 20A). By implication, these data strongly suggest that dopamine cells generated from patient-derived hiPSCs using our protocol are functionally as effective as fetal VM cells. A recent study by Takahashi et al. elegantly demonstrated that hiPSC-derived DA cells survived and improved motor behavior in an MPTP-lesioned monkey model (65), but differences in the platforms used preclude direct comparison of these results with our study. We found that in all studies, fresh and cryopreserved C4 D28 cells resulted in similar yields of viable DA neurons and improved behavior, suggesting that hiPSC-derived mDAPs can be cryopreserved, stored, and shipped to surgical centers for transplantation. The importance of developing practical, cost-effective clinical treatments cannot be overemphasized.

[0041] Thus, the present method provides a clinically applicable personalized autologous cell therapy for PD.

[0042] See also U.S. Patent Nos. 20180371422; 20120128655; 20130052268; 20160002604; 20140199274; and 20090226401, as well as U.S. Patent Nos. 9,657,273 and 9,750,768.

[0043] Autologous cell generation for cell therapy The methods described herein may include the use of induced pluripotent stem cells (hiPSCs), e.g., similar to neurogenic floor plate cells, which are known in the art or may be generated using the methods described herein. In some embodiments, the method for generating hiPSCs may include obtaining a population of primary somatic cells from a subject, e.g., a subject suffering from PD and in need of treatment for PD. Preferably, the subject is a mammal, e.g., a human. In some embodiments, the somatic cells are fibroblasts. Fibroblasts may be obtained, for example, using known biopsy methods, from connective tissue within a mammal, e.g., skin, e.g., from the eyelid, behind the ear, a scar (e.g., an abdominal Cesarean section scar), or skin from the groin (see, e.g., Fernandes et al., Cytotechnology. 2016 Mar; 68(2): 223-228). Other sources of somatic cells for hiPSCs include hair keratinocytes (Raab et al., Stem Cells Int. 2014;2014:768391), blood cells, or bone marrow mesenchymal stem cells (MSCs) (Streckfuss-Bomeke et al., Eur Heart J. 2013 Sep;34(33):2618-29).

[0044] According to this method, cells (e.g., fibroblasts) are exposed to factors that induce reprogramming into iPSCs. While other protocols for reprogramming (e.g., known in the art or described herein) can also be used, in a preferred embodiment, the method involves introducing four transcription factors, namely, Oct4, Sox2, Klf4, and L-Myc. In some embodiments, the method involves transfecting the cells with a polycistronic episomal vector that expresses OCT4, KLF4, SOX2, and L-MYC, e.g., an episomal vector that contains an intervening sequence between the coding sequences that encodes a "self-cleaving" 2A peptide. The 2A peptide is an 18-22 amino acid viral peptide that mediates cleavage of the polypeptide during translation in eukaryotic cells. 2A peptides include F2A (foot-and-mouth disease virus), E2A (equine rhinitis virus type A), P2A (porcine teschovirus type 1 2A), and T2A (Thosea asigna virus 2A), and generally contain the sequence GDVEXNPGP (SEQ ID NO: 1) at the C-terminus. See, e.g., Liu et al., Sci Rep. 2017; 7: 2193. The following table provides exemplary 2A sequences.

[0045] [Table 1]

[0046] In some embodiments, the method includes transfecting cells with a polycistronic episomal vector containing coding sequences for human Oct4 linked to the foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to the porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC to express OCT4, KLF4, SOX2, and L-MYC.

[0047] Reference numbers for exemplary sequences of OCT4, KLF4, SOX2, and L-MYC are provided in the table below.

[0048] [Table 2]

[0049] In some embodiments, the method also or alternatively includes expressing one or more exogenous microRNAs in the cell, such as one or more of miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and miR-371 / 373. miR-302s refers to the miR-302 cluster, which includes five miRNAs, including 302a, 302b, 302c, 302d, and 367; any one or more of them may be used. In a preferred embodiment, the method includes expressing miR-302s and miR-200c in the cell, for example, from a single episomal vector. In some embodiments, the method includes introducing into the cell an episomal vector containing sequences encoding miR-302s and miR-200c.

[0050] Exemplary sequences of miRNAs are presented in the table below. Sequences in bold represent mature miRNAs.

[0051] [Table 3]

[0052] The sequence used may be at least 80, 85, 90, 95, or 100% identical to the exemplary (reference) sequence presented herein, provided that it retains the desired activity of the exemplary (reference) sequence. Calculation of "identity" between two sequences may be performed as follows: The sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced into one or both of the first and second nucleic acid sequences for optimal alignment, and non-identical sequences may be discarded for comparison purposes). The length of the sequence aligned for comparison purposes is at least 60% (e.g., at least 70%, 80%, 90%, or 100%) of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at this position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences when considering the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap.

[0053] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In some embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package, using a Blosum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0054] In some embodiments, the method includes expressing all of OCT4, KLF4, SOX2, L-MYC, miR-302s, and miR-200c in a cell. In embodiments, the method includes introducing into the cell a lentiviral vector or a polycistronic episomal vector containing coding sequences for human Oct4 linked to the foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to the porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC, and a vector, e.g., a lentiviral vector or an episomal vector, containing sequences encoding miR-302s (e.g., as set forth above) and miR-200c (e.g., the sequences set forth above, or uaauacugccggguaaugaugga (SEQ ID NO: 21)).

[0055] Primary somatic cells may be directly transfected, or may be first cultured, removed from the culture plate, and resuspended before transfection. To achieve transfection, cells are combined with and treated with exogenous nucleic acid sequences, for example, to stably integrate them into their genome. As used herein, the term "transfection" includes various techniques for introducing exogenous nucleic acids into cells, all of which are known in the art, including calcium phosphate precipitation or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection, or electroporation. If the vector is a viral vector, transfection may include transducing viral particles into cells.

[0056] After introducing these factors into cells, the cells are maintained under conditions long enough to express the factors and induce reprogramming into iPS cells, for example, cells that express alkaline phosphatase (AP) as well as the more stringent pluripotency marker TRA-1-60 (Chan et al., 2009; Tanabe et al., 2013).Many methods are known in the art; see, for example, Malik and Rao, Methods Mol Biol. 2013;997:23-33. In some embodiments, the conditions include maintaining the cells in a medium containing, for example, DMEM / F-12, L-glutamine (e.g., 2 mM), serum, e.g., fetal bovine serum (FBS) (e.g., 10%), non-essential amino acids (NEAA, e.g., 1× concentration), nicotinamide (NAM, e.g., 1 mM), sodium butyrate (NaB) (e.g., 25 mM), and ascorbic acid (AA, e.g., 50 μg / ml); however, alternatively, DMEM medium with knockout serum replacement, glutamine, and β-mercaptoethanol (KSR, chemically defined, FBS-free medium) can also be used. One skilled in the art will understand that other concentrations can also be used. For example, the cells are incubated for 4-6, e.g., 5-6 days.

[0057] In a preferred embodiment, cells can be seeded onto a plate using a biomatrix hydrogel support, e.g., a basement membrane extract such as MATRIGEL, PATHCLEAR Grade basement membrane extract (Amsbio), or other synthetic alternatives, e.g., as described in Nguyen et al., Nat Biomed Eng. 2017;1. pii:0096, e.g., about 10 μl of gel, into discrete, preferably substantially circular or oval, areas (also referred to herein as "spots") measuring 2-10 mm in diameter, e.g., about 5 mm. Spots can be applied, for example, by placing droplets of appropriate volume onto the plate, spaced about 1-3 cm apart, e.g., on the intersections of a 2 x 2 cm grid, to maintain separation between spots (so that spots do not touch each other) (FIG. 11C). For example, about 10 μl of gel can be placed at the grid intersections of a gridded culture plate to create spots about 2 to 10 mm in diameter, e.g., about 5 mm. After incubation for a sufficient time, e.g., 10 to 60 minutes, e.g., 25 to 45 minutes, e.g., about 30 minutes, the gel is partially aspirated from the spots (stopping before the gel is completely dry), leaving a layer of gel in the spots. Also provided herein are plates prepared in this manner (e.g., having gel spots described herein). After the plates are prepared, cells are then seeded at a density of, e.g., about 5,000 to 20,000 cells per spot, e.g., about 10,000 cells per μl, e.g., about 10 μl of cell suspension at a density of 10,000 cells per μl.

[0058] After reprogramming into iPSCs, the cells can be optionally maintained in hiPSC medium, e.g., containing DMEM / F-12, L-glutamine (e.g., 2 mM), KSR (e.g., 20%), NEAA, NAM, NaB, and bFGF, until the formation of ES-like colonies, which can be identified by, for example, (1) staining with antibodies against three germ layer markers (OTX2, an ectoderm marker; SOX17, an endoderm marker; and BRACHYURY, a mesoderm marker); and (2) gene expression of cell lineage-specific markers (e.g., PAX6 and MAP2 for ectoderm, FOXA2, SOX17, and CK8 for endoderm, and MSX1, MYL2A, and COL6A2 for mesoderm). In some embodiments, iPSC cells are maintained in ESSENTIAL 8 medium or its equivalent, i.e., an equivalent comprising or consisting essentially of DMEM / F-12, L-ascorbic acid, selenium, transferrin, NaHCO3, insulin, FGF2, and TGFβ1. See, e.g., Chen et al., Nat Methods 8(5):424-429.

[0059] Once iPS cells are generated, they can be maintained as iPS cell lines. In some embodiments, for each patient, multiple iPSC cell lines are generated and characterized, and the best cell lines (e.g., one, two, three, or more best cell lines) are selected.

[0060] Also provided herein are cells, eg, iPS cell lines, produced by the methods described herein, and compositions comprising the cells.

[0061] viral vectors Viral vectors for use in the present methods and compositions include recombinant retroviruses, adenoviruses, adeno-associated viruses, and lentiviruses.

[0062] In this method, a preferred viral vector system useful for delivering nucleic acids to the inner ear is adeno-associated virus (AAV). AAV is a minute, non-enveloped virus with a 25 nm capsid. No diseases are known or have been shown to be associated with wild-type viruses. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit episomal, long-term transgene expression, and AAV has demonstrated excellent transgene expression in the brain, particularly in neurons. AAV vectors containing as few as 300 base pairs can be packaged and integrated. Space for exogenous DNA is limited to approximately 4.7 kb. AAV vectors, such as those described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see, for example, Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993)). Numerous alternative AAV variants (more than 100 AAV variants have been cloned), and AAV variants have been identified based on desired characteristics. For example, AAV9 has been shown to efficiently cross the blood-brain barrier. Additionally, AAV capsids can be engineered to increase transduction efficiency and selectivity, e.g., biotinylated AAV vectors, directed molecular evolution, self-complementary AAV genomes, etc. In some embodiments, AAV1 is used.

[0063] Alternatively, retroviral vectors and adeno-associated viral vectors can also be used as recombinant gene delivery systems for the introduction of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the introduced nucleic acid is stably integrated into the host's chromosomal DNA. The development of specialized cell lines (called "packaging cells") that produce only replication-defective retroviruses has increased the usefulness of retroviruses for gene therapy, and defective retroviruses have been characterized for use in gene transfer for gene therapy purposes (for a review, see Miller, Blood 76:271 (1990)). Replication-defective retroviruses can be packaged into virions that can be used to infect target cells using standard techniques through the use of helper viruses. Protocols for producing recombinant retroviruses and infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE, and pEM, which are known to those skilled in the art. Examples of packaging viruses suitable for preparing both ecotropic and amphotropic retroviral systems include ΨCrip, ΨCre, Ψ2, and ΨAm.Retroviruses have been used in vitro and / or in vivo to transfer a variety of genes into many different cell types, including epithelial cells (e.g., Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application Publication No. WO 89 / 07136; PCT Application Publication No. WO 89 / 02468; PCT Application Publication No. WO 89 / 05345; and PCT Application Publication No. WO 92 / 07573).

[0064] Another viral gene delivery system useful in this method utilizes adenovirus-derived vectors. The adenovirus genome can be engineered to encode and express a gene product of interest, but its replication ability during the normal lytic viral life cycle is inactivated. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Those skilled in the art are familiar with suitable adenovirus vectors derived from the adenovirus strain Ad type 5 dl324 or other adenovirus strains (e.g., Ad2, Ad3, or Ad7). Recombinant adenoviruses can be advantageous in that, under certain circumstances, they are capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, viral particles are relatively stable, amenable to purification and concentration, and, as described above, can be modified to affect the spectrum of infectivity. In addition, the introduced adenoviral DNA (and the foreign DNA contained therein) does not integrate into the host cell genome but remains episomal, thereby avoiding potential problems that can arise as a result of in situ insertional mutagenesis, where the introduced DNA is integrated into the host genome (e.g., retroviral DNA). Furthermore, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) compared to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986)).

[0065] Differentiation into mDAP / mDAN In some embodiments, the method is used to generate mDAP or mDAN as follows: For base plate induction, after transfection, cells are maintained in DMEM medium with 15% KSR, glutamine, and β-mercaptoethanol for approximately 6 days (days 1-6). For days 6-12 (D6-D12), which is the neural progenitor cell induction stage, cells are maintained in DMEM medium with 11.5% KSR, 0.25% N2 (days 6-8), 7.5% KSR, 0.5% N2 (days 8-10), and 3.75% KSR, L-glutamine, β-mercaptoethanol, and non-essential amino acids (NEAAs), 0.75% N2 (days 10-12). For example, dual Smad inhibitors, 0.2 μM LDN193189 and 10 μM SB431542, may be added on days 1-12 and 1-8, respectively. For example, one or more SHH agonists (e.g., 2 μM purmorphamine and 100 ng / ml Shh) may be added along with 100 ng / ml FGF8 on days 2-10. A Wnt signaling activator, e.g., CHIR99021 (1 μM), may be incorporated on days 4-12. On day 9, cells may be treated with, e.g., 40 μM quercetin, for example, for 6-24 or 12-18 hours, e.g., for 16 hours.

[0066] For the DA progenitor induction / maturation stage (day 12+), cells can be maintained for approximately 12-15 days in DMEM:F12 medium supplemented with N2, BDNF (e.g., 20 ng / ml), GDNF (e.g., 20 ng / ml), dbcAMP (e.g., 500 μM), ascorbic acid (e.g., 200 μM), TGF-β3 (e.g., 10 ng / ml), along with a gamma secretase inhibitor (e.g., DAPT, e.g., 10 μM), and a Wnt agonist (e.g., CHIR99021, e.g., 1 μM).

[0067] On about day 15, the cells in the spot may be harvested and dissociated, for example, chemically, enzymatically, or mechanically, using, for example, EDTA, and the single cell suspension may be reseeded, for example, in a poly-L-ornithine / fibronectin / laminin-coated (PLO / FN / L-coated) dish. On day 15, a medium such as N2, DMEM:F12 with growth factors including BDNF (e.g., 20 ng / ml), GDNF (e.g., 20 ng / ml), dbcAMP (e.g., 500 μM), ascorbic acid (e.g., 200 μM), and TGF-β3 (e.g., 10 ng / ml), may be applied. A ROCK inhibitor, for example, Y-27632 (e.g., 10 μM), may be added on the day of dissociation and then removed. The cells can then be maintained in culture until induction of mDA precursor cells (mDAP) and / or mDA neurons (mDAN), e.g., for at least 21-28 days, sufficient for expression of mDAP markers (e.g., OTX2, LMX1A, and EN1) and / or mDAN markers (e.g., TH, DAT, and PITX3).

[0068] Those skilled in the art will appreciate that other reagents and concentrations may also be used. For example, SHH agonists include purmorphamine, oxysterols, and Smoothened agonist (SAG); a number of Wnt agonists are presented in Table A.

[0069] [Table 4-1]

[0070] [Table 4-2]

[0071] Other gamma secretase inhibitors include RO4929097; DAPT (N-[(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl ester); L-685458 ((5S)-(t-butoxycarbonylamino)-6-phenyl-(4R)hydroxy-(2R)benzylhexanoyl)-L-leu-L-phe-amide); BMS-708163 (avagacestat); BMS-299897 (2-[(1R)-1-[[(4-chlorophenyl)sulfonyl](2,5-difluorophenyl)amino]ethyl-5-fluorobenzenebutyrate); MK-0752; YO-01027; MDL28170 (Sigma); LY411575 (N-2((2S)-2-(3,5- (difluorophenyl)-2-hydroxyethanoyl)-N1-((7S)-5-methyl-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-l-alaninamide, see U.S. Pat. No. 6,541,466; ELN-46719 (2-hydroxy-valeric acid amide analog of LY411575, where LY411575 is 3,5-difluoro-mandelic acid amide) (U.S. Pat. No. 6,541,466); PF-03084014 ((S)-2-((S)-5,7-difluoro-1,2,3,4-tetrahydronaphthalen-3-ylamino)-N-(1-(2-methyl-1-(neopentylamino)propan-2-yl)-1H-imidazol-4-yl)pentanamide, Samon et al., Mol Cancer Ther 2012;11:1565-1575; Compound E ((2S)-2-{[(3,5-difluorophenyl)acetyl]amino}-N-[(3S)-1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-1,4-benzodiazepin-3-yl]propanamide; WO 98 / 28268; and Samon et al., Mol Cancer Ther 2012;11:1565-1575); and semagacestat (LY450139; (2S)-2-hydroxy-3-methyl-N-((1S)-1-methyl-2-{[(1S)-3-methyl-2-oxo-2,3,4,5-tetrahydro-1H-3-benzazepin-1-yl]amino}-2-oxoethyl)butanamide), or a pharmaceutically acceptable salt thereof.

[0072] Also provided herein are cells, eg, mDAP or mDAN cells, produced by the methods described herein, and compositions comprising the cells.

[0073] Although the present method is exemplified for the differentiation of iPSCs into dopaminergic neurons, the spotting method can also be used in differentiation protocols for other cell types, including other neuronal types. Numerous neuronal differentiation protocols are known in the art; see, e.g., Salimi et al., Mol Biol Rep. 2014 Mar;41(3):1713-21; Gunhnlar et al., Molecular Psychiatry 23:1336-1344 (2018); Trilck et al., Methods Mol Biol. 2016;1353:233-59; Zhang et al., Stem Cell Res Ther. 2018 Mar 15;9(1):67; D'Aiuto et al., Organogenesis. 2014;10(4):365-77; Marton and Ioannidis, Stem Cells Translational Medicine 2019;8:366-374; Bell et al. Bio-protocol 9(5): e3188 (2019). DOI: 10.21769 / BioProtoc.3188; Bianchi et al., Stem Cell Research 32:126-134 (2018).

[0074] Treatment The mDAPs and mDANs produced using the methods described herein may be used, for example, as cell models and can be used to treat subjects with Parkinson's disease (PD) (or at risk of developing PD). Such subjects can be identified by those skilled in the art of medical care delivery using methods known in the art. The methods can include obtaining primary somatic cells; generating a cell population comprising mDAPs; and administering the cells. Preferably, the primary somatic cells are obtained from a subject to be treated who has PD (or is at risk of developing PD), although in some embodiments, the cells are preferably obtained from a different subject, preferably an immunologically matched subject, of the same species as the subject to be treated (i.e., autologous cells). Preferably, the methods described herein produce sufficient mDAPs to create a population that includes cells expressing one, two, or more mDAP markers (e.g., FOXA2, OTX2, LMX1A, and EN1, e.g., FOXA2 and LMX1A; optionally, TH+ cells co-expressing FOXA2, LMX1A, and NURR1), and optionally includes cells expressing one, two, or more mDAN markers (e.g., TH, DAT, and PITX3), but does not include cells expressing SOX1, PAX6, and KI67.

[0075] Cells are administered by methods known in the art.In some embodiments, cells are administered by implanting directly into or near the affected region of the brain of the subject, for example, by using magnetic resonance imaging-guided stereotaxic surgery, into one or more of the caudate nucleus, putamen, and substantia nigra bilaterally.For example, see Garitaonandia et al., Stem Cells Dev.2018 Jul 15;27(14):951-957;Kikuchi et al., Nature 548: 592-596 (31 August 2017);MOrizane et al., Nature Communications 8:385 (2017);Sonntag et al., Prog Neurobiol.2018 Sep;168:1-20.

[0076] Culture dish Also provided herein are culture dishes for use in the methods described herein. The dish has a grid on the bottom, with the distance between grid lines being 1.5 to 2.5 cm, e.g., an approximately 2 cm, e.g., 2 x 2 cm, grid. The grid can be formed as part of the dish, e.g., printed or etched into the bottom. The culture dish can be fabricated using methods known in the art, e.g., conventional injection molding or thermoforming, and any material acceptable for culture dishes, e.g., thermoplastic resins made from polystyrene, polyethylene, polypropylene, polycarbonate, and polyvinyl. Another suitable material is glass. In some embodiments, the dish has a substantially flat bottom; alternatively, at the intersections of the grid lines, there can be circular or oval depressions or indentations, e.g., about 2 to 10 mm, e.g., about 3 to 7 mm, e.g., about 5 mm, in diameter. The indentations can be, e.g., 0.01 to 0.2 mm deep. In some embodiments, the dish comprises a biological matrix hydrogel support, ie, a basement membrane extract, or a synthetic matrix.

[0077] In some embodiments, the gridded culture dish is a 10 or 6 cm round culture dish with 12 or 6 intersections, respectively, for seeding cells. The distance between cell placement areas (from the center of a spot to the center of an adjacent spot) is 2 cm, and the diameter of a cell spot is 0.5 cm. The perimeter is approximately 1.57 cm, and the area is approximately 0.2 cm. 2 Thus, for a 6 cm dish there are only 6 possible spots at the intersections of the grid lines, and for a 10 cm dish there are 12 possible spots. [Example]

[0078] The invention is further described in the following examples, which do not limit the scope of the invention, as claimed.

[0079] material and method In the examples below, the following materials and methods were used:

[0080] The antibodies and reagents used are shown in Table B.

[0081] [Table 5-1]

[0082] [Table 5-2]

[0083] [Table 5-3]

[0084] [Table 5-4]

[0085] biopsy Skin biopsies (Table C) were taken from three healthy subjects and one sporadic PD patient under an IRB-approved protocol (IRB partner number: 2010P001100).

[0086] [Table 6]

[0087] experimental animals The strain details and number of animals within each group are as follows: Athymic rats (NTac:NIH-Foxn1) lesioned with 6-hydroxydopamine rnu , Taconic Biosciences), male, 12-14 weeks old. Athymic rats (Crl: NIH-Foxn1 rnu , Charles River stock code number: 316), male, 12-14 weeks old. NOD-SCID (NOD.CB17-Prkdc scid / NCrCrl, Charles River stock code number: 394), male or female, 8-10 weeks old. All animals were housed in ventilated cages under a 12-hour light / dark cycle with sterile food and water available ad libitum.

[0088] cell culture Human BJ dermal fibroblasts (hDF) and HEK293T cells were purchased from ATCC and grown according to previously published protocols (19). To induce hiPSCs, infected cells were maintained in induction medium containing DMEM / F-12, 2 mM L-glutamine, 10% FBS, 1× NEAA, 1 mM NAM, 25 mM NaB, and 50 μg / ml AA for 5 days after transfection, and then in hiPSC medium containing DMEM / F-12, 2 mM L-glutamine, 20% KSR, 1× NEAA, 1 mM NAM, 25 mM NaB, and 10 ng / ml bFGF. The H9 hESC cell line was obtained from WiCell Institute. All hiPSC cell lines were maintained in Essential 8 medium using a Matrigel matrix and subcultured using 0.5 mM EDTA solution for gentle dissociation. All hESC cell lines were maintained in mTeSR™1 medium using a Matrigel matrix. The cell lines used in this study were not found in the databases of commonly misidentified cell lines maintained by ICLAC and NCBI Biosample. All cell lines were authenticated by the supplier via interspecies determination (isoenzyme analysis and STR analysis) and routinely tested for mycoplasma detection.

[0089] Generation of human iPSCs To generate hiPSCs using lentivirus, cells were transduced overnight with individual lentiviral vectors containing Y4 factors (OCT4, SOX2, KLF4, and c-MYC; kindly provided by Dr. Gustavo Mostoslavsky) and / or miRNAs, or with lentiviral particles derived from the polycistronic STEMCCA vector. The following day, the medium was replaced with induction medium, and the cells were incubated for 5 days. On day 6, the cells were fed with hiPSC medium and maintained in this medium until ES-like colonies formed. Observed ESC-like colonies were manually picked and transferred to Essential 8 medium on Matrigel-coated tissue culture plates to generate hiPSC cell lines.

[0090] To generate hiPSCs using an episomal system, cells were electroporated with pCXLE vectors expressing reprogramming factors using the Neon transfection system and then seeded onto Matrigel-coated 6-well plates in hDF medium supplemented with 10 μM Y-27632. The next day, cells were fed with induction medium for an additional 5 days.

[0091] Plasmid construction and lentivirus production The coding sequences of individual miRNAs (miR-17 / 92, miR-106a, miR-106b, miR-200c, miR-302s, miR-369s, and miR-371 / 373) were PCR amplified from H9 hESCs, cloned into the pGEM-T Easy vector, and their identities were confirmed by sequencing.The miRNA coding sequences were then introduced into the EcoRI site of the FUW-tetO vector. For polycistronic episomal vectors expressing OCT4, KLF4, SOX2, and L-MYC, the coding sequences of human Oct4 linked to the foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to the porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC were PCR-amplified from H9 hESCs and then sequentially introduced into a modified pCXLE episomal vector lacking the EGFP sequence.For episomal vectors expressing miR-302s and / or miR-200c, the coding sequences of human miR-302s or human miR-200c were introduced into the modified pCXLE vector.

[0092] Lentivirus production was performed as previously described (Cha et al., 2017. Nat Cell Biol 19:445-456) with slight modifications. Briefly, 293T cells were co-transfected with the lentiviral vector along with packaging plasmids containing pMD2.G and psPAX2 using PolyJet transfection reagent according to the manufacturer's instructions and maintained in DMEM supplemented with 10% FBS. The lentivirus-containing supernatant was collected 48 hours after transfection and filtered through a 0.45 μm Millex-HV (Millipore) filter to remove cell debris.

[0093] hiPSC formation assay For TRA-1-60 staining, cells were fixed with 4% formaldehyde for 5 minutes, washed with PBS, and then incubated with anti-TRA-1-60 antibody (1:500) overnight at 4°C. After washing three times with PBS, cells were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:500) for 1 hour. After washing three times with 0.1% Triton X-100 in PBS, cells were stained with 3,3'-diaminobenzidine (DAB) according to the manufacturer's instructions. For AP staining, fixed cells were washed with PBS and then stained with alkaline phosphatase substrate NBT / BCIP solution, followed by three washes with PBS to stop the reaction.

[0094] Live cell metabolic analysis Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an XFp analyzer (Agilent Technologies) according to the manufacturer's instructions. Briefly, cells were seeded into wells of an XF mini-plate and incubated overnight at 37°C in a CO2 incubator. Assays were performed after cells were equilibrated for 1 hour in a non-CO2 incubator in XF assay medium supplemented with 10 mM glucose, 5 mM sodium pyruvate, and 2 mM L-glutamine. Mitochondrial activity of hDFs was monitored via sequential injections of 1 μM oligomycin (Oligo), 2 μM FCCP, and 0.5 μM antimycin A / rotenone (Anti / Rot) to calculate basal respiration (= baseline OCR - Anti / Rot OCR), ATP turnover (= basal respiration - Oligo OCR), maximal respiration (= FCCP OCR - Anti / Rot OCR), and oxidative reserve capacity (= maximal respiration - basal respiration). Using a Bradford protein assay, plotted values ​​were normalized to the total protein quantified.

[0095] Quantitative RT-PCR To extract total RNA, cells were lysed with Trizol and RNA was isolated according to the manufacturer's recommendations. RNA concentration was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies). RNA was reverse transcribed with an oligo-dT primer using Superscript II. For real-time quantitative RT-PCR, we performed reactions on a CFX Connect Real-Time System (Bio-Rad) using SsoAdvanced Universal SYBR Green Supermix. PCR amplification was performed using gene-specific primers (Table D). Target gene expression was determined by normalization to endogenous actin via the Ct comparison method.

[0096] [Table 7-1]

[0097] [Table 7-2]

[0098] [Table 7-3]

[0099] [Table 7-4]

[0100] Karyotype analysis To assess human iPS cell chromosome number and structure, human iPS cells were sent to Cell Line Genetics, Inc. (Madison, WI) for standard G-banded karyotype analysis.

[0101] Detection of episomal plasmids Cytosolic plasmids were isolated using the Thermo Scientific Gene JET Plasmid Miniprep Kit to detect the presence of unintegrated residual vector. 2 μl of each 20 μl extract was used for conventional PCR amplification with EBNA-1-specific primers at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds for 30 cycles. Genomic DNA was prepared using the DNeasy Blood & Tissue Kit from Qiagen. To detect plasmid-derived sequences, we used the same PCR conditions and EBNA-1 primers. GAPDH primers were used as input controls. The primer sequences for EBNA-1 and GAPDH are listed in Table D.

[0102] DNA fingerprinting Genomic DNA was extracted from cells using the QIAamp DNA FFPE Tissue kit, and PCR was performed using standard buffer conditions, 0.2 μg of DNA, and GoTaq DNA polymerase in a total volume of 20 μl, with 35 cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and extension at 72° C. for 1 minute. Primers used in this study are listed in Table D.

[0103] Whole-exome sequencing To identify somatic mutations resulting from fibroblast reprogramming and passaging of reprogrammed iPSCs, we performed WES on fibroblasts and four iPSC cell lines using the Personalis ACE WES service, which provides extended coverage for >8,000 medically relevant genes, including >1,400 cancer-related genes (Patwardhan et al. 2015. Genome Med 7:71). The average depth of coverage for the target regions was 75x across all samples. For the four iPSC cell lines, we performed paired analyses using MuTect2 to detect somatic mutations on fibroblasts and each iPSC cell line (Cibulskis et al., 2013. Nat Biotechnol 31:213-219).

[0104] Sequencing reads were aligned to the GRCh38 reference genome, including alternative contigs and decoys, using the BWA-MEM program (version 0.7.15) (Li and Durbin, 2010. Bioinformatics 26:589-595). Mapped reads were further processed using SAM tools (version 1.3.1) (Li et al., 2009. Bioinformatics 25:2078-2079), Picard tools (broadinstitute.github.io / picard, version 2.5.0), and the Genome Analysis Toolkit (GATK) software (version 3.6) (DePristo et al., 2011. Nat Genet 43:491-498) to generate analysis-ready BAM files. Each iPSC cell line was analyzed for somatic mutations compared to fibroblasts using the MuTect2 module in GATK (Cibulskis et al., supra). Ensembl Variant Effect Predictor (version GRCh38.89) (McLaren et al., 2016. Genome Biol 17:122) was used to annotate the identified somatic mutations and examine their consequences on gene transcription and protein products. To reduce false-positive somatic mutation calls, we considered only mutations found within regions sufficiently covered by 20 or more high-quality effective aligned reads across all samples to be somatic mutations. Among the candidate somatic mutations, we filtered for potential germline variants by excluding mutations with a maximum minor allele frequency >0.01% in the Exome Aggregation Consortium (ExAC) database (Lek et al. 2016. Nature 536:285-291).For the remaining somatic mutation candidates, we searched the Catalogue of Somatic Mutations in Cancer (COSMIC) (cancer.sanger.ac.uk, version 80) (Forbes et al. 2017. Nucleic Acids Res 45:D777-D783) and the Cancer Gene Census (CGC) database (Futreal et al. 2004. Nat Rev Cancer 4:177-183) to identify frequently reported mutations and genes in cancer. Using copy number variation (CNV) analysis by ngCGH (github.com / seandavi / ngCGH, version 0.4.4) and the Personalis ACE Cancer Exome Pipeline (Personalis, Inc., CA), we investigated chromosomal aberrations and other interregional copy number changes. The present inventors visually inspected all CNV candidates for read alignment using Integrated Genome Viewer (version 2.3.79).

[0105] Quercetin treatment To investigate the effect of quercetin on human iPSC harvest, human iPSCs were seeded onto 6-well plates. Cells were treated with various concentrations of quercetin (5, 10, 20, 40, and 100 μM) for 2, 6, 16, and 24 hours. After each time point, the quercetin-containing medium was replaced with fresh medium, and the cells were cultured for 48 hours from the initial quercetin treatment time. Cells were dissociated using TrypLE, and cell viability was measured using trypan blue exclusion and a hemocytometer.

[0106] Flow cytometry All FACS analyses were performed using a BD Accuri C6 system (BD Bioscience), and data analysis was performed according to the manufacturer's instructions. Human iPS cells were dissociated using TrypLE or Accutase, respectively, and filtered through a 70 μm cell strainer. Single-cell suspensions were first fixed with 4% formaldehyde for 10 minutes and then suspended in permeabilization buffer on ice for 15 minutes. After blocking for 30 minutes, cells were incubated with labeled primary antibodies (PE-conjugated anti-SSEA-4, PE-conjugated anti-TRA-1-60) for 1 hour on ice in the dark. After washing with PBS containing 1% FBS, FACS analysis was performed. Fluorochrome-matched isotype controls were used and subtracted during analysis.

[0107] For cell loss / yield analysis, supernatants were collected from monolayer-based or spotting-based culture dishes and subjected to FACS. The number of particles in 100 μl of supernatant was calculated, and the total cell number was obtained based on the ratio of 100 μl to the total supernatant volume.

[0108] Detection of the presence of undifferentiated cells Using three different methods, a mixture of undifferentiated C4 cells was diluted 10-fold (10 5 , 10 4 , 10 3 , 10 2 , 10 1 , and 10 0Residual C4 cells were detected by serial dilution in 1:1 hDF (1:1). For colony formation assays, each cell dilution was cultured in E8 medium for 6 days, and pluripotent colonies were identified by AP staining. For quercetin-induced undifferentiated cell collection, cells were treated with 40 μM quercetin for 16 hours and cultured in fresh E8 medium. For fluorescence-activated cell sorting (FACS), C4 cells were dissociated using TrypLE and filtered through a 70 μm cell strainer. Single-cell suspensions were first fixed with 4% formaldehyde for 10 minutes and suspended in permeabilization buffer on ice for 15 minutes. After blocking for 30 minutes, cells were incubated with labeled primary antibodies (PE-conjugated anti-SSEA-4, PE-conjugated anti-TRA-1-60) for 1 hour on ice in the dark. After washing with PBS containing 1% FBS, FACS analysis was performed using a BD Accuri C6 system (BD Bioscience), and data analysis was performed according to the manufacturer's instructions. Fluorochrome-matched isotype controls were used and subtracted during analysis. For qRT-PCR assays, total RNA was extracted from all dilutions and subjected to qRT-PCR to determine the cycle time (Ct) values ​​of OCT4. OCT4 copy number was calculated from the curve equation generated from qRT-PCR of a partial sequence of purified OCT4. OCT4 copy number was then plotted against PSC number.

[0109] Preparation of spot-type dishes As shown in Figure 13B, a grid consisting of two horizontal lines and three vertical lines was drawn on the bottom of a 6 cm dish, resulting in six intersections. 10 μl of unheated Matrigel was loaded at each intersection, resulting in a defined spot-coated area. The spotted dishes were incubated at 37°C for at least 30 minutes, and the Matrigel was aspirated immediately before seeding the cells. Uniformly suspended cells were plated in a 60 mm cell culture dish at a density of 730 × 10 cells per dish. 3In contrast to the usual seeding conditions, the spotted dish was seeded at a density of 40 × 10 cells per 10 μl spot. 3 10 x 10 cells per 10 μl spot 3 2.5 x 10 cells per 10 μl spot 3 The specimens were then spotted (spotting condition).

[0110] Differentiation of mDA progenitor cells The differentiation medium conditions and all morphogen factors are shown in Figure 5A. No antibiotics were used throughout the differentiation procedure. For the floor plate induction stage (days 1–6), we used DMEM medium with 15% KSR, glutamine, and β-mercaptoethanol. For the neural progenitor cell induction stage (days 6–12), we used DMEM medium with 11.5% KSR, 0.25% N2 (days 6–8), 7.5% KSR, 0.5% N2 (days 8–10), and 3.75% KSR, L-glutamine, β-mercaptoethanol, and 0.75% N2 containing non-essential amino acids (NEAAs) (days 10–12). Dual Smad inhibitors, LDN193189 (0.2 μM) and SB431542 (10 μM), were added on days 1 to 12 and 1 to 8, respectively. From days 2 to 10, cells were treated with SHH agonists (purmorphamine (2 μM) and Shh (100 ng / ml)) along with 100 ng / ml FGF8. CHIR99021 (1 μM), a Wnt signaling activator, was added on days 4 to 12. On day 9, cells were treated with quercetin (40 μM) for 16 hours. For the DA progenitor induction / maturation stage (day 12+), DMEM:F12 medium was supplemented with N2 supplement (20 ng / ml BDNF, 20 ng / ml GDNF, 500 μM dbcAMP, 200 μM ascorbic acid, 10 ng / ml TGF-β3), 10 μM DAPT, and 1 μM CHIR (days 12–15). On day 15, cells were dissociated with 0.5 mM EDTA, and single-cell suspensions were replated at approximately 2.5 million cells per dish onto poly-L-ornithine / fibronectin / laminin-coated dishes. From day 15 onwards, N2 supplements (20 ng / ml BDNF, 20 ng / ml GDNF, 500 μM dbcAMP, 200 μM ascorbic acid, and 10 ng / ml TGF-β3) were added to the DMEM:F12 medium. At the time of harvest, 10 μM Y-27632 was added to the medium.

[0111] immunocytochemistry hiPSC-derived dopaminergic neurons were cultured in phosphate-buffered saline (PBS) (Ca 2+ and Mg 2+ ), and fixed with 4% formaldehyde in PBS (pH 7.4) for 10 minutes. Cells were incubated in blocking solution (0.3% Triton X-100 and 1% horse serum in PBS) for 1 hour at room temperature. Cells were incubated overnight with primary antibodies in PBS containing 0.3% Triton X-100 and 1% horse serum. Cells were then incubated with the appropriate fluorescently conjugated secondary antibodies, along with Hoechst 33342 for nuclear staining, for 1 hour at room temperature. Cell images were obtained by confocal microscopy (Keyence Corporation, Osaka, Japan). Data regarding specific cell populations were determined from the microscopic images using ImageJ software (11). To measure apoptotic cells, cells were stained for the apoptosis marker cleaved caspase 3 and the DNA-binding nuclear dye Hoechst 33342. After staining with Hoechst 33342, compacted chromatin was brighter than normal cells, and condensed nuclei were counted by fluorescence microscopy. Data on specific cell populations were determined from microscopic images using ImageJ software.

[0112] High-performance liquid chromatography (HPLC) analysis On day 47 of differentiation, the supernatant was collected and centrifuged at 300 × g for 5 minutes to remove cell debris. Samples were immediately stored at -80 °C and sent to Emory University's HPLC Bioanalytical Core for reverse-phase HPLC with electrochemical detection to determine DA and DOPAC levels. Briefly, the supernatant was transferred to a microcentrifuge tube equipped with a fresh 0.22 μM PVDF filter. Any remaining particulate matter was removed by filtration through a spin filter at 5000 rpm for 5 minutes at 4 °C. Monoamine concentrations were determined by reverse-phase HPLC with electrochemical detection. For HPLC, an ESA 5600A CoulArray detection system equipped with an ESA 584 pump and an ESA 542 refrigerated autosampler was used. Separation was performed at 25 °C using an MD-150 × 3.2 mm C18 column equipped with a C18 column guard cartridge. The mobile phase consisted of 1.5 mM sodium 1-octanesulfonate, 75 mM NaH2PO4, 0.025% triethylamine, and 8% acetonitrile at pH 2.95. A sample volume of 25 μl was injected. Samples were eluted isocratically at 0.4 mL / min and detected using a Model 6210 electrochemical cell (ESA, Bedford, MA) equipped with a Model 5020 guard cell. The guard cell potential was set at 500 mV, while the analysis cell potentials were set at -175, 200, 350, and 425 mV. Analytes were identified by matching retention time criteria with known standards (Sigma Chemicals Co., St. Louis, MO). Compounds were quantified by comparing peak areas with those of the standards on the dominant sensor.

[0113] electrophysiology For electrophysiological recordings, day 70 dopaminergic cells were placed in a recording chamber and continuously perfused at a rate of 1.2 ml / min with artificial cerebrospinal fluid (CSF) consisting of 130 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl, 1 mM MgSO, 1.25 mM NaHPO, 26 mM NaHCO, and 10 mM glucose, continuously bubbled with 95% O and 5% CO. Whole-cell patch-clamp recordings were performed at room temperature (22 ± 1.0 °C) using an EPC9 amplifier and Pulse v8.80 software (HEKA Elektronik). Recording electrodes (5–6 MΩ resistance) were filled with a pipette solution containing 150 mM potassium gluconate, 5 mM NaCl, 1 mM MgCl2, 0.2 mM EGTA, 10 mM HEPES, 2 mM Mg-ATP, and 0.5 mM Na-GTP (292 mOsm, pH adjusted to 7.3 with KOH). The potassium gluconate-based pipette solution was used to compensate for a liquid junction potential of 15.1 mV. Action potential firing was recorded at a resting membrane potential in current-clamp mode. Series (access) resistance was not compensated for and was continuously monitored. Spontaneous synaptic events were analyzed offline using Mini Analysis v6.0.7 (Synaptosoft) and Clampfit 8.2 (Molecular Devices) programs. Voltage-gated sodium channels were blocked with 1 μM tetrodotoxin (TTX). Neurobiotin (0.2%) was incorporated into the intrapipette solution, and the recorded cells were fixed in 4% formaldehyde at 4°C and co-stained with TH antibody.

[0114] Multi-electrode array (MEA) recording A 24-well microelectrode array (MEA) plate (Axion Biosystems) was precoated with poly-L-ornithine (0.0015%), fibronectin (1 μg / ml), and laminin (1 μg / ml) overnight at 37°C in a CO2 incubator. The next day, C4-derived D28 cells were seeded onto the precoated MEA plate at 20,000 cells per well and generated according to the same schedule described above. The D28 cells were maintained in a humidified incubator with 5% CO2 at 37°C for 2 days to allow proper attachment before electrophysiological recordings were initiated. A 60% medium change was performed every other day. Before and after compound treatment, extracellular recordings of spontaneous action potentials were performed in culture medium at 37°C using a Maestro MEA system and AxIS software (Axion Biosystems). The MEA platform was configured with 324 channels and formatted with 16 electrodes per well in a 4 x 4 grid when using 24-well plates. Approximately 20,000 cells were seeded onto the electrode grid within each well. Using AxIS Navigator 1.5.1 software, baseline and post-treatment raw data files (*.raw) were converted to spike files (*.spk) and Excel files (*.csv). Converting to these file formats allowed for further processing and analysis of the data. For mDA neurons, measurements of neural spikes within the AxIS software were set within the high-pass range of 200 Hz to low-pass range of 3,000 Hz. The threshold for spike detection was set to six times the rolling standard deviation of the filtered field potential on each electrode. Five minutes of recording was used to calculate the average spike count and the number of active electrodes ("active electrodes") in each well. Active electrodes were defined as those with a spike rate of ≥ 5 spikes per minute.

[0115] To verify both the robustness of activity and the quality and consistency of well activity, spike train raster plots were examined using the Neural Metric Tool from Axion BioSystems. These raster plot visualizations were also used to aid in the interpretation of processed data. Wells with no spike activity, sparse spike activity, or little or no bursting or network synchronization were excluded from the experiment. Before recording began, plates were allowed to equilibrate on the system for at least 2 minutes. To isolate spontaneous dopaminergic neuronal activity, cells were treated with a combination of the GABAergic antagonist picrotoxin; the AMPA receptor antagonist NBQX; and the NMDAR antagonist AP5, all at a concentration of 10 μM in 500 μl of medium per well. After addition of the blocking agents, both the average spike count and the average electrode count were calculated. Recording and analysis were performed as described above. The mean spike counts and mean active electrode counts were compared between the control and treatment groups using t-tests.

[0116] Cell preparation and cryopreservation for transplantation C4-derived D28 cells were rinsed twice with DPBS and then treated with Accutase at 37°C for 5 minutes. Cells were harvested using DMEM:F12 medium supplemented with N2 supplements: 20 ng / ml BDNF, 20 ng / ml GDNF, 500 μM dbcAMP, 200 μM ascorbic acid, 10 ng / ml TGF-β3, and 10 μM Y-27632. After centrifugation at 300 × g for 3 minutes, the cell pellet was suspended in transplantation medium (DMEM / F-12 (without phenol red), 20 ng / ml BDNF, 20 ng / ml GDNF, 10 μM Y-27632, 20 mM Boc-D-FMK). The cell suspension was passed through a 70 μm strainer to remove large cell clumps. Cell concentration was calculated by trypan blue exclusion using a hemocytometer. The final cell product consisted of 50,000 or 100,000 cells per μl in transplantation medium. For cryopreservation, the cell pellet was suspended in CryoStor® CS10 cryopreservation medium. The cells in the cryovial were placed in a Mr. Frosty™ Freezing Container (Nalgene) for controlled freezing at −80° C. The frozen cells were then introduced into liquid nitrogen. After one week, the frozen cells were thawed for transplantation.

[0117] Surgical procedure Animals were anesthetized with isoflurane using a SomnoSuite Anesthesia System (Kent Scientific Corporation, Torrington, CT). Stereotaxic surgery was performed on a stereotaxic apparatus (David KOPF Instruments, Tujunga, CA) equipped with a Micro4 controller (World Precision Instruments, Sarasota, FL).

[0118] Unilateral lesions of the nigrostriatal pathway were established in Charles River athymic rats by stereotaxic injection of 6-hydroxydopamine into the medial forebrain bundle. Fifteen minutes before anesthesia, rats were injected with desipramine (10 mg / kg) to protect noradrenergic projections. Two microliters of 6-hydroxydopamine (7.5 mg / ml in 0.2% ascorbic acid / 0.9% saline) were injected using a 2.5 μl Hamilton syringe (Hamilton Company, Reno, NV). Coordinates were calculated relative to the following: anterior-posterior axis (AP), -4.0; medial-lateral axis (ML), -1.3; and dorsoventral axis (DV), -7.0 (Torres et al., 2011. J Neurosci Methods 200:29-35). For intrastriatal transplantation of H9- or C4-derived D28 cells, one 2 μl deposit (50,000 cells per μl) was placed at the following coordinates: AP, +0.8; ML, −3.0; and DV, −5.5. Cells were injected at a rate of 0.4 μl / min with a 10 μl Hamilton syringe fitted with a 26G, 0.75-inch blunt needle. For Taconic athymic rats, C4 D28 cells were suspended at a concentration of 100,000 cells per μl. For the 100,000-cell group, 1 microliter of cells was injected at AP, +0.8; ML, −3.0; and DV, −5.5. For the 300,000-cell group, two 1.5 μl deposits were placed at the following coordinates: AP, +0.8; ML, −3.0; and DV, −5.0 and DV, −6.0. Control rats received only implantation medium injections. For intrastriatal injections into NOD SCID mice, one 2 μl deposit (50,000 cells per μl) of C4 D0, C4 D14, or C4 D28 cells was injected intrastriatally bilaterally according to the following coordinates (in mm) relative to the bregma: AP: +0.5; ML: ±1.8; DV: −3.2.

[0119] After injection, the needle was kept in the brain for 5 minutes, and then slowly withdrawn for 5 minutes. After surgery, the incised skin was sutured with Autoclip® Surgical Suture (Fine science tool, Foster City, CA), and the animals were monitored on a heating pad until recovery. All animals were subcutaneously injected with ketoprofen (5 mg / kg; Ketofen, Santa Cruz, SC-363115Rx) to relieve pain, and 1 ml of 0.9% sodium chloride was intraperitoneally injected to prevent dehydration.

[0120] For intratesticular injection into NOD SCID mice, a 1 cm longitudinal incision was made through the skin and peritoneum, and the testes were placed on sterile gauze. 10 μl (5,000 cells per μl) of C4 iPSCs was slowly injected into the center of the seminal vesicles through any large blood vessel. The needle was slowly removed to avoid backflow of cells. The testes and adipose tissue were returned to their original positions in the abdomen.

[0121] D-amphetamine-induced rotational behavior test D-amphetamine, a presynaptic (indirect) DA agonist, was administered intraperitoneally (4 mg / kg) to induce rotational behavior in rats successfully lesioned with 6-hydroxydopamine. Rotational bias was recorded using an automated system (SD Instruments, San Diego, CA). Rats were recorded for 90 min (9 segments; 10 min per segment). Only complete trunk rotations were counted, and rotations toward the lesioned side were given a positive value and expressed as net rotations per minute. Only animals showing more than six ipsilateral rotations per minute were considered successfully lesioned (Kirkeby et al. 2012. Cell Rep 1:703-714).

[0122] Corridor Test To measure non-pharmacological behavioral improvement, we used the corridor test (Dowd et al. 2005. Brain Res Bull 68:24-30). First, rats were habituated to a corridor containing scattered sugar pellets for 10 min each over two days to reduce exploratory behavior during testing. The next day, rats were placed at the end of a corridor containing 10 pairs of cups filled with 5–10 sugar pellets spaced at regular intervals along the floor. Animals were allowed to freely explore the corridor. An investigator blinded to the group counted acquisition attempts directly. An "acquisition attempt" was defined as a rat inserting its nose into a unique cup each time. All rats were examined until 20 acquisition attempts were made or the duration of the test reached 5 min. Prior to testing, all rats were placed in an empty corridor for 5 min to allow them to acclimate to the unfamiliar environment. Rats were food restricted the day before and throughout the 4-day test. Results were calculated as the mean number of contralateral (right) acquisitions and presented as the number of acquisitions relative to the total number of acquisitions. Testing was performed every 4 weeks until 24 weeks after implantation.

[0123] Cylinder Test To measure forelimb asymmetry in exploratory behavior, rats were assessed using the cylinder task (Bjorklund et al. 2010. Brain 133:496-511), in which rats were placed in a glass cylinder (20 cm diameter) and their forepaw contacts with the wall were recorded up to 30 times. The investigator, blinded to the group, performed the assessment. Results were calculated as the mean number of contacts using the right (contralateral) forepaw and presented as a percentage of the mean total number of contacts. Testing was performed 24 weeks after implantation.

[0124] Stepping Test To measure forelimb akinesia, rats were assessed using the side-stepping test (Olsson et al. 1995. J Neurosci 15:3863-3875), in which coordinated forelimb steps are quantified over a 90 cm length. Steps were counted by an investigator blinded to the group. Results were calculated as the mean number of right (contralateral) forelimb steps and presented as a percentage of the mean number of left forelimb steps. Testing was performed 24 weeks after implantation.

[0125] Biodistribution analysis To verify the presence of transplanted human cells, we used a RT-PCR method specific for amplifying human-specific genes. First, DNA was extracted from 15 mg of mouse tissues (a mixture of olfactory bulb and cerebellum, spinal cord, lung, heart, liver, kidney, and spleen) using the QIAamp DNA FFPE Tissue Kit according to the manufacturer's instructions. The concentration of the extracted DNA was measured using a Nanodrop ND-1000 spectrophotometer, and 100 ng of DNA was used for real-time RT-PCR reactions. The human-specific primer sequences were as follows: forward 5'-ATTGCCCCAAAACTTTTTTG-3' (SEQ ID NO: 106) and reverse 5'-TTGAAGACCAGTCTGGGAAG-3'. Endogenous mouse genes were detected using the following primers: forward 5'-CCACATCTCCCTCCAGAAAA-3' (SEQ ID NO: 107) and reverse 5'-AGGGTCTGGGCCATAGAACT-3' (SEQ ID NO: 108).

[0126] Brain sectioning and immunohistochemistry Deep anesthesia was induced by intraperitoneal injection of ketamine (75 mg / kg) / xylazine (7.5 mg / kg), followed by intracardiac perfusion with ice-cold phosphate-buffered saline (PBS; 0.01 M, pH 7.4) for 8 minutes, followed by perfusion with 4% formaldehyde at a flow rate of 10 ml / min for 20 minutes. Brains were then removed and fixed overnight in 4% formaldehyde at 4°C. They were then cryopreserved by sequential incubation in 20% and 30% sucrose. Brains were embedded in optimal cutting temperature (OCT) compound, and coronal sections (30 μm) covering the entire striatum were sequentially collected (Leica CM1950, Buffalo Grove, IL). Brain slices were incubated with PBS containing 30% H2O2 for 30 minutes, then incubated overnight with rabbit anti-TH antibody (1:5000), mouse anti-hNCAM antibody (1:1000), and mouse anti-hNuc (1:1000). After rinsing, the samples were stained with biotinylated secondary antibodies (Vector Labs) for 1 hour. Finally, sections were visualized using the Vectastain Elite ABC kit and DAB peroxidase substrate kit according to the manufacturer's protocol. TH in the grafts was visualized using the Vectastain Elite ABC kit and DAB peroxidase substrate kit according to the manufacturer's protocol. + To count neurons, a Stereo Investigator optical fractionator probe (MBF Bioscience, Williston, VT) was used under a 63x oil immersion lens with a 50 x 50 μm counting frame and a grid size of 200 x 200 μm. Final counts were corrected for series (1:6) to obtain an estimate of the total number of TH-positive neurons per animal brain.

[0127] Vimentin immunohistochemistry was performed by the Rodent Histopathology Core at Harvard Medical School, Boston, MA.

[0128] Immunofluorescence on brain sections Free-floating coronal sections of the whole midbrain were preincubated for 1 hour at room temperature in a blocking solution containing 5% normal donkey serum, 3% BSA, and 0.3% Triton X-100 in PBS. Primary antibodies were diluted in 3% BSA and 0.3% Triton X-100 in PBS and applied overnight at 4°C. After three washes with PBS containing 0.3% Tween 20, the sections were incubated for 1 hour at room temperature with Alexa 488-, Alexa 568-, or Alexa 647-conjugated secondary antibodies diluted in the same buffer as the primary antibodies. All sections were counterstained with Hoechst 33342. After three further washes, coverslips were applied to the sections along with mounting medium and visualized under a fluorescence microscope (Keyence Corporation, Osaka, Japan). Sections stained with secondary antibody alone were processed and photographed under the same conditions and used as negative controls.

[0129] Hematoxylin / eosin staining For pathological analysis of NOD SCID mouse testes, each mouse was anesthetized with ketamine / xylazine, and the testes were removed and temporarily preserved in 4% formaldehyde. For pathological analysis of NOD SCID mouse brain tissue, every sixth coronal section covering the entire striatum was mounted on a glass slide. Testicular and brain tissue slides were sent to the Rodent Histopathology Core at Harvard Medical School, Boston, MA, for hematoxylin / eosin staining.

[0130] Quantitative and statistical analysis Unless otherwise indicated, all experiments were performed in biological triplicate. The "n" for each experiment is found in the figure caption and represents the number of independently generated samples for all experiments. Statistical analysis was performed using GraphPad Prism v7 software. A p-value of <0.05 was considered statistically significant. Throughout the figures, an asterisk indicates the significance of the p-value: * p<0.05; ** p<0.01; *** p<0.001 is indicated. For tests of mutations present in cell fractions within each iPSC cell line, p-values ​​were generated by a two-tailed binomial test and corrected with a Bonferroni correction. Mutation data were analyzed and visualized using R.

[0131] [Example 1] Identification of microRNAs (miRNAs) that regulate metabolic reprogramming Recently, we have shown that SIRT2, which is directly targeted by miR-200c, is crucial for metabolic reprogramming and the generation of hiPSCs (19). To verify the functional link between miR-200c and reprogramming, we investigated whether forced expression of miR-200c induces metabolic changes. Indeed, overexpression of miR-200c in human dermal fibroblasts (hDFs) resulted in significant metabolic changes, including a decrease in oxygen consumption rate (OCR) and an increase in extracellular acidification rate (ECAR) (Figures 9A and 9B). Compared to the empty vector control cell line, miR-200c OE cells showed a significant decrease in oxidative phosphorylation (OXPHOS) capacity, as well as decreases in basal respiration, ATP turnover, maximal respiration, and oxidative reserve capacity, as well as altered OCR after carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) injection (Figures 9C-9E). We next treated hDFs with reprogramming factors (i.e., Y4F) in combination with miR-200c. Addition of miR-200c OE significantly reduced OXPHOS compared to Y4F alone (Figures 9F-9K), suggesting that pluripotency-associated miRNAs influence the reprogramming process by facilitating metabolic reprogramming. To investigate this, we investigated whether other miRNAs also induce metabolic changes similar to miR-200c. Based on previous miRNA expression studies (20-23), we identified eight candidate miRNA clusters (miR-17 / 92, miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and miR-371 / 373) that were consistently enriched in hPSCs. We investigated whether the OE of these miRNAs in hDFs leads to metabolic changes.Interestingly, we found that seven of these eight miRNA clusters (excluding miR-17 / 92) resulted in significant metabolic reprogramming, including a decrease in OCR and an increase in ECAR, resulting in a robust reduction in the OCR / ECAR ratio ranging from 3- to 20-fold compared to empty vector-transduced control cells (Figures 9L-9N).

[0132] [Example 2] Combining metabolically regulated miRNAs with reprogramming factors efficiently generates high-quality hiPSCs We investigated whether the addition of these metabolically regulated miRNAs to conventional reprogramming factors (Y4F or Y3F (OCT4, SOX2, and KLF4)) on lentiviral vectors would facilitate the generation of hiPSCs. Among the seven miRNA clusters identified above, miR-302s exhibited the highest efficacy in enhancing hiPSC generation when combined with Y3F or Y4F (Figures 1A and 1B). In addition, miR-106a, miR-106b, miR-200c, miR-369s, or the miR-371 / 373 cluster also significantly enhanced hiPSC generation, albeit to a lesser extent. Next, we investigated whether any additional miRNAs would further enhance hiPSC generation in the combination of Y3F and miR-302s (Y3F+3) or Y4F and miR-302s (Y4F+3). In the presence of Y3F+3, the addition of any of the other miRNA clusters significantly enhanced hiPSC generation (Figure 1C). When using Y4F+3, only miR-200c significantly enhanced hiPSC generation (Figure 1D). Therefore, we identified the combination of Y4F, miR-302s, and miR-200c (Y4F+3+2) as the optimal combination. We compared the kinetics of metabolic changes during reprogramming induced by Y4F, Y4F+3, and Y4F+3+2. Notably, Y4F+3+2 induced the most significant metabolic changes (Figures 1E and 1F), supporting the link between metabolic changes and efficient hiPSC generation. Next, we investigated whether this combination could also affect the overall quality of hiPSCs by staining for alkaline phosphatase (AP) and TRA-1-60, a more stringent pluripotency marker (24, 25). AP generated by Y4F or Y4F+3 induced the most significant metabolic changes (Figures 1E and 1F), supporting the link between metabolic changes and efficient hiPSC generation. + Approximately 40% of the colonies were TRA-1-60 + In contrast, AP produced by Y4F+3+2 + Approximately 90% of the colonies were TRA-1-60 +Furthermore, TRA-1-60 produced by Y4F+3+2 was significantly higher than that of the control group (Fig. 1G and Fig. 10A). + The hiPSC colonies displayed typical hESC-like condensed colony morphology (Figure 10A). We also reprogrammed adult hDF (GM03529, Coriell Institute) and found that over 90% of colonies generated by Y4F+3+2 on lentiviral vectors were AP colonies. + / TRA-1-60 + We found that (Figure 10B).

[0133] Next, we investigated whether this combination (Y4F+3+2) could generate high-quality hiPSCs using nonviral vectors. We developed two episomal vectors, one carrying Y4F (pY4F; Figure 10C) and the other carrying the miR-302s and miR-200c cluster (p3+2; Figure 10D). Because of the known transforming activity of c-Myc (26), we replaced it with L-MYC on pY4F. Thus, we established a novel episomal reprogramming protocol (Figure 10E) using a single transfection of these two vectors, which allowed hDF colonies to grow with >90% AP. + / TRA-1-60 +These cells were efficiently reprogrammed into hiPSC colonies (Figure 1H). We selected hiPSC cell lines with hESC-like morphology generated by Y4F, Y4F+3, and Y4F+3+2, subcultured them for >20 passages, and characterized their properties. As shown in Figures 2A and 2B, their morphology and expression levels of pluripotency markers were very similar to those of H9 hESCs. Interestingly, as evidenced by (1) staining with antibodies against the three germ layer markers and (2) gene expression of lineage-specific markers, hiPSCs generated by H9 and Y4F+3+2 differentiated well and evenly into all three germ layer lineages, whereas differentiation of hiPSCs generated by Y4F or Y4F+3 was biased toward the mesoderm lineage (Figures 2C and 2D). These results suggest that the Y4F+3+2 combination enables the generation of high-quality hiPSCs with less bias in differentiation potential compared to conventional methods (Y4F or Y4F+3), regardless of the delivery vector, from both neonatal and adult human fibroblasts (Table 1).

[0134] [Table 8]

[0135] [Example 3] Genomic integrity and somatic mutations in hiPSCs To determine whether our reprogramming method could reliably generate clinical-grade hiPSCs, we attempted to generate hiPSC cell lines using adult hDFs from multiple sources, including nine fibroblast cell lines from the Coriell Institute (three familial PD subjects, three sporadic PD subjects, and three healthy subjects) and four samples derived from fresh skin biopsies (three healthy subjects and one sporadic PD patient). As shown in Tables B and C and Figures 11A and 11B, our method yielded multiple hiPSC cell lines from all of these fibroblasts using a single transfection of pY4F and p3+2 (Figure 10E). All hiPSC cell lines displayed hESC-like morphology and significant expression of pluripotency markers, including OCT4, TRA-1-60, NANOG, and SSEA-4.

[0136] Focusing on personalized cell therapy, we further characterized a hiPSC clone (MCL540 in Table B) generated from a skin biopsy of a sporadic PD patient under an IRB-approved protocol (IRB partner number: 2010P001100). Fundamental criteria for clinical-grade hiPSCs are the maintenance of genomic integrity and the absence of deleterious (e.g., reportedly oncogenic) mutation(s) (7, 17). As an example, we examined five independent hiPSC clones from MCL540 (N17, C4, N3, C11, and C5), which had been subcultured for approximately 20 passages from the original isolate, as well as control cells (parental fibroblasts and H9) for potential integration of vector DNA into the host genome (Table 2). To detect plasmid-derived sequences, we designed eight sets of EBNA-1-specific primers and identified two sets (EB-01 and EB-02) that specifically detected plasmid DNA (Figure 12A). Plasmid DNA was undetectable in the cytoplasmic fraction (Figure 12B), but one of the five clones (N17) showed integration of plasmid sequences (Figure 12C). qRT-PCR analysis indicated that N17 had 1.3–1.7 × 10 integration of plasmid sequences per 100 nanograms of genomic DNA. 4 The amount of DNA in a diploid cell is approximately 6 picograms (bionumbers.hms.harvard.edu / bionumber.aspx?id=111206), so 100 nanograms of genomic DNA used in qRT-PCR corresponds to approximately 1.76 x 10 cells. 4 Thus, clone N17 appears to contain approximately one copy of the plasmid sequence per cell. In contrast, the other four clones and the negative controls (original fibroblasts and H9) did not contain any integrated plasmid DNA (Figure 12D). Thus, we excluded N17 and further analyzed the remaining four hiPSC clones (C4, N3, C11, and C5) by DNA fingerprinting, karyotyping, and in vivo pluripotent differentiation (Figures 12E-12G).

[0137] Table 9

[0138] We performed whole-exome sequencing (WES) on these four hiPSC clones and compared them with the parental fibroblast DNA sequence. We found a total of 524 somatic mutations, including 137 mutant coding exons or ±2 bp splice acceptor and splice donor sites. Each hiPSC cell line harbored a median of 126 somatic mutations (range: 92–205), including a median of 114.5 singleton mutations (range: 80–195). A small number of common mutations (n ​​= 1–4) were observed among the hiPSC cell lines (Figure 3A). C5 had the highest number of somatic mutations (n ​​= 205), while C4 had the lowest number of somatic mutations (n ​​= 92), including 80 singleton mutations. Among somatic mutations in protein-coding regions, the hiPSC cell lines harbored a median of 36.5 (range: 17–50) nonsynonymous mutations, including 27 (median, range: 14–35) nonsynonymous mutations. Again, C4 harbored the fewest mutations. We examined mutations in 127 genes reported to be frequently mutated across multiple cancer types (27). Our hiPSC cell lines harbored a maximum of one mutation (synonymous or nonsynonymous) in these genes, and no nonsynonymous mutations were found in C4 or N3. In summary, none of the somatic mutations found in all four hiPSC cell lines were causally involved in cancer. Finally, we compared the somatic mutation burden in our hiPSC cell lines with published datasets (Figure 3B). We collected high-confidence somatic mutations (28) from WES based on 140 hESC cell lines and somatic coding mutations (29) from WGS data on 299 hiPSC cell lines (generated by Sendai virus technology) within the Human Induced Pluripotent Stem Cells Initiative (HipSci).Our hiPSC cell lines exhibited a total mutation burden similar to that of the HipSci hiPSC cell lines (median: 25, range: 5-492) and significantly lower than that of the hESC cell lines (median: 70, range: 34-223) (Wilcoxon rank-sum test, p-value: 0.00071) (Figure 3B; left). Our hiPSC cell lines also harbored fewer mutations, even within genes frequently mutated in cancer (Figure 3B; right).

[0139] We also examined somatic mutations that may exist in subpopulations of each hiPSC cell line. We estimated the distribution of allele frequencies within the observed somatic mutations and performed a binomial test with a null model centered at 45% for SNVs and 35% for indels (28, 30). For each hiPSC cell line, a median of 16 variants (range 9–18) with a Bonferroni-corrected p-value of <0.01 were considered potential candidates for somatic mutations originating from a given cell fraction. The distribution of minor allele frequencies for all somatic mutations found across all hiPSC cell lines (Figure 3C) showed that both clonal and subclonal mutations were observed in each hiPSC cell line (identified as two peaks in the plot), but that subclonal mutations were unique to individual hiPSC cell lines. We observed 20 mutations conserved across two or more hiPSC cell lines; however, visual inspection of the short reads aligned by WES revealed one or two short reads associated with mutant alleles in the parental fibroblasts for 14 somatic mutation candidates, suggesting that these subclonal mutation candidates potentially originated from the germline. Notably, our hiPSC cell lines did not exhibit clonal or subclonal somatic mutations within cancer driver genes, such as TP53 (28). C4 and N3 were further characterized because they had the lowest somatic mutation burden across the four hiPSC cell lines.

[0140] [Example 4] The "spotting" culture method reliably produces high-yield, high-quality mDA cells Numerous laboratories have investigated the in vitro differentiation of mouse and human PSCs toward the mDA cell fate. Based on the findings that mDA cells originate from the neurogenic floor plate and that Wnt and Sonic Hedgehog signaling play crucial roles (31-33), recent mDA differentiation protocols utilize activators of these signals (7, 34, 35). Because embryoid body-derived neurosphere-based methods are highly variable between experiments (18, 35, 36), we sought to establish a more efficient and reproducible monolayer method based on "dual SMAD inhibition" (36, 37). mDA cells used for transplantation studies are generally differentiated in vitro for 16–32 days (7). Therefore, we first cultured mDA cells at 730,000 cells per 60-mm dish (i.e., 1 cm ) according to previously published optimized conditions (37). 2Using the well-studied H9 (<36 passages) starting at 34,000 cells per well (<34,000 cells per well), we sought to optimize the first 15 days, crucial for determining the derivation of baseplate-based mDA progenitors (mDAPs). Surprisingly, we observed severe cell death / loss beginning at days 8-10, resulting in highly variable outcomes. Evaluation of multiple experiments (n = 76 for hESCs and n = 48 for hiPSCs) performed by four independent researchers within our laboratory revealed that >50% of both hESCs and hiPSCs did not yield meaningful data due to severe cell loss (Figure 13A). Therefore, we carefully monitored cell loss during the differentiation process by determining the number of detached cells using fluorescence-activated cell sorting (FACS) at the time of medium change (Figure 4A). On day 15 (D15), we counted the total number of harvested cells and then further characterized these cells. Notably, when we examined two hESC cell lines (H9 and H7) and two hiPSC cell lines (C4 and N3), the total number of detached / lost cells from days 1 to 14 was much greater than the total number of harvested cells (Figure 4B and Table 3). Therefore, we expanded the monolayer cultures to include a small number of H9 and C4 cells (240,000 cells / cm). 2 11,000 cells per cm), and 60,000 cells per cm 2 We started with 3,500 cells per 1cm 2 Using 11,000 cells per cm, we found a similar pattern of significant cell loss (Table 3). 2At even lower densities of 3,500 cells per cell, both H9 and C4 cells showed poor viability and similarly lost and detached, resulting in unacceptably low final cell yields. This pattern of severe cell loss, regardless of initial cell concentration, suggests that evenly distributed monolayer conditions are not ideal for in vitro differentiation of hiPSCs and hESCs. Thus, we hypothesized that dividing the monolayer into discrete subsections (referred to herein as "spots") might improve in vitro differentiation. To investigate this, we restricted initial cell attachment to designated areas by pre-coating circular areas ("spots") approximately 5 mm in diameter with 10 μl of Matrigel at the intersections of a 2 × 2 cm grid (Figures 13B and 13C).

[0141] To find the optimal cell density, we seeded three different numbers of cells (40,000, 10,000, and 2,500) in each spot using H9 or C4 cells. Notably, this spotting method significantly reduced cell loss and improved yield at day 15 compared to the monolayer method. In particular, we found that 10,000 cells per spot (60,000 total cells per 60 mm dish) resulted in nearly 100% success of in vitro differentiation (Figure 13A), resulting in a final yield of 6-8 million mDA cells at day 15, while total cell loss was less than 3 million cells (Figure 4B, Table 3). We observed a similar pattern for the H7 hESC and N3 hiPSC cell lines (Figure 4B), suggesting that this spotting method is broadly applicable to the differentiation of hPSC cell lines into mDA. More importantly, cells harvested on day 15 contained a small number of dead cells (Figure 4C) and a significantly smaller number of cleaved caspase 3-positive cells, as well as reduced nuclear condensation (Figure 4D), a well-known marker of programmed cell death (38, 39). We speculated that the difference in outcomes between the spotting method and the monolayer method was due to insufficient oxygen and nutrients for cells in monolayer conditions, and attempted to correct this by more frequent medium changes. However, daily medium changes neither reduced cell loss nor enhanced cell yield. Conversely, they increased cell loss (Figure 14A). In the spotting method, daily medium changes did not affect cell loss or cell yield, again confirming that differentiation was more stable with spotting than with the monolayer method. Notably, we observed that the culture medium became significantly more acidic in monolayer cultures alone, regardless of the frequency of medium changes (Figure 14B), which at least partially explains the poor cell health. In summary, this novel spotting-based method reduced cell loss, increased final cell yield, and resulted in healthier mDA cells compared to the conventional monolayer method.

[0142] Table 3 shows the level of cell loss during in vitro differentiation of H9 and C4 at three different cell densities (1 cm 2 34,000 pieces per 1cm 2 11,000 pieces per 1cm 2 Figure 1 shows the results of a comparison between a monolayer-based method using a monolayer of 100 cells per spot (3,500 cells per spot) and a spotting-based method using three different cell densities (40,000 cells per spot, 10,000 cells per spot, and 2,500 cells per spot). FACS was used to count the detached cells present in the supernatant after medium change.

[0143] [Table 10-1]

[0144] [Table 10-2]

[0145] [Example 5] Quercetin treatment eliminates undifferentiated cells during in vitro differentiation A key issue for hPSC-based cell therapy is ensuring safety by eliminating residual undifferentiated cells with neoplastic potential. Based on previous findings that BIRC5 (encoding survivin) is highly expressed in hPSCs compared with somatic cells (40), we hypothesized that chemical inhibition of survivin would eliminate residual undifferentiated hiPSCs. However, because survivin is known to be important for neural progenitor cells (41, 42), it is important to examine whether this strategy interferes with the production of mDAP. Among survivin inhibitors (40), we selected the flavonoid quercetin (3,3',4',5,7-pentahydroxyflavone) because this natural compound is present in high concentrations in commonly consumed vegetables and fruits (43). We first treated 100,000 undifferentiated C4 cells with 5, 10, 20, 40, and 100 μM quercetin for 2, 6, 16, and 24 hours. After washing with fresh medium, the cells were further cultured for a total of 48 hours. As shown in Figure 5A, no viable cells were detected after treatment with >20 μM quercetin for >16 hours, indicating that undifferentiated hiPSCs were eliminated with >99.99% efficiency. To investigate whether quercetin affects mDAP survival, we treated D9 C4 cells (mostly neural progenitor cells) with different concentrations of quercetin for 16 hours and examined the outcome on day 11. At day 11, neither cell viability nor cell number was affected (FIGS. 5B and 5C), suggesting that quercetin does not affect hiPSC-derived mDAP.

[0146] To establish a highly sensitive and specific assay, we created a test mixture of undifferentiated C4 cells in hDF with 100,000 total cells and performed three different assays. First, we used FACS with monoclonal antibodies against SSEA-4 and TRA-1-60 (Fig. 15A) and found a significant discrepancy between the input and detected cell numbers, especially below 100 cells (Fig. 15B), indicating that the method was insensitive to small numbers of undifferentiated cells. Second, we cultured diluted cell samples for 6 days and performed AP analysis. + Colonies were counted as a surrogate marker for undifferentiated cells (Fig. 5D). A linear relationship was observed, but AP + The number of colonies was approximately one-tenth of that expected based on the input cell number (Figure 5E). This discrepancy may be due to the limited survival and proliferation of individual hiPSCs and / or their tendency to aggregate during colony formation. Despite this limitation, 10 5 Even when hiPSCs were seeded, APs were still significantly increased after treatment with quercetin. + Since no colonies were detected, this result confirmed that the efficacy of quercetin treatment was >99.99%. However, since this method cannot detect undifferentiated cells below 10 undifferentiated cells per 100,000 cells, we next used qRT-PCR, using OCT4 expression as a surrogate marker. Undifferentiated C4 cells 10 2 ~10 5Using qRT-PCR analysis of mRNA prepared from D28, we generated a standard curve for OCT4 copy number (Figure 5F), which allowed us to predict the number of undifferentiated cells. Using this assay, the calculated numbers of undifferentiated C4 cells at days 14, 21, and 28 without quercetin treatment were 30, 2, and 0.17 per 100,000 cells, respectively (Figure 5G). Therefore, if 10 million cells were transplanted into a PD patient on days 14, 21, or 28 of differentiation, the graft would contain approximately 3,000, 200, and 17 undifferentiated cells, respectively. Because quercetin treatment can eliminate undifferentiated cells with >99.99% efficiency, the predicted number of undifferentiated cells after quercetin treatment would be a maximum of 17 × 0.01% = 0.0017 cells per 10 million D28 cells. Consistent with this, the number of undifferentiated cells calculated using qRT-PCR curves at days 14, 21, and 28 after quercetin treatment (40 μM for 16 hours on day 9) was much lower than 1 cell per 100,000 cells (Figure 5G). + Consistent with these results, cells were observed without treatment but were not detected with treatment (Figure 15C). Taken together, our results, using a highly sensitive method, indicate that quercetin treatment reduces the number of undifferentiated cells to undetectable levels, thereby significantly reducing the risk of tumor formation, even when millions of differentiated cells are transplanted.

[0147] [Example 6] Functional characterization of mDAPs and mDANs Based on the spotting method and quercetin treatment described above, we established a modified in vitro protocol (Figure 6A) for differentiating hiPSCs into mDAP / mDAN. C4 cells differentiated using these methods showed a progressive increase in condensed shape, minimal detachment (Figure 14C), and bipolar extension of neurites from the tip (Figure 16A). On day 15, the cells were dissociated into a single-cell suspension, replated, and further differentiated. As shown in Figures 6B and 6C, expression of neural progenitor markers (e.g., SOX2, SOX1, and NESTIN) and floor plate / substrate markers (e.g., GLI1, FOXA2, and CORIN) began on day 7, persisted at high levels until day 28, and finally declined on day 40. Expression of mDAP markers (e.g., OTX2, LMX1A, and EN1) increased on days 21 and 28, whereas mDAN markers (e.g., TH, DAT, and PITX3) increased thereafter. These data were confirmed by stage-specific immunocytochemical analysis (Figure 16B), which showed a gradual decrease in NESTIN and an increase in mDAN markers. Because D28 cells exhibited a more mature phenotype than D14 cells (Figure 16B), we predicted that D28 cells would be more suitable than early cells. Thus, we analyzed D28 cells using immunocytochemistry for typical mDAP and mDAN markers (Figures 6D-6H). Approximately 40% and 15% of total cells expressed MAP2 and TH, respectively, and 38% of cells expressed NURR1 (Figures 6D and 6E). More than 80% of all cells coexpressed FOXA2 and LMX1A, a characteristic feature of the mDA phenotype (Fig. 6D and 6F), and the majority of TH+ cells coexpressed FOXA2, LMX1A, and NURR1 (Fig. 6D and 6G). We observed that approximately 30% and 20% of D28 cells expressed the dorsal patterning marker PAX6 and the proliferation marker KI67, respectively (Fig. 6D and 6H). Importantly, cells coexpressing PAX6, SOX1, and KI67, which are known to form abnormal outgrowths upon transplantation (44, 45), were undetectable (Fig. 6D and 6H).GABA. + Cells or 5-HT + Few cells were detected at any stage of differentiation (FIG. 16B).

[0148] Many THs co-express MAP2, dopamine transporter (DAT), and synaptophysin (SYP). + To determine whether these neuron-containing cells would become physiologically functional neurons, we performed whole-cell patch clamp recordings at day 70 in culture (Fig. 17A). + Neurons co-expressed additional mature mDA markers, including PITX3 and VMAT2 (Fig. 17A). + ALDH1A1 + Neurons also coexpressed GIRK2 or, in some cases, calbindin, which characterize A9 and A10 mDANs, respectively (Fig. 17B). In current-clamp recording mode, we assessed the intrinsic membrane properties of these cells (resting membrane potential: -55.93 ± 2.43 mV; input resistance: 1.52 ± 0.44 GΩ; n = 7 neurons), including the action potentials (APs) observed in response to depolarizing current injection (Fig. 18A; mean AP amplitude: 54.96 ± 4.66 mV; half-width: 6.04 ± 0.82 ms; afterhyperpolarization (AHP) amplitude: 3.55 ± 1.46 mV; n = 7 cells). In voltage-clamp recording mode, voltage pulses from -70 mV to +40 mV evoked transient inward currents, which were mediated by tetrodotoxin (TTX; voltage-dependent Na+). + The complete blockade of voltage-dependent Na +In addition to channel expression, persistent outward currents, representing potassium currents, were observed (Fig. 18B). Furthermore, during whole-cell voltage-clamp recordings, we observed spontaneous postsynaptic currents (sPSCs), indicating the presence of functional synapses (at a holding potential of -70 mV, sPSC frequency: 0.11 ± 0.03 Hz; peak amplitude, 14.71 ± 3.05 pA; rise time, 0.73 ± 0.14 ms; decay time, 1.72 ± 0.19 ms; n = 5 cells) (Fig. 18C). Spontaneous firing was observed in the absence of injected current, consistent with pacemaker activity at the resting membrane potential (46). Recorded cells spontaneously fired at a mean frequency of 4.4 ± 0.8 Hz (n = 4), as typically observed in A9 mDANs (Fig. 18D). Recorded individual neurons (loaded with neurobiotin via the recording patch pipette; red) colocalized with TH-positive cells, confirming their dopaminergic identity (Figure 18E). In addition to single-cell patch-clamp recordings, we also measured population-level electrical activity using multi-electrode arrays (MEAs). Differentiated cells generated robust synchronous bursting patterns, indicative of maturation of the neuronal network (Figure 18F). Cumulative activity maps showed an increase in spike density and spike area within mDAs between days 30 and 44 (Figure 18F). To isolate spontaneous activity from mDAs, cultures were treated with glutamate receptor antagonists, NBQX+AP5, and GABA receptor antagonists. A D47 cells were treated in combination with the receptor antagonist picrotoxin. Administration of this cocktail only slightly reduced the total spiking and number of active electrodes (Fig. 18G and 18H), suggesting the presence of abundant mDNA in these cultures. Finally, HPLC analysis of the culture medium further demonstrated that D47 cells released dopamine (3.1 ± 0.1 ng / ml) and DOPAC (0.2 ± 0.0 ng / ml) (Fig. 6I).

[0149] [Example 7] In vivo safety testing after implantation Our in vitro characterization showed that the majority of cells between days 14 and 28 represented mDAPs suitable as a transplantable cell source. To examine their safety, we transplanted D14 C4 cells or D28 C4 cells (with or without quercetin treatment; 100,000 cells per animal) into the striatum of immunodeficient NOD SCID mice. As expected, transplantation of undifferentiated C4 cells (day 0) induced the formation of teratomas containing the characteristic three germ layers, a defining feature of PSCs, in all four tested mice (Figure 7A, left panel). In comparison, when D14 cells were transplanted without or with quercetin treatment (n = 8) (n = 19; Figure 7A, middle column), and when D28 cells were transplanted with quercetin treatment (n = 23; Figure 7A, right column), no teratoma formation was observed (Figure 7B). Interestingly, we observed rosette-like structures in approximately 40% of the host brains transplanted with D14 cells (3 of 8 in the D14 without quercetin group; 8 of 19 in the D14 with quercetin group; open circles in the middle lane of Figure 7A). In contrast, when D28 cells were transplanted, no rosette-like structures were observed (0 of 23 mice; Figures 7A and 7C). Immunohistochemistry showed that D14 transplants contained more vimentin-positive immature cells than D28 transplants (Figure 7D). In addition, the number of SOX1-positive, KI67-positive, SOX1 / KI67 double-positive, SOX1 / PAX6 double-positive, and SOX1 / PAX6 / KI67 triple-positive cells in the D28 cell-derived grafts was also lower than in the D14 cell-derived grafts (33% vs. 4.5%; 5.9% vs. 1.2%; 2.1% vs. 0.15%; 1.2% vs. none; 0.75% vs. none, Figures 7E–7G), indicating that the D28 grafts contained fewer cells with proliferative potential than the D14 grafts. These results suggest that although completely undifferentiated cells were eliminated and teratomas did not form, the D14 grafts still contained immature progenitor cells capable of forming rosette-like structures.Additionally, because SOX1 / PAX6 / KI67 triple-positive cells were undetectable within the D28 grafts, we conclude that D28 cells represent a safer cell source for transplantation than D14 cells. We further investigated the safety of D28 cells by assessing their biodistribution. Six months after D28 cell transplantation into the striatum, we isolated central nervous system regions (the olfactory bulb and cerebellum combined, and the spinal cord) and five peripheral organs (lung, heart, liver, kidney, and spleen) to explore the migration of human-derived cells from the striatal grafts. Genomic qPCR did not detect human DNA sequences in any of these regions, whereas the hiPSC-positive control showed significant expression (Figure 7H), confirming the lack of detectable redistribution of transplanted cells within the brain or to peripheral organs.

[0150] [Example 8] In vivo efficacy studies and graft analysis in animal models for PD The 6-hydroxydopamine-lesioned rat model was the first animal model of PD to be developed (47) and remains a common model (48, 49). This rat model is particularly useful for quantitatively assessing the effects of cell transplantation on locomotion. Its use in athymic rats is gaining recognition as a preferred model because it does not require immunosuppression. Athymic rats from two different sources (Taconic Biosciences (Hudson, NY) and Charles River (Wilmington, MA)) were used. We first unilaterally transplanted 100,000 and 300,000 C4 D28 cells into the striatum of 6-hydroxydopamine-lesioned athymic Taconic rats and monitored their amphetamine-induced rotational behavior monthly after transplantation. After 12 weeks, both the 100,000-cell and 300,000-cell groups showed a significant reduction in ipsilateral rotational behavior (Figure 19A). After 16 weeks, rotational behavior was completely rescued in all implanted rats, and some rats even showed contralateral rotational behavior. In contrast, vehicle-treated rats showed no recovery. Hematoxylin / eosin (HE) staining showed that the implants contained no teratomas or rosettes (Figure 19B). Immunohistochemistry for human neural cell adhesion molecule (hNCAM) revealed dense hNCAM expression within the striatum (STR) (Figure 19C), prefrontal cortex (PFC; Figure 19D), septal nuclei (Figure 19E), nucleus accumbens (NAc; Figure 19F), and corpus callosum (CC; Figure 19G). + Immunohistochemistry showed abundant TH in the grafts. + Stereological quantification revealed viable TH + The average number of neurons was 5,621 ± 1029 per 100,000 transplanted cells (n = 4), and they contained a mixture of neuronal shapes, including large, angular cell bodies typical of A9 neurons (Figure 19I), and small, spherical neurons typical of A10 neurons (Figure 19J).

[0151] These data suggesting the safety and efficacy of D28 C4 cells led us to more extensively examine D28 C4 cells in athymic rats from Charles River, which are more physically robust than the Taconic strain and facilitate long-term analysis. We selected a single dose (100,000 cells) of D28 C4 cells for transplantation (Fig. 19K) and compared the efficacy and safety of cryopreserved cells with freshly prepared cells. Cryopreserved D28 C4 cells (frozen D28) maintained a similar viability level (approximately 90%) to their freshly prepared counterparts and displayed the same mDA cell phenotype after 1 week of storage in liquid nitrogen (Fig. 19L). Amphetamine-induced rotational behavior was significantly reduced 16 weeks after transplantation of fresh or frozen D28 C4 cells and was completely rescued at 20 and 24 weeks (Fig. 8A). As seen in Taconic rats (Fig. 19A), some animals exhibited contralateral rotational behavior at 20 and 24 weeks. We also assessed the functional efficacy of these grafts in several tests without exogenous pharmacological stimulation, which resulted in motor deficits more closely resembling those in human PD. In the corridor test (50), a sensitive test of lateralized sensorimotor response selection, fresh or frozen D28 C4 cells significantly reduced the lesion-induced ipsilateral bias at 24 weeks after transplantation (Fig. 8B). Notably, no significant reduction was observed at 16 or 20 weeks, suggesting that improvement in this task requires more time than rotational behavior. In the cylinder and stepping tests (51, 52), which measure forelimb akinesia, the impairment of forelimb function caused by 6-hydroxydopamine lesions was also significantly improved by transplantation of fresh or frozen D28 C4 cells 24 weeks after transplantation (Figures 8C and 8D). In summary, both fresh and frozen D28 C4 cells significantly and equally improved ataxia in all four behavioral tests.Furthermore, further transplantation of animals at later time points confirmed that recovery of rotational behavior was sustained up to the final test time point of 52 weeks (FIG. 19M), suggesting that the functional improvements resulting from transplantation were well maintained.

[0152] Because H9-derived mDA cells have been extensively validated and explicitly shown to be functionally equivalent to human fetal ventral midbrain (VM) cells (53), we directly compared the outcomes of H9 hESC-derived D28 cells and C4hiPSC-derived D28 cells after transplantation. 5 and 4 × 10 5 Transplantation of both cell lines demonstrated that both resulted in the same degree and time course of recovery of rotational behavior (FIG. 20A).

[0153] Next, the present inventors analyzed the grafts 26 weeks after transplantation and found that hNCAM + Cells and TH + We found that all of the cells displayed extensive innervation of the entire dorsolateral STR (dl-STR), with extensive extension to dopaminergic target regions such as the PFC and NAc (Figures 8E-8L and 20B). The robust innervation of the host brain by these graft-derived mDANs was further verified by widespread co-expression of hNCAM within dopaminergic fibers in the dl-STR (Figure 8M). Additionally, triple immunofluorescence staining was performed using antibodies against TH, human presynaptic protein (synaptophysin; hSyn), and a striatal medium spiny neuron marker (DARPP32). We characterized their preferential targets at the graft border and host dendritic spines (DARPP32). + In neurons, TH + / hSyn + Neuronal terminals were observed, indicating that the transplanted DANs formed synaptic connections with host intrastriatal neurons (Figure 8N). Frozen and fresh D28 grafts expressed hNCAM. + / TH +The grafts of fresh and frozen D28 C4 cells showed similar reinnervation and synaptogenesis patterns (Fig. 20C). Grafts of both fresh and frozen D28 C4 cells contained similar numbers of DA neurons with A9- or A10-like morphologies (D28: 34,560 ± 3,200; frozen D28: 46,094 ± 8,967; Figs. 21A and 21B). Graft volume was also similar between D28 and frozen D28 (D28: 12.2 ± 1.1 mm). 3 ;Freezing D28:13.0±1.7mm 3 (Fig. 21C). hNCAM in the explants from D28 and frozen D28, respectively. + The total number of cells was approximately 3.0 × 10 6 and 2.45 × 10 6 and TH + The mean percentages of cells were 1.48±0.55% and 2.08±0.65%. + The majority of neurons (70–80%) co-express FOXA2 and LMX1A, and over 90% of TH + Neurons co-expressed NURR1 (Figures 21D-21F). + Within neurons, the mature DA marker DAT was abundantly expressed (Fig. 21G), whereas KI67, a marker associated with proliferative potential, was not. + was expressed in <1% of cells (D28: 0.86 ± 0.09%; frozen D28: 0.54 ± 0.21%; Figures 21H and 21I). No rosettes or teratomas were observed, and proliferative cells co-expressing SOX1, PAX6, and KI67 were rare or undetectable (SOX1 + PAX6 + :D28:0.37±0.10%;Freezing D28:0.15±0.11%;SOX1 + PAX6 + KI67 + :D28: 0.02±0.02%; Frozen D28: Not detected; Figures 21H and 21I). +Within the neurons, GIRK2 or calbindin was expressed (Fig. 21J and 21K), and the majority co-expressed GIRK2 (D28: 79.29 ± 4.88%; frozen D28: 81.28 ± 3.50%; Fig. 21L). + Neurons co-express additional A9 markers, such as ALDH1A1. + ALDH1A1 + Neurons frequently co-express SOX6 and GIRK2, representing A9-type mDANs (Figures 21M and 21N); whereas some TH + ALDH1A1 + Neurons co-expressed calbindin, which represents the A10 mDNA (Fig. 21O). Collectively, these data suggest that TH is essential for the development of TH in both fresh and frozen D28 C4 cell grafts. + The majority of neurons have characteristics of A9 mDANs, consistent with widespread and prolonged recovery of ataxia in behavioral tests.

[0154] When these data were compared with recently published transplantation studies of hiPSC-derived DA cells in a 6-hydroxydopamine-lesioned rat model (44, 45, 57-64), the DA yield (ratio of surviving DA neurons to the number of transplanted cells) in the present study was higher than in any of these other studies (Table 4).

[0155] [Table 11-1]

[0156] [Table 11-2]

[0157] [Example 9] GMP-compliant differentiated cell production Finally, we investigated the scalability and clinical applicability of our platform by generating and characterizing differentiated C4 cells in vitro under this protocol in a GMP facility at the Dana Farber Institute. Starting from approximately 1 million D0 C4 iPS cells, we successfully generated >160 million D28 cells (Figures 22A-22F). Quality control data (e.g., genomic footprinting, immunocytochemistry for marker proteins, qRT-PCR) demonstrated that these clinically relevant numbers were significantly higher than those of FOXA2. + LMX1A + Pathogen-free and high quality was confirmed as evidenced by a high percentage of cells (>85%) and the absence of irrelevant markers (e.g., 5-HT, DBH, OCT4, and SSEA-4; representing serotonergic, noradrenergic, and pluripotent markers, respectively).

[0158] [Example 10] In vivo human efficacy studies A human patient with PD was treated with the implantation of autologous mDA progenitor cells generated by the methods described herein. The patient was a 69-year-old, right-handed, male physician with a 10-year history of progressive idiopathic PD. The patient's PD medications included three capsules of Rytary (extended-release carbidopa / levodopa 23.75 mg / 95 mg) four times daily, 4 mg of rotigotine daily, and 1 mg of rasagiline daily (a dose equivalent to 904 mg of levodopa). Despite optimal medical treatment, the patient reported suboptimal symptom control, with an average of three hours of off-time per day, characterized by tremor, posture, and deterioration of fine motor control. The patient had no movement disorders. The informed consent document included a thorough discussion of the risks associated with this first-in-human use of this technology in PD and a review of currently available medical and surgical treatment options, including deep brain stimulation. Using fibroblasts collected from skin biopsies, multiple iPSC cell lines were generated, which were extensively investigated for pluripotent differentiation potential in vitro and in vivo and screened for somatic mutations using whole-exome sequencing. Based on these data, a single clone (designated C4) lacking known cancer-associated mutations and exhibiting minimal overall mutational burden was selected for the generation of transplantable mDAP cells. Before release for clinical use, the mDAP cells met strict GMP and quality control standards and were tested for gene expression of the A9 mDA-specific neural marker and other neural markers, as well as for genomic integrity by whole-genome sequencing (WGS).

[0159] In accordance with FDA regulatory guidelines, patients underwent two MRI-guided stereotactic surgical procedures, 6 months apart, for implantation into the putamen, first in the left hemisphere and then in the right hemisphere. Each procedure involved three trajectories within the putamen, posterior to the reference plane of the anterior commissure, each spanning the superior and inferior extent of the nucleus (Schweitzer et al., Oper Neurosurg (Hagerstown) 2019;18:321-328). A total of 4 million cells were delivered per procedure, divided equally among the three injection tracts. Intravenous cefazolin was administered during surgery. No immunosuppressants, glucocorticoids, or anticonvulsants were used at any time. After each procedure, patients were monitored overnight and discharged one day later.

[0160] material and method In this example, the following materials and methods were used:

[0161] Overview The informed consent form included a thorough discussion of the risks associated with the first human use of this method in Parkinson's disease, along with a review of currently available medical and surgical treatment options, including deep brain stimulation. The study was conducted under regulatory guidelines from the U.S. Food and Drug Administration (FDA). Approval was obtained from the review boards at Weill Cornell Medical Center and Massachusetts General Hospital. All animal procedures were performed with approval from the McLean Hospital Animal Care and Use Committee.

[0162] iPSC generation, differentiation, and preclinical safety / efficacy testing As described above, iPSCs were generated using a protocol combining traditional Yamanaka factors with two microRNA clusters. Fibroblasts harvested from skin biopsies were used to generate multiple iPSC cell lines, which were examined for pluripotent differentiation potential in vitro and in vivo and screened for the presence of protein-coding mutations by whole-exome sequencing. A single iPSC clone (designated C4) exhibiting a normal karyotype was selected for further characterization and production of mDAP under Good Manufacturing Practice (GMP)-compliant conditions. Using a "spotting"-based method under the GMP conditions described above, C4 iPSCs were differentiated into mDAP cells in vitro for 28 days. This protocol included overnight quercetin treatment on day 9, which eliminated residual undifferentiated iPSCs (i.e., cells expressing pluripotency markers such as OCT4, SSEA1, and NANOG) by inhibiting BIRC5, a PSC-specific anti-apoptotic gene that encodes survivin. See supra and Lee et al., Proc Natl Acad Sci USA 2013;110:E3281-90.

[0163] Characterization of in vitro differentiated mDAPs In the two validation experiments described above, C4 iPSC-derived cells showed normal karyotypes and were characterized as mDAP with dopamine neuron-specific neural markers and other neural markers. Whole genome sequencing of both C4 iPSCs and C4-derived progenitor cells was performed, and the progenitor cells were compared with the original source fibroblasts; the results confirmed the absence of known cancer-associated mutations and neurodegeneration-associated mutations in the progenitor cells.

[0164] We found missense and splice-site disrupting variants, including 23 somatic mutations, in C4 iPSCs and mDAPs compared with parental fibroblasts. However, known cancer-related genes (i.e., according to the CENSUS database), disease genes reported for neurodegenerative disorders (i.e., according to HGMD and ClinVar), and genes involved in tyrosine metabolism and dopaminergic synaptic pathways (i.e., according to the KEGG database) were not affected by these mutations. In particular, a missense variant in FLG2 (ENSP00000373370.4:p.Val672Gly) was present at a low rate in C4 iPSC samples, which we referred to as a heterozygous variant in C4 iPSCs. Therefore, we speculated that this missense variant exists as a subclonal somatic mutation in both C4 iPSCs and mDAPs. No new somatic mutations were introduced during differentiation of C4 iPSCs into mDAPs. Most of the mutations found in C4 iPSCs or mDAP appeared as subclones in other samples (the two left-most peaks in each box). Next, we performed read-depth-based CNV analysis using ASCAT (allele-specific copy number analysis of tumors) (Van Loo et al. Proceedings of the National Academy of Sciences of the United States of America 2010;107:16910-5). We found heterozygous deletions spanning introns and single exons within the PODXL gene in C4 iPSCs and mDAP, but did not find any additional CNVs introduced into mDAP compared to C4 iPSCs. This copy number variant was not detected using WES. PODXL has not been reported as a cancer driver gene.

[0165] Prior to clinical use, neurons derived from these progenitor cells demonstrated dopamine secretion and electrophysiological properties characteristic of dopaminergic neurons in the substantia nigra pars compacta in vitro, and in animal models, demonstrated functional efficacy similar to that of fetal midbrain-derived tissue, as described above, and met FDA regulatory release standards. After treatment with quercetin, the final cell product (at day 28) had no detectable residual undifferentiated iPSCs based on immunostaining and real-time polymerase chain reaction-based assays (the upper limit of the 95% confidence interval was set at ≤1 undifferentiated cell per billion differentiated cells at day 28). Serotonergic neurons (Olanow et al. Ann Neurol 2003;54:403-14), a potential cause of graft-induced motor disorders, were not detected in the final product.

[0166] Graft survival under autologous versus allogeneic conditions in humanized mice Patient-derived iPSCs (C4) and allogeneic human embryonic stem cells (H9) were differentiated into day 28 mDAP (C4-mDAP and H9-mDAP), with 1 × 10 cells of each cell line. 5 Individual grafts were transplanted into the striatum of non-obese diabetic / severely immunodeficient (NOD SCID) mice, non-obese diabetic / severely immunodeficient / interleukin-2 receptor gamma-depleted mice (NOD SCID gamma mice), patient-humanized NOD SCID gamma mice (C4-hu; using patient peripheral blood mononuclear cells obtained 24 months [left hemisphere] and 18 months [right hemisphere] after surgery), and allogeneic humanized mice (K1-hu). After 2 weeks, animals were sacrificed and examined histologically for graft survival, the presence of neurons expressing a marker for dopaminergic neurons (tyrosine hydroxylase [TH] neurons), and cellular immune responses (CD4+ cells) within the grafts by labeling for human neural cell adhesion molecule (hNCAM+) cells.

[0167] Surgical procedures in patients The patient underwent two surgical procedures (in accordance with FDA regulatory guidelines) for cell implantation, six months apart, in the left hemisphere followed by the right. MRI-based Leksell stereotaxic techniques were used. During each procedure, three trajectories were created, starting from a single injection point in the superior parasagittal region of the frontal lobe. Cells were prepared at the DF / HCC GMP Cell Manipulation Core and harvested on the day of surgery. Cells were injected into each injection tract using a device specifically designed to create columns spanning the sagittal extent of the putamen (Schweitzer et al. 2019). Intraoperative CT imaging of the cannula was used, and this image was integrated back into the preoperative surgical plan to confirm localization accuracy and prevent bleeding (Figures 24A-24B). A total of 4 million viable cells were delivered during each surgical procedure, equally divided among the three injection tracts. Antibiotics were administered (cefazolin, 2 g intravenously every 8 hours for three doses during surgery), but no immunosuppressants, steroids, or anticonvulsants were used. After surgery, patients were monitored overnight in the intensive care unit and discharged 1 day later.

[0168] clinical scale Neurological examinations were performed, and Parkinson's disease-specific measures were assessed at baseline and 1, 3, 6, 9, and 12 months after each implant, and at 6-month intervals thereafter. At each examination, a neurologist recorded the patient-reported "non-control" time during which medications did not adequately control motor symptoms. Prespecified assessments included the Movement Disorder Society Unified Parkinson's Disease Rating Scale (MDS-UPDRS) Part III (scores ranging from 0 to 132, with higher scores indicating worsening Parkinson's disease motor symptoms) (Cha et al., Nat Cell Biol 2017;19:445-56) and the 39-item Parkinson's Disease Questionnaire (PDQ-39; scores ranging from 0 to 156, with higher scores indicating worsening quality of life) (Lee et al., 2013).

[0169] Brain imaging Computed tomography (CT) scans were performed intraoperatively to confirm accurate placement of the cell injection within the putamen, and immediately after surgery to screen for bleeding at or near the implantation site. Serial magnetic resonance imaging (MRI) scans and magnetic resonance spectroscopy findings were reviewed for any evidence of tumor, stroke, or bleeding. Serial fluorine-18-L-dihydroxyphenylalanine ( 18 F-DOPA) positron emission tomography (PET)-CT was performed to assess the presence of dopamine activity in presynaptic terminals within the engrafted putamen region. Changes in radioisotope uptake were 18 The F-DOPA uptake was evaluated semiquantitatively by the ratio of normalized F-DOPA uptake values.

[0170] Safety Monitoring Concurrent with the imaging workup, serial clinical neurological examinations to detect neurological adverse events were performed by two study neurologists and a study radiologist. Patients continued to receive independent care from local neurologists.

[0171] result Immunogenicity of grafts in humanized mice after implantation As shown in Figure 23A and above, both patient-derived mDAP (C4-mDAP) and allogeneic mDAP (H9-mDAP) survived in NOD SCID gamma mice, but both graft types were rejected when transplanted into allogeneic humanized mice (K1-hu). Two weeks after transplantation, the patient-humanized mice (C4-hu) tolerated the survival of autologous C4-mDAP, and the grafts stained positive for hNCAM+ cells and contained TH+ neurons, whereas the C4-hu mice rejected allogeneic H9-mDAP, with prominent CD4+ lymphocyte infiltrates (Figures 23B-23C).

[0172] Imaging in patients 0-24 months after implant Three months after the first implantation, 18 F-DOPA PET-CT imaging shows the following in the putamen: 18 Following an initial decline in F-DOPA uptake from baseline, there was a subsequent decline in F-DOPA uptake in the right and left sides, respectively, for up to 18 and 24 months after implantation. 18 The study showed a small increase in F-DOPA uptake. As seen in the color intensity scale and quantitative comparisons for selected subregions, the increase in activity was greater on the right side (second implant) than on the left, and was most pronounced in the posterior putamen near the implant site (Figures 24A-24B). Semiquantitative changes from baseline in radioisotope uptake are shown in Figures 24A-24B and ranged from -4.0% to 13.5% on the right side and from -4.8% to 9.8% on the left side.

[0173] Six months after the first implantation and at subsequent time points, MRI revealed areas of increased T2-weighted signal intensity similar to the implantation site within the putamen, but more prominent on the right side along the surgical injection tract within the white matter (Figures 24A-24B). No bright-contrast enhancement was observed at the six putaminal implantation sites. Six months after the second surgery, a 4-mm area of ​​enhancement was observed 3 cm above the target within one injection tract; CT and MRI, including arterial spin-labeling magnetic resonance perfusion imaging and magnetic resonance spectroscopy, showed changes consistent with postoperative gliosis.

[0174] Clinical evaluation Twenty-four months after the first (left) implant and 18 months after the second (right) implant, the patient reported no adverse events or declines in function. Prior to the first implant, scores on the MDS-UPDRS Part III (assessing motor signs of Parkinson's disease) after an overnight cessation ("off") of dopamine replacement therapy were not measured because the patient declined to discontinue medication due to worsening symptoms. Scores during the off period were 43 4 weeks after the first implant, 33-41 during subsequent follow-up periods, and 33 at 24 months. At peak doses ("on") of dopamine replacement therapy, scores on the MDS-UPDRS Part III were 38 at implant, 19-35 during follow-up periods, and 29 at 24 months. PDQ-39 scores (assessing Parkinson's disease-related quality of life, with lower scores indicating improved quality of life) were 62 at implantation, 2 to 34 during follow-up, and 2 at 24 months (Figures 25A-25B and Table 5).

[0175] [Table 12]

[0176] After 24 months, the patient's Parkinson's disease medications were carbidopa-levodopa sustained-release (capsules containing 23.75 mg and 95 mg, respectively, at doses of 3, 3, 2, and 3 capsules, four times daily), rotigotine (4 mg daily), rasagiline (1 mg daily), and droxidopa (100 mg daily) (for a total daily dose of 847 mg levodopa equivalents); this represented a 6% reduction in levodopa equivalents compared with before implantation. The patient reported less than 1 hour of "non-control" time per day. No movement disorders were reported by the patient or observed during clinical examination (similar to their absence before surgery).

[0177] In addition to improvements in motor scores and motor ADLs, subjects reported improved sleep quality, including a reduction in REM sleep, reduced behavioral symptoms, reduced drooling and dysphagia, and reduced anxiety and depression. There was no decline in subjective cognitive function, and MoCA scores remained between 27 and 30.

[0178] This study reports the generation and implantation of iPSC-derived autologous dopaminergic progenitor cells in patients with Parkinson's disease, along with clinical and imaging results, providing evidence of therapeutic benefit. References

[0179] [Table 13-1]

[0180] [Table 13-2]

[0181] [Table 13-3]

[0182] [Table 13-4]

[0183] [Table 13-5]

[0184] [Table 13-6]

[0185] [Table 13-7]

[0186] Other embodiments While the present invention has been described in conjunction with a detailed description thereof, it is to be understood that the foregoing description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. The invention as originally claimed in the present application is described below. [Invention 1] 1. A method of generating a population of midbrain dopaminergic progenitor cells (mDAP), comprising: providing a population of induced pluripotent stem cells (iPSCs), preferably human iPSCs; seeding the cell population into separate regions within the biomatrix hydrogel support at a density of about 5,000 to 20,000 cells per region, preferably about 10,000 cells per region, with sufficient distance between the regions to maintain separation between the regions; and maintaining the iPSCs under conditions sufficient to differentiate the cells into mDAPs. A method comprising: [Invention 2] The method according to claim 1, wherein the biological matrix hydrogel support is a basement membrane extract or a synthetic matrix. [Invention 3] 3. The method according to claim 1 or 2, wherein the cells are suspended in the gel prior to seeding. [Invention 4] 4. The method according to any one of claims 1 to 3, wherein the region has a diameter of about 2 to 10 mm. [Invention 5] 5. The method according to any one of claims 1 to 4, wherein the distance between the regions is 1 to 3 cm. [Invention 6] 6. The method according to any one of claims 1 to 5, wherein the iPSCs express alkaline phosphatase (AP) and TRA-1-60. [Invention 7] 7. The method of any one of claims 1 to 6, wherein the mDAPs express one, two, or more markers, including FOXA2, OTX2, LMX1A, and / or EN1, preferably at least FOXA2 and LMX1A; optionally, the mDAPs are TH+ cells that co-express FOXA2, LMX1A, and NURR1. [Invention 8] The iPSCs Obtaining a population of primary cells from a subject, preferably wherein said primary cells are fibroblasts, hair keratinocytes, blood cells, or bone marrow mesenchymal stem cells (MSCs); Inducing expression of OCT4, KLF4, SOX2, and L-MYC in the cells; and maintaining the primary cells under conditions sufficient for them to become iPSCs. 8. The method according to any one of claims 1 to 7, wherein the method comprises: [Invention 9] The method of invention 8, wherein the step of inducing expression of OCT4, KLF4, SOX2, and L-MYC comprises transfecting the primary cells with a polycistronic episomal vector comprising coding sequences of human Oct4 linked to the foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to the porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC. [Invention 10] 10. The method according to any one of claims 1 to 9, wherein the iPSCs are produced by a method comprising expressing in the cells one or more exogenous microRNAs (miRNAs) selected from the group consisting of miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and miR-371 / 373. [Invention 11] The method according to claim 10, wherein the miRNA comprises one or both of miR-302s and miR-200c. [Invention 12] 12. The method according to claim 11, comprising the step of introducing into said cells an episomal vector comprising a sequence encoding miR-302s and miR-200c. [Invention 13] 13. The method according to any one of claims 1 to 12, wherein the iPSCs are produced by a method comprising the step of expressing all of OCT4, KLF4, SOX2, miR-302s and miR-200c in the primary cells. [Invention 14] The method of Invention 13, comprising the step of introducing into the cell (i) a vector, preferably a viral vector or a polycistronic episomal vector, comprising coding sequences for human Oct4, KLF4 linked to the 2A sequence of foot-and-mouth disease virus (OCT4-F2A), SOX2 linked to the 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC, or the mature RNAs of Oct4, KLF4, SOX2, and L-MYC, or the corresponding proteins, and (ii) a vector, preferably a viral vector or an episomal vector, comprising sequences encoding miR-302s and miR-200c, or mature miR-302s and mature miR-200c. [Invention 15] 15. The method according to any one of claims 1 to 14, wherein the cells are human cells. [Invention 16] Preferably, the method according to invention 8 further comprises reducing undifferentiated iPSCs by inhibiting the BIRC5 gene. [Invention 17] A cell population containing mDAP, produced by the method described in inventions 1 to 16. [Invention 18] 18. A composition comprising the cell population according to claim 17. [Invention 19] 1. A method of treating a subject having or at risk of developing Parkinson's disease (PD), comprising: Preferably, obtaining primary somatic cells from said subject having or at risk of developing PD and generating iPSCs from said primary cells; Preferably, treating the iPSCs with quercetin for a time sufficient to reduce the number of SOX1-positive cells, KI67-positive cells, SOX1 / KI67 double-positive cells, SOX1 / PAX6 double-positive cells, and SOX1 / PAX6 / KI67 triple-positive cells; Producing a cell population containing mDAP by a method according to any one of claims 1 to 16; and administering the cell population to the subject A method comprising: [Invention 20] 20. The method of claim 19, wherein the cells are administered by implantation, optionally using magnetic resonance imaging-guided stereotaxic surgery, directly into or near the affected region of the subject's brain, preferably bilaterally into one or more of the caudate nucleus, putamen, and substantia nigra. [Invention 21] 21. The method of claim 20, wherein the cells are administered via injection, preferably by a device, with a single injection point, preferably in the superior parasagittal region of the cerebral cortex, preferably by three injection tracts, creating a column spanning the sagittal extent of the putamen. [Invention 22] 22. The method of claim 21, wherein a dose of about 1 million, 2 million, 3 million, 4 million, 5 million, 6 million, 7 million, or 8 million cells is administered, preferably with the cells split evenly between the three injection routes. [Invention 23] 23. The method of any one of claims 19 to 22, wherein both hemispheres are treated and the cells are administered to one hemisphere in a first treatment and to the other hemisphere in a second treatment. [Invention 24] 24. The method of claim 23, wherein the time between said first treatment and said second treatment is about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 48 ​​months, 54 months, or 60 months. [Invention 25] 25. The method according to any one of claims 19 to 24, wherein at least one antibiotic is administered before, during and / or after surgery. [Invention 26] A culture dish for culturing cells, wherein a grid having grid lines spaced 1.5 to 2.5 cm apart, preferably a 2 x 2 cm grid, is provided on the back of the dish. [Invention 27] 27. The culture dish according to claim 26, wherein the grid is formed as part of the dish by being printed or etched onto the back surface. [Invention 28] 27. The culture dish according to claim 26, comprising a thermoplastic resin made of polystyrene, polyethylene, polypropylene, polycarbonate, or polyvinyl. [Invention 29] 27. A culture dish according to claim 26, comprising a layer of a biological matrix hydrogel support, preferably a basement membrane extract or a synthetic matrix, disposed therein.

Claims

1. 1. A method for generating a population of midbrain dopaminergic progenitor cells (mDAP), comprising: providing a population of induced pluripotent stem cells (iPSCs), preferably human iPSCs; seeding the cell population into separate regions within a biological matrix hydrogel support at a density of about 5,000 to 20,000 cells per region, preferably about 10,000 cells per region, with sufficient distance between the regions to maintain separation between the regions, wherein the regions are about 2 to 10 mm in diameter and the distance between the regions is 1 to 3 cm; and maintaining the cells in the isolated region under conditions sufficient for the iPSCs to differentiate into mDAPs. A method comprising:

2. The method of claim 1 , wherein the biological matrix hydrogel support is a basement membrane extract or a synthetic matrix.

3. The method of claim 1 or 2, wherein the cells are suspended in the biomatrix hydrogel prior to seeding.

4. The method of any one of claims 1 to 3, wherein the iPSCs express alkaline phosphatase (AP) and TRA-1-60.

5. 5. The method of any one of claims 1 to 4, wherein the mDAPs express one, two, or more markers including FOXA2, OTX2, LMX1A, and / or EN1, preferably at least FOXA2 and LMX1A; and optionally, the mDAPs are TH+ cells that co-express FOXA2, LMX1A, and NURR1.

6. The iPSCs Inducing expression of OCT4, KLF4, SOX2, and L-MYC in cells of a population of primary cells from the subject; and maintaining the primary cells under conditions sufficient for them to become iPSCs.

6. The method of claim 1, wherein the cell is produced by a method comprising:

7. 7. The method of claim 6, wherein the step of inducing expression of OCT4, KLF4, SOX2, and L-MYC comprises transfecting the primary cells with a polycistronic episomal vector comprising coding sequences for human Oct4 linked to a foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4, SOX2 linked to a porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC.

8. 6. The method of any one of claims 1 to 5, wherein the iPSCs are produced by a method comprising expressing in primary cells from the subject one or more exogenous microRNAs (miRNAs) selected from the group consisting of miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and miR-371 / 373.

9. The method of claim 8, wherein the miRNA comprises one or both of miR-302s and miR-200c.

10. The method of claim 9, comprising the step of introducing into said cells an episomal vector comprising a sequence encoding miR-302s and miR-200c.

11. 6. The method of any one of claims 1 to 5, wherein the iPSCs are produced by a method comprising expressing all of OCT4, KLF4, SOX2, miR-302s and miR-200c in primary cells derived from the subject.

12. 12. The method of claim 11, comprising the step of introducing into the cell (i) a vector, preferably a viral vector or a polycistronic episomal vector, comprising coding sequences for human Oct4, KLF4 linked to a foot-and-mouth disease virus 2A sequence (OCT4-F2A), SOX2 linked to a porcine teschovirus 2A sequence (SOX2-P2A), and L-MYC, or the mature RNAs of Oct4, KLF4, SOX2, and L-MYC, or the corresponding proteins, and (ii) a vector, preferably a viral vector or an episomal vector, comprising sequences encoding miR-302s and miR-200c, or mature miR-302s and mature miR-200c.

13. 13. The method of any one of claims 1 to 12, wherein the cell is a human cell.

14. The method of claim 6, further comprising reducing undifferentiated iPSCs, preferably by inhibiting the BIRC5 gene.

15. A cell population containing mDAP, produced by the method of any one of claims 1 to 14.

16. A composition comprising the cell population of claim 15.

17. 1. A pharmaceutical composition for use in a method of treating a subject having or at risk of developing Parkinson's disease (PD), comprising:

15. The method of claim 1, further comprising: using iPSCs, preferably generated from primary somatic cells obtained from the subject having or at risk of developing PD, wherein the iPSCs have been treated with quercetin for a time sufficient to reduce the number of SOX1-positive cells, KI67-positive cells, SOX1 / KI67 double-positive cells, SOX1 / PAX6 double-positive cells, and SOX1 / PAX6 / KI67 triple-positive cells; The pharmaceutical composition.

18. 18. The pharmaceutical composition of claim 17, wherein the pharmaceutical composition is adapted to be administered by implanting the cell population directly into or near an affected region of the subject's brain, preferably bilaterally, into one or more of the caudate nucleus, putamen, and substantia nigra, optionally using magnetic resonance imaging-guided stereotaxic surgery.

19. 19. The pharmaceutical composition of claim 18, wherein the cell population is administered via injection, preferably by a device, with a single injection point, preferably in the superior parasagittal region of the cerebral cortex, preferably by three injection tracts, creating a column spanning the sagittal extent of the putamen.

20. 20. The pharmaceutical composition of claim 19, wherein the cell population is administered in a dose of about 1 million, 2 million, 3 million, 4 million, 5 million, 6 million, 7 million, or 8 million cells, preferably with the cell population evenly divided between the three infusion routes.

21. 21. The pharmaceutical composition of any one of claims 17 to 20, wherein the pharmaceutical composition is used such that both hemispheres are treated, the cell population being administered to one hemisphere in a first treatment and to the other hemisphere in a second treatment.

22. 22. The pharmaceutical composition of claim 21, wherein the time between the first treatment and the second treatment is about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 48 ​​months, 54 months, or 60 months.

23. 23. The pharmaceutical composition of any one of claims 17 to 22, wherein the pharmaceutical composition is used in combination with at least one antibiotic agent, and the antibiotic agent is administered before, during, and / or after surgery.

Images