PCR reagent storage method and PCR testing method

By mixing and refrigerating PCR reagents in separate containers, the method significantly reduces PCR testing time from sample collection to completion, addressing the inefficiencies of conventional methods and enabling rapid diagnosis of cerebral infarction types.

JP7794211B2Active Publication Date: 2026-01-06SHIMADZU SEISAKUSHO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023559418
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-11-11
Filing Date
2022-06-29
Publication Date
2026-01-06
Estimated Expiration
2042-06-29

AI Technical Summary

Technical Problem

Conventional PCR testing methods take longer than one hour due to tedious preparation steps involving multiple reagents and pretreatment processes, which delays the diagnosis of cerebral infarction types based on RNF213 gene p.R4810K polymorphism.

Method used

A method involving the mixing of DNA polymerase, primer, and buffer solutions in separate containers, followed by refrigeration, to prepare a PCR reaction solution, which is then used with a pretreatment solution to extract nucleic acids and perform PCR.

Benefits of technology

This method allows PCR testing to be completed in a short time, typically within 60 minutes, by simplifying the preparation process and ensuring accurate results through refrigerated storage of reagents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007794211000001
    Figure 0007794211000001
  • Figure 0007794211000002
    Figure 0007794211000002
  • Figure 0007794211000003
    Figure 0007794211000003
Patent Text Reader

Abstract

This preservation method is a method for preserving a PCR reagent, and comprises, in order: (1) a step in which a first composition including a DNA polymerase, a second composition including a primer, and a third composition including a buffer fluid are all mixed and a reaction fluid is prepared; and (2) a step in which the reaction fluid is refrigerated. The first composition, the second composition, and the third composition are respectively accommodated in different containers.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for storing PCR reagents and a PCR testing method. [Background technology]

[0002] In recent years, the incidence of strokes has been increasing, with cerebral infarction accounting for approximately 70–80% of all strokes. Cerebral infarction occurs when a blood vessel in the brain becomes blocked, preventing sufficient blood flow to brain cells beyond the blocked blood vessel, resulting in their death. Cerebral infarction is primarily classified into three types: atherothrombotic cerebral infarction (a condition in which a large blood vessel in the brain is blocked due to arteriosclerosis), lacunar infarction (a condition in which a small blood vessel deep within the brain is blocked), and cardiogenic cerebral embolism (a condition in which a blood clot formed elsewhere, such as in the heart, travels and blocks the bloodstream). Patients who have suffered a cerebral infarction are diagnosed with both the location and type of infarction, and treatment is tailored to the type of infarction diagnosed. The type of infarction is typically diagnosed by reviewing CT / MRI images or digitally reconstructed radiographs (DRR) displayed as a roadmap on fluoroscopic images taken during treatment.

[0003] Furthermore, because the incidence of cerebral infarction is particularly high in Japan compared to Western countries, the existence of genetic factors different from those in Westerners has been pointed out. It has been reported that the RNF213 gene p.R4810K polymorphism (a genetic polymorphism in which arginine at position 4810 in the protein encoded by the RNF213 gene is replaced by lysine) is a susceptibility gene for atherothrombotic cerebral infarction. Therefore, in recent years, attempts have been made to use information on the RNF213 gene p.R4810K polymorphism in addition to conventional imaging information to diagnose the type of cerebral infarction in patients with cerebral infarction, which is expected to lead to improved diagnostic accuracy. To determine whether a patient with cerebral infarction has the RNF213 gene p.R4810K polymorphism, blood is typically collected from the patient and the mutant form of the RNF213 gene p.R4810K polymorphism is detected by real-time PCR (see Patent Document 1). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Publication No. 2020-92660 Summary of the Invention [Problem to be solved by the invention]

[0005] In the acute phase of cerebral infarction, once a patient is transported to the hospital, blood samples are taken, and CT / MRI scans and interpretations are performed to confirm the location and type of cerebral infarction, and treatment is initiated promptly. Since the longer the start of initial treatment for cerebral infarction is delayed, the more severe the brain damage becomes, and treatment is therefore necessary as soon as possible. Therefore, when using information from the RNF213 gene p.R4810K polymorphism to determine the type of cerebral infarction during the acute phase, PCR testing must be completed in a short time (within approximately one hour).

[0006] However, with conventional PCR testing, the time from sample collection to PCR completion exceeds one hour. One of the reasons for this time is the tedious preparation steps before PCR testing. Specifically, a reagent kit consists of three or more types of reagents, such as an enzyme-containing reagent, a primer / probe-containing reagent, and a buffer-containing reagent. These are dispensed in the desired amounts just before PCR to prepare a PCR reaction solution, which is then mixed with a sample such as blood, and the mixture is then loaded into a PCR instrument. Extracting nucleic acids from a patient's sample (e.g., blood) also requires a pretreatment step in which a specialized processing solution is added to denature proteins and liberate nucleic acids. Furthermore, to prevent false-negative or false-positive diagnoses, a positive control and a negative control may be required, in which case the PCR reaction solution must be mixed with the control. Thus, with conventional methods, the preparation steps before loading the PCR instrument are time-consuming due to the tedious dispensing and mixing of each reagent. As a result, the entire PCR test time from sample collection to PCR completion exceeds one hour. Therefore, there is a demand to shorten the time required for PCR testing.

[0007] The present invention aims to provide a method that can complete a PCR test in a short period of time. [Means for solving the problem]

[0008] The first form of the method for storing PCR reagents of the present invention comprises the steps of (1) mixing a first composition containing a DNA polymerase, a second composition containing a primer, and a third composition containing a buffer solution to prepare a reaction solution, and (2) refrigerating the reaction solution, wherein the first composition, the second composition, and the third composition are each contained in a different container.

[0009] A first embodiment of the PCR testing method of the present invention includes, in order, a step of carrying out the first embodiment of the preservation method, a step of preparing a solution from which nucleic acids have been extracted by adding a pretreatment solution to a specimen, a step of mixing the solution from which nucleic acids have been extracted with the reaction solution, and a step of carrying out PCR on the mixed reaction solution. [Effects of the Invention]

[0010] According to the PCR reagent storage method and PCR testing method of the first embodiment, the PCR testing can be completed in a short time. [Brief explanation of the drawings]

[0011] [Figure 1] 1 shows a schematic diagram of the first type of preservation method (preparation step, mixing step, and refrigeration step). [Figure 2] 1 shows a schematic diagram of the PCR process of the first embodiment. [Figure 3] 3 shows the PCR detection results of Example 1, with Figure 3A showing the PCR results for the first positive control in the first PCR tube, Figure 3B showing the PCR results for the second positive control in the second PCR tube, Figure 3C showing the PCR results for the third positive control in the third PCR tube, and Figure 3D showing the PCR results for the sample-containing reaction solution in the fifth PCR tube. In each PCR result, the horizontal axis shows the PCR cycle number, the vertical axis shows fluorescence intensity, the solid line in the graph shows fluorescence intensity from the fluorescent-labeled probe (FAM) that binds to the wild-type base sequence, and the dashed line in the graph shows luminescence intensity from the fluorescent-labeled probe (ROX) that binds to the mutant base sequence. [Figure 4] 4 shows the PCR results of Example 2, with FIG. 4A showing the results for the first PCR tube, FIG. 4B showing the results for the second PCR tube, FIG. 4C showing the results for the third PCR tube, and FIG. 4D showing the results for the fifth PCR tube. [Figure 5] 5 shows the PCR results of Example 3, with FIG. 5A showing the results for the first PCR tube, FIG. 5B showing the results for the second PCR tube, FIG. 5C showing the results for the third PCR tube, and FIG. 5D showing the results for the fifth PCR tube. [Figure 6]6 shows the PCR results of Example 4, with FIG. 6A showing the results for the first PCR tube, FIG. 6B showing the results for the second PCR tube, FIG. 6C showing the results for the third PCR tube, and FIG. 6D showing the results for the sixth PCR tube. [Figure 7] The PCR results of Reference Example 1 are shown in FIG. 7A, the results of the first PCR tube, FIG. 7B, the results of the second PCR tube, FIG. 7C, the results of the third PCR tube, and FIG. 7D, the results of the sixth PCR tube. [Figure 8] A schematic diagram of the preservation method (preparation step, mixing step, and refrigeration step) performed in each example is shown. [Figure 9] Schematic diagrams of the PCR steps carried out in each example are shown. [Figure 10] The PCR results of Example 5 are shown, with FIG. 10A showing the results for the first PCR tube, FIG. 10B showing the results for the second PCR tube, FIG. 10C showing the results for the third PCR tube, and FIG. 10D showing the results for the sixth PCR tube. DETAILED DESCRIPTION OF THE INVENTION

[0012] 1. First Form A first embodiment of the present invention is a testing method using PCR (Polymerase Chain Reaction: nucleic acid amplification reaction), which sequentially comprises a preservation method and a PCR step, as shown in Figures 1 and 2. The first embodiment of the preservation method carried out in this first embodiment sequentially comprises (1) a preparation step and (2) a refrigeration step. In the PCR testing method of the first embodiment, the test subject of the PCR test, i.e., the nucleic acid to be amplified, will be described as a representative case where the RNF213 gene p.R4810K polymorphism is used, but the test subject is not limited to this polymorphism.

[0013] The RNF213 gene p.R4810K polymorphism (hereinafter sometimes abbreviated as "this polymorphism") is a polymorphism in which arginine at position 4810 in the protein encoded by the RNF213 gene is changed to lysine. This polymorphism is a single nucleotide polymorphism in which the 14576th base of the RNF213 gene is guanine (G) in the wild type but adenine (A) in the mutant type. This polymorphism exists in three forms: "mutant / mutant" homozygotes, "wild type / wild type" homozygotes, and "mutant / wild type" heterozygotes.

[0014] (Preparation process) In this step, a reaction solution is prepared by mixing a first composition containing a DNA polymerase, a second composition containing a primer, and a third composition containing a buffer solution. This step may, for example, include, in order, (i) a preparation step of preparing the first composition, the second composition, and the third composition, each contained in a different container, and (ii) a mixing step of mixing all of these first to third compositions.

[0015] (i) In the preparation step, a reaction solution reagent set is prepared. Preferably, in addition to the reaction solution reagent set, a pretreatment solution is also prepared.

[0016] The reaction solution reagent set essentially contains a DNA polymerase, a primer, and a buffer solution, and preferably further contains a probe and a dNTP mix. Specifically, it is a reagent kit consisting of at least a first composition containing a DNA polymerase, a second composition containing a primer, and a third composition containing a buffer solution, and these compositions are contained separately in three containers (e.g., vials).

[0017] The first composition contained in the first container contains a DNA polymerase, and is preferably a first liquid composition containing a DNA polymerase and a solvent.

[0018] The DNA polymerase is, for example, a thermostable DNA polymerase derived from a thermophilic bacterium, and specific examples thereof include Taq DNA polymerase, Tth DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, and mutants thereof. In order to reduce nonspecific amplification by the DNA polymerase, a hot-start DNA polymerase such as BIOTAQ® DNA polymerase may also be used.

[0019] The solvent for the first composition or the second composition is not limited, and examples thereof include aqueous solvents such as purified water, physiological saline, and buffer solutions, organic solvents such as glycerol, and mixed solvents thereof.

[0020] The second composition contained in the second container contains a primer, and is preferably a second liquid composition containing a primer, a probe, and a solvent.

[0021] The primer is an oligonucleotide that hybridizes (binds) to the polymorphism to be amplified and amplifies the polymorphism, and is preferably an oligonucleotide that amplifies a nucleotide sequence containing a genetic mutation corresponding to the polymorphism. The nucleotide sequence containing a genetic mutation corresponding to the polymorphism is a nucleotide sequence containing the 14576th base (guanine or adenine) of the RNF213 gene. By selecting a primer that hybridizes to the polymorphism, the PCR reaction solution containing the first to third compositions is less susceptible to reaction with the coexisting DNA polymerase when stored in a refrigerator, making PCR possible even after storage.

[0022] The primers usually consist of a pair of forward and reverse primers. The base length of each primer pair is preferably, for example, 10 bases or more and 30 bases or less. Specific examples of primer pairs include the oligonucleotides shown in SEQ ID NO: 1 and SEQ ID NO: 2. (Forward) 5'-TTCCAGCAAGT-3' (SEQ ID NO: 1) (Reverse) 5'- ACAGTCCTGGTCCTGTCAGA -3' (SEQ ID NO: 2)

[0023] The probe is an oligonucleotide probe capable of hybridizing to the polymorphism, preferably a fluorescently labeled oligonucleotide probe. The fluorescently labeled oligonucleotide probe may be a single type or a combination of two or more types. A preferred example is a combination of a fluorescently labeled oligonucleotide probe that hybridizes to a mutant nucleotide sequence containing a genetic mutation corresponding to the polymorphism and a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence. The mutant nucleotide sequence containing a genetic mutation corresponding to the polymorphism is a nucleotide sequence containing the 14576th base in the RNF213 gene when the 14576th base is a mutant (adenine). The wild-type nucleotide sequence corresponding to the mutant nucleotide sequence is a nucleotide sequence containing the 14576th base in the RNF213 gene when the 14576th base is a wild-type (guanine). This allows the mutant and wild-type forms to be distinguished from each other and simultaneously detected. Furthermore, the probe that binds to this polymorphism is less susceptible to reaction with the coexisting DNA polymerase when the PCR reaction solution containing the first to third compositions is stored in a refrigerator, making it possible to reliably perform PCR even after storage.

[0024] The base length of such a probe is preferably, for example, 10 to 30 bases. A specific example of a probe combination is a fluorescently labeled oligonucleotide probe having the base sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4. Probe binding to mutant base sequence: 5'-CTCCATCAAAGGCTTCCT-3' (SEQ ID NO: 3) Probe binding to the wild-type base sequence: 5'-CTCCATCAGAGGCTTCCT-3' (SEQ ID NO: 4)

[0025] In a fluorescently labeled oligonucleotide probe, the ends of its base sequence are modified with a reporter (fluorescent dye) and a quencher (quenching substance). Examples of types of fluorescently labeled oligonucleotide probes include hydrolysis probes (e.g., TaqMan probes), molecular beacon probes, and cycling probes, with hydrolysis probes being preferred. A hydrolysis probe is a probe whose 5' and 3' ends are modified with a reporter or quencher. Specifically, a reporter is bound to the 5' end of the probe shown in SEQ ID NO: 3 or 4, and a quencher is bound to the 3' end.

[0026] Examples of reporters that can be modified include FAM (6-carboxyfluorescein), ROX (6-carboxy-X-rhodamine), TET (6-carboxy-4,7,2',7'-tetrachlorofluorescein), HEX (4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein), Cy3 (cyanine dye), and Cy5 (cyanine dye). When using two of the above oligonucleotide-labeled probes, it is best to select a combination of reporters whose fluorescence wavelength ranges do not overlap.

[0027] The quencher to be modified is determined appropriately depending on the reporter, and examples include TAMRA (6-Carboxytetramethylrhodamine), BHQ-1 ([(4-(2-Nitro-4-methyl-phenyl)-azo)-yl-((2-methoxy-5-methyl-phenyl)-azo)]-anilline), BHQ-2 ([(4-(1-Nitro-phenyl)-azo)-yl-((2,5-dimethoxy-phenyl)-azo)]-anilline), Dabcyl (4-[[4-Dimethylamino)-phenyl]-azo]-benzoic acid), and Eclipse (4-[[2-Chloro-4-nitro-phenyl]-azo]-anilline).

[0028] The third composition contained in the third container contains a buffer solution, and is preferably a third liquid composition containing a buffer solution and a dNTP mix.

[0029] Examples of the buffer solution include phosphate buffer, Tris buffer, borate buffer, Good's buffer (HEPES, etc.), and the like.

[0030] The dNTP mix is ​​a substrate for the PCR reaction and is a mixture consisting of dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate), and dTTP (thymidine triphosphate).

[0031] The third composition may further contain a substance that suppresses the action of PCR inhibitors. Specifically, it may contain a substance that binds to negatively charged biological substances (e.g., certain sugars or dyes) that adsorb to DNA polymerase or positively charged biological substances (e.g., certain proteins) that adsorb to DNA, thereby neutralizing the PCR inhibitory action of the negatively or positively charged substances. Examples of buffer solutions containing such substances include Ampdirect (registered trademark, manufactured by Shimadzu Corporation), a gene amplification reagent. This allows the nucleic acids contained in the treated sample solution together with impurities to be subjected to PCR without purification, thereby enabling PCR testing in a short time.

[0032] The third composition may further contain additives such as magnesium chloride (MgCl 2 ) and potassium chloride (KCl) from the viewpoint of further activating the DNA polymerase enzyme.

[0033] In addition to the above components, Compositions 1 to 3 may contain various additives for desired purposes. The suitable blending ratios of the above components in Compositions 1 to 3 can be determined appropriately by those skilled in the art.

[0034] The reaction reagent set preferably further includes a positive control. The positive control prevents a false-negative diagnosis, in which a negative result is erroneously determined due to an inappropriate PCR. The positive control contains a positive control nucleic acid.

[0035] The positive control nucleic acid is the polymorphism and may be any of (a) a wild-type / wild-type homozygote, (b) a mutant / mutant homozygote, or (c) a mutant / wild-type heterozygote. Preferably, these three types are prepared separately, i.e., three types of positive control nucleic acids are prepared. This makes it easy to determine which conjugate the test subject corresponds to. The positive control nucleic acid is contained in a container separate from the pretreatment solution and the first to third compositions. When two or three types of positive control nucleic acids are present, they are each contained in a separate container. The control nucleic acid may be artificially synthesized or may be extracted and amplified in advance from another test specimen. The positive control is contained in a container separate from the first to third compositions.

[0036] The pretreatment solution provided with the reaction solution reagent set is a proteolysis solution for extracting (eluting) nucleic acids contained in membranes such as envelopes in biological samples collected from subjects. For example, when blood is used as the sample, the pretreatment solution is a blood dissolving solution, specifically containing blood dissolving components such as surfactants. Examples of surfactants include anionic surfactants, cationic surfactants, amphoteric surfactants, and nonionic surfactants. From the viewpoints of solubility and inertness to reactions with other components, anionic surfactants and nonionic surfactants are preferred, and anionic surfactants are more preferred. Examples of anionic surfactants include sodium dodecyl sulfate, ammonium dodecyl sulfate, sodium cholate, alkylbenzene sulfonates, and alkyl carboxylates. Examples of nonionic surfactants include polyoxyethylene sorbitan monolaurate (Tween® 20), polyoxyethylene sorbitan monooleate (Tween® 80), and polyoxyethylene pt-octylphenol (Triton® X-100).

[0037] When the pretreatment solution is used as a blood dissolving solution, it may preferably further contain an anticoagulant such as ethylenediaminetetraacetic acid, citric acid, etc. Note that the pretreatment solution may contain a protease such as proteinase instead of a surfactant, if necessary, but it is preferable not to contain it.

[0038] The solvent for the pretreatment liquid is not limited, and examples thereof include aqueous solvents such as purified water, physiological saline, and buffer solutions, organic solvents such as glycerol, and mixtures thereof. The pretreatment liquid is contained in a container separate from the first to third compositions.

[0039] (ii) In the mixing step, the first composition, the second composition, and the third composition are mixed. That is, these three compositions are placed in one container. This prepares a PCR reaction solution (hereinafter sometimes abbreviated as "reaction solution").

[0040] After mixing, the reaction solution is dispensed into test containers. Preferably, multiple test containers are prepared. Specifically, in addition to a specimen test container (an example of a second test container), a positive control test container (an example of a first test container) and a negative control test container are prepared to check for false negatives and false positives. Preferably, three positive control test containers are prepared so that three types of conjugates can be measured.

[0041] A portion of the reaction solution is dispensed into the specimen test container and the negative control test container. A portion of the reaction solution is dispensed into the positive control test container together with the positive control nucleic acid. That is, (a) a wild-type / wild-type homozygote, (b) a mutant / mutant homozygote, or (c) a mutant / wild-type heterozygote is dispensed into the first, second, or third positive control test container together with the reaction solution. The amount of each reaction solution dispensed is determined appropriately depending on the PCR device and the type of nucleic acid, but may be, for example, 5 to 50 μL. The amount of the positive control nucleic acid may be, for example, 0.1 to 10 μL. In addition to these test containers, from the perspective of starting a PCR test with shorter preparation times, it is preferable to also prepare a pretreatment test container (an example of a third test container), and dispense a pretreatment solution into this container.

[0042] This results in the preparation of a specimen test container containing only the reaction solution, a negative control test container containing only the reaction solution, (a) a first positive control test container containing a wild-type / wild-type homozygote and a reaction solution, (b) a second positive control test container containing a mutant / mutant homozygote and a reaction solution, and (c) a third positive control test container containing a mutant / wild-type heterozygote and a reaction solution.

[0043] The test container is preferably a container that can be directly set into a PCR device for testing, such as a PCR tube. PCR tubes can be procured as strip tubes, which are multiple PCR tubes connected together. The strip tube is used by cutting each tube individually when PCR is performed. By using a single strip tube to connect each connected tube, respectively, as a test container for the specimen, a test container for the positive control, and a test container for the negative control, the PCR reagent set can be stored together in a single strip tube, making management and refrigeration easier and further shortening the time from the start of work to setting up the PCR device. In this case, for management reasons, it is preferable to store the pretreatment solution in a separate PCR tube in the same strip tube, and to also prepare a pretreatment test container containing only the pretreatment solution. Furthermore, one strip tube (e.g., an eight-tube strip) may be prepared and divided into multiple sets (set A, set B), with positive control test containers and negative control test containers assigned to one set (e.g., set A consisting of four tubes), and specimen test containers and pretreatment test containers assigned to the other set (e.g., set B consisting of four tubes) (see Figures 8-9). This reduces the risk of contamination of the positive and negative controls when specimens are added to the pretreatment test containers and stirred, or when specimens are dispensed into specimen test containers. Note that the strip tube may be divided from the above viewpoint, but it is not necessary to divide it.

[0044] When mixing the positive control nucleic acid with the reaction solution, the reaction solution may be temporarily stored in a refrigerator before mixing. This prevents deterioration of the positive control nucleic acid due to prolonged contact with the reaction solution, and prevents a decrease in PCR accuracy. In this case, the temporary storage time may be, for example, within 60 days, preferably within 30 days.

[0045] (refrigeration process) In this step, the reaction solution is refrigerated. Specifically, the specimen test container containing only the reaction solution, the negative control test container containing only the reaction solution, and the positive control test containers (a) to (c) containing the positive control nucleic acid and the reaction solution are stored in a refrigerator. At this time, a pretreatment test container containing only the pretreatment solution may also be stored in the refrigerator along with these containers.

[0046] The refrigeration temperature is, for example, 10°C or lower, preferably 5°C or lower, or, for example, 0°C or higher. If the temperature exceeds 10°C, the DNA polymerase in the reaction solution may be activated during refrigeration, potentially reducing the accuracy of PCR after storage. On the other hand, if the temperature falls below 0°C, the reaction solution may freeze, requiring time for thawing or damaging each of the main components, such as the positive control nucleic acid.

[0047] The refrigeration time is, for example, 1 hour or more, preferably 24 hours or more, and for example, 60 days or less. If the refrigeration time is too short, the preparation process may be performed while treating an emergency patient, such as a patient with cerebral infarction, making it impossible to provide a simple PCR testing method. On the other hand, if the refrigeration time is too long, the components in the reaction solution may deteriorate.

[0048] The PCR reagent stored by this process comprises at least a reaction solution (for specimen testing) containing DNA polymerase, a probe, and a buffer solution in one container, and is preferably a reagent kit comprising the reaction solution (for specimen testing), a reaction solution (for negative control) having the same components as the reaction solution, a reaction solution (for positive control) containing a positive control nucleic acid, and a pretreatment solution, each in separate containers.

[0049] (PCR process) In this step, PCR is carried out using the PCR reagents stored in the refrigeration step. That is, PCR is carried out using the PCR reagent set, and the PCR product (amplified nucleic acid) is detected.

[0050] First, a specimen containing the nucleic acid (polymorphism) to be tested is collected. The specimen is a biological sample from which nucleic acid can be collected, and examples thereof include body fluids such as blood, cerebrospinal fluid, lymph, saliva, nasal mucus, urine, and feces; and cells or tissues such as hair, nails, skin, and mucous membranes. From the viewpoints of minimal invasiveness and ease of handling, blood is preferred. Examples of blood include whole blood, plasma, and serum.

[0051] Next, nucleic acids are extracted from the specimen as a pretreatment. Specifically, the specimen is added to a pretreatment test container and mixed with a pretreatment solution. This allows the dissolving action of the pretreatment solution to produce a specimen-treated solution in which nucleic acids have been extracted from the specimen. At this time, the specimen may be diluted 2 to 10 times beforehand as necessary before mixing with the pretreatment solution. Furthermore, a heat treatment may be carried out as necessary. When heating is performed, the heating temperature is, for example, 50°C or higher and 95°C or lower, and the heating time is, for example, 3 minutes or higher and 10 minutes or lower.

[0052] Next, the sample-treated solution is added to the sample test container, i.e., the extracted nucleic acid is mixed with the reaction solution, thereby preparing a sample-containing reaction solution in the sample test container.

[0053] Next, the specimen test container is set in a PCR device together with the positive control test containers (first to third positive control test containers) and the negative control test container, and PCR is carried out.

[0054] PCR is performed for several tens of cycles, each cycle consisting of (i) a heat denaturation step to convert double-stranded DNA into single strands, (ii) an annealing step to hybridize PCR primers and the probe of the present invention to the single-stranded DNA, and (iii) an extension step to extend the DNA from the PCR primers using DNA polymerase to convert it into double strands. Before each of these several tens of cycles, a pre-incubation (e.g., at 95°C for 300 to 600 seconds) is appropriately performed.

[0055] As a specific method of PCR, real-time PCR is preferably adopted. In real-time PCR, the amount of PCR amplification is monitored and analyzed in real time. Examples of PCR methods include the intercalator method and the hydrolysis probe method. In the first embodiment, the hydrolysis probe method is preferred from the viewpoint of being able to detect multiple conjugates using the above-mentioned fluorescently labeled probe.

[0056] The number of PCR cycles is, for example, 30 or more, and, for example, 50 or less, preferably 35 or less. If the lower limit of the number of cycles is 30, the nucleic acid can be sufficiently amplified and the rising edge of the amplification curve can be confirmed. On the other hand, if the upper limit of the number of cycles is 50, saturation of amplification can be prevented and the measurement time can be shortened. In particular, by setting the upper limit to 35, the rising edge of the amplification curve can be confirmed and the process from sample collection to completion of PCR can be completed in a short time.

[0057] The heating temperature and time per PCR cycle are determined appropriately, but it is preferable to set at least the denaturation temperature and time and the annealing temperature and time (upper and lower temperature limits) to approximately 95±3°C for 5±3 seconds and 60±3°C for 15±3 seconds, respectively. This makes it possible to confirm the rise of the PCR amplification curve even with a small number of PCR cycles, such as 35, and to achieve PCR in a short period of time (for example, approximately 45 minutes).

[0058] The PCR test results are then confirmed. That is, the presence or absence of an increase in the amplification curve in the sample-containing reaction solution is confirmed on the PCR device monitor, and a positive or negative diagnosis is made. Specifically, the amplification curve in the sample-containing reaction solution is confirmed to be either (a) the fluorescence emitted by the fluorescently labeled probe that binds to the mutant base sequence, or (b) the fluorescence emitted by the fluorescently labeled probe that binds to the wild-type base sequence, and it is determined whether the sample contains a mutant base sequence and / or a wild-type base sequence. If the sample contains a mutant base sequence, the result is positive, i.e., a diagnosis of suspected atherothrombotic cerebral infarction can be made.

[0059] At the same time, the presence or absence of a rise in the amplification curve is also confirmed for each of the positive controls (first to third positive controls) and the negative control. Specifically, by confirming that the desired rise in the amplification curve is observed for each positive control and that no rise in the amplification curve is observed for the negative control, the success or failure of a false negative or false positive for the sample-containing reaction solution is diagnosed.

[0060] The first embodiment is a method for preserving PCR reagents, comprising the steps of (1) mixing all of the first, second, and third compositions to prepare a reaction solution, and (2) refrigerating the reaction solution, the first, second, and third compositions being contained in separate containers. Specifically, in this preservation method, PCR reagents are prepared, each consisting of a DNA polymerase, primers, and buffer solution, all of which are contained in separate containers, and then mixed and refrigerated. This reduces the time from sample collection to PCR completion, particularly the time required for PCR preparation. Specifically, simply adding refrigerated reaction solution to a sample from which nucleic acid has been extracted (e.g., a sample to which a pretreatment solution has been added) and placing the sample in a PCR device reduces the number of preparatory steps and significantly shortens the preparatory time required for PCR. Furthermore, because the stored reaction solution is refrigerated, deterioration of the reaction solution is suppressed, and the rise of the PCR amplification curve can be reliably detected even after refrigeration, enabling PCR measurement. In particular, the PCR reaction solution contains a primer pair and a probe that bind to the polymorphism, which are less likely to react when refrigerated, but does not contain highly active enzymes such as proteinases, making it less likely for the components in the reaction solution to react with each other when stored in a refrigerator, and allowing for long-term storage of the components in a liquid state. Therefore, a PCR testing method incorporating the first type of storage method can shorten the time from sample collection to PCR completion, for example, to within 60 minutes.

[0061] In the first form, it is preferable to predict the use of PCR reagents and carry out this storage method at least one day before the predicted date of use. As an example, multiple PCR reagents are stored using this storage method, and as soon as the PCR reagents are used (consumed), new PCR reagents are added in the same number as used and stored using this storage method. This allows a certain number of PCR reagents to be kept on hand, making it possible to always perform PCR tests on emergency patients in a short time.

[0062] 2. Second Form In the first embodiment, the reaction solution reagent set preferably includes a positive control, which is mixed with the reaction solution; however, for example, the reaction solution reagent set does not necessarily need to include a positive control. In this embodiment, a preferred example of the stored PCR reagent is, for example, a reagent kit including a reaction solution (for specimen testing), a reaction solution (for negative control) having the same components as the reaction solution, and a pretreatment solution, each in separate containers. In the present invention, the first embodiment is preferred from the viewpoint of being able to confirm false negatives and improving test accuracy.

[0063] 3. Aspects It will be appreciated by those skilled in the art that the exemplary embodiments described above are examples of the following aspects.

[0064] (Item 1) A method according to one embodiment is a method for preserving PCR reagents, and includes the steps of (1) preparing a reaction solution by mixing a first composition containing a DNA polymerase, a second composition containing a primer, and a third composition containing a buffer solution, and (2) refrigerating the reaction solution, in that order. The first composition, the second composition, and the third composition may each be contained in a different container. This allows PCR testing to be performed with a simple procedure, and the PCR test can be completed in a short time. In other words, there is no need to mix the first to third compositions immediately before PCR; the reaction solution, which has been refrigerated, can be mixed with a sample and set in a PCR device. This greatly simplifies the preparation work for PCR, and allows processing to be completed in a short time.

[0065] (Item 2) In the method described in item 1, the PCR reagent may further comprise a positive control, and in step (2), a portion of the reaction solution may be placed in a first test container together with the positive control, and only a portion of the reaction solution may be placed in a second test container, and then the first and second test containers may be refrigerated. In this way, the first test container containing the positive control can be placed in a PCR device as is after refrigeration, thereby completing the PCR test for the positive control, and simultaneously confirming false negatives, thereby completing the PCR test in a short time.

[0066] (Item 3) In the method according to item 1 or 2, the second composition may further contain an oligonucleotide probe, thereby enabling PCR to be carried out reliably.

[0067] (Item 4) In the method according to any one of items 1 to 3, the refrigeration temperature in step (2) may be 10° C. or lower and 0° C. or higher. This can suppress PCR degradation during use after storage, and can also suppress deterioration due to freezing and thawing of the reaction solution.

[0068] (Item 5) In the method according to any one of Items 1 to 4, the nucleic acid amplified by the PCR reagent may be the p.R4810K polymorphism of the RNF213 gene, thereby enabling PCR testing of the p.R4810K polymorphism of the RNF213 gene and diagnosing atherothrombotic cerebral infarction.

[0069] (Item 6) In the method according to item 5, the second composition may contain a primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the polymorphism, a fluorescently labeled oligonucleotide probe that binds to a mutant nucleotide sequence containing a genetic mutation corresponding to the polymorphism, and a fluorescently labeled oligonucleotide probe that binds to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence. This allows three types of positive control results (wild-type / wild-type homozygote, mutant / mutant homozygote, and mutant / wild-type heterozygote) to be obtained, thereby reliably preventing false-negative diagnoses.

[0070] (Item 7) In the method according to item 2, the PCR reagent may further comprise a pretreatment liquid, and in step (2), the pretreatment liquid may be contained in a third test container and refrigerated. This allows nucleic acids contained in a membrane in the sample to be extracted, ensuring reliable PCR. Furthermore, since a desired amount of treatment liquid can be added to the third test container in advance, there is no need to dispense the pretreatment liquid when collecting the sample, and the sample can be diluted and stirred in the third test container using pipetting. As a result, PCR testing can be started with shorter preparation times.

[0071] (Item 8) In the method according to item 7, the pretreatment solution may be a blood dissolving solution containing an anionic surfactant, which allows nucleic acids to be extracted from the blood sample and ensures reliable PCR.

[0072] (Item 9) A PCR testing method of the first embodiment may include, in order, a step of carrying out the preservation method according to any one of Items 1 to 6, a step of applying a pretreatment solution to a specimen to prepare a solution from which nucleic acids have been extracted, a step of mixing the solution from which nucleic acids have been extracted with the reaction solution, and a step of carrying out PCR on the mixed reaction solution. This allows the results of the PCR testing to be obtained in a short time.

[0073] (Item 10) In the PCR testing method according to Item 9, the number of PCR cycles may be between 30 and 35. This allows the time required for PCR to be further reduced, for example, the PCR amplification time to be within 45 minutes, and as a result, the time from sample collection to completion of PCR to be within 60 minutes. [Example]

[0074] The present invention will now be described in detail with reference to examples, but the scope of the present invention is not limited to these examples.

[0075] <Examples 1 to 4> (Preservation process) The first vial contained BIOTAQ® DNA polymerase (Bioline) and purified water; the second vial contained the PCR primer pair shown in SEQ ID NO:1 (forward) and SEQ ID NO:2 (reverse), the fluorescently labeled probes shown in SEQ ID NO:3 and SEQ ID NO:4 (fluorescent dyes: ROX and FAM, respectively), and purified water; and the third vial contained dNTP mix, Ampdirect reagent (Shimadzu Corporation), KCl, MgCl, and Tris buffer. Additionally, a vial for blood lysis solution (pretreatment solution) containing an anionic surfactant, glycerol, and Tris buffer was prepared.

[0076] Subsequently, the liquid compositions in vials 1 to 3 were mixed to prepare a PCR reaction solution, which was then temporarily stored in a refrigerator at 4°C for 5 days.

[0077] Next, an eight-strip PCR tube with a lid was prepared. A portion of the reaction mixture was dispensed into the first PCR tube (first test container) together with the wild-type gene for the RNF213 gene p.R4810K polymorphism (wild-type / wild-type homozygote: G / G type) as a positive control nucleic acid to prepare the first positive control. A portion of the PCR reaction mixture was dispensed into the second PCR tube (first test container) together with the mutant gene (mutant / mutant homozygote: A / A type) as a positive control nucleic acid to prepare the second positive control. A portion of the PCR reaction mixture was dispensed into the third PCR tube (first test container) together with the mutant gene and the wild-type gene (wild-type / mutant heterozygote: G / A type) as positive control nucleic acids to prepare the third positive control. A portion of the PCR reaction mixture alone was dispensed into the fourth PCR tube to prepare the negative control. Only a portion of the PCR reaction solution was dispensed into the fifth to seventh PCR tubes, and these containers were designated as specimen test containers (second test containers). In other words, three samples were prepared for PCR testing. Only the blood lysis solution (pretreatment solution) was dispensed into the eighth PCR tube, and this container was designated as the pretreatment test container (third test container). To prevent contamination, the strip tube was cut into the first to fourth PCR tubes (set A) and the fifth to eighth PCR tubes (set B) (see Figures 8 and 9).

[0078] These eight PCR tubes were then capped and further stored in a refrigerator at 4°C for the desired time (1 hour, 24 hours, 9 days, or 42 days), and then removed.

[0079] (PCR process) A human blood sample (whole blood; provided by the National Cerebral and Cardiovascular Center, a national research and development organization) was added to the eighth PCR tube and pipetted to obtain a 10-fold diluted sample treatment solution. The sample treatment solution was then dispensed into the fifth to seventh PCR tubes to prepare sample-containing reaction solutions in which the sample treatment solution and PCR reaction solution were mixed in the fifth to seventh PCR tubes.

[0080] Next, PCR tubes 1 to 7 were placed in a real-time PCR device (LightCycler 96 System, Nippon Genetics) and PCR was performed. The conditions included pre-incubation at 95°C for 600 seconds, followed by 50 cycles of 95°C for 10 seconds and 60°C for 30 seconds. The total PCR time was 80 minutes.

[0081] The PCR results for PCR tubes 1 to 3 and 5 where the storage time after dispensing into PCR tubes was 1 hour are shown in Figure 3 as Example 1. The PCR results for PCR tubes 1 to 3 and 5 where the storage time was 24 hours are shown in Figure 4 as Example 2. The PCR results for PCR tubes 1 to 3 and 5 where the storage time was 9 days are shown in Figure 4 as Example 5. The PCR results for PCR tubes 1 to 3 and 5 where the storage time was 42 days are shown in Figure 6 as Example 4. In each figure, the solid line represents the luminescence (FAM) due to the fluorescently labeled probe binding to the wild-type base sequence, and the dashed line represents the luminescence (ROM) due to the fluorescently labeled probe binding to the mutant base sequence. In addition, the PCR results for the fourth PCR tube were negative in all of Examples 1 to 4, with no rise in the amplification curve observed.

[0082] <Reference example 1> The PCR results for the first to eighth PCR tubes prepared and PCR performed immediately after preparing the PCR reaction solution are shown in Figure 7. The PCR result for the fourth PCR tube showed no rise in the amplification curve and was negative.

[0083] From the above results, it was found that all of Examples 1 to 4 showed amplification curves almost similar to those of Reference Example 1, and therefore that appropriate PCR testing was possible even after refrigeration.

[0084] <Example 5> Compared to Example 2, the PCR conditions were changed to a pre-incubation at 95°C for 300 seconds, a PCR cycle of 95°C for 5 seconds and 60°C for 15 seconds, and 35 PCR cycles, shortening the PCR time to 45 minutes. The results are shown in Figure 10. These results demonstrate that even with a PCR time of 45 minutes, the rise of the amplification curve can be sufficiently confirmed and can be used to determine the quality of the test.

Claims

1. 1. A method for storing PCR reagents, comprising: (1) preparing a reaction solution by mixing a first composition containing a DNA polymerase, a second composition containing a primer and an oligonucleotide probe, and a third composition containing a buffer and a dNTP mix; (2) refrigerating the reaction solution; In order, the first composition, the second composition, and the third composition are contained in different containers, The PCR reagent further comprises a positive control; A storage method characterized in that in step (2), a portion of the reaction solution is placed in a first test container together with a positive control, and only a portion of the reaction solution is placed in a second test container, and then the first and second test containers are refrigerated.

2. Only a portion of the reaction solution is contained in a plurality of second test vessels; The storage method according to claim 1, wherein at least one of the second test containers is assigned as a test container for specimens to which a specimen is added, and at least one of the second test containers is assigned as a negative control container to which no specimen is added.

3. A storage method as described in claim 1, wherein in step (2), the first and second test containers are stored in a refrigerator for at least 24 hours and not more than 60 days.

4. The method for preserving food according to claim 1, wherein the refrigeration temperature in step (2) is 10°C or lower and 0°C or higher.

5. 2. The method for preserving nucleic acids according to claim 1, wherein the nucleic acid amplified by the PCR reagent is the RNF213 gene p.R4810K polymorphism.

6. The storage method according to claim 5, wherein the second composition contains a primer pair that amplifies a base sequence containing a genetic mutation corresponding to the polymorphism, a fluorescently labeled oligonucleotide probe that binds to a mutant base sequence containing a genetic mutation corresponding to the polymorphism, and a fluorescently labeled oligonucleotide probe that binds to a wild-type base sequence corresponding to the mutant base sequence.

7. The PCR reagent further comprises a pretreatment solution; The preservation method according to claim 1 , wherein in the step (2), the pretreatment liquid is contained in a third inspection container and refrigerated.

8. The method for preserving blood according to claim 7 , wherein the pretreatment solution is a blood dissolving solution containing an anionic surfactant.

9. A step of carrying out the preservation method according to any one of claims 1 to 8; a step of adding a pretreatment solution to a specimen to prepare a solution in which nucleic acids have been extracted; mixing the solution from which the nucleic acid has been extracted with the reaction solution; performing PCR on the mixed reaction solution; A PCR testing method comprising the steps of:

10. The PCR testing method according to claim 9, wherein the number of PCR cycles is 30 to 35.

Citation Information

Patent Citations

  • Reagent kit for detecting nucleic acid amplification, having excellent preservation stability

    JP2010233504A

  • Methods for predicting onset risk of brain infarction

    JP2020092660A

  • Brain infarction risk evaluation method

    JP2021090390A