Method for producing immobilized cells for mannose production and use thereof
The production of immobilized cells using a simplified process with Escherichia coli or Bacillus subtilis fermentation broths addresses the challenges of enzyme recovery and cost in mannose production, achieving efficient and cost-effective industrial-scale mannose synthesis.
Patent Information
- Application Number
- JP2023580465
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-07-05
- Filing Date
- 2022-01-04
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2042-01-04
AI Technical Summary
Conventional methods for mannose production face challenges such as cumbersome enzyme production steps, low enzyme recovery and utilization rates, difficulty in recycling, and high production costs, which hinder industrial scalability and efficiency.
A method involving the production of immobilized cells using fermentation broths of Escherichia coli or Bacillus subtilis expressing specific enzymes, combined with inorganic soil, flocculant, and cross-linking agents, followed by granulation and drying to create uniform pellets, simplifying the process and enhancing enzyme recovery and reuse.
The method simplifies enzyme production, facilitates easy separation and purification, allows for repeated use of enzymes, reduces costs, and achieves high product yields, with continuous catalytic reactions maintaining efficiency over multiple batches.
Smart Images

Figure 0007797036000001 
Figure 0007797036000002 
Figure 0007797036000003
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to the technical field of biotechnology, and in particular to the field of mannose production and manufacturing. [Background technology]
[0002] Mannose is a six-carbon sugar and an isomer of glucose. Mannose has functions such as immunomodulation, defense against bacterial and viral infections, promotion of glycoprotein synthesis in the body, and anti-cancer properties. Therefore, mannose is widely used in the fields of biology and medicine. Mannose is not only used as a raw material for some pharmaceutical and chemical industries and as a raw material for synthesizing precursors of important sugar drugs, but also as a sweetener for food and beverages. In recent years, the demand for mannose has increased significantly in the fields of functional foods, feed additives, and medicine, and it has enormous economic development value.
[0003] The main methods for industrially producing mannose are extraction and isomerization. Extraction is a method in which a mixed sugar solution containing mannose is obtained by acid hydrolysis of raw materials such as palm kernel shells and ivory palm kernels. However, this method involves high costs for the separation and purification process due to the complex composition of the raw materials, and is prone to problems such as the use of large amounts of dilute acid and environmental pollution caused by organic solvents (Fan, S.-P., et al., "High-yield production of sugars from deproteinated palm kernel cake under microwave irradiation via dilute sulfuric acid hydrolysis." Bioresource Technology, 2014. 153(0): 69-78. Saari, P. and M. Hurme, "Process Synthesis Principles in the Chromatographic Separation of Sugars from Biomass Hydrolysates." Chemical Engineering & Technology, 2011. 34(2): 282-288.). The isomerization method is a method for preparing mannose by chemical or enzymatic isomerization, mainly using glucose or fructose as raw materials. However, due to thermodynamic limitations, this method has a low conversion rate and a complicated separation process (Kockritz, A., et al., Rearrangement of glucose to mannose catalyzed by polymer-supported Mo catalysts in the liquid phase. Applied Catalysis A: General, 2008. 334(1-2): 112-118. Park, C.S., et al., Mannose production from fructose by free and immobilized D-lyxose isomerases from Providencia stuartii. Biotechnol Lett, 2010. 32(9) 1305-1309.).
[0004] Patent CN109750011A, filed by the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, discloses a novel biosynthetic method for mannose. This method fundamentally changes the existing mannose production process by constructing a multi-enzyme reactor and synthesizing mannose from inexpensive carbon sources such as formaldehyde, glycerin, starch, maltodextrin, sucrose, and glucose. This multi-enzyme mannose synthesis pathway not only overcomes the limitations of the extraction method for mannose synthesis, such as high energy consumption, complex products, difficult purification, numerous side reactions, and severe chemical pollution, but also overcomes the drawbacks of the isomerization method, such as low conversion rate and complicated separation process. However, the multi-enzymes used in this method must be extracted from enzyme-containing cells obtained by fermentation. This process involves a series of cumbersome steps, including cell collection, heavy suspension, homogenization, supernatant collection, and enzyme separation and purification, making enzyme production complicated and difficult to achieve on a large scale. Furthermore, because the free enzyme and the reaction mixture form a homogeneous mixture, it is difficult to recover and recycle the enzyme after the catalytic reaction is complete, resulting in low enzyme recovery and utilization rates and high enzyme costs. These problems make it impossible to further reduce the production costs of the mannose biosynthesis method, making industrial production impossible.
[0005] Patent CN112342179B, granted by the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, reports a method for producing tagatose using whole cells of Bacillus subtilis with a starch catalyst. This method involves immobilizing permeabilized Bacillus subtilis, obtaining immobilized whole cells, and then applying them to tagatose production. While this method allows for whole cell recycling and reduces production costs, research and analysis have revealed that this method still has several drawbacks when producing immobilized cells. First, this method requires many tedious steps, such as cell collection, cell suspension, and cell permeabilization, prior to immobilization. Second, this method relies on permeabilized cells for granulation immobilization, but cell permeabilization can easily cause leakage of heterologous proteins expressed within the cells, resulting in loss of the heterologous protein and reduced enzyme immobilization efficiency during the immobilization process. Furthermore, this method only obtains immobilized enzyme particles by simple extrusion granulation, and the resulting immobilized enzyme particles are not uniform.
[0006] Therefore, there is an urgent need to develop a method for easily obtaining uniform immobilized cells that can simplify the enzyme production process, avoid or reduce enzyme leakage or loss due to permeable cells during the immobilization process, improve enzyme immobilization efficiency, realize enzyme recycling, reduce mannose production costs, and enable industrial production of mannose. Summary of the Invention [Problem to be solved by the invention]
[0007] In response to problems present in conventional methods for producing mannose using multienzyme catalysts, such as cumbersome enzyme production steps, complicated separation and purification, low enzyme recovery and utilization rates, and difficulty in recycling, which result in high mannose production costs, the present disclosure aims to provide a method for producing mannose using immobilized cells that simplifies the enzyme production steps in mannose production, simplifies the separation and purification of products and enzymes in mannose production, enables the recycling of multienzymes in a new multienzyme synthetic pathway for mannose, reduces mannose production costs, and enables industrial production of mannose. [Means for solving the problem]
[0008] To solve the above technical problems, the present disclosure adopts the following technical solutions:
[0009] A method for producing immobilized cells for mannose production, comprising: obtaining fermentation broths of Escherichia coli or Bacillus subtilis in which α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase have been expressed by fermentation, and mixing the fermentation broths to obtain a fermentation mixture; Adding inorganic soil to the fermentation mixture and stirring uniformly; Further, adding a flocculant to the fermentation mixture to flocculate the bacterial cells, and then adding a cross-linking agent to cross-link the bacterial cells; Vacuum filtering to obtain a filter cake, extruding the filter cake into strands using a rotary granulator to granulate them, and then cutting the extrudate into pellets with a uniform length using a spheronizer; and a step of fluidized bed drying the pellet to obtain immobilized cells for mannose production.
[0010] In one particular embodiment, the present disclosure adopts the following technical solutions:
[0011] A method for producing immobilized cells for mannose production, comprising: obtaining fermentation broths of Escherichia coli or Bacillus subtilis in which α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase have been expressed by fermentation, and mixing the fermentation broths to obtain a fermentation mixture; adding 1 to 10% w / v inorganic soil to the fermentation mixture and stirring uniformly; Further, adding 0.1 to 2% w / v of a flocculant to the fermentation mixture to flocculate the bacterial cells, and then adding 0.05 to 3% v / v of a cross-linking agent to cross-link the bacterial cells for 1 to 4 hours; filtration under vacuum to obtain a filter cake, extruding the filter cake into strands using a rotary granulator, and then cutting the strands of immobilized cells into pellets with a uniform length using a spheronizer; and a step of fluidizing and drying the pellets by controlling the temperature at the blowing port to 60 to 90°C to obtain immobilized cells for mannose production.
[0012] The fermentation broth can be produced by a method known in the art. Any medium suitable for the production of foreign proteins may be used for the fermentation, including, but not limited to, LB medium, SR medium, TB medium, etc.
[0013] Preferably, the α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase are thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase, respectively.
[0014] The thermostable α-glucan phosphorylase refers to an enzyme that has the function of phosphorylating starch to glucose-1-phosphate (G1P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the thermostable α-glucan phosphorylase is produced from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor cronotskiiensis, or the like. kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermus thermophilus, Methanothermobacter marburgensis, Archaeoglobus profundus, or the like, or the amino acid sequence of said thermostable α-glucan phosphorylase has at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identity with the thermostable α-glucan phosphorylase derived from said thermophilic microorganism.More preferably, the thermostable α-glucan phosphorylase is derived from Thermococcus kodakarensis.
[0015] Specifically, thermostable phosphoglucomutase refers to an enzyme that has the function of converting glucose-1-phosphate (G1P) to glucose-6-phosphate (G6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the thermostable phosphoglucomutase is derived from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor cronotskiiensis, or the like. or the amino acid sequence of the thermostable phosphoglucomutase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to that of the thermostable phosphoglucomutase derived from the thermophilic microorganism.More preferably, the thermostable phosphoglucomutase is derived from Thermococcus kodakarensis.
[0016] Specifically, thermostable glucose phosphate isomerase refers to an enzyme that has the function of converting glucose-6-phosphate (G6P) to fructose-6-phosphate (F6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the thermostable glucose phosphate isomerase is produced from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, The thermostable glucose phosphate isomerase is derived from Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermus thermophilus, Methanothermobacter marburgensis, Archaeoglobus profundus, or the like, or the amino acid sequence of the thermostable glucose phosphate isomerase has at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identity with the thermostable glucose phosphate isomerase derived from the thermophilic microorganism.More preferably, the thermostable glucose phosphate isomerase is derived from Thermus thermophilus.
[0017] Specifically, mannose 6-phosphate isomerase refers to an enzyme that has the function of converting fructose-6-phosphate (F6P) to mannose-6-phosphate (M6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the thermostable mannose 6-phosphate isomerase is produced from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor cronotskiiensis, or the like. or the amino acid sequence of the thermostable mannose-6-phosphate isomerase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to that of the thermostable glucose phosphate isomerase derived from the thermophilic microorganism.More preferably, the thermostable mannose 6-phosphate isomerase is derived from Geobacillus thermodenitrificans.
[0018] Specifically, the mannose-6-phosphate phosphatase refers to an enzyme that has the function of dephosphorylating mannose-6-phosphate (M6P) to convert it to mannose at 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the mannose 6-phosphate phosphatase is produced from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor cronotskiiensis, or the like. or the amino acid sequence of the thermostable mannose-6-phosphate isomerase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to that of the thermostable glucose phosphate isomerase derived from the thermophilic microorganism.More preferably, the thermostable mannose 6-phosphate phosphatase is derived from Thermotoga maritima.
[0019] More preferably, wet bacterial cells expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase are mixed in a ratio of (0.1-10):(0.1-10):(0.1-10):(0.1-10):(0.1-10), and the OD600 of the mixed bacterial suspension is adjusted to be between 10 and 150.
[0020] Furthermore, the mineral soil includes, but is not limited to, montmorillonite, diatomaceous earth, kaolin, bentonite, etc., and preferably, the mineral soil is diatomaceous earth.
[0021] Furthermore, the flocculant includes, but is not limited to, polyethyleneimine, chitosan, polydimethyldiallylammonium chloride (PDADMAC), polyacrylamide, etc., and preferably, the flocculant is polyethyleneimine or PDADMAC, and preferably, the molecular weight of the polyethyleneimine is 600 to 70,000.
[0022] Furthermore, the cross-linking agent includes, but is not limited to, glutaraldehyde, tris(hydroxymethyl)phosphine, N,N-methylenebisacrylamide, epichlorohydrin, etc., and preferably, the cross-linking agent is glutaraldehyde.
[0023] The method further comprises the step of screening the obtained immobilized cells to obtain immobilized cells with a uniform morphology.
[0024] Therefore, the present disclosure also provides a method for producing mannose using immobilized cells, which comprises converting starch or a starch derivative into mannose using the immobilized cells.
[0025] Furthermore, the method further includes a step of recovering the immobilized cells by filtration after the reaction is completed.
[0026] In a specific embodiment, the bioconversion reaction system includes 50-300 g / L of starch or starch derivative, a buffer solution having a pH value of 5.0-8.0, 10-50 mM inorganic phosphate, 3-7 mM divalent magnesium ions, and immobilized cells.
[0027] Furthermore, the buffer may be a HEPES buffer, a phosphate buffer, a Tris buffer, an acetate buffer, etc. The inorganic phosphate may be sodium phosphate or potassium phosphate. [Effects of the Invention]
[0028] Compared with the prior art, the present disclosure has the following beneficial effects. Compared with multienzyme catalytic reactions, the method for producing mannose using immobilized cells not only simplifies the enzyme production and manufacturing process, but also overcomes the difficulty of separating the multienzyme from the product, facilitating the separation and purification of the product mannose. The immobilized cells and the reaction solution can be separated by simple filtration, which makes enzyme separation from the product easier than with whole-cell catalytic reactions and allows for repeated enzyme use, thereby improving cell utilization and reducing mannose production costs. Furthermore, repeated use of cells avoids environmental pollution caused by multiple fermentations and simplifies operational steps. The present disclosure produces and mixes a fermentation broth containing expressed enzymes, and then uses the fermentation mixture directly for granulation. This important step eliminates the steps of cell collection, cell suspension, and cell permeabilization of the fermentation broth (eliminating the cell collection step from the fermentation broth, facilitating the immobilization process, improving process operability, and eliminating the cell permeabilization step). On the other hand, when immobilization was performed directly using a fermentation mixture, the cell membrane and cell wall were hardly damaged, and the enzyme expressed after immobilization was less likely to leak, resulting in high enzyme immobilization efficiency. In this disclosure, to obtain immobilized cells by immobilization, strands of controlled thickness were first produced using a rotary extrusion granulator. The strands were then cut into uniform-length particles using a spheronizer. The particles were then dried at high temperature using a fluidized bed dryer (to achieve the purpose of cell permeabilization), and sieved to obtain immobilized enzyme particles with uniform particle sizes, which can be more effectively used in mannose production. The granulation process used in this disclosure not only favors the subsequent permeabilization process and particle uniformity, but also simplifies the previous cell collection step (the specific process for cell immobilization in this disclosure is shown in Figure 1). Experimental results showed that the effects of the present disclosure were very significant, with the continuous catalytic reaction using the immobilized Bacillus subtilis of the present disclosure achieving a maximum initial product yield of 63%, and even after 25 batches of continuous catalytic reaction, the product yield could be maintained at 43%. The continuous catalytic reaction using the immobilized E. coli of the present disclosure achieved a maximum initial product yield of 65%, and even after 25 batches of continuous catalytic reaction, the product yield could be maintained at 44%. [Brief explanation of the drawings]
[0029] [Figure 1] FIG. 1 is a schematic diagram showing a specific flow of cell immobilization according to the present disclosure. [Figure 2] 1 shows an SDS PAGE diagram of each enzyme in Example 1, where M represents a protein marker, S represents the supernatant of the cell lysate, and T represents the total protein. [Figure 3] 1 shows an SDS PAGE diagram of each enzyme in Example 9. Here, M represents a protein marker, S represents the supernatant of the cell lysate, and T represents the total protein. [Figure 4] 1 shows the effect of mannose production by immobilized Bacillus subtilis in Example 3. [Figure 5] 11 shows the effect of mannose production by immobilized E. coli in Example 11. [Figure 6] 1 shows the effect of mannose production by Bacillus subtilis in Comparative Example 1. [Figure 7] 1 shows the effect of mannose production by Escherichia coli in Comparative Example 2. DETAILED DESCRIPTION OF THE INVENTION
[0030] In order to further explain the technical solutions adopted in the present disclosure and their effects, the technical solutions of the present disclosure will be further described below using specific examples. However, it should be understood that the above examples are merely illustrative and do not limit the scope of the present disclosure. Those skilled in the art may modify or replace the details and forms of the technical solutions of the present disclosure without departing from the spirit and scope of the present disclosure, and it is understood that all such modifications or replacements fall within the protection scope of the present disclosure.
[0031] Example 1: Production of enzyme-expressing Bacillus subtilis fermentation broth (1) Construction of pMA5-Pylb-aGP In this example, the agp gene sequence (NCBI Protein ID: BAD85595) encoding thermostable α-glucan phosphorylase was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and spliced into a conventional plasmid. The thermostable α-glucan phosphorylase gene agp was obtained by PCR using a pair of primers (1-IF and 1-IR). The pMA5-Pylb linear backbone was obtained by PCR using a pair of primers (1-VF and 1-VR). The thermostable α-glucan phosphorylase gene fragment and the pMA5-Pylb vector backbone were then assembled using POE-PCR. The ligation product was transformed into competent SCK6 using the calcium chloride method. Transformants were selected and subjected to colony PCR, double enzyme digestion, and sequencing verification. The expression vector, designated pMA5-Pylb-aGP, was obtained. 1-IF:AGAAACAACAAAGGGGGAGATTTGTatggtgaacgtttccaatgccgttg(SEQ ID NO:1) 1-IR:gcttgagctcgactctagaggatcctcagtcaagtcccttccacttgacca(SEQ ID NO:2) 1-VF:tggtcaagtggaagggacttgactgaggatcctctagagtcgagctcaagc(SEQ ID NO:3) 1-VR:caacggcattggaaacgttcaccatACAAATCTCCCCCTTTGTTGTTTCT(SEQ ID NO:4)
[0032] (2) Construction of pMA5-Pylb-PGM In this example, the thermostable phosphoglucomutase-encoding gene pgm sequence (NCBI Protein ID: BAD85297) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and spliced into a conventional plasmid. The thermostable phosphoglucomutase gene pgm was obtained by PCR using a pair of primers (2-IF and 2-IR). The pMA5-Pylb linear backbone was obtained by PCR using a pair of primers (2-VF and 2-VR). The thermostable phosphoglucomutase gene fragment and the pMA5-Pylb vector backbone were then assembled using POE-PCR. The ligation product was transformed into competent SCK6 using the calcium chloride method. Transformants were selected and subjected to colony PCR, double enzyme digestion, and sequencing verification. The expression vector, designated pMA5-Pylb-PGM, was obtained. 2-IF:AGAAACAACAAAGGGGGAGATTTGTatgggcaaactgtttggtaccttcg(SEQ ID NO:5) 2-IR:gcttgagctcgactctagaggatccTTAacctttcagtgcttcttccagc(SEQ ID NO:6) 2-VF:gctggaagaagcactgaaaggtTAAggatcctctagagtcgagctcaagct(SEQ ID NO:7) 2-VR:cgaaggtaccaaacagtttgcccatACAAATCTCCCCCTTTGTTGTTTCT(SEQ ID NO:8)
[0033] (3) Construction of pMA5-Pylb-PGI In this example, the thermostable glucose phosphate isomerase gene-encoding gene pgi sequence (NCBI-Protein ID: AAS82052) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and spliced into a conventional plasmid. The thermostable glucose phosphate isomerase gene pgi gene was obtained by PCR using a pair of primers (3-IF and 4-IR). The pMA5-Pylb linear backbone was obtained by PCR using a pair of primers (3-VF and 3-VR). The thermostable glucose phosphate isomerase gene fragment and the pMA5-Pylb vector backbone were then assembled using POE-PCR. The ligation product was transformed into competent SCK6 using the calcium chloride method. Transformants were selected and subjected to colony PCR, double enzyme digestion, and sequencing verification. The expression vector, designated pMA5-Pylb-PGI, was obtained. 3-IF:AGAAACAACAAAGGGGGAGATTTGTATGCTGCGTCTGGATACTCGCTTTC(SEQ ID NO:9) 3-IR:agcttgagctcgactctagaggatccTTAACCAGCCAGGCGTTTACGAGTC(SEQ ID NO:10) 3-VF:GACTCGTAAACGCCTGGCTGGTTAAggatcctctagagtcgagctcaagct(SEQ ID NO:11) 3-VR:GAAAGCGAGTATCCAGACGCAGCATACAAATCTCCCCCTTTGTTGTTTCT(SEQ ID NO:12)
[0034] (4) Construction of pMA5-Pylb-MPI In this example, the mpi gene sequence (NCBI Protein ID: AAS81322) encoding the thermostable mannose 6-phosphate isomerase gene was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and spliced into a conventional plasmid. The mpi gene was obtained by PCR using a pair of primers (4-IF and 4-IR). The pMA5-Pylb linear backbone was obtained by PCR using a pair of primers (4-VF and 4-VR). The thermostable mannose 6-phosphate isomerase gene fragment and the pMA5-Pylb vector backbone were then assembled using POE-PCR. The ligation product was transformed into competent SCK6 using the calcium chloride method. Transformants were selected and subjected to colony PCR, double enzyme digestion, and sequencing verification. The expression vector, designated pMA5-Pylb-MPI, was obtained. 4-IF:GTAGAAACAACAAAGGGGGAGATTTGTatgaggcggttggagcccaaacccgtggc(SEQ ID NO:13) 4-VF: ccacgggtttgggctccaaccgcctcatACAAATCTCCCCCTTTGTTGTTTCTAC(SEQ ID NO:14) 4-VR: tgccgccctggccaaggagggggcgtgaggatcctctagagtcgagctcaagc(SEQ ID NO:15) 4-IR: gcttgagctcgactctagaggatcctcacgccccctccttggccagggcggca(SEQ ID NO:16)
[0035] (5) Construction of pMA5-Pylb-M6PP In this example, the m6pp gene sequence (NCBI Protein ID: NP_228460) encoding the thermostable mannose 6-phosphate phosphatase gene was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and spliced into a conventional plasmid. The m6pp gene was obtained by PCR using a pair of primers (5-IF and 5-IR). The pMA5-Pylb linear backbone was obtained by PCR using a pair of primers (5-VF and 5-VR). The thermostable mannose 6-phosphate phosphatase gene fragment and the pMA5-Pylb vector backbone were then assembled using POE-PCR. The ligation product was transformed into competent SCK6 using the calcium chloride method. Transformants were selected and subjected to colony PCR, double enzyme digestion, and sequencing verification. The expression vector, designated pMA5-Pylb-M6PP, was obtained. 5-IF: GTAGAAACAACAAAGGGGGAGATTTGTATGTACCGCGTTTTTGTTTTTGATC(SEQ ID NO:17) 5-VF: GATCAAAAACAAAAACGCGGTACATACAAATCTCCCCCTTTGTTGTTTCTAC(SEQ ID NO:18) 5-VR: AGCACCGATTGTCTGGATGAAtgaggatcctctagagtcgagctcaagc(SEQ ID NO:19) 5-IR: gcttgagctcgactctagaggatcctcaTTCATCCAGACAATCGGTGCT(SEQ ID NO:20)
[0036] (6) Obtaining fermentation liquid Recombinantly engineered Bacillus subtilis strains expressing the thermostable α-glucan phosphorylase gene, thermostable phosphoglucomutase gene, thermostable glucose phosphate isomerase gene, thermostable mannose 6-phosphate isomerase gene, and thermostable mannose 6-phosphate phosphatase gene (SCK6 was used as the starting strain in this example; see CN112342179B) were selected and inoculated into LB medium and cultured overnight with shaking at 37°C. The cultures were transferred to LB medium at a 1% inoculum amount and cultured overnight with shaking at 37°C to obtain B. subtilis fermentation broths expressing thermostable α-glucan phosphorylase, B. subtilis fermentation broths expressing thermostable phosphoglucomutase, B. subtilis fermentation broths expressing thermostable glucose phosphate isomerase, B. subtilis fermentation broths expressing thermostable mannose 6-phosphate isomerase, and B. subtilis fermentation broths expressing thermostable mannose 6-phosphate phosphatase, respectively. The expression of thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase in Bacillus subtilis is shown in Figure 2.
[0037] Example 2: Production of mannose by immobilized Bacillus subtilis The fermentation broth of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, the fermentation broth of Bacillus subtilis expressing the thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing the thermostable glucose phosphate isomerase, the fermentation broth of Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to OD600 = 100. 2% w / v montmorillonite was added to the bacterial suspension and stirred uniformly. Next, a 1% w / v aqueous solution of polyethyleneimine with a molecular weight of 600 was added and the mixture was allowed to flocculate at room temperature. A 0.5% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 3.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0038] A 1L reaction system was mixed with 100g / L starch, 50mM sodium phosphate buffer (pH 7.0), and immobilized Bacillus subtilis to a final concentration of 20. The reaction was performed in a shaker at 70°C in a water bath. During the reaction, the mannose content was analyzed by high-performance liquid chromatography. After the reaction was completed, the immobilized Bacillus subtilis was collected by simple filtration, washed with buffer, and then used in the next batch of reaction. Experimental results showed that in continuous catalytic reactions using immobilized Bacillus subtilis, the initial product yield reached a maximum of 60%, and even after 20 batches of continuous catalytic reactions, the product yield remained at 40%.
[0039] Example 3: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and 5% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.5% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and the mixture was allowed to flocculate at room temperature. A 0.5% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 0.4 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 60°C to obtain immobilized cells.
[0040] Mannose was produced by the method of Example 2. The experimental results shown in Figure 4 show that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 65%, and even after 25 batches of continuous catalytic reaction, the product yield reached 45%.
[0041] Example 4: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and 2% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.5% w / v aqueous solution of polydimethyldiallylammonium chloride (PDADMAC) was added and the mixture was allowed to flocculate at room temperature. A 0.5% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 3 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 90°C to obtain immobilized cells.
[0042] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 63%, and even after 25 batches of continuous catalytic reaction, the product yield still reached 43%.
[0043] Example 5: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:2:2, and 4% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 1% w / v aqueous solution of polydimethyldiallylammonium chloride (PDADMAC) was added and the mixture was allowed to flocculate at room temperature. A 1% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 3 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0044] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 63%, and even after 25 batches of continuous catalytic reaction, the product yield still reached 40%.
[0045] Example 6: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and 6% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.8% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and the mixture was allowed to aggregate at room temperature. A 0.5% v / v aqueous solution of tris(hydroxymethyl)phosphine was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 0.4 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0046] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 64%, and even after 25 batches of continuous catalytic reaction, the product yield reached 41%.
[0047] Example 7: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and 3% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.5% w / v aqueous polyacrylamide solution was added and the mixture was allowed to aggregate at room temperature. A 2.0% v / v aqueous N,N-methylenebisacrylamide solution was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 90°C to obtain immobilized cells.
[0048] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached up to 65%, and even after 25 batches of continuous catalytic reaction, the product yield reached 42%.
[0049] Example 8: Production of mannose by immobilized Bacillus subtilis The fermentation broths of Bacillus subtilis expressing the thermostable α-glucan phosphorylase prepared in Example 1, Bacillus subtilis expressing the thermostable phosphoglucomutase, Bacillus subtilis expressing the thermostable glucose phosphate isomerase, Bacillus subtilis expressing the thermostable mannose 6-phosphate isomerase, and Bacillus subtilis expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to OD600 = 100. 1% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.1% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and the mixture was allowed to flocculate at room temperature. A 0.3% v / v aqueous solution of epichlorohydrin was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0050] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 63%, and even after 25 batches of continuous catalytic reaction, the product yield still reached 40%.
[0051] Example 9: Production of enzyme-expressing E. coli fermentation broth The construction methods for the thermostable α-glucan phosphorylase gene, thermostable phosphoglucomutase gene, thermostable glucose phosphate isomerase gene, thermostable mannose 6-phosphate isomerase gene, and thermostable mannose 6-phosphate phosphatase gene plasmids are as described in Patent CN 109750011 A. The thermostable α-glucan phosphorylase gene, thermostable phosphoglucomutase gene, thermostable glucose phosphate isomerase gene, thermostable mannose 6-phosphate isomerase gene, and thermostable mannose 6-phosphate phosphatase gene were synthesized in the pET-21a vector between the enzyme digestion sites NdeI and XhoI, and the recombinant plasmids were named pET-21a-aGP, pET-21a-PGM, pET-21a-PGI, pET-21a-MPI, and pET-21a-M6PP, respectively.
[0052] The recombinant plasmids pET-21a-aGP, pET-21a-PGM, pET-21a-PGI, pET-21a-MPI, and pET-21a-M6PP were transformed into E. coli BL21(DE3) to obtain recombinant strains. Single clones were picked in LB medium and cultured overnight at 37°C with shaking. The cultures were transferred to LB medium at a 1% inoculum size, induced with IPTG at 18°C, and cultured overnight with shaking to obtain fermentation broths expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase, respectively. The expression of thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase in Bacillus subtilis is shown in FIG.
[0053] Example 10: Mannose production by immobilized E. coli The fermentation broths of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broths of E. coli expressing the thermostable phosphoglucomutase, the fermentation broths of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to OD600 = 100. 1% w / v montmorillonite was added to the bacterial suspension and stirred uniformly. Next, a 0.2% w / v aqueous solution of polyethyleneimine with a molecular weight of 600 was added and the mixture was allowed to flocculate at room temperature. A 0.2% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The filter cake was obtained by vacuum filtration, and the filter cake was extruded and granulated in a rotary granulator into strands with a particle diameter of 0.8 mm. The extruded cake was then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 60°C to obtain immobilized cells.
[0054] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached up to 60%, and even after 20 batches of continuous catalytic reaction, the product yield still reached more than 40%.
[0055] Example 11: Mannose production by immobilized E. coli The fermentation broths of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broths of E. coli expressing the thermostable phosphoglucomutase, the fermentation broths of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed to an OD600 ratio of 1:1:1:1:1, and 1% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.5% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and the mixture was allowed to flocculate at room temperature. A 1% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The extruded cake was then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0056] Mannose was produced by the method of Example 2. The experimental results shown in Figure 5 show that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached a maximum of 65%, and even after 25 batches of continuous catalytic reaction, the product yield reached 44%.
[0057] Example 12: Mannose production by immobilized E. coli The fermentation broths of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broths of E. coli expressing the thermostable phosphoglucomutase, the fermentation broths of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the bacterial suspension was adjusted to OD600 = 100. 2% w / v diatomaceous earth was added to the suspension and stirred uniformly. Next, a 0.5% w / v aqueous solution of polydimethyldiallylammonium chloride (PDADMAC) was added and the mixture was allowed to flocculate at room temperature. A 0.5% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 3 hours. The filter cake was obtained by vacuum filtration, and the filter cake was extruded and granulated in a rotary granulator into strands with a particle diameter of 3.0 mm. The extruded cake was then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 90°C to obtain immobilized cells.
[0058] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached up to 60%, and even after 25 batches of continuous catalytic reaction, the product yield still reached 40%.
[0059] Example 13: Mannose production by immobilized E. coli The fermentation broth of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broth of E. coli expressing the thermostable phosphoglucomutase, the fermentation broth of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broth of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broth of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:2:2, and the mixture was adjusted to OD600 = 100. 3% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.4% w / v aqueous solution of polydimethyldiallylammonium chloride (PDADMAC) was added and the mixture was allowed to flocculate at room temperature. A 1% v / v aqueous solution of glutaraldehyde was then added and the mixture was allowed to crosslink at room temperature for 3 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The extruded cake was then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0060] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached up to 60%, and even after 25 batches of continuous catalytic reaction, the product yield reached 41%.
[0061] Example 14: Mannose production by immobilized E. coli The fermentation broths of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broths of E. coli expressing the thermostable phosphoglucomutase, the fermentation broths of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to an OD600 of 100. 3% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.5% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and the mixture was allowed to aggregate at room temperature. A 1.0% v / v aqueous solution of tris(hydroxymethyl)phosphine was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0062] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized Bacillus subtilis, the initial product yield reached a maximum of 61%, and even after 25 batches of continuous catalytic reaction, the product yield still reached 40%.
[0063] Example 15: Mannose production by immobilized E. coli The fermentation broths of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broths of E. coli expressing the thermostable phosphoglucomutase, the fermentation broths of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broths of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to an OD600 of 100. 5% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.8% w / v aqueous solution of polyacrylamide was added and the mixture was allowed to aggregate at room temperature. A 0.8% v / v aqueous solution of N,N-methylenebisacrylamide was then added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 90°C to obtain immobilized cells.
[0064] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached a maximum of 63%, and even after 25 batches of continuous catalytic reaction, the product yield reached 41%.
[0065] Example 16: Mannose production by immobilized E. coli The fermentation broth of E. coli expressing the thermostable α-glucan phosphorylase prepared in Example 9, the fermentation broth of E. coli expressing the thermostable phosphoglucomutase, the fermentation broth of E. coli expressing the thermostable glucose phosphate isomerase, the fermentation broth of E. coli expressing the thermostable mannose 6-phosphate isomerase, and the fermentation broth of E. coli expressing the thermostable mannose 6-phosphate phosphatase were mixed at an OD600 ratio of 1:1:1:1:1, and the mixture was adjusted to OD600 = 100. 1% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, a 0.4% w / v aqueous solution of polyethyleneimine with a molecular weight of 600 was added and the mixture was allowed to flocculate at room temperature. Then, a 0.4% v / v aqueous solution of epichlorohydrin was added and the mixture was allowed to crosslink at room temperature for 2 hours. The mixture was filtered under vacuum to obtain a filter cake, which was then extruded and granulated in a rotary granulator into strands with a particle diameter of 1.0 mm. The strands were then cut into pellets of uniform length using a spheronizer, and the resulting immobilized cell pellets were fluidized and dried at 70°C to obtain immobilized cells.
[0066] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized E. coli, the initial product yield reached a maximum of 61%, and even after 25 batches of continuous catalytic reaction, the product yield reached 39%.
[0067] Comparative Example 1: Production of mannose by Bacillus subtilis The fermentation broth prepared in Example 1 was centrifuged at 5,500 rpm for 10 minutes, and the supernatant was discarded to obtain whole cells expressing thermostable α-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable glucose phosphate isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase. 50 mM sodium phosphate buffer (pH 7.5) was added to each of the cells, and the cells were resuspended to an OD600 of 200. The resuspended cells were heat-treated at 75°C for 90 minutes. The whole cells were mixed with pH 7.0 sodium phosphate buffer at a ratio of 1:1:1:1:1 to obtain an OD600 of 200.
[0068] Starch (final concentration: 100 g / L), 50 mM sodium phosphate buffer (pH 7.0), and the above-mentioned mixed Bacillus subtilis were added to a 1 L reaction system, and the resulting mixture was shaken in a 70°C water bath until the OD600 reached 20. During the reaction, the mannose content was analyzed by high-performance liquid chromatography. After the reaction, the precipitated cells were collected by centrifugation, washed with buffer, and then used in the next batch of reaction. The experimental results shown in Figure 6 indicate that the initial product yield reached a maximum of 65% in the case of continuous catalytic reactions using immobilized Bacillus subtilis, but after two batches of continuous catalytic reactions, the product yield was only 15%.
[0069] Comparative Example 2: Production of mannose by E. coli The fermentation broth prepared in Example 9 was centrifuged at 5,500 rpm for 10 minutes, and the supernatant was discarded to obtain whole cells expressing thermostable α-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable glucose phosphate isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase. Each of the cells was resuspended in 50 mM sodium phosphate buffer (pH 7.5) to an OD of 200. The resuspended cells were heat-treated at 75°C for 90 minutes. The whole cells were mixed with pH 7.0 sodium phosphate buffer at a ratio of 1:1:1:1:1 to obtain an OD of 200.
[0070] Starch (final concentration: 100 g / L), 50 mM sodium phosphate buffer (pH 7.0), and the above-mentioned mixed E. coli were added to a 1 L reaction system, adjusted to an OD600 of 20, and the reaction was carried out on a shaker in a water bath at 70°C. During the reaction, the mannose content was analyzed by high-performance liquid chromatography. After the reaction, the precipitated cells were collected by centrifugation, washed with buffer, and then used in the next batch of reaction. The experimental results shown in Figure 7 showed that in the case of continuous catalytic reaction using E. coli, the initial product yield reached a maximum of 63%, but after two batches of continuous catalytic reaction, the product yield was only 12%.
[0071] Comparative Example 3: Production of mannose by immobilized permeabilized Bacillus subtilis Recombinant Bacillus subtilis strains expressing the thermostable α-glucan phosphorylase gene, the thermostable phosphoglucomutase gene, the thermostable glucose phosphate isomerase gene, the thermostable mannose 6-phosphate isomerase gene, and the thermostable mannose 6-phosphate phosphatase gene were selected and inoculated into LB medium and cultured overnight at 37°C with shaking. The cultures were transferred to LB medium at a 1% inoculum size and cultured overnight at 37°C with shaking. The cultures were then centrifuged at 5500 rpm for 10 minutes, and the supernatant was discarded to obtain whole cells expressing thermostable α-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable glucose phosphate isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase, respectively. 50 mM sodium phosphate buffer (pH 7.5) was added to each of the above cells, and the cells were resuspended to an OD600 of 200. The heavily suspended cells were heat-treated at 75°C for 90 minutes.
[0072] The permeabilized whole cells were mixed with pH 7.0 sodium phosphate buffer at a 1:1:1:1:1 ratio to achieve an OD600 of 100. 5% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, 0.5% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and allowed to flocculate at room temperature. A 0.5% v / v aqueous solution of glutaraldehyde was then added and allowed to crosslink at room temperature for 2 hours. The filter cake was obtained by vacuum filtration. The filter cake was extruded into pellets with a particle size of 0.4 mm using a rotary granulator. The resulting immobilized cell pellet was dried at 30°C to obtain immobilized cells.
[0073] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized permeabilized Bacillus subtilis, the initial product yield reached a maximum of 55%, and even after 25 batches of continuous catalytic reaction, the product yield was only 27%. Comparative Example 4: Mannose production by immobilized permeabilized E. coli
[0074] Recombinant E. coli strains expressing the thermostable α-glucan phosphorylase gene, the thermostable phosphoglucomutase gene, the thermostable glucose phosphate isomerase gene, the thermostable mannose 6-phosphate isomerase gene, and the thermostable mannose 6-phosphate phosphatase gene were selected and inoculated into LB medium and cultured overnight at 37°C with shaking. The cultures were transferred to LB medium at a 1% inoculum size, induced with IPTG at 18°C, cultured overnight with shaking, and centrifuged at 5500 rpm for 10 min. The supernatant was discarded to obtain whole cells expressing thermostable α-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable glucose phosphate isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase, respectively. 50 mM sodium phosphate buffer (pH 7.5) was added to each of the above cells, and the cells were resuspended to an OD600 of 200. The heavily suspended cells were heat-treated at 75°C for 90 minutes.
[0075] The permeabilized whole cells were mixed with pH 7.0 sodium phosphate buffer at a 1:1:1:1:1 ratio to achieve an OD600 of 100. 1% w / v diatomaceous earth was added to the bacterial suspension and stirred uniformly. Next, 0.5% w / v aqueous solution of polyethyleneimine with a molecular weight of 70,000 was added and allowed to flocculate at room temperature. A 1% v / v aqueous solution of glutaraldehyde was then added and allowed to crosslink at room temperature for 2 hours. The filter cake was obtained by vacuum filtration. The filter cake was extruded into pellets with a particle size of 1.0 mm using a rotary granulator. The resulting immobilized cell pellet was dried at 30°C to obtain immobilized cells.
[0076] Mannose was produced by the method of Example 2. Experimental results showed that in the case of continuous catalytic reaction using immobilized permeabilized E. coli, the initial product yield reached a maximum of 56%, and even after 25 batches of continuous catalytic reaction, the product yield was only 26%.
Claims
1. A method for producing immobilized cells for mannose production, comprising: obtaining fermentation broths of Escherichia coli or Bacillus subtilis in which α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase have been expressed by fermentation, and mixing the fermentation broths to obtain a fermentation mixture; Adding inorganic soil to the fermentation mixture and stirring uniformly; Further, adding a flocculant to the fermentation mixture to flocculate the bacterial cells, and then adding a cross-linking agent to cross-link the bacterial cells; Vacuum filtering to obtain a filter cake, extruding the filter cake into strands using a rotary granulator to granulate them, and then cutting the extrudate into pellets with a uniform length using a spheronizer; and a step of fluidized bed drying the pellet to obtain immobilized cells for mannose production.
2. A method for producing immobilized cells for mannose production, comprising: obtaining fermentation broths of Escherichia coli or Bacillus subtilis in which α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase have been expressed by fermentation, and mixing the fermentation broths to obtain a fermentation mixture; adding 1-10% w / v inorganic soil to the fermentation mixture and stirring uniformly; Further, adding 0.1 to 2% w / v flocculant to the fermentation mixture to flocculate the bacterial cells, and then adding 0.05 to 3% v / v cross-linking agent to cross-link the bacterial cells for 1 to 4 hours; Vacuum filtering to obtain a filter cake, extruding the filter cake into strands using a rotary granulator to granulate them, and then cutting the extrudate into pellets with a uniform length using a spheronizer; and a step of fluidizing and drying the pellets by controlling the temperature at the blowing port to 60 to 90°C to obtain immobilized cells for mannose production.
3. The method according to claim 1 or 2, wherein the α-glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, mannose 6-phosphate isomerase, and mannose 6-phosphate phosphatase are thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase, respectively.
4. The method according to claim 3, wherein the heat resistance means that the enzyme has enzymatic activity even at temperatures of 40°C or higher.
5. The method according to claim 3, wherein wet bacterial cells expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose phosphate isomerase, thermostable mannose 6-phosphate isomerase, and thermostable mannose 6-phosphate phosphatase are mixed in a ratio of (0.1-10):(0.1-10):(0.1-10):(0.1-10):(0.1-10), and the OD600 of the bacterial suspension after mixing is adjusted to be between 10 and 150.
6. 3. The method of claim 1, wherein the mineral soil is selected from montmorillonite, diatomaceous earth, kaolin, or bentonite.
7. 3. The method of claim 1, wherein the flocculating agent is selected from polyethyleneimine, chitosan, polydimethyldiallylammonium chloride, and polyacrylamide.
8. 8. The method according to claim 7, wherein the flocculating agent is polyethyleneimine or PDADMAC, and the molecular weight of the polyethyleneimine is 600 to 70,000.
9. 3. The method of claim 1, wherein the cross-linking agent is selected from glutaraldehyde, tris(hydroxymethyl)phosphine, N,N-methylenebisacrylamide, or epichlorohydrin.
10. 3. The method according to claim 1 or 2, further comprising the step of screening the obtained immobilized cells to obtain immobilized cells with a uniform morphology.
11. A method for producing mannose using immobilized cells, comprising: A method for producing mannose using immobilized cells, characterized in that starch or a starch derivative is converted into mannose using the immobilized cells obtained by the method according to any one of claims 1 to 10.
12. The method according to claim 11, further comprising the step of recovering the immobilized cells by filtration after the reaction is completed.
13. 12. The method of claim 11, wherein the bioconversion reaction system comprises 50-300 g / L of starch or starch derivative, a buffer solution having a pH value of 5.0-8.0, 10-50 mM inorganic phosphate, 3-7 mM divalent magnesium ions, and immobilized cells.
14. 14. The method of claim 13, wherein the buffer is a HEPES buffer, a phosphate buffer, a Tris buffer, or an acetate buffer, and the inorganic phosphate is sodium phosphate or potassium phosphate.
Citation Information
Patent Citations
Preparation method of micropore gel particle immobilized cell for improving catalysis capabilities of catalysts
CN101532006A
Immobilization method of recombinant high-temperature-resistant glucose isomerase-containing cell
CN107400667A
Mannose6-phosphate phosphatase and biological preparation method of mannose
CN109750011A
Bacillus subtilis genetically-engineered bacteria for producing tagatose and method for preparing tagatose
CN112342179A
Immobilized enzyme compositions for the production of hexoses
WO2021011881A1