Lentiviral vector formulations

Stabilized LV formulations using a TRIS-free buffer system with sucrose, surfactants, and salts improve stability and reduce toxicity, addressing the challenges of maintaining LV potency under diverse conditions.

JP7803014B2Active Publication Date: 2026-01-21BIOVERATIV THERAPEUTICS INC +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2022519675
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-09-30
Filing Date
2020-09-30
Publication Date
2026-01-21
Estimated Expiration
2040-09-30

AI Technical Summary

Technical Problem

Current formulations of lentiviral vectors (LVs) face challenges in maintaining structural stability and biological activity under various conditions, including agitation, freezing/thawing, and temperature fluctuations, leading to reduced potency and potential toxicity.

Method used

LV formulations stabilized by a TRIS-free buffer system, such as phosphate or histidine buffer, combined with a carbohydrate like sucrose, a surfactant like poloxamer or polysorbate, and a salt like NaCl, at pH ranging from 6.0 to 7.5, suitable for systemic administration.

Benefits of technology

The formulations enhance LV stability, preserving structural integrity and biological activity, reducing toxicity, and ensuring effective delivery for therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007803014000015
    Figure 0007803014000015
  • Figure 0007803014000016
    Figure 0007803014000016
  • Figure 0007803014000017
    Figure 0007803014000017
Patent Text Reader

Abstract

Provided are lentiviral vector (LV) formulations suitable for systemic administration with improved stability, and pharmaceutical compositions containing such LV formulations. Also provided are methods for treating disorders, particularly hematological disorders, using systemic administration of the LV formulations.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 908,390, filed September 30, 2019, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy, created on September 28, 2020, is titled "709718_SA9-472PC_SeqList_ST25.txt" and is 104,426 bytes in size.

[0003] FIELD OF THE INVENTION The present disclosure relates to formulations of recombinant lentiviral vectors (LVs) and related pharmaceutical products for use in the treatment of disease. In particular, the disclosure relates to formulations that improve the stability and quality of LVs while also being suitable for use in systemic and other types of administration to subjects to treat diseases, including bleeding disorders such as hemophilia A and hemophilia B. [Background technology]

[0004] Lentiviral vectors (LVs) and other viral vectors are attractive tools for gene therapy (Non-Patent Document 1). LVs can transduce a wide range of tissues, including non-dividing cells such as hepatocytes, neurons, and hematopoietic stem cells. Furthermore, LVs can integrate into the target cell genome, resulting in long-term transgene expression.

[0005] One of the current challenges in the fields of gene therapy and vaccine development is to create a non-toxic liquid formulation that allows LV to remain structurally stable and biologically active for a longer period of time and to withstand conditions such as agitation, freezing / thawing, and storage at a range of temperatures. LV titer has been observed to decrease in a biphasic manner with increasing freezing / thawing cycles and storage at relatively high temperatures (Non-Patent Document 2). For gene therapy to be most effective, it is desirable to have a lentiviral vector that maintains biological activity or potency.

[0006] The biological activity of LV depends on the conformational integrity of the encapsulating structure, which consists of at least the following: (a) a core polynucleotide, (b) a shell of interconnected capsid proteins surrounding the core polynucleotide, and (c) a lipid membrane with embedded glycoproteins surrounding the interconnected capsid protein shell. Unlike organic and inorganic drugs, LV is a highly complex biological structure, and even minor chemical or physical stressors can contribute to the degradation of the structural integrity of the encapsulating structure. Such stressors include osmotic pressure, buffer, pH, viscosity, electrolytes, agitation, and temperature fluctuations. The structural or conformational integrity of LV is directly linked to its biological activity or potency. Therefore, LV can lose potency as a result of physical instability, including denaturation, soluble and insoluble aggregation, precipitation, and adsorption, as well as chemical instability, including hydrolysis, deamidation, and oxidation. All of these types of degradation can result in reduced biological activity and may also lead to the formation of by-products or derivatives with increased toxicity and / or altered immunogenicity. Therefore, a good formulation of LV is crucial not only to ensure a reasonable shelf life but also to ensure low toxicity upon administration to a subject, such as via systemic administration. Finding a vehicle that stabilizes LV and results in a robust formulation, such that LV is stable over a wide range of conditions, requires careful optimization of buffer type, pH, and excipients. For each set of conditions tested, LV stability must be measured by various experimental methods. Therefore, considering all the variables, finding the optimal conditions for formulating LV is difficult, and the composition of a good formulation cannot be predicted a priori.

[0007] Therefore, there is a need in the art to prepare formulations that are suitable for administration to a subject and that improve LV stability by preserving LV quantity, structural integrity, and potency under a range of conditions. Herein, the inventors disclose formulations suitable for systemic administration to a subject that exhibit improved LV stability under a variety of conditions. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Thomas et al., 2003 [Non-patent document 2] Kigashikawa and Chang, 2001, Virology 280, pp. 124-131 Summary of the Invention [Means for solving the problem]

[0009] The present disclosure is based on the unexpected discovery that lentiviral vector (LV) formulations with improved stability can be achieved when LVs are suspended in a vehicle comprising a TRIS-free buffer system (e.g., phosphate buffer or histidine buffer) in combination with a carbohydrate (e.g., sucrose), a surfactant (e.g., poloxamer or polysorbate), and a salt (e.g., NaCl or other chloride salt). The contribution of surfactants, e.g., poloxamers, to LV stability was surprising, given that surfactants are known in the art to destabilize lipid membrane-bound particles. Also surprising was the observation that LV formulations at a pH ranging from about 6.0 to about 7.5 (e.g., pH 6.5) improved LV stability instead of destabilizing LV surface proteins (e.g., capsid protein and VSV-G protein) and promoting LV disassembly or collapse. Furthermore, the present disclosure demonstrates that the LV formulations of the present disclosure are particularly suitable for systemic administration (e.g., intravenous administration) to a subject.

[0010] In one aspect, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to a human patient.

[0011] In certain embodiments, the lentiviral vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof.

[0012] In certain embodiments, the buffer system comprises a phosphate buffer.

[0013] In certain embodiments, the concentration of the phosphate buffer is between 5 mM and 30 mM.

[0014] In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM.

[0015] In certain embodiments, the salt concentration is between 80 mM and 150 mM.

[0016] In certain embodiments, the salt concentration is about 100 mM, about 110 mM, about 130 mM, or about 150 mM.

[0017] In certain embodiments, the salt is a chloride salt.

[0018] In certain embodiments, the chloride salt is NaCl.

[0019] In certain embodiments, the surfactant is a poloxamer.

[0020] In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof.

[0021] In certain embodiments, the poloxamer is poloxamer 188 (P188).

[0022] In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0023] In certain embodiments, the surfactant is a polysorbate.

[0024] In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof.

[0025] In certain embodiments, the concentration of the surfactant is between 0.01% (w / v) and 0.1% (w / v).

[0026] In certain embodiments, the concentration of the surfactant is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v).

[0027] In certain embodiments, the carbohydrate concentration is between 0.5% (w / v) and 5% (w / v).

[0028] In certain embodiments, the carbohydrate concentration is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v).

[0029] In certain embodiments, the carbohydrate is sucrose.

[0030] In certain embodiments, the pH of the buffer system or preparation is between 6.0 and 8.0.

[0031] In certain embodiments, the pH is between 6.0 and 7.0.

[0032] In certain embodiments, the pH is about 6.5.

[0033] In certain embodiments, the pH is from about 7.0 to about 8.0.

[0034] In certain embodiments, the pH is about 7.3.

[0035] In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a histidine buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to a human patient.

[0036] In certain embodiments, the lentiviral vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof.

[0037] In certain embodiments, the concentration of the histidine buffer is between 5 mM and 30 mM.

[0038] In certain embodiments, the concentration of the histidine buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM.

[0039] In certain embodiments, the salt concentration is between 80 mM and 150 mM.

[0040] In certain embodiments, the salt concentration is about 100 mM, about 110 mM, about 130 mM, or about 150 mM.

[0041] In certain embodiments, the salt is a chloride salt.

[0042] In certain embodiments, the chloride salt is NaCl.

[0043] In certain embodiments, the surfactant is a poloxamer.

[0044] In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof.

[0045] In certain embodiments, the poloxamer is poloxamer 188 (P188).

[0046] In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0047] In certain embodiments, the surfactant is a polysorbate.

[0048] In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof.

[0049] In certain embodiments, the concentration of the surfactant is between 0.01% (w / v) and 0.1% (w / v).

[0050] In certain embodiments, the concentration of the surfactant is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v).

[0051] In certain embodiments, the carbohydrate concentration is between 0.5% (w / v) and 5% (w / v).

[0052] In certain embodiments, the carbohydrate concentration is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v).

[0053] In certain embodiments, the carbohydrate is sucrose.

[0054] In certain embodiments, the pH of the buffer system or preparation is between 6.0 and 8.0.

[0055] In certain embodiments, the pH is between 6.0 and 7.0.

[0056] In certain embodiments, the pH is about 6.5.

[0057] In certain embodiments, the pH is from about 7.0 to about 8.0.

[0058] In certain embodiments, the pH is about 7.3.

[0059] In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a phosphate buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to a human patient.

[0060] In certain embodiments, the lentiviral vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof.

[0061] In certain embodiments, the concentration of the phosphate buffer is between 5 mM and 30 mM.

[0062] In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM.

[0063] In certain embodiments, the salt concentration is between 80 mM and 150 mM.

[0064] In certain embodiments, the salt concentration is about 100 mM, about 110 mM, about 130 mM, or about 150 mM.

[0065] In certain embodiments, the salt is a chloride salt.

[0066] In certain embodiments, the chloride salt is NaCl.

[0067] In certain embodiments, the surfactant is a poloxamer.

[0068] In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof.

[0069] In certain embodiments, the poloxamer is poloxamer 188 (P188).

[0070] In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0071] In certain embodiments, the surfactant is a polysorbate.

[0072] In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof.

[0073] In certain embodiments, the concentration of the surfactant is between 0.01% (w / v) and 0.1% (w / v).

[0074] In certain embodiments, the concentration of the surfactant is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v).

[0075] In certain embodiments, the carbohydrate concentration is between 0.5% (w / v) and 5% (w / v).

[0076] In certain embodiments, the carbohydrate concentration is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v).

[0077] In certain embodiments, the carbohydrate is sucrose.

[0078] In certain embodiments, the pH of the buffer system or preparation is between 6.0 and 8.0.

[0079] In certain embodiments, the pH is between 6.0 and 7.0.

[0080] In certain embodiments, the pH is about 6.5.

[0081] In certain embodiments, the pH is from about 7.0 to about 8.0.

[0082] In certain embodiments, the pH is about 7.3.

[0083] In certain embodiments, the recombinant lentiviral vector further comprises a nucleotide sequence that is at least 80% identical to the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

[0084] In certain embodiments, the recombinant lentiviral vector further comprises a factor VIII (FVIII) coding sequence as set forth in SEQ ID NO:1 or SEQ ID NO:2.

[0085] In certain embodiments, the recombinant lentiviral vector further comprises a nucleotide sequence that is at least 80% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3.

[0086] In certain embodiments, the recombinant lentiviral vector further comprises a factor IX (FIX) coding sequence as set forth in SEQ ID NO:3.

[0087] In certain embodiments, the recombinant lentiviral vector further comprises an enhanced transthyretin (ET) promoter.

[0088] In certain embodiments, the recombinant lentiviral vector further comprises a nucleotide sequence that is at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7.

[0089] In certain embodiments, the recombinant lentiviral vector is isolated from transfected host cells selected from the following group: CHO cells, HEK293 cells, BHK21 cells, PER.C6 cells, NSO cells, and CAP cells.

[0090] In certain embodiments, the host cell is a CD47-positive host cell.

[0091] In one aspect, the invention is directed to a method of treating a human patient having a disorder, wherein the human patient is administered a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to the human patient.

[0092] In certain embodiments, the preparation is administered systemically to a human patient.

[0093] In certain embodiments, the preparation is administered intravenously.

[0094] In certain embodiments, the disorder is a bleeding disorder.

[0095] In certain embodiments, the bleeding disorder is hemophilia A or hemophilia B.

[0096] In another aspect, a recombinant lentiviral vector preparation is provided that includes: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pH of the buffer system or preparation is about 6.0 to about 7.5, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0097] In certain exemplary embodiments, the lentiviral vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof.

[0098] In certain exemplary embodiments, the buffer system comprises a phosphate buffer or a histidine buffer. In certain exemplary embodiments, the concentration of the phosphate buffer is about 5 mM to about 30 mM. In certain exemplary embodiments, the concentration of the phosphate buffer is about 10 mM to about 20 mM, about 10 mM to about 15 mM, about 20 mM to about 30 mM, about 20 mM to about 25 mM, or about 15 mM to about 20 mM. In certain exemplary embodiments, the concentration of the histidine buffer is about 5 mM to about 30 mM. In certain exemplary embodiments, the concentration of the histidine buffer is about 10 mM to about 20 mM, about 10 mM to about 15 mM, about 20 mM to about 30 mM, about 20 mM to about 25 mM, or about 15 mM to about 20 mM.

[0099] In certain exemplary embodiments, the salt concentration is about 80 mM to about 150 mM. In certain exemplary embodiments, the salt concentration is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain exemplary embodiments, the salt is a chloride salt. In certain exemplary embodiments, the chloride salt is NaCl.

[0100] In certain exemplary embodiments, the surfactant is a poloxamer, such as poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), or poloxamer 231 (P231). , poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain exemplary embodiments, the poloxamer is poloxamer 188 (P188). In certain exemplary embodiments, the poloxamer is poloxamer 407 (P407).

[0101] In certain exemplary embodiments, the surfactant is a polysorbate. In certain exemplary embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain exemplary embodiments, the concentration of the surfactant is about 0.01% (w / v) to about 0.1% (w / v). In certain exemplary embodiments, the concentration of the surfactant is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v).

[0102] In certain exemplary embodiments, the carbohydrate concentration is about 0.5% (w / v) to about 5% (w / v). In certain exemplary embodiments, the carbohydrate concentration is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v). In certain exemplary embodiments, the carbohydrate is sucrose.

[0103] In certain exemplary embodiments, the preparation comprises: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0104] In certain exemplary embodiments, the preparation comprises: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 130 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 1% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0105] In certain exemplary embodiments, the preparation comprises (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 6.5, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0106] In certain exemplary embodiments, the preparation comprises (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0107] In certain exemplary embodiments, the preparation comprises (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0108] In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid comprising the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid consisting of the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0109] In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid comprising the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain exemplary embodiments, a recombinant lentiviral vector comprises a nucleic acid consisting of the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0110] In certain exemplary embodiments, the recombinant lentiviral vector comprises an enhanced transthyretin (ET) promoter.

[0111] In certain exemplary embodiments, the recombinant lentiviral vector further comprises a nucleotide sequence that is at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7.

[0112] In certain exemplary embodiments, the recombinant lentiviral vector is isolated from transfected host cells selected from the following group: CHO cells, HEK293 cells, BHK21 cells, PER.C6 cells, NSO cells, and CAP cells. In certain exemplary embodiments, the host cells are CD47-positive host cells.

[0113] In another aspect, a method of treating a human patient having a disorder is provided, the method comprising administering to the human patient a recombinant lentiviral vector preparation described herein.

[0114] In certain exemplary embodiments, the preparation is administered systemically to a human patient, hi certain exemplary embodiments, the preparation is administered intravenously.

[0115] In certain exemplary embodiments, the disorder is a bleeding disorder. In certain exemplary embodiments, the bleeding disorder is hemophilia A or hemophilia B.

[0116] The above and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication containing color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0117] [Figure 1]Figure 2 depicts the characterization of lentiviral vector (LV) formulations after processing in a phosphate vehicle (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3). The bulk drug (DS) pool exhibits a distinct monomer peak, which shifts somewhat toward larger sizes after UF / DF into the final vehicle buffer (post-tangential flow filtration - TFF), indicating the presence of some larger particles. Without being bound by theory, this may be due to physical degradation of particles during the stress of processing the material. Upon filtration through a 0.22 μm filter membrane, the final DP profile reverts to match that of the DS pool at the start of processing. The effect of TFF stress can be visualized in the photographs shown in Figures 2A-B. [Figure 2] Figures 2A-2B are photographs of the effect of sterile filtration on lentiviral vectors (LV) in phosphate vehicle (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3) after tangential flow filtration (TFF) (Figure 2A) and on the final bulk drug (DS) pool (Figure 2B). [Figure 3] Figures 3A-3B are graphs depicting the stability of lentiviral vectors (LVs) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) without (Figure 3A) and with (Figure 3B) the addition of 1% (w / v) P188, as measured by p24 concentration using a p24 ELISA. [Figure 4]1 is a graph depicting the stability of lentiviral vectors (LVs) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) after agitation, as measured by particle concentration and particle size using a NanoSight. Stability study using TSSM formulation: 20 mM Tris, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3, shown with and without poloxamer 188 (P188). Measurements were performed using a NanoSight. [Figure 5] Figures 5A-5B are graphs depicting the stability of lentiviral vectors (LVs) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) after agitation, as measured by particle concentration and particle size using a NanoSight. Figure 5A shows that lentiviral particles appear to increase in size somewhat in response to agitation stress. The main peak is estimated to be monomeric lentiviral vector (approximately 130 nm), while the smaller, larger peak is likely due to degradation of monomeric particles. Figure 5B shows that the addition of 1% (w / v) poloxamer 188 (P188) did not interfere with lentiviral particle size. [Figure 6] Figures 6A-6B are graphs depicting the stability of lentiviral vectors (LVs) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) over 0, 3, 7, and 14 days at 37°C, as measured by functional titer in TU / ml using ddPCR (Figure 6A) and as a % of TO (Figure 6B). Figure 6B is normalized to time 0. The bars in each group represent a dilution series: undiluted (no dilution), 20-fold dilution (20x), and 100-fold dilution (100x). [Figure 7]Figures 7A-7B are graphs depicting the stability of lentiviral vectors (LVs) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) over 0, 3, 7, and 14 days at 37°C, as measured by functional titer in TU / ml using ddPCR and particle concentration using NanoSight (Figure 7A) or by overlay of functional titer and p24 data (Figure 7B). [Figure 8] Figure 8A is a graph depicting the stability of lentiviral vectors (LV) in the vehicle TSSM (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) at 37°C as a function of incubation time in days and weeks, as measured by particle concentration and particle size using a Nanosight. Figure 8B is a graph reporting the results of the 37°C stability experiment on a logarithmic scale to more clearly see the differences in particle size over time. [Figure 9] 1 is a graph depicting the stability of lentiviral vectors (LV) in a vehicle phosphate formulation (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3) as a function of incubation time in days, incubation temperature, agitation, and freeze / thaw (F / T) cycles, as measured by functional titer as % of TO using ddPCR and p24 concentration using p24 ELISA. [Figure 10] Figures 10A-10B are graphs depicting the stability of lentiviral vectors (LV) at 37°C using a phosphate formulation (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3) as a function of time in days, as measured by particle concentration and particle size distribution using NanoSight. Figure 10A reports NanoSight data normalized to 1 to better visualize differences in degradation peaks. Figure 10B presents raw data showing the decrease in the monomer peak over time upon 37°C incubation. [Figure 11] Figures 11A-11B show the functional titer, as measured by ddPCR, of three formulations subjected to 5 and 10 cycles of freezing and thawing (F / T) (Figure 11A) and compared at room temperature (RT) and RT with agitation (orbital shaker, 350 rpm) for 3 days (Figure 11B): Formulation 1. Phosphate formulation: 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 2. 10 mM phosphate, 130 mM NaCl, 1% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 3. 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3. 6.5 is a graph depicting the stability of lentiviral vectors (LV). [Figure 12] 12A-12B are graphs depicting the stability of lentiviral vectors (LVs), as measured by particle count using a NanoSight, comparing three formulations: Formulation 1 (Phos). Phosphate formulation: 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 2 (Phos. higherSalt). 10 mM phosphate, 130 mM NaCl, 1% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; and Formulation 3 (Hist). 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5. FIG. 12A shows data for 3 days at room temperature (RT) and at RT with agitation (orbital shaker, 350 rpm), while FIG. 12B shows data for 5 and 10 cycles of freeze-thaw (F / T). [Figure 13] 1 is a graph depicting a simulated practical stability study using one formulation: Formulation 1 (phosphate buffer): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3, exposed to an IV bag at room temperature for 6 hours. [Figure 14]1 is a graph depicting a formulation buffer stability study comparing the performance of container closures (Schott Type 1 glass vials and West CZ COP vials) over one freeze and thaw cycle (-80°C overnight, thawed in a 37°C water bath): Formulation 1 (Phosphate Buffer): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3. Particle concentrations were obtained using Microflow Imaging (MFI). [Figure 15] 1 is a graph depicting vial strain testing using Schott Type 1 glass vials with one freeze and thaw cycle (-80°C, thawed in a 37°C water bath): Formulation 1 (phosphate buffer only): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3. Data was collected using strain gauges and thermocouples. [Figure 16-1] Figures 16A-16C depict LVV material compatibility graphs comparing container closure (Schott Type 1 glass vial and West CZ vial) performance for various stability conditions: 1FT = 1 cycle of freeze and thaw; 2hr = 2 hours of exposure to room temperature; Foam x 3 = vigorous pipetting and dispensing to produce visible bubbles in the container; and 10x = the same stability parameter as a 10-fold dilution. LVV was measured in Formulation 1 (phosphate buffer): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3, by functional titer (Figure 16A), p24 concentration (Figure 16B), and particle concentration (Figure 16C). Data were collected using strain gauges and thermocouples. Particle concentration was obtained using a NanoSight. [Figure 16-2] Continued from Figure 16-1. [Figure 17]1 is a graph depicting stability studies comparing two formulations over 10 cycles of freeze-thaw (F / T) and at room temperature (RT) for 1 day and 3 days: Formulation 1 (phosphate buffer): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 3 (histidine buffer): 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5. [Figure 18] Graph depicting long-term stability (9 months (9 mo.) after frozen storage at -80°C) data for phosphate and histidine formulations: Formulation 1 (Phosphate): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 3 (Histidine): 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5. [Figure 19-1] Figures 19A-19D are graphs depicting stability studies comparing phosphate and histidine buffers at the same pH, pH 7.0, as measured by functional titer (Figure 19A), normalized functional titer (Figure 19B), p24 concentration (Figure 19C), and particle concentration (Figure 19D): Formulation 4 (phosphate): 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.0; Formulation 5 (histidine): 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.0. Results are presented in units of functional titer and normalized as a percentage of the starting material (TO). Particle concentrations were obtained using a NanoSight. [Figure 19-2] Continuation of Figure 19-1. DETAILED DESCRIPTION OF THE INVENTION

[0118] The present disclosure provides, inter alia, lentiviral vector (LV) preparations (formulations) and pharmaceutical compositions containing recombinant LV. The present disclosure also provides methods of using the LV preparations to treat subjects with disorders, including bleeding disorders, such as hemophilia A or hemophilia B. The present disclosure also provides processes for producing the LV preparations.

[0119] In general, the nomenclatures used herein in connection with cell and tissue culture, molecular biology, biophysics, immunology, microbiology, genetics, and protein and nucleic acid chemistry are well known and commonly used in the art. The methods and techniques provided herein are generally carried out according to conventional methods well known in the art, as described in the various general and more specific references cited and discussed throughout this specification, unless otherwise indicated. Enzymatic reactions and purification techniques are carried out according to manufacturer's specifications, as commonly performed in the art, or as described herein. The nomenclatures used in connection with analytical chemistry, synthetic organic chemistry, and their medicinal and pharmaceutical chemistry, as well as their testing procedures and techniques, described herein, are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation, and delivery, and patient treatment.

[0120] Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or collateral definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Unless otherwise specified, the use of "or" means "and / or." The use of the term "including," as well as other forms such as "includes" and "included," is not limiting.

[0121] In order that the present invention may be more readily understood, certain terms are first defined.

[0122] As used herein, the term "vector" refers to any vehicle for cloning and / or transferring a nucleic acid into a host cell. A vector may be a replicon to which another nucleic acid segment can be attached, resulting in replication of the attached segment. A "replicon" refers to any genetic element (e.g., a plasmid, a phage, a cosmid, a chromosome, a virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control. The term "vector" includes both viral and non-viral vehicles for introducing nucleic acids into cells in vitro, ex vivo, or in vivo. Numerous vectors, including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses, are known and used in the art. Insertion of a polynucleotide into a suitable vector can be achieved by ligating an appropriate polynucleotide fragment into a selected vector with complementary cohesive termini.

[0123] As used herein, the term "recombinant lentiviral vector" refers to a vector that has sufficient lentiviral genetic information to allow packaging of the RNA genome into viral particles that can infect target cells in the presence of packaging components. Infection of target cells can involve reverse transcription and integration into the target cell genome. Recombinant lentiviral vectors carry non-viral coding sequences that are delivered to target cells by the vector. Recombinant lentiviral vectors are unable to independently replicate in the final target cell to produce infectious lentiviral particles. Typically, recombinant lentiviral vectors lack functional gag-pol and / or env genes and / or other genes essential for replication. The vectors of the present invention can also be configured as split-intron vectors.

[0124] As used herein, the term "treating" refers to the improvement or alleviation of one or more symptoms of a disorder. Treating does not necessarily mean curing.

[0125] As used herein, the term "human patient" refers to a human having a disease or disorder and in need of treatment for that disease or disorder.

[0126] As used herein, the phrase "systemic administration" refers to administering or administering to a subject a pharmaceutical composition comprising LV, so that the LV is directly introduced into the subject's bloodstream.Exemplary routes of systemic administration include, but are not limited to, intravenous, for example, intravenous injection and intravenous infusion, for example, via central venous access.

[0127] As used herein, the term "about," when used in reference to a particular stated numerical value, means that the value can vary by no more than 10% of the stated value. For example, as used herein, the expression "about 100" includes 90 and 110, and all values ​​therebetween (e.g., 90, 91, 92, 93, 94, 95, etc.).

[0128] A. Formulation of Lentiviral Vectors (LV) with a TRIS-Free Buffer System In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) an effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the pH of the buffer system is about 6.0 to about 8.0. In certain embodiments, the pH of the buffer system is about 6.0 to about 7.5. In certain embodiments, the pH of the buffer system is about 6.0 to about 7.0. In certain embodiments, the pH of the buffer system is about 6.0 to about 8.0. In certain embodiments, the pH of the buffer system is about 6.5. In certain embodiments, the pH of the buffer system is about 7.3. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is about 5 mM to about 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 mM to about 20 mM, about 10 mM to about 15 mM, about 20 mM to about 30 mM, about 20 mM to about 25 mM, or about 15 mM to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is about 80 mM to about 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is about 0.01% (w / v) to about 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is about 0.5% (w / v) to about 5% (w / v). In certain embodiments, the chloride salt is sodium chloride (NaCl).In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is about 6.1, about 6.3, about 6.5, about 6.7, about 6.9, about 7.1, about 7.3, about 7.5, about 7.7, or about 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is about 10 mM, about 15 mM, about 20 mM, or about 25 mM. In certain embodiments, the chloride salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v). In certain embodiments, the concentration of the carbohydrate is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0129] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0130] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 130 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 1% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0131] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 6.5, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0132] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0133] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient.

[0134] A.1. Lentiviral Vectors Lentiviral vectors are part of the larger group of retroviral vectors (Coffin et al. (1997), "Retroviruses," Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus, pp. 758-763). Examples of primate lentiviruses include human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al. (1992); Lewis and Emerman (1994)).

[0135] As used herein, a lentiviral vector is a vector that contains at least one component that can be derived from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects cells, expresses genes, or replicates. In a recombinant lentiviral vector, at least a portion of one or more protein coding regions essential for replication can be removed from the virus. This makes the viral vector replication-deficient. Alternatively, a portion of the viral genome can be replaced with a transgene, thereby allowing the vector to transduce target non-dividing host cells and / or integrate its genome into the host genome.

[0136] Recombinant lentiviruses are typically pseudotyped. Pseudotyping can confer one or more advantages. For example, the env gene product of HIV-based vectors is thought to restrict these vectors to infecting only cells expressing a protein called CD4. However, if the env gene in these vectors is replaced with env sequences from other RNA viruses, they may have a broader infectious spectrum (Verma and Somia, 1997). The envelope glycoprotein (G) of vesicular stomatitis virus (VSV), a rhabdovirus, is an envelope protein that has been shown to be capable of pseudotyping certain retroviruses. Pseudotyped VSV-G vectors can be used to transduce a wide range of mammalian cells. Incorporating a non-lentiviral pseudotyped envelope, such as the VSV-G protein, has the advantage that vector particles can be concentrated to high titers without losing infectivity (Akkina et al., 1996, J. Virol. 70:2581-5). Lentiviral and retroviral envelope proteins appear unable to withstand the shear forces of ultracentrifugation, likely because they consist of two noncovalently linked subunits. The interaction between these subunits is disrupted by centrifugation. In contrast, the VSV glycoprotein consists of a single unit. Therefore, pseudotyping of the VSV-G protein may offer potential advantages.

[0137] Lentiviruses include members of the bovine lentivirus group, equine lentivirus group, feline lentivirus group, ovine and caprine lentivirus group, and primate lentivirus group. The development of lentiviral vectors for gene therapy is reviewed in Klimatcheva et al. (1999), Frontiers in Bioscience 4:481-496. The design and use of lentiviral vectors suitable for gene therapy are described, for example, in U.S. Patent Nos. 6,207,455 and 6,615,782. Examples of lentiviruses include, but are not limited to, HIV-1, HIV-2, HIV-1 / HIV-2 pseudotyped, HIV-1 / SIV, FIV, caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus, and bovine immunodeficiency virus.

[0138] In some embodiments, the lentiviral vector of the present disclosure is a "third-generation" lentiviral vector. As used herein, the term "third-generation" lentiviral vector refers to a lentiviral packaging system that has the characteristics of a second-generation vector system and further lacks a functional tat gene, e.g., the tat gene has been deleted or inactivated. Typically, the gene encoding rev is provided on a separate expression construct. See, e.g., Dull et al. (1998), J. Virol. 72:8463-8471. As used herein, a "second-generation" lentiviral vector system refers to a lentiviral packaging system that lacks functional accessory genes, e.g., the accessory genes vif, vpr, vpu, and nef have been deleted or inactivated. See, e.g., Zufferey et al. (1997), Nat. Biotechnol. 15:871-875. As used herein, a "packaging system" refers to a set of viral constructs that encode the viral proteins involved in packaging the recombinant virus. Typically, the packaging system construct is ultimately incorporated into a packaging cell.

[0139] In some embodiments, the third-generation lentiviral vector of the present disclosure is a self-inactivating lentiviral vector. In some embodiments, the lentiviral vector is a VSV.G pseudotyped lentiviral vector. In some embodiments, the lentiviral vector comprises a hepatocyte-specific promoter for transgene expression. In some embodiments, the hepatocyte-specific promoter is an enhanced transthyretin promoter. In some embodiments, the lentiviral vector comprises one or more target sequences of miR-142 to reduce immune responses to the transgene product. In some embodiments, incorporating one or more target sequences of miR-142 into the lentiviral vector of the present disclosure enables a desired transgene expression profile. For example, incorporating one or more target sequences of miR-142 can suppress transgene expression in intravascular and extravascular hematopoietic cell lineages, while maintaining transgene expression in non-hematopoietic cells. No carcinogenesis has been detected in tumor-prone mice treated with the lentiviral vector system of the present disclosure. See Brown et al. (2007) Blood 110:4144-52, Brown et al. (2006) Nat. Ned. 12:585-91, and Cantore et al. (2015) Sci. Transl. Med. 7(277):277ra28.

[0140] The lentiviral vector of the present disclosure comprises a codon-optimized polynucleotide transgene encoding a specific protein, such as the FVIII or FIX protein described herein. In one embodiment, the optimized coding sequence of the FVIII or FIX protein is operably linked to an expression control sequence. As used herein, two nucleic acid sequences are operably linked when they are covalently linked in a manner that allows each component nucleic acid sequence to retain its function. A coding sequence and a gene expression control sequence are said to be operably linked when they are covalently linked in a manner that places the expression or transcription and / or translation of the coding sequence under the influence or control of the gene expression control sequence. Two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences (1) does not result in the introduction of a frameshift mutation, (2) does not interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) does not interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence is considered to be operably linked to a coding nucleic acid sequence if the gene expression sequence is capable of effecting transcription of that coding nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.

[0141] In certain embodiments, the lentiviral vector is a recombinant lentiviral vector capable of infecting non-dividing cells. In certain embodiments, the lentiviral vector is a recombinant lentiviral vector capable of infecting liver cells (e.g., hepatocytes). Lentiviral genomes and proviral DNA typically contain three genes found in retroviruses: gag, pol, and env, which are flanked by two long terminal repeat (LTR) sequences. The gag gene encodes internal structural (matrix, capsid, and nucleocapsid) proteins; the pol gene encodes RNA-directed DNA polymerase (reverse transcriptase), protease, and integrase; and the env gene encodes viral envelope glycoproteins. The 5' and 3' LTRs function to promote transcription and polyadenylation of virion RNA. The LTRs contain all other cis-acting sequences required for viral replication. Lentiviruses have additional genes including vif, vpr, tat, rev, vpu, nef and vpx (in HIV-1, HIV-2 and / or SIV).

[0142] The 5' LTR is flanked by sequences necessary for reverse transcription of the genome (tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (Psi site). If the viral genome lacks sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions), a cis defect prevents encapsidation of the genomic RNA.

[0143] However, the resulting mutant remains capable of directing the synthesis of all virion proteins. The present disclosure provides a method for generating a recombinant lentivirus capable of infecting non-dividing cells, comprising transfecting a suitable host cell with two or more vectors carrying packaging functions, i.e., gag, pol, and env, and rev and tat. As disclosed herein below, for certain applications, vectors lacking a functional tat gene are desirable. Thus, for example, packaging cells can be generated with one vector providing nucleic acid encoding viral gag and viral pol, and another vector providing nucleic acid encoding viral env. Introducing a vector providing a heterologous gene, identified herein as a transfer vector, into packaging cells results in producer cells that release infectious viral particles carrying the foreign gene of interest.

[0144] According to the above-described configuration of the vector and the foreign gene, the second vector can provide a nucleic acid encoding a viral envelope (env) gene. The env gene can be derived from almost any suitable virus, including retroviruses. In some embodiments, the env protein is an amphotropic envelope protein that allows transduction of cells of both human and other species.

[0145] Examples of env genes from retroviruses include, but are not limited to, Moloney murine leukemia virus (MoMuLV or MMLV), Harvey murine sarcoma virus (HaMuSV or HSV), mouse mammary tumor virus (MuMTV or MMTV), gibbon ape leukemia virus (GaLV or GALV), human immunodeficiency virus (HIV), and Rous sarcoma virus (RSV). Other env genes, such as vesicular stomatitis virus (VSV) protein G (VSV-G), hepatitis virus, and influenza, can also be used. In some embodiments, the viral env nucleic acid sequence is operably linked to a regulatory sequence described elsewhere herein. In certain embodiments, the formulation buffers of the present disclosure confer lentiviral stability, particularly for lentiviruses containing VSV-G, resulting in long-term frozen storage. The formulation buffers of the present disclosure provide enhanced lentiviral stability against freezing and thawing and exposure to high temperatures, particularly for lentiviruses containing VSV-G.

[0146] In certain embodiments, the lentiviral vector is deleted from HIV pathogenicity genes env, vif, vpr, vpu and nef, without impairing the ability of the vector to transduce non-dividing cells.In some embodiments, the lentiviral vector comprises the deletion of the U3 region of 3'LTR.The deletion of the U3 region can be complete or partial deletion.

[0147] In some embodiments, the lentiviral vector of the present disclosure comprising the FVIII nucleotide sequence described herein can be transfected into cells having (a) a first nucleotide sequence comprising the gag, pol, or gag and pol genes, and (b) a second nucleotide sequence comprising a heterologous env gene; wherein the lentiviral vector lacks a functional tat gene. In other embodiments, the cells are further transfected with a fourth nucleotide sequence comprising the rev gene. In certain embodiments, the lentiviral vector lacks a functional gene selected from vif, vpr, vpu, vpx, and nef, or a combination thereof.

[0148] In certain embodiments, the lentiviral vectors of the present disclosure comprise one or more nucleotide sequences encoding a gag protein, a Rev response element, a central polypurine tract (cPPT), or any combination thereof.

[0149] In some embodiments, the lentiviral vector expresses one or more polypeptides on its surface that improve the targeting and / or activity of the lentiviral vector or the encoded FVIII polypeptide. The one or more polypeptides can be encoded by the lentiviral vector or can be incorporated during the budding of the lentiviral vector from the host cell. During lentivirus production, viral particles bud from the producer host cell. During the budding process, the viral particles acquire a lipid coat, which is derived from the lipid membrane of the host cell. As a result, the lipid coat of the viral particle can include membrane-associated polypeptides that were previously present on the surface of the host cell.

[0150] In some embodiments, the lentiviral vector expresses one or more polypeptides on its surface that inhibit an immune response to the lentiviral vector after administration to a human subject. In some embodiments, the surface of the lentiviral vector comprises one or more CD47 molecules. CD47 is a "marker of self" protein that is ubiquitously expressed on human cells. Surface expression of CD47 inhibits macrophage-induced phagocytosis of endogenous cells through the interaction of CD47 with SIRPα expressed by macrophages. Cells expressing high levels of CD47 are less likely to be targeted and destroyed by human macrophages in vivo.

[0151] In some embodiments, the lentiviral vector expresses high concentrations of CD47 polypeptide molecules on its surface. In some embodiments, the lentiviral vector is generated in a cell line with a high CD47 expression level. In certain embodiments, the lentiviral vector expresses CD47high In certain embodiments, the lentiviral vector is produced in cells that have high expression of CD47 on the cell membrane. high The CD47 is generated in HEK 293T cells, which have high expression of CD47 on the cell membrane. In some embodiments, the HEK 293T cells are modified to increase CD47 expression compared to unmodified HEK 293T cells. In certain embodiments, the CD47 is human CD47.

[0152] In some embodiments, the lentiviral vector has little or no surface expression of major histocompatibility complex class I (MHC-I). Surface-expressed MHC-I presents peptide fragments of "non-self" proteins from within the cell, e.g., protein fragments indicative of infection, and promotes an immune response against the cell. In some embodiments, the lentiviral vector has little or no surface expression of MHC-I. low In some embodiments, the lentiviral vector is produced in a cell, and the cell has reduced expression of MHC-I on the cell membrane. - (or "MHC-I free ", "MHC-1 neg " or "MHC negative" ) cells, which lack expression of MHC-I.

[0153] In certain embodiments, the lentiviral vector comprises a lipid coat that contains a high concentration of CD47 polypeptide and lacks MHC-I polypeptides. high / MHC-I low Cell lines, e.g., CD47 high / MHC-I low In some embodiments, the lentiviral vector is produced in a HEK 293T cell line. high / MHC-I free Cell lines, e.g., CD47 high / MHC-I free Produced in the HEK 293T cell line.

[0154] Examples of lentiviral vectors are disclosed in U.S. Pat. No. 9,050,269 and WO9931251, WO9712622, WO9817815, WO9817816, and WO9818934, which are incorporated herein by reference in their entireties.

[0155] In some embodiments, the present disclosure provides a lentiviral vector comprising an isolated nucleic acid molecule comprising a nucleotide sequence comprising a nucleotide sequence set forth in Table 1.

[0156] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

[0157] The lentiviral vectors of the present disclosure are expressed in a concentration of 5×10 10 TU / kg or less, 10 9 TU / kg or less, or 10 8At such dosages, administration of the lentiviral vectors of the present disclosure is therapeutically effective when administered at a dose of TU / kg or less. At such dosages, administration of the lentiviral vectors of the present disclosure increases or decreases plasma FVIII activity in a subject in need thereof by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, or at least about 15-fold, compared to basal levels in the subject, compared to levels in subjects administered a control lentiviral vector, compared to levels in subjects administered a control nucleic acid molecule, or compared to levels in a subject after administration of a polypeptide encoded by a control nucleic acid molecule. and can result in an increase of at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 55-fold, at least about 60-fold, at least about 65-fold, at least about 70-fold, at least about 75-fold, at least about 80-fold, at least about 85-fold, at least about 90-fold, at least about 95-fold, at least about 100-fold, at least about 110-fold, at least about 120-fold, at least about 130-fold, at least about 140-fold, at least about 150-fold, at least about 160-fold, at least about 170-fold, at least about 180-fold, at least about 190-fold, or at least about 200-fold.

[0158] In certain embodiments, it may be useful to include one or more miRNA target sequences in a lentiviral vector, for example, operably linked to a transgene, such as an optimized FVIII transgene. Thus, the present disclosure also provides at least one miRNA sequence target that is operably linked to an optimized FVIII or optimized FIX nucleotide sequence or otherwise inserted into a lentiviral vector. More than one copy of the miRNA target sequence included in a lentiviral vector can increase the effectiveness of the system.

[0159] Different miRNA target sequences can also be included.For example, a lentiviral vector that expresses more than one transgene can have the transgene under the control of more than one miRNA target sequence, which can be the same or different.The miRNA target sequence can be tandem, but other arrangements are also included.The transgene expression cassette containing the miRNA target sequence can also be inserted into the lentiviral vector in antisense orientation.Antisense orientation can be useful in the production of viral particles to avoid the expression of gene products that may otherwise be toxic to producer cells.

[0160] In other embodiments, the lentiviral vector contains one, two, three, four, five, six, seven, or eight copies of the same or different miRNA target sequences. In certain embodiments, the lentiviral vector does not contain any miRNA target sequences. The choice of whether to include (and the number of) miRNA target sequences will be guided by known parameters such as the intended tissue target, the desired level of expression, etc.

[0161] In one embodiment, the target sequence is the miR-223 target, which has been reported to be most effective in myeloid-committed progenitor cells and at least partially block expression in earlier HSPCs. The miR-223 target can block expression in differentiated myeloid cells, including granulocytes, monocytes, macrophages, and myeloid dendritic cells. The miR-223 target may also be suitable for gene therapy applications that rely on robust transgene expression in lymphocyte or erythroid lineages. The miR-223 target can also block expression very effectively in human HSCs.

[0162] In another embodiment, the target sequence is the miR142 target (tccataaagtaggaaacactaca (SEQ ID NO: 7)). In one embodiment, the lentiviral vector contains four copies of the miR-142 target sequence. In certain embodiments, the complementary sequence of a hematopoietic-specific microRNA, such as miR-142 (142T), is incorporated into the 3' untranslated region of the lentiviral vector, rendering the transgene-encoding transcript susceptible to miRNA-mediated downregulation. This method can block transgene expression in hematopoietic antigen-presenting cells (APCs) while maintaining it in non-hematopoietic cells (Brown et al., Nat Med, 2006). This strategy can impose stringent post-transcriptional control on transgene expression, thus enabling stable delivery and long-term expression of the transgene. In some embodiments, miR-142 modulation prevents immune-mediated elimination of transduced cells and / or induces antigen-specific regulatory T cells (Tregs) to mediate robust immune tolerance to the antigen encoded by the transgene.

[0163] In some embodiments, the target sequence is a miR181 target. Chen CZ and Lodish H, Seminars in Immunology (2005) 17(2):155-165, discloses that miR-181 is a miRNA that is specifically expressed in B cells in mouse bone marrow (Chen and Lodish, 2005). It also discloses that some human miRNAs are associated with leukemia.

[0164] A target sequence can be fully or partially complementary to a miRNA. The term "fully complementary" means that the target sequence has a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that it recognizes. The term "partially complementary" means that the target sequence is only partially complementary to the sequence of the miRNA that it recognizes, whereby the partially complementary sequence is still recognized by the miRNA. In other words, in the context of the present disclosure, a partially complementary target sequence is effective in recognizing the corresponding miRNA and causing inhibition or reduction of transgene expression in cells that express that miRNA. Examples of miRNA target sequences are described in WO2007 / 000668, WO2004 / 094642, WO2010 / 055413, or WO2010 / 125471, which are incorporated herein by reference in their entirety.

[0165] A.2. Excipients, Carriers, and Other Components of Formulations For gene therapy, lentiviral vectors (LVs) are often administered systemically, i.e., directly into the patient's bloodstream. Therefore, there is widespread interest in creating LV formulations that are nontoxic yet maintain the stability and efficacy of LVs. When testing vehicles for creating LV formulations, several basic principles must be kept in mind. To ensure minimal shock in the recipient, the pH, ionic concentration, and osmolality must be optimized to match physiological conditions. The combination of buffers, salts, and carbohydrates (to adjust pH, ionic concentration, and osmolality, respectively) cannot be determined a priori and must be tested experimentally.

[0166] For example, U.S. Patent Application Publication No. 20170073702A1 discloses a TSSM vehicle (20 mM TRIS, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3), which could be expected to be non-toxic upon systemic administration to mammals. However, formulations using TSSM alone or in combination with LV were found to be toxic to mice (see Example 2). Surprisingly, however, when a phosphate vehicle (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3) or a histidine vehicle (20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5) was used, the formulations were non-toxic to mice.

[0167] Although this would not have been expected a priori, formulations using phosphate vehicles resulted in greater stability and integrity of LVs compared with TSSM formulations (Examples 3 and 4). Unexpectedly, histidine vehicles conferred greater stability to LVs than phosphate vehicles (Example 4). This important feature of histidine formulations, i.e., the compatibility of lentiviral vectors with low-pH vehicles (pH 6.5) compared with the neutral pH of phosphate or TRIS buffers (pH 7.3), was surprising for at least the following reasons: The VSV-G envelope protein is a critical component of lentiviral vectors, which promotes their infectivity within cells. The pI (isoelectric point) of VSV-G is approximately 5, which means that the closer the pH of the solution is to this pI, the more neutral the charge of the protein. The more neutral the charge of proteins, the stronger their ability to attract each other, which can lead to aggregation (a degradation mechanism) and thereby impair infectivity.

[0168] It was also surprising that the inclusion of the surfactant poloxamer 188 (P188) in the phosphate and histidine formulations improved LV stability and integrity compared to the TSSM formulation. This was unexpected, as surfactants were expected to destabilize the outer lipid membrane envelope of LVs and therefore reduce LV stability and integrity. Similarly, it was not a priori clear that the removal of mannitol from the formulation would result in a formulation with greater LV stability and integrity (Examples 3 and 4).

[0169] Thus, based on the findings described herein, it has been found that lentiviral vector preparations comprising a TRIS-free buffer system can provide improved lentiviral vector stability and integrity.Those skilled in the art will understand that a TRIS-free buffer system refers to any buffer system that does not contain TRIS (also known as tris(hydroxymethyl)aminomethane, tromethamine, or THAM).In certain embodiments, the TRIS-free buffer system comprises phosphate.In certain embodiments, the TRIS-free buffer system comprises histidine.

[0170] In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 6.0 to about 8.0. In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 6.0 to about 7.5. In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 6.0 to about 7.0. In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 7.0 to about 8.0. In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 6.5. In certain embodiments, the pH of the TRIS-free buffer system or preparation is about 7.3.

[0171] Those skilled in the art will be able to determine suitable buffer components to be employed in the TRIS-free buffer systems of the preparations disclosed herein to maintain a target pH or target pH range. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range of about 6.0 to about 8.0. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range of about 6.0 to about 7.5. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range of about 6.0 to about 7.0. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range of about 7.0 to about 8.0. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range capable of maintaining a pH of 6.5. In certain embodiments, the TRIS-free buffer system comprises buffer components having an effective pH buffering range capable of maintaining a pH of 7.3.

[0172] Compositions containing the lentiviral gene therapy vectors disclosed herein, or host cells of the present disclosure (e.g., hepatocytes targeted by the lentiviral gene therapy vectors disclosed herein) can contain a suitable pharmaceutically acceptable carrier. For example, they can contain excipients and / or adjuvants that facilitate processing of the active compound into a preparation designed for delivery to the site of action.

[0173] The pharmaceutical composition can be formulated for parenteral administration (i.e., intravenous, subcutaneous, or intramuscular) by bolus injection. The preparation for injection can be provided in unit dosage form, for example, in ampoules or multi-dose containers, with added preservatives. The composition can take the form of a suspension, solution, or emulsion in an oily or aqueous vehicle, and can contain formulatory agents such as suspending agents, stabilizers, and / or dispersants. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, for example, pyrogen-free water.

[0174] Suitable formulations for parenteral administration also include aqueous solutions of the active compound in water-soluble form, for example, as a water-soluble salt. Additionally, suspensions of the active compound can be administered as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and dextran. Optionally, the suspension can also contain stabilizers. Liposomes can also be used to encapsulate the molecules of the present disclosure for delivery to cells or interstitial spaces. Exemplary pharmaceutically acceptable carriers include physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, water, saline, phosphate-buffered saline, dextrose, glycerol, ethanol, and the like. In some embodiments, the composition includes an isotonic agent, for example, a sugar, a polyalcohol such as mannitol or sorbitol, or sodium chloride. In other embodiments, the composition contains pharmaceutically acceptable substances such as wetting agents or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers which enhance the shelf life or effectiveness of the active ingredient.

[0175] The compositions of the present disclosure may be in a variety of forms, including, for example, liquids (e.g., injectable and infusible solutions), dispersions, suspensions, semi-solid and solid dosage forms. The preferred form will vary depending on the mode of administration and therapeutic application.

[0176] The composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable for high drug concentration.Sterile injectable solutions can be prepared by incorporating the active ingredient in the required amount in a suitable solvent, along with one or a combination of the above-listed ingredients, as needed, and then sterilizing by filtration.Generally, dispersions are prepared by incorporating the active ingredient into a sterile vehicle containing a basic dispersion medium and the other necessary ingredients listed above.For sterile powders for preparing sterile injectable solutions, the preferred preparation method is vacuum drying and freeze-drying, which produces a powder of the active ingredient plus any desired additional ingredients from a previously sterile-filtered solution.The proper fluidity of the solution can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants.The prolonged absorption time of injectable compositions can be achieved by including an agent that delays absorption, such as monostearate salts and gelatin, in the composition.

[0177] Active ingredient can be formulated with controlled release preparation or controlled release device.Examples of such preparation and device include implant, transdermal patch and microencapsulated delivery system.Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester and polylactic acid can be used.The preparation method of such preparation and device is known in the art.For example, see Sustained and Controlled Release Drug Delivery Systems, edited by JR Robinson, Marcel Dekker, Inc., New York, 1978.

[0178] Injectable depot preparations can be prepared by forming microencapsulated matrices of drugs in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer and the nature of the polymer used, the rate of drug release can be controlled. Other exemplary biodegradable polymers include polyorthoesters and polyanhydrides. Injectable depot preparations can also be prepared by entrapping drugs in liposomes or microemulsions.

[0179] Supplementary active compounds can be incorporated into the composition. In one embodiment, the chimeric protein of the present disclosure is formulated with other coagulation factors, or their variants, fragments, analogs, or derivatives. For example, coagulation factors include, but are not limited to, factor V, factor VII, factor VIII, factor IX, factor X, factor XI, factor XII, factor XIII, prothrombin, fibrinogen, von Willebrand factor, or recombinant soluble tissue factor (rsTF), or activated forms of any of the foregoing. Hemostatic coagulation factors can also include antifibrinolytic agents, such as epsilon-aminocaproic acid and tranexamic acid.

[0180] Dosage regimen can be adjusted to obtain optimal desired response.For example, single bolus administration can be carried out, or several divided doses can be administered over time, or according to the exigencies of the therapeutic situation, the dose can be reduced or increased accordingly.For ease of administration and uniformity of dosage, it is advantageous to formulate parenteral compositions in dosage unit form.For example, see Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, Pa. 1980).

[0181] In addition to the active compound, liquid dosage forms may contain inactive ingredients such as water, ethyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils, glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan.

[0182] Non-limiting examples of suitable pharmaceutical carriers are also described in Remington's Pharmaceutical Sciences by EW Martin.Some examples of excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerin monostearate, talc, sodium chloride, dried skim milk, glycerin, propylene, glycol, water, ethanol, etc.The composition can also contain a pH buffering agent, and a wetting agent or emulsifying agent.

[0183] For oral administration, pharmaceutical compositions can be in the form of tablets or capsules prepared by conventional means. The compositions can also be prepared as liquids, such as syrups or suspensions. Liquids can contain suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats), emulsifiers (lecithin or gum arabic), non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils), and preservatives (e.g., methyl or propyl p-hydroxybenzoate or sorbic acid). Preparations can also contain flavorings, colorings, and sweeteners. Alternatively, the compositions can be provided as a dry product for constitution with water or another suitable vehicle.

[0184] For buccal administration, the compositions may take the form of tablets or lozenges according to conventional protocols.

[0185] For administration by inhalation, the compound for use according to the present disclosure is conveniently delivered in the form of nebulized aerosol with or without excipient, or in the form of aerosol spray from pressurized pack or nebulizer, optionally with propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoromethane, carbon dioxide or other suitable gas.In the case of pressurized aerosol, dosage unit can be determined by providing a valve to deliver a metered amount.Capsules and cartridges, for example, made of gelatin, can be formulated to contain the powder mixture of compound and suitable powder base, for example, lactose or starch, for use in inhaler or insufflator.

[0186] Pharmaceutical compositions also can be formulated for rectal administration as suppositories or retention enemas, eg, containing conventional suppository bases such as cocoa butter or other glycerides.

[0187] In one embodiment, the pharmaceutical composition comprises a lentiviral vector comprising an optimized nucleic acid molecule encoding a polypeptide having Factor VIII or Factor IX activity, and a pharmaceutically acceptable carrier. In another embodiment, the pharmaceutical composition comprises a host cell (e.g., a hepatocyte) comprising a lentiviral vector comprising an optimized nucleic acid molecule encoding a polypeptide having Factor VIII or Factor IX activity, and a pharmaceutically acceptable carrier.

[0188] In some embodiments, the composition is administered by a route selected from the group consisting of topical, intraocular, parenteral, intrathecal, subdural, and oral administration. Parenteral administration can be intravenous or subcutaneous.

[0189] A fundamental aspect of ensuring a therapeutic formulation transitions from the laboratory to a manufacturable, marketable product of high and consistent quality is its stability in the dosage form. Due to their complex chemical properties and structure, proteins, such as viral surface and capsid proteins, are susceptible to various forms of physical and chemical degradation that can compromise the biological efficacy and safety of the final product. For example, protein aggregation is a key quality attribute routinely monitored for protein-based products and is crucial for determining a product's shelf life. At a fundamental level, protein aggregation is associated with the stability of the protein's native form, and growth in non-native cells (e.g., non-native mammalian cells) is generally associated with an increased rate and extent of aggregation. It is therefore not surprising that attempts to control and minimize aggregation during a product's shelf life (kinetic stability) are often made through the use of excipients or formulation conditions intended to enhance the protein's conformational stability. Essentially, the intent is to stabilize the protein in its native conformation to minimize the population of aggregation-competent "non-native" species. Sugars and polyols such as sucrose, trehalose, mannitol, and sorbitol are often used to stabilize proteins in their native state and reduce the rate of aggregation, but one undesirable effect of using these stabilizers is a concentration-dependent increase in solution viscosity.

[0190] Solution viscosity is an important attribute of protein products, especially those formulated at high protein concentrations, and can critically affect product utility and outcomes. Product manufacturability and ultimate use by patients or healthcare professionals are closely linked to the solution's ability to flow uninterrupted. For example, high viscosity may require the use of specialized administration devices or protocols that are not always suitable for the desired population, thereby limiting product use. In other instances, high solution viscosity may require the application of manufacturing techniques (e.g., high-temperature processing) that may adversely affect protein stability. For this reason, it is not uncommon to employ viscosity-reducing excipients, such as salts and amino acids, in high-protein concentration solutions. However, these excipients can adversely affect protein stability, resulting in solutions with higher aggregation rates compared to high-viscosity control solutions without the viscosity-reducing agents. In short, commonly employed stabilizers and viscosity-reducing excipients can have adverse effects on product performance, potentially complicating product development.

[0191] Another important attribute that must be considered for injectable products (mostly protein-based products) is their osmolality. While solutions for intravenous injection generally need to be isotonic, solutions for subcutaneous injection are often hypertonic. Indeed, there is evidence in the literature that hypertonic formulations enhance the bioavailability of proteins after subcutaneous administration (Fathallah, AM et al., Biopharm Drug Dispos. 2015 March;36(2):115-25). Therefore, the impact of solution osmolality (and therefore tonicity) on injection site discomfort and / or reactions in patient populations, as well as bioavailability, needs to be carefully monitored and characterized during clinical development.

[0192] Formulations may sometimes contain surfactants, such as poloxamers and polysorbates, which may confer specific benefits. Poloxamers are nonionic poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO) copolymers. They are used in pharmaceutical formulations as surfactants, emulsifiers, solubilizers, dispersants, and in vivo absorbance enhancers. Poloxamers are synthetic triblock copolymers with the following core formula: (PEO)a-(PPO)b-(PEO)a. All poloxamers have a similar chemical structure but differ in molecular weight and the composition of the hydrophilic PEO and hydrophobic PPO blocks. The two most commonly used poloxamers are poloxamer 188 (a = 80, b = 27), with molecular weights ranging from 7680 to 9510 Da, and poloxamer 407 (a = 101, b = 56), with molecular weights ranging from 9840 to 14600 Da. Other poloxamers include poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), and poloxamer 218 (P218). Poloxamer-231 (P231), poloxamer-234 (P234), poloxamer-235 (P235), poloxamer-237 (P237), poloxamer-238 (P238), poloxamer-282 (P282), poloxamer-284 (P284), poloxamer-288 (P288), poloxamer-331 (P331), poloxamer-333 (P333), poloxamer-334 (P334), poloxamer-335 (P335), poloxamer-338 (P338), poloxamer-401 (P401), poloxamer-402 (P402), and poloxamer-403 (P403).

[0193] Polysorbates are a class of emulsifiers used in some pharmaceutical and food preparations. Polysorbates are oily liquids derived from ethoxylated sorbitan, a derivative of sorbitol, esterified with fatty acids. Common trade names for polysorbates include Scattics, Alkest, Canarcel, and Tween. The naming convention for polysorbates is usually as follows: polysorbate x (polyoxyethylene (y) sorbitan mono 'z'), where x refers to the type of fatty acid (z) attached to the polyoxyethylene sorbitan, and y refers to the total number of oxyethylene -(CH2CHO)- groups found in the polysorbate molecule. Examples of polysorbates include: (a) polysorbate 20 (polyoxyethylene(20) sorbitan monolaurate), (b) polysorbate 40 (polyoxyethylene(20) sorbitan monopalmitate), (c) polysorbate 60 (polyoxyethylene(20) sorbitan monostearate), and (d) polysorbate 80 (polyoxyethylene(20) sorbitan monooleate).

[0194] B. Lentiviral Vector (LV) Formulations for Use in Treating Hematological Disorders In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) an effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a detergent; (e) a carbohydrate; and (f) a nucleotide sequence at least 80% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the vector comprises the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the vector comprises the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0195] In another aspect, the present invention provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a detergent; and (e) a carbohydrate, wherein the recombinant lentiviral vector comprises a recombinant lentiviral vector comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0196] In certain embodiments, the pH of the buffer system is about 6.0 to about 8.0. In certain embodiments, the pH of the buffer system is about 6.0 to about 7.5. In certain embodiments, the pH of the buffer system is about 6.0 to about 7.0. In certain embodiments, the pH of the buffer system is about 6.0 to about 8.0. In certain embodiments, the pH of the buffer system is about 6.5. In certain embodiments, the pH of the buffer system is about 7.3. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or the histidine buffer is about 5 mM to about 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 mM to about 20 mM, about 10 mM to about 15 mM, about 20 mM to about 30 mM, about 20 mM to about 25 mM, or about 15 mM to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is about 80 mM to about 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is about 0.01% (w / v) to about 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is about 0.5% (w / v) to about 5% (w / v). In certain embodiments, the chloride salt is sodium chloride (NaCl).In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is about 6.1, about 6.3, about 6.5, about 6.7, about 6.9, about 7.1, about 7.3, about 7.5, about 7.7, or about 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is about 10 mM, about 15 mM, about 20 mM, or about 25 mM. In certain embodiments, the chloride salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is about 0.03% (w / v), about 0.05% (w / v), about 0.07% (w / v), or about 0.09% (w / v). In certain embodiments, the concentration of the carbohydrate is about 1% (w / v), about 2% (w / v), about 3% (w / v), or about 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0197] In certain embodiments, the disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient, wherein the recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, and the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0198] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 130 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 1% (w / v) sucrose, wherein the pH of the preparation is about 7.3, and the pharmaceutical composition is suitable for systemic administration to a human patient, wherein the recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, and the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0199] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 6.5, and the pharmaceutical composition is suitable for systemic administration to a human patient, wherein the recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, and the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0200] In certain embodiments, the disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 10 mM phosphate; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient, wherein the recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, and the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0201] In certain embodiments, the present disclosure provides a recombinant lentiviral vector preparation comprising: (a) a therapeutically effective dose of a recombinant lentiviral vector; (b) about 20 mM histidine; (c) about 100 mM sodium chloride; (d) about 0.05% (w / v) poloxamer 188; and (e) about 3% (w / v) sucrose, wherein the pH of the preparation is about 7.0, and the pharmaceutical composition is suitable for systemic administration to a human patient, wherein the recombinant lentiviral vector comprises a nucleic acid comprising a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3, and the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid comprising a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the recombinant lentiviral vector comprises a nucleic acid consisting of a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0202] In certain embodiments, the recombinant lentiviral vector comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the recombinant lentiviral vector comprises an enhanced transthyretin (ET) promoter. In certain embodiments, the recombinant lentiviral vector comprises a nucleotide sequence that is at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7.

[0203] In certain embodiments, recombinant lentiviral vectors are isolated from transfected host cells, including CHO cells, HEK293 cells, BHK21 cells, PER.C6 cells, NSO cells, and CAP cells. In certain embodiments, the host cells are CD47-positive host cells.

[0204] In certain embodiments, the preparation is administered systemically to a human patient, hi certain embodiments, the preparation is administered intravenously.

[0205] In certain embodiments, the pH of the buffer system is between 6.0 and 8.0. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is between 5 mM and 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is between 80 mM and 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is between 0.01% (w / v) and 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is between 0.5% (w / v) and 5% (w / v). In certain embodiments, the chloride salt is NaCl.In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is 6.1, 6.3, 6.5, 6.7, 6.9, 7.1, 7.3, 7.5, 7.7, or 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is 10 mM, 15 mM, 20 mM, or 25 mM. In certain embodiments, the chloride salt is 100 mM, 110 mM, 130 mM, or 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v). In certain embodiments, the carbohydrate concentration is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0206] In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) an effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a detergent; (e) a carbohydrate; and (f) an enhanced transthyretin (ET) promoter, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the vector further comprises a nucleotide sequence at least 80% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the vector comprises the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the vector comprises the Factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0207] In certain embodiments, the vector further comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the pH of the buffer system is between 6.0 and 8.0. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is between 5 mM and 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is between 80 mM and 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is between 0.01% (w / v) and 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is between 0.5% (w / v) and 5% (w / v). In certain embodiments, the chloride salt is NaCl.In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is 6.1, 6.3, 6.5, 6.7, 6.9, 7.1, 7.3, 7.5, 7.7, or 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is 10 mM, 15 mM, 20 mM, or 25 mM. In certain embodiments, the chloride salt is 100 mM, 110 mM, 130 mM, or 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v). In certain embodiments, the carbohydrate concentration is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407). In one aspect, the present invention is directed to a recombinant lentiviral vector preparation comprising: (a) an effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; (e) a carbohydrate; and (f) a nucleotide sequence at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the vector further comprises an enhanced transthyretin (ET) promoter. In certain embodiments, the vector further comprises a nucleotide sequence at least 80% identical to the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or the factor IX (FIX) coding sequence set forth in SEQ ID NO:3. In certain embodiments, the vector comprises the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the vector comprises the Factor IX (FIX) coding sequence set forth in SEQ ID NO:3.

[0208] In certain embodiments, the vector further comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the pH of the buffer system is between 6.0 and 8.0. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is between 5 mM and 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is between 80 mM and 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is between 0.01% (w / v) and 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is between 0.5% (w / v) and 5% (w / v). In certain embodiments, the chloride salt is NaCl.In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is 6.1, 6.3, 6.5, 6.7, 6.9, 7.1, 7.3, 7.5, 7.7, or 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is 10 mM, 15 mM, 20 mM, or 25 mM. In certain embodiments, the chloride salt is 100 mM, 110 mM, 130 mM, or 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v). In certain embodiments, the carbohydrate concentration is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0209] In one aspect, the present invention is directed to a recombinant lentiviral vector preparation, wherein the recombinant lentiviral vector is isolated from transfected host cells, including CHO cells, HEK293 cells, BHK21 cells, PER.C6 cells, NSO cells, and CAP cells; the recombinant lentiviral vector preparation comprises (a) an effective dose of the recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to a human patient. In certain embodiments, the host cells are CD47-positive host cells. In certain embodiments, the vector further comprises an enhanced transthyretin (ET) promoter. In certain embodiments, the vector further comprises a nucleotide sequence at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7. In certain embodiments, the vector further comprises a nucleotide sequence at least 80% identical to the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or the factor IX (FIX) coding sequence set forth in SEQ ID NO:3. In certain embodiments, the vector comprises a factor VIII (FVIII) coding sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the vector comprises a factor IX (FIX) coding sequence set forth in SEQ ID NO: 3.

[0210] In certain embodiments, the vector further comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the pH of the buffer system is between 6.0 and 8.0. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is between 5 mM and 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is between 80 mM and 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is between 0.01% (w / v) and 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is between 0.5% (w / v) and 5% (w / v). In certain embodiments, the chloride salt is NaCl.In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is 6.1, 6.3, 6.5, 6.7, 6.9, 7.1, 7.3, 7.5, 7.7, or 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is 10 mM, 15 mM, 20 mM, or 25 mM. In certain embodiments, the chloride salt is 100 mM, 110 mM, 130 mM, or 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v). In certain embodiments, the carbohydrate concentration is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0211] In one aspect, the present invention is directed to a method for treating a human patient with a disorder, wherein a recombinant lentiviral vector preparation is systemically administered to the human patient, the recombinant lentiviral vector preparation comprising: (a) an effective dose of a recombinant lentiviral vector; (b) a TRIS-free buffer system; (c) a salt; (d) a surfactant; and (e) a carbohydrate, wherein the pharmaceutical composition is suitable for systemic administration to the human patient. In certain embodiments, the preparation is systemically administered to the human patient. In certain embodiments, the preparation is administered intravenously.

[0212] In certain embodiments, the disorder is a bleeding disorder. In certain embodiments, the bleeding disorder is hemophilia A or hemophilia B.

[0213] In certain embodiments, the vector further comprises an enhanced transthyretin (ET) promoter. In certain embodiments, the vector further comprises a nucleotide sequence at least 90% identical to the target sequence of miR-142 set forth in SEQ ID NO:7. In certain embodiments, the vector further comprises a nucleotide sequence at least 80% identical to the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or the factor IX (FIX) coding sequence set forth in SEQ ID NO:3. In certain embodiments, the vector comprises the factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the vector comprises the factor IX (FIX) coding sequence set forth in SEQ ID NO:3.

[0214] In certain embodiments, the vector further comprises a nucleotide sequence encoding VSV-G or a fragment thereof. In certain embodiments, the pH of the buffer system is between 6.0 and 8.0. In certain embodiments, the buffer system is a phosphate buffer or a histidine buffer. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is between 5 mM and 30 mM. In certain embodiments, the concentration of the phosphate buffer is about 10 to about 20 mM, about 10 to about 15 mM, about 20 to about 30 mM, about 20 to about 25 mM, or about 15 to about 20 mM. In certain embodiments, the salt is a chloride salt. In certain embodiments, the concentration of the chloride salt is between 80 mM and 150 mM. In certain embodiments, the concentration of the salt is about 100 mM, about 110 mM, about 130 mM, or about 150 mM. In certain embodiments, the surfactant is a poloxamer or polysorbate. In certain embodiments, the concentration of the poloxamer or polysorbate is between 0.01% (w / v) and 0.1% (w / v). In certain embodiments, the carbohydrate is sucrose. In certain embodiments, the concentration of the carbohydrate is between 0.5% (w / v) and 5% (w / v). In certain embodiments, the chloride salt is NaCl.In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 101 (P101), poloxamer 105 (P105), poloxamer 108 (P108), poloxamer 122 (P122), poloxamer 123 (P123), poloxamer 124 (P124), poloxamer 181 (P181), poloxamer 182 (P182), poloxamer 183 (P183), poloxamer 184 (P184), poloxamer 185 (P185), poloxamer 188 (P188), poloxamer 212 (P212), poloxamer 215 (P215), poloxamer 217 (P217), poloxamer 231 (P231), poloxamer 232 (P232), poloxamer 233 (P233), poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 236 (P236), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 239 (P239), poloxamer 240 (P240), poloxamer 241 (P241), poloxamer 242 (P242), poloxamer 243 (P243), poloxamer 244 (P244), poloxamer 245 (P245), poloxamer 246 (P246), poloxamer 247 (P247), poloxamer 248 (P248 The poloxamer is selected from the group consisting of poloxamer 234 (P234), poloxamer 235 (P235), poloxamer 237 (P237), poloxamer 238 (P238), poloxamer 282 (P282), poloxamer 284 (P284), poloxamer 288 (P288), poloxamer 331 (P331), poloxamer 333 (P333), poloxamer 334 (P334), poloxamer 335 (P335), poloxamer 338 (P338), poloxamer 401 (P401), poloxamer 402 (P402), poloxamer 403 (P403), poloxamer 407 (P407), and combinations thereof. In certain embodiments, the polysorbate is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof. In certain embodiments, the pH of the phosphate buffer or histidine buffer is 6.1, 6.3, 6.5, 6.7, 6.9, 7.1, 7.3, 7.5, 7.7, or 7.9. In certain embodiments, the concentration of the phosphate buffer or histidine buffer is 10 mM, 15 mM, 20 mM, or 25 mM. In certain embodiments, the chloride salt is 100 mM, 110 mM, 130 mM, or 150 mM. In certain embodiments, the concentration of the poloxamer or polysorbate is 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v). In certain embodiments, the carbohydrate concentration is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v).In certain embodiments, the poloxamer is poloxamer 188 (P188). In certain embodiments, the poloxamer is poloxamer 407 (P407).

[0215] B.1. Bleeding Disorders Bleeding disorders are the result of an impaired ability of blood to form clots at sites of vascular injury. There are several types of bleeding disorders, including hemophilia A, hemophilia B, von Willebrand disease, and rare factor deficiencies. Hemophilia A results from a deficiency of factor VIII (FVIII) caused by mutations or low expression of the factor VIII gene, while hemophilia B results from a deficiency of factor IX (FIX) caused by mutations or low expression of the factor IX gene.

[0216] According to the Centers for Disease Control and Prevention, hemophilia occurs in approximately 1 in 5,000 births. Approximately 20,000 people in the United States have hemophilia. All races and ethnicities are affected. Hemophilia A is four times more common than hemophilia B, and the majority of people with hemophilia A have severe hemophilia. People with hemophilia require extensive medical monitoring throughout their lives. Without intervention, affected individuals will experience spontaneous joint bleeding, which can cause severe pain and debilitating immobility. Bleeding into muscles can cause blood to accumulate in those tissues, while spontaneous bleeding in the head and neck can cause choking if not treated immediately. Renal bleeding and severe bleeding following surgery, minor accidental injuries, or suture removal are also common.

[0217] Disclosed herein is a formulation for use in treating a bleeding disorder or condition in a subject in need thereof. The bleeding disorder or condition is selected from the group consisting of bleeding coagulopathy, hemarthrosis, muscle bleeding, oral bleeding, bleeding, bleeding into muscle, oral bleeding, trauma, head trauma, gastrointestinal bleeding, intracranial bleeding, intraperitoneal bleeding, intrathoracic bleeding, fracture, central nervous system bleeding, bleeding in the retropharyngeal space, bleeding in the retroperitoneal space, bleeding in the iliopsoas sheath, and any combination thereof. In yet another embodiment, the subject is scheduled to undergo surgery. In yet another embodiment, the treatment is prophylactic or on-demand.

[0218] Gene therapy using stable and potent formulations of lentiviral vectors (LVs) shows great promise in treating individuals affected with hemophilia A or B through stable integration of the factor VIII or factor IX gene into cells, resulting in expression of sufficient levels of functional factor VIII or factor IX.

[0219] Somatic cell gene therapy is being investigated as a potential treatment for bleeding disorders. Gene therapy is particularly attractive for hemophilia because it has the potential to cure the disease through continuous endogenous production of FVIII or FIX after a single administration of vectors encoding the respective coagulation factors. Hemophilia A (FVIII deficiency) and hemophilia B (FIX deficiency) are well suited to gene replacement approaches because their clinical pathology is entirely due to the lack of a single gene product (FVIII or FIX) circulating in plasma at trace amounts (200 ng / ml).

[0220] Lentivirus has attracted attention as a gene delivery vehicle due to its large capacity and ability to maintain transgene expression through integration.Over the past decade, lentivirus has been evaluated in many ex vivo cell therapy clinical programs, showing promising efficacy and safety profile, and has gained widespread experience.As the use of lentivirus in in vivo gene therapy is becoming more widely accepted, there is a need in the art to provide an improved formulation that enhances the stability of lentivirus for long-term storage.

[0221] The present disclosure fulfills an important need in the art by providing a formulation buffer or vehicle that confers lentivirus stability and allows for long-term frozen storage.In certain exemplary embodiments, the formulation buffer confers lentivirus stability and allows for long-term frozen storage when the administration route is systemic.In some embodiments, the lentivirus is purified and then processed in the formulation buffer or vehicle of the present disclosure.Once formulated, the lentivirus is stored frozen.The formulation buffer or vehicle of the present invention provides greater stability against freezing and thawing and exposure to high temperatures.

[0222] Provided herein is a lentiviral vector comprising a codon-optimized FVIII sequence or a codon-optimized FIX sequence, which may exhibit increased expression in a subject and provide a higher therapeutic effect when used in gene therapy methods.Embodiments of the present disclosure are directed to a lentiviral vector comprising one or more codon-optimized nucleic acid molecules encoding a polypeptide having FVIII activity, or a lentiviral vector comprising one or more codon-optimized nucleic acid molecules encoding a polypeptide having FIX activity, as described herein, a host cell (e.g., hepatocyte) comprising the lentiviral vector, and a method of using the disclosed lentiviral vector (e.g., treatment for bleeding disorders using the lentiviral vector disclosed herein).In certain embodiments, during scale-up processing, the lentiviral vector is packaged into a lentivirus that is processed into a formulation buffer or vehicle of the present disclosure.

[0223] In general, the therapeutic methods disclosed herein involve the administration of a lentiviral vector comprising a nucleic acid molecule comprising at least one codon-optimized nucleic acid sequence encoding a FVIII clotting factor, or a lentiviral vector comprising a nucleic acid molecule comprising at least one codon-optimized nucleic acid sequence encoding a FIX clotting factor. In some embodiments, the nucleic acid sequence encoding the FVIII clotting factor is operably linked to a suitable expression control sequence, which in some embodiments is incorporated into a lentiviral vector (e.g., a replication-deficient lentiviral vector). In some embodiments, the nucleic acid sequence encoding the FIX clotting factor is operably linked to a suitable expression control sequence, which in some embodiments is incorporated into a lentiviral vector (e.g., a replication-deficient lentiviral vector).

[0224] The present disclosure provides methods for treating a bleeding disorder (e.g., hemophilia A or hemophilia B) in a subject in need thereof, the method comprising administering to the subject at least one dose of a lentiviral vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide having FVIII or FIX activity. In certain embodiments, the lentiviral vector is packaged into a lentivirus that is processed in a formulation buffer of the present invention. In certain embodiments, the nucleotide sequence encoding the polypeptide having FVIII activity comprises a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1 shown in Table 1. In certain embodiments, the nucleotide sequence encoding the polypeptide having FVIII activity consists of the nucleotide sequence set forth in SEQ ID NO: 1 shown in Table 1. In certain embodiments, the nucleotide sequence encoding the polypeptide having FVIII activity comprises a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2 shown in Table 1. In certain embodiments, the nucleotide sequence encoding the polypeptide having FVIII activity consists of the nucleotide sequence set forth in SEQ ID NO: 2 shown in Table 1.In certain embodiments, a nucleotide sequence encoding a polypeptide having FIX activity comprises a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 3 shown in Table 1. In certain embodiments, the nucleotide sequence encoding a polypeptide having FIX activity consists of the nucleotide sequence set forth in SEQ ID NO: 3 shown in Table 1.

[0225] The present disclosure provides a method for treating a bleeding disorder (e.g., hemophilia A or hemophilia B) in a subject in need thereof, comprising administering to the subject at least one dose of a lentiviral vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide having FVIII or FIX activity. In certain embodiments, the lentiviral vector is packaged into a lentivirus processed in a formulation buffer or vehicle of the present invention. In certain embodiments, 5×10 6 lentiviral vectors comprising a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide having FVIII or FIX activity as described herein are administered. 10 or less transducing units / kg (TU / kg) (or 10 9 TU / kg or less, or 10 8 At least one dose of 1000 mg / kg or less of 1000 mg / kg of serotonin is administered to the subject.

[0226] In some embodiments, the dose is about 5.0 x 10 10 TU / kg, approximately 4.9 x 10 10 TU / kg, approximately 4.8 x 10 10 TU / kg, approximately 4.7 x 10 10 TU / kg, approximately 4.6 x 10 10TU / kg, about 4.5×10 10 TU / kg, about 4.4×10 10 TU / kg, about 4.3×10 10 TU / kg, about 4.2×10 10 TU / kg, about 4.1×10 10 TU / kg, about 4.0×10 10 TU / kg, about 3.9×10 10 TU / kg, about 3.8×10 10 TU / kg, about 3.7×10 10 TU / kg, about 3.6×10 10 TU / kg, about 3.5×10 10 TU / kg, about 3.4×10 10 TU / kg, about 3.3×10[[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​In some embodiments, the dosage is about 9.9×10 9 TU / kg, about 9.8×10 9 TU / kg, about 9.7×10 9 TU / kg, about 9.6×10 9 TU / kg, about 9.5×10 9 TU / kg, about 9.4×10 9 TU / kg, about 9.3×10 9 TU / kg, about 9.2×10 9 TU / kg, about 9.1×10 9 TU / kg, about 9.0×10 9 TU / kg, about 8.9×10 9 TU / kg, about 8.8×10 9 TU / kg, about 8.7×10 9 TU / kg, about 8.6×10 9 TU / kg, about 8.5×10 9 TU / kg, about 8.4×10 9 TU / kg, about 8.3×10 9 TU / kg, about 8.2×10 9 TU / kg, about 8.1×10 9 TU / kg, about 8.0×10 9 TU / kg, about 7.9×10 9 TU / kg, about 7.8×10 9 TU / kg, about 7.7×10 9 TU / kg, about 7.6×10 9 TU / kg, about 7.5×10 9 TU / kg, about 7.4×10 9 TU / kg, about 7.3×10 9 TU / kg, about 7.2×10 9 TU / kg, about 7.1×10 9 TU / kg, about 7.0×10 9 TU / kg, about 6.9×10 9 TU / kg, about 6.8×10 9 TU / kg, about 6.7×10 9 TU / kg, about 6.6×10 9 TU / kg, about 6.5×10 9 TU / kg, about 6.4×10 9 TU / kg, about 6.3×10 9 TU / kg, about 6.2×10 9TU / kg, approximately 6.1×10 9 TU / kg, approximately 6.0×10 9 TU / kg, approximately 5.9×10 9 TU / kg, approximately 5.8×10 9 TU / kg, approximately 5.7×10 9 TU / kg, approximately 5.6×10 9 TU / kg, approximately 5.5×10 9 TU / kg, approximately 5.4×10 9 TU / kg, approximately 5.3×10 9 TU / kg, approximately 5.2×10 9 TU / kg, approximately 5.1×10 9 TU / kg, approximately 5.0×10 9 TU / kg, approximately 4.9×10 9 TU / kg, approximately 4.8×10 9 TU / kg, approximately 4.7×10 9 TU / kg, approximately 4.6×10 9 TU / kg, approximately 4.5×10 9 TU / kg, approximately 4.4×10 9 TU / kg, approximately 4.3×10 9 TU / kg, approximately 4.2×10 9 TU / kg, approximately 4.1×10 9 TU / kg, approximately 4.0×10 9 TU / kg, approximately 3.9×10 9 TU / kg, approximately 3.8×10 9 TU / kg, approximately 3.7×10 9 TU / kg, approximately 3.6×10 9 TU / kg, approximately 3.5×10 9 TU / kg, approximately 3.4×10 9 TU / kg, approximately 3.3×10 9 TU / kg, approximately 3.2×10 9 TU / kg, approximately 3.1×10 9 TU / kg, approximately 3.0×10 9 TU / kg, approximately 2.9×10 9 TU / kg, approximately 2.8×10 9 TU / kg, approximately 2.7×10 9 TU / kg, approximately 2.6×10 9 TU / kg, approximately 2.5×10 9 TU / kg, approximately 2.4×10 9 TU / kg, approximately 2.3×109 TU / kg, approximately 2.2 x 10 9 TU / kg, approximately 2.1 x 10 9 TU / kg, approximately 2.0 x 10 9 TU / kg, approximately 1.9 x 10 9 TU / kg, approximately 1.8 x 10 9 TU / kg, approximately 1.7 x 10 9 TU / kg, approximately 1.6 x 10 9 TU / kg, approximately 1.5 x 10 9 TU / kg, approximately 1.4 x 10 9 TU / kg, approximately 1.3 x 10 9 TU / kg, approximately 1.2 x 10 9 TU / kg, approximately 1.1 x 10 9 TU / kg, or approximately 1.0 x 10 9 It is TU / kg.

[0228] In some embodiments, the dose is about 9.9 x 10 8 TU / kg, approximately 9.8 x 10 8 TU / kg, approximately 9.7 x 10 8 TU / kg, approximately 9.6 x 10 8 TU / kg, approximately 9.5 x 10 8 TU / kg, approximately 9.4 x 10 8 TU / kg, approximately 9.3 x 10 8 TU / kg, approximately 9.2 x 10 8 TU / kg, approximately 9.1 x 10 8 TU / kg, approximately 9.0 x 10 8 TU / kg, approximately 8.9 x 10 8 TU / kg, approximately 8.8 x 10 8 TU / kg, approximately 8.7 x 10 8 TU / kg, approximately 8.6 x 10 8 TU / kg, approximately 8.5 x 10 8 TU / kg, approximately 8.4 x 10 8 TU / kg, approximately 8.3 x 10 8 TU / kg, approximately 8.2 x 10 8 TU / kg, approximately 8.1 x 10 8 TU / kg, approximately 8.0 x 10 8 TU / kg, approximately 7.9 x 10 8 TU / kg, approximately 7.8 x 10 8 TU / kg, approximately 7.7 x 108 TU / kg, approximately 7.6×10 8 TU / kg, approximately 7.5×10 8 TU / kg, approximately 7.4×10 8 TU / kg, approximately 7.3×10 8 TU / kg, approximately 7.2×10 8 TU / kg, approximately 7.1×10 8 TU / kg, approximately 7.0×10 8 TU / kg, approximately 6.9×10 8 TU / kg, approximately 6.8×10 8 TU / kg, approximately 6.7×10 8 TU / kg, approximately 6.6×10 8 TU / kg, approximately 6.5×10 8 TU / kg, approximately 6.4×10 8 TU / kg, approximately 6.3×10 8 TU / kg, approximately 6.2×10 8 TU / kg, approximately 6.1×10 8 TU / kg, approximately 6.0×10 8 TU / kg, approximately 5.9×10 8 TU / kg, approximately 5.8×10 8 TU / kg, approximately 5.7×10 8 TU / kg, approximately 5.6×10 8 TU / kg, approximately 5.5×10 8 TU / kg, approximately 5.4×10 8 TU / kg, approximately 5.3×10 8 TU / kg, approximately 5.2×10 8 TU / kg, approximately 5.1×10 8 TU / kg, approximately 5.0×10 8 TU / kg, approximately 4.9×10 8 TU / kg, approximately 4.8×10 8 TU / kg, approximately 4.7×10 8 TU / kg, approximately 4.6×10 8 TU / kg, approximately 4.5×10 8 TU / kg, approximately 4.4×10 8 TU / kg, approximately 4.3×10 8 TU / kg, approximately 4.2×10 8 TU / kg, approximately 4.1×10 8 TU / kg, approximately 4.0×10 8 TU / kg, approximately 3.9×10 8TU / kg, approximately 3.8 x 10 8 TU / kg, approximately 3.7 x 10 8 TU / kg, approximately 3.6 x 10 8 TU / kg, approximately 3.5 x 10 8 TU / kg, approximately 3.4 x 10 8 TU / kg, approximately 3.3 x 10 8 TU / kg, approximately 3.2 x 10 8 TU / kg, approximately 3.1 x 10 8 TU / kg, approximately 3.0 x 10 8 TU / kg, approximately 2.9 x 10 8 TU / kg, approximately 2.8 x 10 8 TU / kg, approximately 2.7 x 10 8 TU / kg, approximately 2.6 x 10 8 TU / kg, approximately 2.5 x 10 8 TU / kg, approximately 2.4 x 10 8 TU / kg, approximately 2.3 x 10 8 TU / kg, approximately 2.2 x 10 8 TU / kg, approximately 2.1 x 10 8 TU / kg, approximately 2.0 x 10 8 TU / kg, approximately 1.9 x 10 8 TU / kg, approximately 1.8 x 10 8 TU / kg, approximately 1.7 x 10 8 TU / kg, approximately 1.6 x 10 8 TU / kg, approximately 1.5 x 10 8 TU / kg, approximately 1.4 x 10 8 TU / kg, approximately 1.3 x 10 8 TU / kg, approximately 1.2 x 10 8 TU / kg, approximately 1.1 x 10 8 TU / kg, or approximately 1.0 x 10 8 It is TU / kg.

[0229] In some embodiments, the dose is 5.0 x 10 10 TU / kg, less than 4.9 × 10 10 TU / kg, less than 4.8 × 10 10 TU / kg, less than 4.7 × 10 10 TU / kg, less than 4.6 × 10 10 TU / kg, less than 4.5 × 10 10 TU / kg, less than 4.4 × 10 10TU / kg, less than 4.3 × 10 10 TU / kg, less than 4.2 × 10 10 TU / kg, less than 4.1 × 10 10 TU / kg, less than 4.0 × 10 10 TU / kg, less than 3.9 × 10 10 TU / kg, less than 3.8 × 10 10 TU / kg, less than 3.7 × 10 10 TU / kg, less than 3.6 × 10 10 TU / kg, less than 3.5 × 10 10 TU / kg, less than 3.4 × 10 10 TU / kg, less than 3.3 × 10 10 TU / kg, less than 3.2 × 10 10 TU / kg, less than 3.1 × 10 10 TU / kg, less than 3.0 × 10 10 TU / kg, less than 2.9 × 10 10 TU / kg, less than 2.8 × 10 10 TU / kg, less than 2.7 × 10 10 TU / kg, less than 2.6 × 10 10 TU / kg, less than 2.5 × 10 10 TU / kg, less than 2.4 × 10 10 TU / kg, less than 2.3 × 10 10 TU / kg, less than 2.2 × 10 10 TU / kg, less than 2.1 × 10 10 TU / kg, less than 2.0 × 10 10 TU / kg, less than 1.9 × 10 10 TU / kg, less than 1.8 × 10 10 TU / kg, less than 1.7 × 10 10 TU / kg, less than 1.6 × 10 10 TU / kg, less than 1.5 × 10 10 TU / kg, less than 1.4 × 10 10 TU / kg, less than 1.3 × 10 10 TU / kg, less than 1.2 × 10 10 TU / kg, less than 1.1 × 10 10 TU / kg, or 1.0 x 10 10 It is less than TU / kg.

[0230] In some embodiments, the dose is 9.9×10 9TU / kg, less than 9.8 × 10 9 TU / kg, less than 9.7 × 10 9 TU / kg, less than 9.6 × 10 9 TU / kg, less than 9.5 × 10 9 TU / kg, less than 9.4 × 10 9 TU / kg, less than 9.3 × 10 9 TU / kg, less than 9.2 × 10 9 TU / kg, less than 9.1 × 10 9 TU / kg, less than 9.0 × 10 9 TU / kg, less than 8.9 × 10 9 TU / kg, less than 8.8 × 10 9 TU / kg, less than 8.7 × 10 9 TU / kg, less than 8.6 × 10 9 TU / kg, less than 8.5 × 10 9 TU / kg, less than 8.4 × 10 9 TU / kg, less than 8.3 × 10 9 TU / kg, less than 8.2 × 10 9 TU / kg, less than 8.1 × 10 9 TU / kg, less than 8.0 × 10 9 TU / kg, less than 7.9 × 10 9 TU / kg, less than 7.8 × 10 9 TU / kg, less than 7.7 × 10 9 TU / kg, less than 7.6 × 10 9 TU / kg, less than 7.5 × 10 9 TU / kg, less than 7.4 × 10 9 TU / kg, less than 7.3 × 10 9 TU / kg, less than 7.2 × 10 9 TU / kg, less than 7.1 × 10 9 TU / kg, less than 7.0 × 10 9 TU / kg, less than 6.9 × 10 9 TU / kg, less than 6.8 × 10 9 TU / kg, less than 6.7 × 10 9 TU / kg, less than 6.6 × 10 9 TU / kg, less than 6.5 × 10 9 TU / kg, less than 6.4 × 10 9 TU / kg, less than 6.3 × 10 9 TU / kg, less than 6.2 × 10 9TU / kg, less than 6.1 × 10 9 TU / kg, less than 6.0 × 10 9 TU / kg, less than 5.9 × 10 9 TU / kg, less than 5.8 × 10 9 TU / kg, less than 5.7 × 10 9 TU / kg, less than 5.6 × 10 9 TU / kg, less than 5.5 × 10 9 TU / kg, less than 5.4 × 10 9 TU / kg, less than 5.3 × 10 9 TU / kg, less than 5.2 × 10 9 TU / kg, less than 5.1 × 10 9 TU / kg, less than 5.0 × 10 9 TU / kg, less than 4.9 × 10 9 TU / kg, less than 4.8 × 10 9 TU / kg, less than 4.7 × 10 9 TU / kg, less than 4.6 × 10 9 TU / kg, less than 4.5 × 10 9 TU / kg, less than 4.4 × 10 9 TU / kg, less than 4.3 × 10 9 TU / kg, less than 4.2 × 10 9 TU / kg, less than 4.1 × 10 9 TU / kg, less than 4.0 × 10 9 TU / kg, less than 3.9 × 10 9 TU / kg, less than 3.8 × 10 9 TU / kg, less than 3.7 × 10 9 TU / kg, less than 3.6 × 10 9 TU / kg, less than 3.5 × 10 9 TU / kg, less than 3.4 × 10 9 TU / kg, less than 3.3 × 10 9 TU / kg, less than 3.2 × 10 9 TU / kg, less than 3.1 × 10 9 TU / kg, less than 3.0 × 10 9 TU / kg, less than 2.9 × 10 9 TU / kg, less than 2.8 × 10 9 TU / kg, less than 2.7 × 10 9 TU / kg, less than 2.6 × 10 9 TU / kg, less than 2.5 × 10 9TU / kg, less than 2.4 × 10 9 TU / kg, less than 2.3 × 10 9 TU / kg, less than 2.2 × 10 9 TU / kg, less than 2.1 × 10 9 TU / kg, less than 2.0 × 10 9 TU / kg, less than 1.9 × 10 9 TU / kg, less than 1.8 × 10 9 TU / kg, less than 1.7 × 10 9 TU / kg, less than 1.6 × 10 9 TU / kg, less than 1.5 × 10 9 TU / kg, less than 1.4 × 10 9 TU / kg, less than 1.3 × 10 9 TU / kg, less than 1.2 × 10 9 TU / kg, less than 1.1 × 10 9 TU / kg, or 1.0 x 10 9 It is less than TU / kg.

[0231] In some embodiments, the dose is 9.9×10 8 TU / kg, less than 9.8 × 10 8 TU / kg, less than 9.7 × 10 8 TU / kg, less than 9.6 × 10 8 TU / kg, less than 9.5 × 10 8 TU / kg, less than 9.4 × 10 8 TU / kg, less than 9.3 × 10 8 TU / kg, less than 9.2 × 10 8 TU / kg, less than 9.1 × 10 8 TU / kg, less than 9.0 × 10 8 TU / kg, less than 8.9 × 10 8 TU / kg, less than 8.8 × 10 8 TU / kg, less than 8.7 × 10 8 TU / kg, less than 8.6 × 10 8 TU / kg, less than 8.5 × 10 8 TU / kg, less than 8.4 × 10 8 TU / kg, less than 8.3 × 10 8 TU / kg, less than 8.2 × 10 8 TU / kg, less than 8.1 × 10 8 TU / kg, less than 8.0 × 10 8TU / kg, less than 7.9 × 10 8 TU / kg, less than 7.8 × 10 8 TU / kg, less than 7.7 × 10 8 TU / kg, less than 7.6 × 10 8 TU / kg, less than 7.5 × 10 8 TU / kg, less than 7.4 × 10 8 TU / kg, less than 7.3 × 10 8 TU / kg, less than 7.2 × 10 8 TU / kg, less than 7.1 × 10 8 TU / kg, less than 7.0 × 10 8 TU / kg, less than 6.9 × 10 8 TU / kg, less than 6.8 × 10 8 TU / kg, less than 6.7 × 10 8 TU / kg, less than 6.6 × 10 8 TU / kg, less than 6.5 × 10 8 TU / kg, less than 6.4 × 10 8 TU / kg, less than 6.3 × 10 8 TU / kg, less than 6.2 × 10 8 TU / kg, less than 6.1 × 10 8 TU / kg, less than 6.0 × 10 8 TU / kg, less than 5.9 × 10 8 TU / kg, less than 5.8 × 10 8 TU / kg, less than 5.7 × 10 8 TU / kg, less than 5.6 × 10 8 TU / kg, less than 5.5 × 10 8 TU / kg, less than 5.4 × 10 8 TU / kg, less than 5.3 × 10 8 TU / kg, less than 5.2 × 10 8 TU / kg, less than 5.1 × 10 8 TU / kg, less than 5.0 × 10 8 TU / kg, less than 4.9 × 10 8 TU / kg, less than 4.8 × 10 8 TU / kg, less than 4.7 × 10 8 TU / kg, less than 4.6 × 10 8 TU / kg, less than 4.5 × 10 8 TU / kg, less than 4.4 × 10 8 TU / kg, less than 4.3 × 10 8TU / kg, less than 4.2 × 10 8 TU / kg, less than 4.1 × 10 8 TU / kg, less than 4.0 × 10 8 TU / kg, less than 3.9 × 10 8 TU / kg, less than 3.8 × 10 8 TU / kg, less than 3.7 × 10 8 TU / kg, less than 3.6 × 10 8 TU / kg, less than 3.5 × 10 8 TU / kg, less than 3.4 × 10 8 TU / kg, less than 3.3 × 10 8 TU / kg, less than 3.2 × 10 8 TU / kg, less than 3.1 × 10 8 TU / kg, less than 3.0 × 10 8 TU / kg, less than 2.9 × 10 8 TU / kg, less than 2.8 × 10 8 TU / kg, less than 2.7 × 10 8 TU / kg, less than 2.6 × 10 8 TU / kg, less than 2.5 × 10 8 TU / kg, less than 2.4 × 10 8 TU / kg, less than 2.3 × 10 8 TU / kg, less than 2.2 × 10 8 TU / kg, less than 2.1 × 10 8 TU / kg, less than 2.0 × 10 8 TU / kg, less than 1.9 × 10 8 TU / kg, less than 1.8 × 10 8 TU / kg, less than 1.7 × 10 8 TU / kg, less than 1.6 × 10 8 TU / kg, less than 1.5 × 10 8 TU / kg, less than 1.4 × 10 8 TU / kg, less than 1.3 × 10 8 TU / kg, less than 1.2 × 10 8 TU / kg, less than 1.1 × 10 8 TU / kg, or 1.0 x 10 8 It is less than TU / kg.

[0232] In some embodiments, the dose is 1×10 8 TU / kg~5×10 10Between TU / kg, 1.5×10 8 TU / kg~5×10 10 Between TU / kg, 2×10 8 TU / kg~5×10 10 Between TU / kg, 2.5×10 8 TU / kg~5×10 10 Between TU / kg, 3×10 8 TU / kg~5×10 10 Between TU / kg, 3.5×10 8 TU / kg~5×10 10 Between TU / kg, 4×10 8 TU / kg~5×10 10 Between TU / kg, 4.5×10 8 TU / kg~5×10 10 Between TU / kg, 5×10 8 TU / kg~5×10 10 Between TU / kg, 5.5×10 8 TU / kg~5×10 10 Between TU / kg, 6×10 8 TU / kg~5×10​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​9 TU / kg to 5×10 10 Between TU / kg and 3×10 9 TU / kg to 5×10 10 Between TU / kg and 3.5×10 9 TU / kg to 5×10 10 Between TU / kg and 4×10 9 TU / kg to 5×10 10 Between TU / kg and 4.5×10 9 TU / kg to 5×10 10 Between TU / kg and 5×10 9 TU / kg to 5×10 10 Between TU / kg and 5.5×10 9 TU / kg to 5×10 10 Between TU / kg and 6×10 9 TU / kg to 5×10 10 Between TU / kg and 6.5×10 9 TU / kg to 5×10 10 Between TU / kg and 7×10 9 TU / kg to 5×10 10 Between TU / kg and 7.5×10 9 TU / kg to 5×10 10 Between TU / kg and 8×10 9 TU / kg to 5×10 10 Between TU / kg and 8.5×10 9 TU / kg to 5×10 10 Between TU / kg and 9×10 9 TU / kg to 5×10 10 Between TU / kg and 9.5×10 9 TU / kg to 5×10 10 Between TU / kg and 10 10 TU / kg to 5×10 10 Between TU / kg and 1.5×10 10 TU / kg to 5×10 10 Between TU / kg and 2×10[[ID=,68]] 10 TU / kg to 5×10 10 Between TU / kg and 2.5×10 10 TU / kg to 5×10 10 Between TU / kg and 3×10 10 TU / kg to 5×10 10 Between TU / kg and 3.5×10 10 TU / kg to 5×1010 Between TU / kg, 4 x 10 10 TU / kg~5×10 10 TU / kg, or 4.5 x 10 10 TU / kg~5×10 10 TU / kg.

[0233] In some embodiments, the dose is 1×10 8 TU / kg~5×10 10 Between TU / kg, 1 x 10 8 TU / kg ~ 4.5 x 10 10 Between TU / kg, 1 x 10 8 TU / kg~4×10 10 Between TU / kg, 1 x 10 8 TU / kg ~ 3.5 x 10 10 Between TU / kg, 1 x 10 8 TU / kg~3×10 10 Between TU / kg, 1 x 10 8 TU / kg ~ 2.5 x 10 10 Between TU / kg, 1 x 10 8 TU / kg~2×10 10 Between TU / kg, 1 x 10 8 TU / kg ~ 1.5 x 10 10 Between TU / kg, 1 x 10 8 TU / kg~10 10 Between TU / kg, 1 x 10 8 TU / kg~9×10 9 Between TU / kg, 1 x 10 8 TU / kg~8.5×10 9 Between TU / kg, 1 x 10 8 TU / kg~8×10 9 Between TU / kg, 1 x 10 8 TU / kg ~ 7.5 x 10 9 Between TU / kg, 1 x 10 8 TU / kg ~ 7 x 10 9 Between TU / kg, 1 x 10 8 TU / kg ~ 6.5 x 10 9 Between TU / kg, 1 x 10 8 TU / kg ~ 6 x 10 9 Between TU / kg, 1 x 10 8 TU / kg ~ 5.5 x 10 9Between TU / kg, 1×10 8 TU / kg~5×10 9 Between TU / kg, 1×10 8 TU / kg~4.5×10 9 Between TU / kg, 1×10 8 TU / kg~4×10 9 Between TU / kg, 1×10 8 TU / kg~3.5×10 9 Between TU / kg, 1×10 8 TU / kg~3×10 9 Between TU / kg, 1×10 8 TU / kg~2.5×10 9 Between TU / kg, 1×10 8 TU / kg~2×10 9 、1×10 8 TU / kg~1.5×10 9 Between TU / kg, 1×10 8 TU / kg~1×10 9 Between TU / kg, 1×10 8 TU / kg~9.5×10 8 Between TU / kg, 1×10 8 TU / kg~9×10 8 Between TU / kg, 1×10 8 TU / kg~8.5×10 8 Between TU / kg, 1×10 8 TU / kg~8×10 8 Between TU / kg, 1×10 8 TU / kg~7.5×10 8 Between TU / kg, 1×10 8 TU / kg~7×10 8 Between TU / kg, 1×10 8 TU / kg~6.5×10 8 Between TU / kg, 1×10 8 TU / kg~6×10 8 Between TU / kg, 1×10 8 TU / kg~5.5×10 8 Between TU / kg, 1×10 8 TU / kg~5×10 8 Between TU / kg, 1×10 8 TU / kg~4.5×10 8 Between TU / kg, 1×10 8TU / kg~4×10 8 Between TU / kg, 1 x 10 8 TU / kg ~ 3.5 x 10 8 Between TU / kg, 1 x 10 8 TU / kg~3×10 8 Between TU / kg, 1 x 10 8 TU / kg ~ 2.5 x 10 8 Between TU / kg, 1 x 10 8 TU / kg~2×10 8 , or 1 × 10 8 TU / kg ~ 1.5 x 10 8 TU / kg.

[0234] In some embodiments, the dose is 1×10 10 TU / kg~2×10 10 TU / kg, 1.1 x 10 10 TU / kg ~ 1.9 x 10 10 TU / kg, 1.2 x 10 10 TU / kg ~ 1.8 x 10 10 TU / kg, 1.3 x 10 10 TU / kg ~ 1.7 x 10 10 TU / kg, or 1.4 x 10 10 TU / kg ~ 1.6 x 10 10 In some embodiments, the dose is between about 1.5 x 10 10 In some embodiments, the dose is 1.5 x 10 10 It is TU / kg.

[0235] In some embodiments, the dose is 1×10 9 TU / kg~2×10 9 TU / kg, 1.1 x 10 9 TU / kg ~ 1.9 x 10 9 TU / kg, 1.2 x 10 9 TU / kg ~ 1.8 x 10 9 TU / kg, 1.3 x 10 9 TU / kg ~ 1.7 x 10 9 TU / kg, or 1.4 x 10 9 TU / kg ~ 1.6 x 10 9In some embodiments, the dose is between 1.5 x 10 9 In certain embodiments, the dose is about 3.0 x 10 9 It is TU / kg.

[0236] In some embodiments, plasma FVIII activity 24 hours, 36 hours, or 48 hours after administration of a lentiviral vector of the present disclosure is increased compared to plasma FVIII activity in a subject administered a control lentiviral vector. In some embodiments, plasma FVIII activity 24 hours, 36 hours, or 48 hours after administration of a lentiviral vector of the present disclosure is increased compared to plasma FVIII activity in a subject administered a control nucleic acid molecule.

[0237] In some embodiments, plasma FIX activity 24 hours, 36 hours, or 48 hours after administration of a lentiviral vector of the present disclosure is increased compared to plasma FIX activity in a subject administered a control lentiviral vector. In some embodiments, plasma FIX activity 24 hours, 36 hours, or 48 hours after administration of a lentiviral vector of the present disclosure is increased compared to plasma FIX activity in a subject administered a control nucleic acid molecule.

[0238] In some embodiments, plasma FVIII activity or plasma FIX activity is increased at about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, about 25 days, about 26 days, about 27 days, or about 28 days after administration of a lentiviral vector of the present disclosure compared to a subject administered a control lentiviral vector or control nucleic acid molecule.

[0239] In some embodiments, the plasma FVIII activity or plasma FIX activity in the subject is at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, at least about 100-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 15 ... An increase of at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 55-fold, at least about 60-fold, at least about 65-fold, at least about 70-fold, at least about 75-fold, at least about 80-fold, at least about 85-fold, at least about 90-fold, at least about 95-fold, at least about 100-fold, at least about 110-fold, at least about 120-fold, at least about 130-fold, at least about 140-fold, at least about 150-fold, at least about 160-fold, at least about 170-fold, at least about 180-fold, at least about 190-fold, or at least about 200-fold.

[0240] In some embodiments, lentiviral vector is administered as a single dose or multiple doses.In some embodiments, lentiviral vector is administered at once or divided into multiple partial doses, for example, two partial doses, three partial doses, four partial doses, five partial doses, six partial doses or more than six partial doses.In some embodiments, multiple lentiviral vectors are administered.

[0241] In some embodiments, the dose of the lentiviral vector is repeatedly administered at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times. In some embodiments, the lentiviral vector is administered via intravenous injection.

[0242] In some embodiments, the subject is a pediatric subject. In some embodiments, the subject is an adult subject.

[0243] In some embodiments, the lentiviral vector comprises at least one tissue-specific promoter, i.e., a promoter that is believed to regulate the expression of a polypeptide having FVIII activity or a polypeptide having FIX activity in a specific tissue or cell type. In some embodiments, the tissue-specific promoter in the lentiviral vector selectively enhances the expression of a polypeptide having FVIII activity in target liver cells. In some embodiments, the tissue-specific promoter that selectively enhances the expression of a polypeptide having FVIII activity in target liver cells comprises the mTTR promoter. In some embodiments, the tissue-specific promoter that selectively enhances the expression of a polypeptide having FIX activity in target liver cells comprises the APOA2 promoter, the SERPINA1 (hAAT) promoter, the mTTR promoter, the MIR122 promoter, the ET promoter (GenBank No. AY661265; see also Vigna et al., Molecular Therapy 11(5):763 (2005)), or any combination thereof. In some embodiments, the target liver cells are hepatocytes.

[0244] Because lentiviral vectors can transduce all liver cell types, the expression of a transgene (e.g., FVIII or FIX) in different cell types can be controlled using different promoters in the lentiviral vector. Thus, the lentiviral vector can contain specific promoters that are thought to control the expression of a FVIII transgene or FIX transgene in different tissues or cell types, such as different liver tissues or cell types. Thus, in some embodiments, the lentiviral vector can contain an endothelial-specific promoter that is thought to control the expression of a FVIII transgene or FIX transgene in liver endothelial tissue, or a hepatocyte-specific promoter that is thought to control the expression of a FVIII transgene or FIX transgene in hepatocytes, or both.

[0245] In some embodiments, the lentiviral vector comprises one or more tissue-specific promoters that control expression of the FVIII or FIX transgene in tissues other than the liver. In some embodiments, the isolated nucleic acid molecule is stably integrated into the genome of a target cell or tissue, for example, the genome of a hepatocyte or the genome of a liver endothelial cell.

[0246] In some embodiments, the isolated nucleic acid molecule in the lentiviral vector of the present disclosure further comprises a heterologous nucleotide sequence encoding a heterologous amino acid sequence (e.g., a half-life extender). In some embodiments, the heterologous amino acid sequence is an immunoglobulin constant region or portion thereof, an XTEN, transferrin, albumin, or a PAS sequence. In some embodiments, the heterologous amino acid sequence is linked to the N-terminus or C-terminus of the amino acid sequence encoded by the nucleotide sequence, or inserted between two amino acids in the amino acid sequence encoded by the nucleotide sequence at one or more insertion sites selected from Table 2. Heterologous nucleotide sequences are further described herein.

[0247] In some embodiments, the polypeptide having FVIII activity is human FVIII. In some embodiments, the polypeptide having FVIII activity is full-length FVIII. In some embodiments, the polypeptide having FVIII activity is B-domain deleted FVIII.

[0248] In some embodiments, the polypeptide having FIX activity is human FIX. In some embodiments, the polypeptide having FIX activity is full-length FIX. In some embodiments, the polypeptide having FIX activity is a variant of human FIX. In certain embodiments, the polypeptide having FIX activity is the R338L variant of human FIX. In certain embodiments, the polypeptide having FIX activity is the Padua variant.

[0249] The lentiviral vectors disclosed herein can be used in vivo in mammals, e.g., human patients, using a gene therapy approach to treat bleeding diseases or disorders selected from the group consisting of bleeding coagulopathy, hemarthrosis, muscle bleeding, oral bleeding, bleeding, bleeding into muscle, oral bleeding, trauma, head trauma, gastrointestinal bleeding, intracranial bleeding, intraperitoneal bleeding, intrathoracic bleeding, fractures, central nervous system bleeding, bleeding in the retropharyngeal space, bleeding in the retroperitoneal space, bleeding in the iliopsoas sheath, and any combination thereof, which may be therapeutically beneficial. In one embodiment, the bleeding disease or disorder is hemophilia. In another embodiment, the bleeding disease or disorder is hemophilia A. In another embodiment, the bleeding disease or disorder is hemophilia B.

[0250] In some embodiments, target cells (e.g., hepatocytes) are treated in vitro with a lentiviral vector disclosed herein before being administered to a patient. In certain embodiments, target cells (e.g., hepatocytes) are treated in vitro with a lentiviral vector disclosed herein before being administered to a patient. In yet other embodiments, cells from a patient (e.g., hepatocytes) are treated in vitro with a lentiviral vector disclosed herein before being administered to a patient.

[0251] In some embodiments, the lentiviral vectors disclosed herein (e.g., 10 10 TU / kg or less, 10 9 TU / kg or less, or 10 8 In some embodiments, plasma FVIII activity after administration of a 200 mg / kg or less FVIII antibody (administered at TU / kg or less) is increased by at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 210%, at least about 220%, at least about 230%, at least about 240%, at least about 250%, at least about 260%, at least about 270%, at least about 280%, at least about 290%, or at least about 300% compared to physiologically normal FVIII levels.

[0252] In some embodiments, the lentiviral vectors disclosed herein (e.g., 10 10 TU / kg or less, 10 9 TU / kg or less, or 10 8TU / kg or less), plasma FIX activity is increased by at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 210%, at least about 220%, at least about 230%, at least about 240%, at least about 250%, at least about 260%, at least about 270%, at least about 280%, at least about 290%, or at least about 300% compared to physiologically normal circulating FIX levels.

[0253] In one embodiment, plasma FVIII activity after administration of a lentiviral vector of the present disclosure is increased by at least about 3,000% to about 5,000% compared to physiologically normal FVIII levels. In some embodiments, plasma FVIII activity after administration of a lentiviral vector comprising a codon-optimized gene encoding a polypeptide having factor VIII (FVIII) activity described herein is increased by at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, at least about 100-fold, at least about 110-fold, at least about 120-fold, at least about 130-fold, at least about 140-fold, at least about 150-fold, at least about 160-fold, at least about 170-fold, at least about 180-fold, at least about 190-fold, or at least about 200-fold compared to a subject administered a control lentiviral vector or control nucleic acid molecule.

[0254] In one embodiment, plasma FIX activity after administration of a lentiviral vector of the present disclosure is increased by at least about 3,000% to about 5,000% compared to physiologically normal circulating FIX levels. In some embodiments, plasma FIX activity after administration of a lentiviral vector comprising a codon-optimized gene encoding a polypeptide having Factor IX (FIX) activity described herein is increased by at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, at least about 100-fold, at least about 110-fold, at least about 120-fold, at least about 130-fold, at least about 140-fold, at least about 150-fold, at least about 160-fold, at least about 170-fold, at least about 180-fold, at least about 190-fold, or at least about 200-fold compared to a subject administered a control lentiviral vector or control nucleic acid molecule.

[0255] The present disclosure also provides a method of treating, preventing, or ameliorating a hemostatic disorder (e.g., a bleeding disorder such as hemophilia A or hemophilia B) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a lentiviral vector comprising an isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide having FVIII activity or a polypeptide having FIX activity.

[0256] The treatment, amelioration, and prevention by the lentiviral vector of the present disclosure can be bypass therapy. The subject undergoing bypass therapy already has an inhibitor to a clotting factor, such as FVIII or FIX, or is susceptible to developing a clotting factor inhibitor.

[0257] The lentiviral vector of the present disclosure treats or prevents hemostatic disorders by promoting the formation of fibrin clots. The polypeptides having FVIII or FIX activity encoded by the nucleic acid molecules of the present disclosure can activate members of the coagulation cascade. The coagulation factors can be involved in the extrinsic pathway, the intrinsic pathway, or both.

[0258] The lentiviral vectors of the present disclosure can be used to treat hemostatic disorders known to be treatable by FVIII or FIX. Hemostatic disorders that can be treated using the methods of the present disclosure include, but are not limited to, hemophilia A, hemophilia B, von Willebrand's disease, factor XI deficiency (PTA deficiency), factor XII deficiency, and deficiencies or structural abnormalities of fibrinogen, prothrombin, factor V, factor VII, factor X, or factor XIII, hemarthrosis, muscle bleeding, oral bleeding, bleeding, bleeding into muscle, oral bleeding, trauma, head trauma, gastrointestinal bleeding, intracranial bleeding, intraperitoneal bleeding, intrathoracic bleeding, fractures, central nervous system bleeding, bleeding in the retropharyngeal space, bleeding in the retroperitoneal space, and bleeding in the iliopsoas sheath.

[0259] Compositions for administration to a subject include lentiviral vectors (for gene therapy applications) containing nucleic acid molecules comprising the optimized nucleotide sequences of the present disclosure encoding FVIII or FIX clotting factors, as well as FVIII or FIX polypeptide molecules. In some embodiments, the composition for administration is a cell that has been contacted in vivo, in vitro, or ex vivo with a lentiviral vector of the present disclosure.

[0260] In some embodiments, the hemostatic disorder is a genetic disorder. In one embodiment, the subject has hemophilia A. In other embodiments, the hemostatic disorder is the result of a deficiency of FVIII. In other embodiments, the hemostatic disorder can be the result of a defective FVIII clotting factor. In one embodiment, the subject has hemophilia B. In other embodiments, the hemostatic disorder is the result of a deficiency of FIX. In other embodiments, the hemostatic disorder can be the result of a defective FIX clotting factor.

[0261] In another embodiment, the hemostatic disorder may be an acquired disorder. The acquired disorder may be due to an underlying secondary disease or condition. Non-related conditions include, but are not limited to, cancer, autoimmune disease, or pregnancy. The acquired disorder may be due to aging or drug therapy (e.g., cancer chemotherapy) to treat the underlying secondary disorder.

[0262] The present disclosure also relates to a method for treating a subject who does not have a hemostatic disorder or a secondary disease or condition that results in the acquisition of a hemostatic disorder. The present disclosure therefore relates to a method for treating a subject in need of a general hemostatic agent, the method comprising administering a therapeutically effective amount of a lentiviral vector of the present disclosure. For example, in one embodiment, the subject in need of a general hemostatic agent is undergoing or about to undergo surgery. The lentiviral vector of the present disclosure can be administered before or after surgery as a prophylactic agent.

[0263] The lentiviral vectors of the present disclosure can be administered during or after surgery, including, but not limited to, liver transplantation, liver resection, or stem cell transplantation, to control acute bleeding episodes.

[0264] In another embodiment, the lentiviral vectors of the present disclosure can be used to treat subjects who do not have a hemostatic disorder and have an acute bleeding episode. The acute bleeding episode can be caused by severe trauma, such as surgery, a car accident, a wound, a gunshot wound, or any other traumatic event that results in uncontrollable bleeding.

[0265] Lentiviral vectors can be used to prophylactically treat subjects with hemostatic disorders. Lentiviral vectors can also be used to treat acute bleeding episodes in subjects with hemostatic disorders.

[0266] In another embodiment, administration of the lentiviral vector disclosed herein and / or subsequent expression of the FVIII or FIX protein does not induce an immune response in the subject. In some embodiments, the immune response includes the development of antibodies against FVIII or FIX. In some embodiments, the immune response includes cytokine secretion. In some embodiments, the immune response includes the activation of B cells, T cells, or both B and T cells. In some embodiments, the immune response is an inhibitory immune response in the subject that reduces the activity of the FVIII protein compared to the activity of FVIII in a subject that has not generated an immune response. In certain embodiments, expression of the FVIII protein by administering the lentiviral vector disclosed herein prevents an inhibitory immune response against the FVIII protein or FVIII protein expressed from the isolated nucleic acid molecule or lentiviral vector.

[0267] In some embodiments, the lentiviral vector of the present disclosure is administered in combination with at least one other agent that promotes hemostasis. The other agent that promotes hemostasis is a therapeutic agent that has been demonstrated to have coagulation activity. Examples of hemostatic agents include, but are not limited to, factor V, factor VII, factor VIII, factor X, factor XI, factor XII, factor XIII, prothrombin, or fibrinogen, or activated forms of any of the foregoing. The coagulation factor or hemostatic agent may also include an antifibrinolytic agent, such as epsilon-aminocaproic acid or tranexamic acid.

[0268] In one embodiment of the present disclosure, the composition (e.g., lentiviral vector) is such that FVIII is present in an activatable form when administered to a subject. In one embodiment of the present disclosure, the composition (e.g., lentiviral vector) is such that FVIX is present in an activatable form when administered to a subject. Such activatable molecules can be activated in vivo at the site of coagulation after administration to a subject.

[0269] The lentiviral vectors of the present disclosure can be administered intravenously, subcutaneously, intramuscularly, or through any mucosal surface, for example, orally, sublingually, buccally, sublingually, nasally, rectally, vaginally, or via the pulmonary route. The lentiviral vector can be implanted in or attached to a biopolymer solid support that allows for the slow release of the vector to the desired site.

[0270] In one embodiment, the route of administration of the lentiviral vector is parenteral. As used herein, the term parenteral includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, or vaginal administration. Intravenous parenteral administration is preferred. While all of these forms of administration are expressly contemplated within the scope of the present disclosure, the form for administration will be an injectable solution, particularly for intravenous or intraarterial injection or infusion. Typically, suitable pharmaceutical compositions for injection can include buffers (e.g., acetate, phosphate, or citrate buffers), surfactants (e.g., polysorbates), and optionally stabilizers (e.g., human albumin). However, in other methods consistent with the teachings herein, lentiviral vectors can be delivered directly to the site of harmful cell populations, thereby increasing the exposure of affected tissues to the therapeutic agent.

[0271] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, vegetable oils such as polyethylene glycol, olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. In this disclosure, pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1 M, preferably 0.05 M, phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antibacterial agents, antioxidants, chelating agents, and inert gases, may be present.

[0272] More specifically, pharmaceutical compositions suitable for injection include sterile aqueous solutions (water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preferably preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0273] Prevention of microbial activity can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, for example, aluminum monostearate and gelatin in the composition.

[0274] In any case, sterile injectable solutions can be prepared by incorporating the active compound (e.g., polypeptide alone or in combination with other active agents) in the required amount in an appropriate solvent, optionally with one or a combination of the ingredients listed herein, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients listed above. In the case of sterile powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and lyophilization, which yield a powder of the active ingredient and any additional desired ingredients from a previously sterilized solution. The preparations for injection are processed and filled into containers such as ampoules, bags, bottles, syringes, or vials, and sealed under aseptic conditions according to methods known in the art. Furthermore, the preparations can be packaged and sold in the form of a kit. It would be preferable for such products to have a label or package insert indicating that the accompanying composition is useful for treating subjects suffering from or predisposed to coagulation disorders.

[0275] Pharmaceutical compositions also can be formulated for rectal administration as suppositories or retention enemas, eg, containing conventional suppository bases such as cocoa butter or other glycerides.

[0276] The effective dose of the composition of the present disclosure for treating a condition varies depending on many different factors, including the means of administration, the target site, the physiological condition of the patient, whether the patient is human or animal, other pharmaceuticals administered, and whether the treatment is preventive or therapeutic.Usually, the patient is human, but non-human mammals, including transgenic mammals, can also be treated.The treatment dosage can be adjusted using routine methods known to those skilled in the art to optimize safety and effectiveness.

[0277] Lentiviral vectors can be administered as a single dose or multiple doses, and multiple doses can be administered continuously or at specific time intervals.In order to determine the optimal dose range and / or administration schedule, in vitro assays can be used.In vitro assays for measuring coagulation factor activity are known in the art.In addition, effective doses can also be estimated by extrapolating dose-response curves obtained from animal models, such as hemophilic dogs (Mount et al., 2002, Blood 99(8):2670).

[0278] The intermediate dose within the above range is also considered to be within the scope of the present disclosure.Such dose can be administered to subject every day, every other day, every week or according to any other schedule that is determined by empirical analysis.Exemplary treatment requires long-term administration, for example, multiple doses over at least 6 months.

[0279] The lentiviral vector of the present disclosure can be administered multiple times. The interval between single doses can be weekly, monthly, or yearly. The interval can also be irregular as indicated by measuring the blood level of the modified polypeptide or antigen in the patient. The dosage and frequency of the lentiviral vector of the present disclosure will depend on the half-life of the FVIII polypeptide or FIX polypeptide encoded by the transgene in the patient.

[0280] The dosage and frequency of administration of the lentiviral vector of the present disclosure can vary depending on whether the treatment is preventive or therapeutic.In preventive applications, a composition containing the lentiviral vector of the present disclosure is administered to a patient who is not yet in a disease state to strengthen the patient's resistance or minimize the effects of the disease.Such an amount is defined as a "prophylactically effective dose."A relatively low dosage is administered at relatively infrequent intervals over a long period of time.Some patients continue to receive treatment for the rest of their lives.

[0281] The lentiviral vectors of the present disclosure can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (eg, prophylactic or therapeutic).

[0282] As used herein, administration of the lentiviral vector of the present disclosure in conjunction with or in combination with an adjunctive therapy refers to the sequential, simultaneous, concurrent, parallel, concomitant, or simultaneous administration or application of the therapy and the disclosed polypeptide. Those skilled in the art will understand that the time of administration or application of various components of a combined therapeutic regimen can be adjusted to enhance the overall effect of the treatment. Those skilled in the art (e.g., physicians) will be able to easily determine an effective combined therapeutic regimen based on the selected adjunctive therapy and the teachings of this specification without undue experimentation.

[0283] It will further be understood that the lentiviral vectors of the present disclosure may be used in conjunction with or in combination with one or more agents (e.g., to provide a combination therapy regimen). Exemplary agents that can be combined with the lentiviral vectors of the present disclosure include agents that represent the current standard of care for the particular disorder being treated. Such agents may be chemical or biological in nature. The terms "biological" or "biological agent" refer to any pharmaceutically active agent produced from a living organism and / or its products that is intended for use as a therapeutic agent.

[0284] The amount of drugs used in combination with the lentiviral vectors of the present disclosure may vary by subject or can be administered according to what is known in the art. See, for example, Bruce A. Chabner et al., Antineoplastic Agents, in GOODMAN & GILMAN'S THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, pp. 1233-1287 (Joel G. Hardman et al., eds., 9th ed., 1996). In another embodiment, an amount of such drug consistent with standard medical practice is administered.

[0285] In certain embodiments, the lentiviral vector of the present disclosure is administered in combination with an immunosuppressant, anti-allergic agent, or anti-inflammatory agent. These agents generally refer to substances that suppress or mask the immune system of the subject being treated herein. These agents include substances that suppress cytokine production, downregulate or suppress the expression of self-antigens, or mask MHC antigens. Examples of such agents include 2-amino-6-aryl-5-substituted pyrimidines; azathioprine; cyclophosphamide; bromocriptine; danazol; dapsone; glutaraldehyde; anti-idiotypic antibodies against MHC antigens and MHC fragments; cyclosporin A; steroids such as glucocorticoids, for example, prednisone, methylprednisolone, and dexamethasone; anti-interferon-γ, -β, or -α antibodies; anti-tumor necrosis factor-α antibodies; anti-tumor necrosis factor The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug.The present invention relates to an antihistamine drug. Examples of antihistamines include chlorpheniramine, diphenhydramine, promethazine, cromolyn sodium, astemizole, azatadine maleate, brompheniramine maleate, carbinoxamine maleate, cetirizine hydrochloride, clemastine fumarate, cyproheptadine hydrochloride, d-brompheniramine maleate, d-chlorpheniramine maleate, dimenhydrinate, diphenhydramine hydrochloride, doxylamine succinate, fexofendazine hydrochloride, terfenadine hydrochloride, hydroxyzine hydrochloride, loratidine, meclizine hydrochloride, tripelennamine citrate, tripelennamine hydrochloride, and triprolidine hydrochloride.

[0286] Immunosuppressants, antiallergic agents or anti-inflammatory agents can be incorporated into the lentiviral vector administration regimen.For example, the administration of immunosuppressants or anti-inflammatory agents can be initiated before the administration of the disclosed lentiviral vector, and can be followed by one or more subsequent administrations.In certain embodiments, the immunosuppressants or anti-inflammatory agents are administered as a premedication for the lentiviral vector.

[0287] As previously discussed, the lentiviral vectors of the present disclosure can be administered in a pharmaceutically effective amount for the in vivo treatment of coagulation disorders. In this regard, it will be understood that the lentiviral vectors of the present disclosure can be formulated to facilitate administration and promote the stability of the active agent. Preferably, the pharmaceutical composition according to the present disclosure comprises a pharmaceutically acceptable, non-toxic, sterile carrier, such as physiological saline, a non-toxic buffer, a preservative, or the like. Of course, the pharmaceutical composition of the present disclosure can be administered in a single or multiple doses to provide a pharmaceutically effective amount of the polypeptide.

[0288] Several tests are available to determine the function of the coagulation system: activated partial thromboplastin time (aPTT) test, chromogenic assays, ROTEM® assay, prothrombin time (PT) test (also used to determine INR), fibrinogen test (often by the Clauss method), platelet count, platelet function test (often by PFA-100), TCT, bleeding time, mixing test (whether abnormalities are corrected when the patient's plasma is mixed with normal plasma), coagulation factor assays, antiphospholipid antibodies, D-dimer, genetic testing (e.g., factor V Leiden, prothrombin mutation G20210A), dilute Russell's viper venom time (dRVVT), other platelet function tests, thromboelastography (TEG or Sonoclot), thromboelastometry (TEM®, e.g., ROTEM®), or euglobulin lysis time (ELT).

[0289] The aPTT test is a performance index that measures the efficacy of the "intrinsic" coagulation pathway (also called the contact activation pathway) and the common coagulation pathway. This test is commonly used to measure the clotting activity of commercially available recombinant coagulation factors, such as FVIII or FIX. It is used in conjunction with the prothrombin time (PT), which measures the extrinsic pathway.

[0290] ROTEM® analysis provides information on the overall dynamics of hemostasis: clotting time, clot formation, clot stability, and lysis. The various parameters in thromboelastometry depend on the activity of the plasma coagulation system, platelet function, fibrinolysis, or many factors that affect their interactions. This assay can provide a complete picture of secondary hemostasis.

[0291] B.2. Tissue-specific expression In certain embodiments, it may be useful to include one or more miRNA target sequences in a lentiviral vector, for example, operably linked to an optimized FVIII transgene. Therefore, the present disclosure also provides at least one miRNA sequence target that is operably linked to an optimized FVIII or optimized FIX nucleotide sequence or otherwise inserted into a lentiviral vector. More than one copy of the miRNA target sequence included in a lentiviral vector can increase the effectiveness of the system.

[0292] Different miRNA target sequences can also be included.For example, a lentiviral vector that expresses more than one transgene can have the transgene under the control of more than one miRNA target sequence, which can be the same or different.The miRNA target sequence can be tandem, but other arrangements are also included.The transgene expression cassette containing the miRNA target sequence can also be inserted into the lentiviral vector in antisense orientation.Antisense orientation can be useful in the production of viral particles to avoid the expression of gene products that may otherwise be toxic to producer cells.

[0293] In other embodiments, the lentiviral vector contains one, two, three, four, five, six, seven, or eight copies of the same or different miRNA target sequences. In certain embodiments, the lentiviral vector does not contain any miRNA target sequences. The choice of whether to include (and the number of) miRNA target sequences will be guided by known parameters such as the intended tissue target, the required level of expression, etc.

[0294] In one embodiment, the target sequence is the miR-223 target, which has been reported to be most effective in myeloid-committed progenitor cells and at least partially block expression in earlier HSPCs. The miR-223 target can block expression in differentiated myeloid cells, including granulocytes, monocytes, macrophages, and myeloid dendritic cells. The miR-223 target may also be suitable for gene therapy applications that rely on robust transgene expression in lymphocyte or erythroid lineages. The miR-223 target can also block expression very effectively in human HSCs.

[0295] In another embodiment, the target sequence is the miR142 target (tccataaagtaggaaacactaca (SEQ ID NO: 7)). In one embodiment, the lentiviral vector contains four copies of the miR-142 target sequence. In certain embodiments, the complementary sequence of a hematopoietic-specific microRNA, such as miR-142 (142T), is incorporated into the 3' untranslated region of the lentiviral vector, rendering the transgene-encoding transcript susceptible to miRNA-mediated downregulation. This method can block transgene expression in hematopoietic antigen-presenting cells (APCs) while maintaining it in non-hematopoietic cells (Brown et al., Nat Med 2006). This strategy can impose stringent post-transcriptional control on transgene expression, thus enabling stable delivery and long-term expression of the transgene. In some embodiments, miR-142 modulation prevents immune-mediated elimination of transduced cells and / or induces antigen-specific regulatory T cells (Tregs) to mediate robust immune tolerance to the antigen encoded by the transgene.

[0296] In some embodiments, the target sequence is a miR181 target. Chen CZ and Lodish H, Seminars in Immunology (2005) 17(2):155-165, discloses that miR-181 is a miRNA that is specifically expressed in B cells in mouse bone marrow (Chen and Lodish, 2005). It also discloses that some human miRNAs are associated with leukemia.

[0297] A target sequence can be fully or partially complementary to a miRNA. The term "fully complementary" means that the target sequence has a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that it recognizes. The term "partially complementary" means that the target sequence is only partially complementary to the sequence of the miRNA that it recognizes, whereby the partially complementary sequence is still recognized by the miRNA. In other words, in the context of the present disclosure, a partially complementary target sequence is effective in recognizing the corresponding miRNA and causing inhibition or reduction of transgene expression in cells that express that miRNA. Examples of miRNA target sequences are described in WO2007 / 000668, WO2004 / 094642, WO2010 / 055413, or WO2010 / 125471, which are incorporated herein by reference in their entirety.

[0298] B.3. Heterologous Nucleotide Sequences In some embodiments, the isolated nucleic acid molecule further comprises a heterologous nucleotide sequence. In some embodiments, the isolated nucleic acid molecule further comprises at least one heterologous nucleotide sequence. The heterologous nucleotide sequence can be linked to the FVIII or FIX coding sequence of the present disclosure at the 5' end, the 3' end, or can be inserted in the middle. Thus, in some embodiments, the heterologous amino acid sequence encoded by the heterologous nucleotide sequence is linked to the N-terminus or C-terminus of the FVIII or FIX amino acid sequence encoded by the nucleotide sequence, or inserted between two amino acids in the FVIII or FIX amino acid sequence. In some embodiments, the heterologous amino acid sequence can be inserted between two amino acids of the FVIII polypeptide at one or more insertion sites selected from Table 2. In some embodiments, the heterologous amino acid sequence can be inserted into a FVIII polypeptide encoded by a nucleic acid molecule of the present disclosure at any site disclosed in International Publication Nos. WO2013 / 123457A1 and WO2015 / 106052A1 or U.S. Patent Application Publication No. 2015 / 0158929A1, the entireties of which are incorporated by reference herein.

[0299] In some embodiments, the heterologous amino acid sequence encoded by the heterologous nucleotide sequence is inserted into the B domain or a fragment thereof. In some embodiments, the heterologous amino acid sequence is inserted into FVIII immediately downstream of the amino acid corresponding to amino acid 745 of mature human FVIII (SEQ ID NO: 4). In one particular embodiment, the FVIII contains a deletion of amino acids 746-1646 corresponding to mature human FVIII (SEQ ID NO: 4), and the heterologous amino acid sequence encoded by the heterologous nucleotide sequence is inserted immediately downstream of amino acid 745 corresponding to mature human FVIII (SEQ ID NO: 4).

[0300] [Table 2]

[0301] In other embodiments, the isolated nucleic acid molecule further comprises two, three, four, five, six, seven or eight heterologous nucleotide sequences. In some embodiments, all heterologous nucleotide sequences are identical. In some embodiments, at least one heterologous nucleotide sequence is different from other heterologous nucleotide sequences. In some embodiments, the present disclosure can comprise more than two, three, four, five, six or seven heterologous nucleotide sequences in tandem.

[0302] In some embodiments, the heterologous nucleotide sequence encodes an amino acid sequence. In some embodiments, the amino acid sequence encoded by the heterologous nucleotide sequence is a heterologous moiety that can extend the half-life of the FVIII molecule (a "half-life extender").

[0303] In some embodiments, the heterologous moiety is a peptide or polypeptide that has either non-structural or structural features that, when incorporated into the protein of the present disclosure, result in an increased in vivo half-life. Non-limiting examples include albumin, albumin fragments, Fc fragments of immunoglobulins, the C-terminal peptide (CTP) of the β subunit of human chorionic gonadotropin, HAP sequences, XTEN sequences, transferrin or fragments thereof, PAS polypeptides, polyglycine linkers, polyserine linkers, albumin binding moieties, or any fragments, derivatives, variants, or combinations of these polypeptides. In a specific embodiment, the heterologous amino acid sequence is an immunoglobulin constant region or a portion thereof, transferrin, albumin, or PAS sequence.

[0304] In some embodiments, the heterologous moiety comprises von Willebrand factor or a fragment thereof. In other related embodiments, the heterologous moiety may comprise an attachment site (e.g., a cysteine ​​amino acid) for a non-polypeptide moiety, such as polyethylene glycol (PEG), hydroxyethyl starch (HES), polysialic acid, or any derivative, variant, or combination of these elements. In some embodiments, the heterologous moiety comprises a cysteine ​​amino acid that functions as an attachment site for a non-polypeptide moiety, such as polyethylene glycol (PEG), hydroxyethyl starch (HES), polysialic acid, or any derivative, variant, or combination of these elements.

[0305] In a specific embodiment, the first heterologous nucleotide sequence encodes a first heterologous moiety that is a half-life extending molecule known in the art, and the second heterologous nucleotide sequence encodes a second heterologous moiety that may also be a half-life extending molecule known in the art. In certain embodiments, the first heterologous moiety (e.g., a first Fc moiety) and the second heterologous moiety (e.g., a second Fc moiety) associate with each other to form a dimer. In one embodiment, the second heterologous moiety is a second Fc moiety, where the second Fc moiety is linked to or associated with the first heterologous moiety, e.g., the first Fc moiety. For example, the second heterologous moiety (e.g., the second Fc moiety) can be linked to the first heterologous moiety (e.g., the first Fc moiety) by a linker or can be associated with the first heterologous moiety by a covalent or non-covalent bond.

[0306] In some embodiments, the heterologous moiety is a polypeptide comprising, consisting essentially of, or consisting of at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least 1100, at least about 1200, at least about 1300, at least about 1400, at least about 1500, at least about 1600, at least about 1700, at least about 1800, at least about 1900, at least about 2000, at least about 2500, at least about 3000, or at least about 4000 amino acids.

[0307] In other embodiments, the heterologous moiety is a polypeptide comprising, consisting essentially of, or consisting of about 100 to about 200 amino acids, about 200 to about 300 amino acids, about 300 to about 400 amino acids, about 400 to about 500 amino acids, about 500 to about 600 amino acids, about 600 to about 700 amino acids, about 700 to about 800 amino acids, about 800 to about 900 amino acids, or about 900 to about 1000 amino acids.

[0308] In certain embodiments, the heterologous moiety improves one or more pharmacokinetic properties of the FVIII or FIX protein without significantly affecting its biological activity or function.

[0309] In certain embodiments, the heterologous moiety extends the in vivo and / or in vitro half-life of the FVIII or FIX protein of the present disclosure. In other embodiments, the heterologous moiety facilitates visualization or localization of the FVIII or FIX protein of the present disclosure, or a fragment thereof (e.g., a fragment comprising the heterologous moiety after proteolytic cleavage of the FVIII or FIX protein). Visualization and / or localization of the FVIII or FIX protein of the present disclosure, or a fragment thereof, can be in vivo, in vitro, ex vivo, or a combination thereof.

[0310] In other embodiments, the heterologous moiety enhances the stability of a FVIII or FIX protein or fragment thereof of the present disclosure (e.g., a fragment comprising a heterologous moiety following proteolytic cleavage of the FVIII or FIX protein). As used herein, the term "stability" refers to an art-recognized measure of the maintenance of one or more physical properties of a FVIII or FIX protein in response to environmental conditions (e.g., elevated or decreased temperature). In certain aspects, the physical property is the maintenance of the covalent structure of the FVIII or FIX protein (e.g., absence of proteolytic cleavage, undesired oxidation, or deamidation). In other aspects, the physical property can also be the presence of the FVIII or FIX protein in a correctly folded state (e.g., absence of soluble or insoluble aggregation or precipitation).

[0311] In one embodiment, the stability of FVIII or FIX protein is measured by assaying the biophysical properties of the FVIII or FIX protein, such as thermal stability, pH unfolding profile, stable removal of glycosylation, solubility, biochemical function (e.g., ability to bind to proteins, receptors, or ligands), and / or a combination thereof. In another embodiment, biochemical function is demonstrated by the binding affinity of an interaction. In one embodiment, the measure of protein stability is thermal stability, i.e., resistance to heat stress. Stability can be measured using methods known in the art, such as HPLC (high performance liquid chromatography), SEC (size exclusion chromatography), and DLS (dynamic light scattering). Methods for measuring thermal stability include, but are not limited to, differential scanning calorimetry (DSC), differential scanning fluorimetry (DSF), circular dichroism (CD), and heat stress assays.

[0312] In certain embodiments, the FVIII or FIX protein encoded by the nucleic acid molecule of the present disclosure comprises at least one half-life extender, i.e., a heterologous moiety that increases the in vivo half-life of the FVIII or FIX protein compared to the in vivo half-life of the corresponding FVIII or FIX protein lacking the heterologous moiety. The in vivo half-life of the FVIII or FIX protein can be determined by any method known to those skilled in the art, such as an activity assay (e.g., a chromogenic assay or a one-stage clotting aPTT assay), ELISA, ROTEM®, etc.

[0313] In some embodiments, the presence of one or more half-life extenders extends the half-life of a FVIII or FIX protein compared to the half-life of the corresponding protein lacking such one or more half-life extenders. The half-life of a FVIII or FIX protein comprising a half-life extender is at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, or at least about 12-fold longer than the in vivo half-life of the corresponding FVIII or FIX protein lacking such half-life extenders.

[0314] In one embodiment, the half-life of a FVIII or FIX protein comprising a half-life extender is about 1.5-fold to about 20-fold, about 1.5-fold to about 15-fold, or about 1.5-fold to about 10-fold longer than the in vivo half-life of the corresponding protein lacking such half-life extender. In another embodiment, the half-life of a FVIII or FIX protein comprising a half-life extender is about 2-fold to about 10-fold, about 2-fold to about 9-fold, about 2-fold to about 8-fold, about 2-fold to about 7-fold, about 2-fold to about 6-fold, about 2-fold to about 5-fold, about 2-fold to about 4-fold, about 2-fold to about 3-fold, about 2.5-fold to about 10-fold, about 2-fold to about 2.5-fold, or about 2.5-fold longer than the in vivo half-life of the corresponding protein lacking such half-life extender. The extension is 5 times to about 9 times, about 2.5 times to about 8 times, about 2.5 times to about 7 times, about 2.5 times to about 6 times, about 2.5 times to about 5 times, about 2.5 times to about 4 times, about 2.5 times to about 3 times, about 3 times to about 10 times, about 3 times to about 9 times, about 3 times to about 8 times, about 3 times to about 7 times, about 3 times to about 6 times, about 3 times to about 5 times, about 3 times to about 4 times, about 4 times to about 6 times, about 5 times to about 7 times, or about 6 times to about 8 times.

[0315] In other embodiments, the half-life of the FVIII or FIX protein comprising the half-life extender is at least about 17 hours, at least about 18 hours, at least about 19 hours, at least about 20 hours, at least about 21 hours, at least about 22 hours, at least about 23 hours, at least about 24 hours, at least about 25 hours, at least about 26 hours, at least about 27 hours, at least about 28 hours, at least about 29 hours, at least about 30 hours, at least about 31 hours, at least about 32 hours, at least about 33 hours, at least about 34 hours, at least about 35 hours, at least about 36 hours, at least about 48 hours, at least about 60 hours, at least about 72 hours, at least about 84 hours, at least about 96 hours, or at least about 108 hours.

[0316] In still other embodiments, the half-life of the FVIII or FIX protein comprising the half-life extender is about 15 hours to about 2 weeks, about 16 hours to about 1 week, about 17 hours to about 1 week, about 18 hours to about 1 week, about 19 hours to about 1 week, about 20 hours to about 1 week, about 21 hours to about 1 week, about 22 hours to about 1 week, about 23 hours to about 1 week, about 24 hours to about 1 week, about 36 hours to about 1 week, about 48 hours to about 1 week, about 60 hours to about 1 week, about 24 hours to about 6 days, about 24 hours to about 5 days, about 24 hours to about 4 days, about 24 hours to about 3 days, or about 24 hours to about 2 days.

[0317] In some embodiments, the average half-life per subject of a FVIII or FIX protein comprising a half-life extender is about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours (1 day), about 25 hours, about 26 hours, about 27 hours, about 28 hours, about 29 hours, about 30 hours, about 31 hours, about 32 hours, about 33 hours, about 34 hours, about 35 hours, about 36 hours, about 37 hours, about 38 hours, about 39 hours, about 40 hours, about 41 hours, about 42 hours, about 43 hours, about 44 hours, about 45 hours, about 46 hours, about 47 hours, about 48 hours, about 49 hours, about 50 hours, about 51 hours, about 52 hours, about 53 hours, about 54 hours, about 55 hours, about 56 hours, about 57 hours, about 58 hours, about 59 hours, about 60 hours, about 61 hours, about 62 hours, about 63 hours, about 64 hours, about 65 hours, about 66 hours, about 67 hours, about 68 hours, about 69 hours, about 70 hours, about 71 hours, about 72 hours, about 73 hours, about 74 hours, about 75 hours, about 76 hours, about 77 hours, about 78 hours, about 79 hours, about 80 hours, about 81 hours, about 82 hours, about 83 hours, about 84 hours, about 85 hours, about 86 hours, about 87 hours, about 88 hours, about 89 hours, about 90 hours, about 91 hours, about 92 hours, about 93 hours, about 94 hours, 3 hours, about 34 hours, about 35 hours, about 36 hours, about 40 hours, about 44 hours, about 48 hours (2 days), about 54 hours, about 60 hours, about 72 hours (3 days), about 84 hours, about 96 hours (4 days), about 108 hours, about 120 hours (5 days), about 6 days, about 7 days (1 week), about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 14 days.

[0318] One or more half-life extenders can be fused to the C-terminus or N-terminus of FVIII or FIX, or inserted internally within FVIII or FIX.

[0319] B.3.a. Immunoglobulin constant region or portion thereof In another aspect, the heterologous moiety comprises one or more immunoglobulin constant regions or portions thereof (e.g., Fc regions). In one embodiment, the isolated nucleic acid molecule of the present disclosure further comprises a heterologous nucleic acid sequence encoding an immunoglobulin constant region or portion thereof. In some embodiments, the immunoglobulin constant region or portion thereof is an Fc region.

[0320] The immunoglobulin constant region is composed of domains designated CH (constant heavy chain) domains (CH1, CH2, etc.). Depending on the isotype (i.e., IgG, IgM, IgA IgD, or IgE), the constant region is composed of three or four CH domains. Some isotype (e.g., IgG) constant regions also contain a hinge region. See Janeway et al., 2001, Immunobiology, Garland Publishing, NY, NY.

[0321] The immunoglobulin constant region or a portion thereof for producing the FVIII or FIX proteins of the present disclosure can be obtained from several different sources. In one embodiment, the immunoglobulin constant region or a portion thereof is derived from a human immunoglobulin. However, it will be understood that the immunoglobulin constant region or a portion thereof can also be derived from the immunoglobulin of another mammalian species, including, for example, a rodent (e.g., mouse, rat, rabbit, guinea pig) or a non-human primate (e.g., chimpanzee, macaque) species. Furthermore, the immunoglobulin constant region or a portion thereof can be derived from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, and any immunoglobulin isotype, including IgG1, IgG2, IgG3, and IgG4. In one embodiment, the human isotype IgG1 is used.

[0322] Various immunoglobulin constant region gene sequences (e.g., human constant region gene sequences) are available in the form of publicly accessible deposits. Constant region domain sequences can be selected that have specific effector functions (or lack specific effector functions) or that incorporate specific modifications that reduce immunogenicity. Many sequences of antibodies and antibody-encoding genes have been published, and suitable Ig constant region sequences (e.g., hinge, CH2, and / or CH3 sequences, or portions thereof) can be derived from these sequences using art-recognized techniques. The genetic material obtained using any of the aforementioned methods can then be modified or synthesized to obtain the polypeptides of the present disclosure. It will be further recognized that the scope of this disclosure encompasses alleles, variants, and mutations of constant region DNA sequences.

[0323] The sequence of immunoglobulin constant region or a part thereof can be cloned, for example, using polymerase chain reaction and primers selected to amplify the domain of interest.To clone the sequence of immunoglobulin constant region or a part thereof from antibody, mRNA can be isolated from hybridoma, spleen or lymphocyte, reverse transcribed into DNA, and the antibody gene can be amplified by PCR.PCR amplification methods are described in detail in U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188; and for example, "PCR Protocols: A Guide to Methods and Applications", edited by Innis et al., Academic Press, San Diego, CA (1990); Ho et al., 1989, Gene 77:51; Horton et al., 1993, Methods Enzymol. 217:270. PCR can be initiated with consensus constant region primers or more specific primers based on published heavy and light chain DNA and amino acid sequences. PCR can also be used to isolate DNA clones encoding antibody light and heavy chains. In this case, libraries can be screened with consensus primers or larger homologous probes, such as mouse constant region probes. Numerous primer sets suitable for amplifying antibody genes are known in the art (e.g., 5' primers based on the N-terminal sequence of purified antibodies (Benhar and Pastan, 1994, Protein Engineering 7:1509); rapid amplification of cDNA ends (Ruberti, F. et al., 1994, J. Immunol. Methods 173:33); antibody leader sequences (Larrick et al., 1989, Biochem. Biophys. Res. Commun. 160:1250). Cloning of antibody sequences is further described in U.S. Pat. No. 5,658,570 to Newman et al., filed Jan. 25, 1995, which is incorporated herein by reference).

[0324] As used herein, an immunoglobulin constant region can include all domains and hinge regions or portions thereof. In one embodiment, an immunoglobulin constant region or portion thereof includes the CH2 domain, the CH3 domain, and the hinge region, i.e., the Fc region or FcRn binding partner.

[0325] As used herein, the term "Fc region" is defined as the portion of a polypeptide corresponding to the Fc region of a native Ig, i.e., the portion formed by the dimeric association of the Fc domains of each of its two heavy chains. A native Fc region forms a homodimer with another Fc region. In contrast, the term "genetically fused Fc region" or "single-chain Fc region" (scFc region), as used herein, refers to a synthetic dimeric Fc region composed of Fc domains genetically linked (i.e., encoded by a single contiguous gene sequence) within a single polypeptide chain. See International Patent Application Publication No. WO 2012 / 006635, which is incorporated herein by reference in its entirety.

[0326] In one embodiment, "Fc region" refers to that portion of a single Ig heavy chain beginning at the hinge region immediately upstream of the papain cleavage site (i.e., residue 216 of IgG, where the first residue of the heavy chain constant region is 114) and ending at the C-terminus of the antibody. Thus, a complete Fc region includes at least the hinge, CH2, and CH3 domains.

[0327] The immunoglobulin constant region or a portion thereof can be an FcRn binding partner. FcRn is active in adult epithelial tissues and is expressed in the lumen of the intestine, the lung airways, the nasal cavity surface, the vaginal surface, the colon, and the rectal surface (U.S. Patent No. 6,485,726). The FcRn binding partner is a portion of an immunoglobulin that binds to FcRn.

[0328] FcRn receptors have been isolated from several mammalian species, including humans. The sequences of human FcRn, monkey FcRn, rat FcRn, and mouse FcRn are known (Story et al., 1994, J. Exp. Med. 180:2377). The FcRn receptor binds IgG (but not other immunoglobulin classes such as IgA, IgM, IgD, and IgE) at a relatively low pH and actively transports IgG transcellularly from the lumen to the serosal membrane, followed by release of IgG at the relatively high pH found in interstitial fluid. It is expressed in adult epithelial tissues (U.S. Patent Nos. 6,485,726, 6,030,613, 6,086,875; WO 03 / 077834; U.S. Patent Application Publication No. 2003-0235536 A1), including lung and intestinal epithelium (Israel et al., 1997, Immunology 92:69), renal proximal tubular epithelium (Kobayashi et al., 2002, Am. J. Physiol. Renal Physiol. 282:F358), and nasal epithelium, vaginal surface, and biliary tree surface.

[0329] FcRn binding partners useful in the present disclosure encompass a range of molecules to which the FcRn receptor can specifically bind, including whole IgG, Fc fragments of IgG, and other fragments containing the complete binding region of the FcRn receptor. The region of the Fc portion of IgG that binds to the FcRn receptor has been described based on X-ray crystallography (Burmeister et al., 1994, Nature 372:379). The main contact region of the Fc with FcRn is near the junction of the CH2 and CH3 domains. All Fc-FcRn contacts are within a single Ig heavy chain. FcRn binding partners include whole IgG, Fc fragments of IgG, and other fragments of IgG containing the complete binding region of the FcRn. Major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-291, 308-311, and 314 in the CH2 domain, and amino acid residues 385-387, 428, and 433-436 in the CH3 domain. All references made to the amino acid numbering of immunoglobulins or immunoglobulin fragments or regions are based on Kabat et al., 1991, Sequences of Proteins of Immunological Interest, USDapartment of Public Health, Bethesda, Md.

[0330] Fc regions or FcRn binding partners bound to FcRn can be efficiently transported across epithelial barriers by FcRn, providing a non-invasive means for systemic administration of desired therapeutic molecules. Furthermore, fusion proteins containing Fc regions or FcRn binding partners are phagocytosed by cells expressing FcRn. However, these fusion proteins are not subject to degradation and are recycled and re-enter the blood circulation, thereby extending the in vivo half-life of these proteins. In certain embodiments, the portion of the immunoglobulin constant region is an Fc region or an FcRn binding partner that typically associates with another Fc region or another FcRn binding partner via disulfide bonds and other non-specific interactions to form dimers and higher-order multimers.

[0331] Two FcRn receptors can bind to a single Fc molecule. Crystallographic data suggest that each FcRn molecule binds to a single polypeptide of an Fc homodimer. In one embodiment, an FcRn binding partner, e.g., an Fc fragment of IgG, is linked to a biologically active molecule, providing a means for delivering the biologically active molecule orally, bucally, sublingually, rectally, vaginally, nasally, or via the pulmonary route as an aerosol, or via the ocular route. In another embodiment, the FVIII protein can be administered invasively, e.g., subcutaneously or intravenously.

[0332] An FcRn binding partner region is a molecule or portion thereof to which the FcRn receptor specifically binds, thereby enabling active transport of the Fc region by the FcRn receptor. Specific binding refers to two molecules forming a complex that is relatively stable under physiological conditions. Specific binding is characterized by high affinity and low to moderate avidity, and is distinguished from nonspecific binding, which is usually characterized by low affinity and moderate to high avidity. Affinity constants with a KA of 10 or greater are typically observed. 6 M -1 Higher than or 10 8 M -1 Binding is considered specific when the binding affinity is higher than 0. If necessary, non-specific binding can be reduced by changing the binding conditions without substantially affecting specific binding. Those skilled in the art can optimize appropriate binding conditions, such as the concentration of the molecule, the ionic strength of the solution, temperature, binding time, and the concentration of the blocking agent (e.g., serum albumin, milk casein) using routine techniques.

[0333] In certain embodiments, the FVIII protein encoded by the nucleic acid molecule of the present disclosure comprises one or more truncated Fc regions sufficient to confer Fc receptor (FcR) binding properties to the Fc region despite the truncation. For example, the portion of the Fc region that binds to FcRn (i.e., the FcRn-binding portion) comprises approximately amino acids 282-438 of IgG1, according to EU numbering (the major contact sites are amino acids 248, 250-257, 272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain, and amino acid residues 385-387, 428, and 433-436 of the CH3 domain). Thus, the Fc region of the present disclosure can comprise or consist of an FcRn-binding portion. The FcRn-binding portion can be derived from a heavy chain of any isotype, including IgG1, IgG2, IgG3, and IgG4. In one embodiment, an FcRn-binding portion derived from an antibody of human isotype IgG1 is used, while in another embodiment, an FcRn-binding portion derived from an antibody of human isotype IgG4 is used.

[0334] The Fc region can be obtained from several different sources. In one embodiment, the Fc region of the polypeptide is derived from a human immunoglobulin. However, it will be understood that the Fc portion can also be derived from the immunoglobulin of another mammalian species, including, for example, rodent (e.g., mouse, rat, rabbit, guinea pig) or non-human primate (e.g., chimpanzee, macaque) species. Furthermore, the Fc domain or portion thereof can be derived from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, and any immunoglobulin isotype, including IgG1, IgG2, IgG3, and IgG4. In another embodiment, the human isotype IgG1 is used.

[0335] In certain embodiments, the Fc variants provide an alteration in at least one effector function conferred by the Fc portion comprising said wild-type Fc domain (e.g., improved or decreased ability of the Fc region to bind to an Fc receptor (e.g., FcγRI, FcγRII, or FcγRIII) or a complement protein (e.g., C1q), or to induce antibody-dependent cellular cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC)). In other embodiments, the Fc variants provide an engineered cysteine ​​residue.

[0336] The Fc regions of the present disclosure may employ art-recognized Fc variants known to confer altered (e.g., enhanced or diminished) effector function and / or FcR or FcRn binding. Specifically, the Fc regions of the present disclosure may employ Fc variants such as those described in International PCT Application Publications WO88 / 07089A1, WO96 / 14339A1, WO98 / 05787A1, WO98 / 23289A1, WO99 / 51642A1, WO99 / 58572A1, WO00 / 09560A2, WO00 / 32767A1, WO00 / 42072A2, WO02 / 44215A2, WO02 / 060919A2, and WO03 / 0744, each of which is incorporated herein by reference. 569A2, WO04 / 016750A2, WO04 / 029207A2, WO04 / 035752A2, WO04 / 063351A2, WO04 / 074455A2, WO04 / 099249A2, WO05 / 040217A2, WO04 / 044859, WO05 / 070963A1, WO05 / 077981A2, WO05 / 092925A2, WO05 / 123780A2, WO06 / 019447A1, WO06 / 047350A2 and WO0 6 / 085967A2; U.S. Patent Application Publication Nos. 2007 / 0231329, 2007 / 0231329, 2007 / 0237765, 2007 / 0237766, 2007 / 0237767, 2007 / 0243188, 2007 / 0248603, 2007 / 0286859, and 2008 / 0057056; or U.S. Patent Nos. 5,648,260, 5,739,277, 5,834,250, and 5,869,046, Nos. 6,096,871, 6,121,022, 6,194,551, 6,242,195, 6,277,375, 6,528,624, 6,538,124, 6,737,056, 6,821,505, 6,998,253, 7,083,784, 7,404,956, and 7,317,091 may contain alterations (e.g., substitutions) at one or more of the amino acid positions disclosed inIn one embodiment, a specific change (e.g., a specific substitution of one or more amino acids disclosed in the art) can be made at one or more of the disclosed amino acid positions, hi another embodiment, a different change (e.g., a different substitution of one or more amino acid positions disclosed in the art) can be made at one or more of the disclosed amino acid positions.

[0337] The Fc region of an IgG or an FcRn binding partner can be modified using well-recognized procedures, such as site-directed mutagenesis, to obtain modified IgG or Fc fragments or portions thereof that bind to FcRn. Such modifications include modifications at sites distant from the FcRn contact site, as well as modifications within the contact site that retain or even enhance binding to FcRn. For example, human IgG1 Fc (Fc The following single amino acid residues in 1) can be substituted: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A, N286A, T287A, V288A, V289A, V290A, V300A, V310A, V311A, V312A, V313A, V314A, V315A, V316A, V317A, V318A, V319A, V320A, V321A, V322A, V323A, V324A, V325A, V326A, V327A, V328A, V329A, V330A, V331A, V332A, V333A, V334A, V335A, V336A, V337A, V338A, V339A, V340A, V341A, V342A, V343A, V344A, V345A, V346A, V347A, V348A, V349A, V350A, V351A, V352A, V353A, V354A, V355A, V356A, V357A, V358A, V359A, V359A, V359A, V359A, V359A, V35 89A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A, S298A, Y300F, R301A, V303A, V305A, T307A, L30 9A, Q311A, D312A, N315A, K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A, A330Q, P331A, E333A , K334A, T335A, S337A, K338A, K340A, Q342A, R344A, E345A, Q347A, R355A, E356A, M358A, T359A, K360A, N361A, Q362A, Y373A, S375A, D376A, A378Q, E380A, E382A, S383A, N384A, Q386A, E388A, N389A, N390A, Y3 91F, K392A, L398A, S400A, D401A, D413A, K414A, R416A, Q418A, Q419A, N421A, V422A, S424A, E430A, N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where, for example, P238A represents a substitution of alanine for the wild-type proline at position 238. By way of example, in a specific embodiment, an N297A mutation is incorporated to remove a highly conserved N-glycosylation site.In addition to alanine, other amino acids can be substituted for the wild-type amino acids at the positions identified above. Mutations can be introduced individually into an Fc to generate over 100 different Fc regions that differ from the native Fc. Furthermore, combinations of two, three, or more of these individual mutations can be introduced together to generate hundreds more Fc regions.

[0338] Certain of the above mutations can confer new functions to the Fc region or FcRn binding partner. For example, in one embodiment, N297A is incorporated to remove a highly conserved N-glycosylation site. The effect of this mutation is to reduce immunogenicity, thereby enhancing the circulating half-life of the Fc region, and to render the Fc region unable to bind to FcγRI, FcγRIIA, FcγRIIB, and FcγRIIIA without impairing affinity for FcRn (Routledge et al., 1995, Transplantation 60:847; Friend et al., 1999, Transplantation 68:1632; Shields et al., 1995, J. Biol. Chem. 276:6591). As a further example of the new functions resulting from the above mutations, in some cases, affinity for FcRn can be increased compared to wild-type affinity. This increased affinity may reflect an increased "on" rate, a decreased "off" rate, or both an increased "on" rate and a decreased "off" rate. Examples of mutations that may result in increased affinity for FcRn include, but are not limited to, T256A, T307A, E380A, and N434A (Shields et al., 2001, J. Biol. Chem. 276:6591).

[0339] Furthermore, at least three human Fcγ receptors are believed to recognize binding sites on IgG in the downstream hinge region, generally amino acids 234-237. Therefore, another example of new function and potentially reduced immunogenicity can be generated by mutating this region, e.g., substituting amino acids 233-236 of human IgG1 ("ELLG") (SEQ ID NO: 8) with the corresponding sequence "PVA" from IgG2 (with a one-amino acid deletion). It has been shown that when such mutations are introduced, FcγRI, FcγRII, and FcγRIII, which mediate various effector functions, no longer bind to IgG1. Ward and Ghetie, 1995, Therapeutic Immunology 2:77; Armour et al., 1999, Eur. J. Immunol. 29:2613.

[0340] In another embodiment, the immunoglobulin constant region or portion thereof comprises an amino acid sequence in the hinge region or portion thereof that forms one or more disulfide bonds with a second immunoglobulin constant region or portion thereof. The second immunoglobulin constant region or portion thereof can be linked to a second polypeptide to unite the FVIII protein and the second polypeptide. In some embodiments, the second polypeptide is an enhancer moiety. As used herein, the term "enhancer moiety" refers to a molecule, fragment thereof, or polypeptide component that can enhance the procoagulant activity of FVIII. The enhancer moiety can be a cofactor, such as soluble tissue factor (sTF), or a procoagulant peptide. Thus, upon activation of FVIII, the enhancer moiety becomes available to enhance the activity of FVIII.

[0341] In certain embodiments, the FVIII protein encoded by the nucleic acid molecule of the present disclosure comprises amino acid substitutions to the immunoglobulin constant region or a portion thereof (e.g., Fc variants) that alter the antigen-dependent effector functions of the Ig constant region, in particular the blood half-life of the protein.

[0342] B.3.b.scFc region In another aspect, the heterologous moiety comprises an scFc (single-chain Fc) region. In one embodiment, the isolated nucleic acid molecule of the present disclosure further comprises a heterologous nucleic acid sequence encoding an ScFc region. The scFc region comprises at least two immunoglobulin constant regions or portions thereof (e.g., Fc moieties or Fc domains (e.g., two, three, four, five, six, or more Fc moieties or domains)) that are capable of folding (e.g., intramolecularly or intermolecularly) within the same linear polypeptide chain to form a functional scFc region linked by an Fc peptide linker. For example, in one embodiment, a polypeptide of the disclosure is capable of binding to at least one Fc receptor (e.g., FcRn, an FcγR receptor (e.g., FcγRIII), or a complement protein (e.g., C1q)) via its ScFc region for purposes of improving half-life, or eliciting immune effector function (e.g., antibody-dependent cellular cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC)), and / or improving manufacturability.

[0343] B.3.CTP In another embodiment, the heterologous moiety comprises one C-terminal peptide (CTP) of the beta subunit of human chorionic gonadotropin, or a fragment, variant, or derivative thereof. One or more CTP peptides inserted into a recombinant protein are known to extend the in vivo half-life of the protein. See, e.g., U.S. Patent No. 5,712,122, incorporated herein by reference in its entirety.

[0344] Exemplary CTP peptides include DPRFQDSSSSKAPPPSLPSPSRLPGPSDTPIL (SEQ ID NO: 9) or SSSSKAPPPSLPSPSRLPGPSDTPILPQ (SEQ ID NO: 10). See, e.g., U.S. Patent Application Publication No. 2009 / 0087411A1, incorporated by reference.

[0345] B.3.d. XTEN Sequences In some embodiments, the heterologous moiety comprises one or more XTEN sequences, fragments, variants, or derivatives thereof. As used herein, "XTEN sequence" refers to an extended polypeptide having a non-naturally occurring, substantially non-repetitive sequence composed primarily of small, hydrophilic amino acids and exhibiting little or no secondary or tertiary structure under physiological conditions. As a heterologous moiety, XTEN can serve as a half-life extending moiety. In addition, XTEN can provide desirable properties, including, but not limited to, enhanced pharmacokinetic parameters and solubility properties.

[0346] Incorporation of heterologous moieties, including XTEN sequences, into proteins of the present disclosure can confer one or more of the following advantageous properties to the protein: conformational flexibility, increased aqueous solubility, enhanced protease resistance, reduced immunogenicity, reduced binding to mammalian receptors, or increased hydrodynamic (or Stokes) radius.

[0347] In certain embodiments, the XTEN sequence can provide improved pharmacokinetic properties, such as a longer in vivo half-life or an increased area under the curve (AUC), such that the proteins of the disclosure remain in vivo and have procoagulant activity for a longer period of time compared to otherwise identical proteins lacking the XTEN heterologous moiety.

[0348] In some embodiments, XTEN sequences useful with the present disclosure are peptides or polypeptides having more than about 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1200, 1400, 1600, 1800, or 2000 amino acid residues. In certain embodiments, XTEN is a peptide or polypeptide having from about 20 to more than about 3000 amino acid residues, from 30 to more than about 2500 residues, from 40 to more than about 2000 residues, from 50 to more than about 1500 residues, from 60 to more than about 1000 residues, from 70 to more than about 900 residues, from 80 to more than about 800 residues, from 90 to more than about 700 residues, from 100 to more than about 600 residues, from 110 to more than about 500 residues, or from 120 to more than about 400 residues. In a particular embodiment, XTEN comprises an amino acid sequence longer than 42 amino acids and shorter than 144 amino acids in length.

[0349] XTEN sequences of the present disclosure can include one or more sequence motifs of 5-14 (e.g., 9-14) amino acid residues, or an amino acid sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence motif, wherein the motif comprises, consists essentially of, or consists of 4-6 amino acids (e.g., 5 amino acids) selected from the group consisting of glycine (G), alanine (A), serine (S), threonine (T), glutamic acid (E), and proline (P). See U.S. Patent Application No. 2010-0239554A1.

[0350] In some embodiments, the XTEN comprise non-overlapping sequence motifs, where about 80%, or at least about 85%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 100% of the sequence is composed of multiple units of non-overlapping sequence selected from a single motif family selected from Table 3, resulting in a family sequence.

[0351] As used herein, "family" means that the XTEN has a motif selected from only a single motif category from Table 3, i.e., AD, AE, AF, AG, AM, AQ, BC, or BD XTEN, and any other amino acids in the XTEN that are not from the family motif are selected to achieve required properties such as allowing the encoding nucleotide to incorporate a restriction site, a cleavage sequence, or to achieve better linkage to FVIII. In some embodiments of an XTEN family, the XTEN sequence contains multiple units of non-overlapping sequence motifs from the AD motif family, or the AE motif family, or the AF motif family, or the AG motif family, or the AM motif family, or the AQ motif family, or the BC family, or the BD family, and the resulting XTEN exhibits the above-mentioned ranges of homology. In other embodiments, the XTEN contains multiple units of motif sequences from two or more of the motif families in Table 3.

[0352] These sequences can be selected to achieve desired physical / chemical characteristics, including properties such as net charge, hydrophilicity, lack of secondary structure, or lack of repetition conferred by the amino acid composition of the motif, as described in more detail below. In the above embodiments described in this paragraph, the methods described herein can be used to select and assemble motifs to be incorporated into XTEN to achieve XTENs of from about 36 to about 3000 amino acid residues.

[0353] [Table 3]

[0354] Examples of XTEN sequences that can be used as heterologous moieties in the chimeric proteins of the present disclosure are described in, for example, U.S. Patent Application Publication Nos. 2010 / 0239554A1, 2010 / 0323956A1, 2011 / 0046060A1, 2011 / 0046061A1, and 2011 / 0077199A1 or 2011 / 0172146A1, or International Patent Application Publication Nos. WO2010 / 091122A1, WO2010 / 144502A2, WO2010 / 144508A1, WO2011 / 028228A1, WO2011 / 028229A1, or WO2011 / 028344A2.

[0355] XTEN can be of various lengths for insertion or linkage to FVIII. In one embodiment, the length of the XTEN sequence is selected based on the property or function to be achieved in the fusion protein. Depending on the intended property or function, the XTEN can be a short or medium-length sequence, or a longer sequence that can serve as a carrier. In certain embodiments, XTEN includes short segments of about 6 to about 99 amino acid residues, medium lengths of about 100 to about 399 amino acid residues, and longer lengths of about 400 to about 1000, up to about 3000 amino acid residues. Therefore, the XTEN inserted into or linked to FVIII can have a length of about 6, about 12, about 36, about 40, about 42, about 72, about 96, about 144, about 288, about 400, about 500, about 576, about 600, about 700, about 800, about 864, about 900, about 1000, about 1500, about 2000, about 2500, or up to about 3000 amino acid residues. In other embodiments, the XTEN sequence is about 6 to about 50, about 50 to about 100, about 100 to 150, about 150 to 250, about 250 to 400, about 400 to about 500, about 500 to about 900, about 900 to 1500, about 1500 to 2000, or about 2000 to about 3000 amino acid residues in length.

[0356] The exact length of the XTEN inserted into or linked to FVIII can be varied without adversely affecting the activity of FVIII. In one embodiment, one or more of the XTEN used in the invention have a length of 42 amino acids, 72 amino acids, 144 amino acids, 288 amino acids, 576 amino acids, or 864 amino acids and can be selected from one or more of the XTEN family sequences, i.e., AD, AE, AF, AG, AM, AQ, BC, or BD.

[0357] In some embodiments, the XTEN sequences used in this disclosure are AE42, AG42, AE48, AM48, AE72, AG72, AE108, AG108, AE144, AF144, AG144, AE180, AG180, AE216, AG216, AE252, AG252, AE288, AG288, AE324, AG324, AE360, AG360, AE396, AG 396, AE432, AG432, AE468, AG468, AE504, AG504, AF504, AE540, AG540, AF540, AD576, AE576, AF576, A G576, AE612, AG612, AE624, AE648, AG648, AG684, AE720, AG720, AE756, AG756, AE792, AG792, AE828, A G828, AD836, AE864, AF864, AG864, AM875, AE912, AM923, AM1318, BC864, BD864, AE948, AE1044, AE11 40, AE1236, AE1332, AE1428, AE1524, AE1620, AE1716, AE1812, AE1908, AE2004A, AG948, AG1044, AG11 AG40, AG1236, AG1332, AG1428, AG1524, AG1620, AG1716, AG1812, AG1908, AG2004, and any combination thereof. See U.S. Patent Application No. 2010-0239554A1. In a specific embodiment, the XTEN comprises AE42, AE72, AE144, AE288, AE576, AE864, AG42, AG72, AG144, AG288, AG576, AG864, or any combination thereof.

[0358] Exemplary XTEN sequences that can be used as heterologous moieties in the chimeric proteins of the present disclosure include XTEN AE42-4 (SEQ ID NO:41), XTEN 144-2A (SEQ ID NO:42), XTEN A144-3B (SEQ ID NO:43), XTEN AE144-4A (SEQ ID NO:44), XTEN AE144-5A (SEQ ID NO:45), XTEN AE144-6B (SEQ ID NO:46), XTEN AG144-1 (SEQ ID NO:47), XTEN AG144-A (SEQ ID NO:48), XTEN AG144-B (SEQ ID NO:49), XTEN AG144-C (SEQ ID NO:50), and XTEN AG144-F (SEQ ID NO:51). In one particular embodiment, the XTEN is encoded by SEQ ID NO:52.

[0359] In some embodiments, less than 100% of the amino acids of the XTEN are selected from glycine (G), alanine (A), serine (S), threonine (T), glutamic acid (E), and proline (P), or less than 100% of the sequence consists of a sequence motif from Table 3 or an XTEN sequence provided herein. In such embodiments, the remaining amino acid residues of the XTEN are selected from any of the other 14 naturally occurring L-amino acids, but can be selected preferentially from hydrophilic amino acids such that the XTEN sequence contains at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% hydrophilic amino acids.

[0360] The content of hydrophobic amino acids in the XTEN utilized in the conjugation construct is less than 5%, or less than 2%, or less than 1%. Less preferred hydrophobic residues in XTEN construction include tryptophan, phenylalanine, tyrosine, leucine, isoleucine, valine, and methionine. Additionally, the XTEN sequence can contain less than 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1%, or 0% of the following amino acids: methionine (e.g., to avoid oxidation), or asparagine and glutamine (to avoid deamidation).

[0361] One or more XTEN sequences can be inserted at the C-terminus or N-terminus of the amino acid sequence encoded by the nucleotide sequence, or can be inserted between two amino acids of the amino acid sequence encoded by the nucleotide sequence. For example, XTEN can be inserted between two amino acids at one or more insertion sites selected from Table 2. Examples of sites in FVIII that allow XTEN insertion can be found, for example, in International Publication No. WO2013 / 123457A1 or U.S. Patent Application Publication No. 2015 / 0158929A1, which are incorporated by reference in their entireties.

[0362] B.3.e. Albumin or a fragment, derivative, or variant thereof In some embodiments, the heterologous moiety comprises albumin or a functional fragment thereof. Human serum albumin (HSA, or HA), a 609 amino acid protein in its full-length form, is responsible for a significant portion of the osmotic pressure of serum and also functions as a carrier of endogenous and exogenous ligands. As used herein, the term "albumin" includes full-length albumin or its functional fragment, variant, derivative, or analog. Examples of albumin or fragments or variants thereof are disclosed in U.S. Patent Application Publication Nos. 2008 / 0194481A1, 2008 / 0004206A1, 2008 / 0161243A1, 2008 / 0261877A1, or 2008 / 0153751A1, or PCT Patent Application Publication Nos. WO2008 / 033413A2, WO2009 / 058322A1, or WO2007 / 021494A2, which are incorporated by reference in their entireties.

[0363] In one embodiment, the FVIII protein encoded by the nucleic acid molecule of the present disclosure comprises albumin, a fragment or variant thereof, further linked to a second heterologous moiety selected from the group consisting of an immunoglobulin constant region or portion thereof (e.g., an Fc region), a PAS sequence, a HES, and PEG.

[0364] B.3.f. Albumin-binding moiety In certain embodiments, the heterologous moiety is an albumin-binding moiety comprising an albumin-binding peptide, a bacterial albumin-binding domain, an albumin-binding antibody fragment, or any combination thereof.

[0365] For example, the albumin-binding protein may be a bacterial albumin-binding protein, an antibody or antibody fragment, including a domain antibody (see U.S. Patent No. 6,696,245). The albumin-binding protein may be, for example, a bacterial albumin-binding domain, such as that of streptococcal protein G (Konig, T. and Skerra, A. (1998) J. Immunol. Methods 218, 73-83). Other examples of albumin-binding peptides that can be used as conjugation partners are those having the Cys-Xaa1-Xaa2-Xaa3-Xaa4-Cys consensus sequence (SEQ ID NO: 52), where Xaa1 is Asp, Asn, Ser, Thr, or Trp; Xaa2 is Asn, Gln, His, Ile, Leu, or Lys; Xaa3 is Ala, Asp, Phe, Trp, or Tyr; and Xaa4 is Asp, Gly, Leu, Phe, Ser, or Thr, as described, for example, in U.S. Patent Application Publication No. 2003 / 0069395 or Dennis et al. (Dennis et al. (2002) J. Biol. Chem. 277, 35035-35043).

[0366] As disclosed in Kraulis et al., FEBS Lett. 378:190-194 (1996) and Linhult et al., Protein Sci. 11:206-213 (2002), domain 3 from streptococcal protein G is an example of a bacterial albumin-binding domain. Examples of albumin-binding peptides include a series of peptides having the core sequence DICLPR WGCLW (SEQ ID NO: 54). See, e.g., Dennis et al., J. Biol. Chem. 2002, 277:35035-35043 (2002). Examples of albumin-binding antibody fragments are disclosed in Muller and Kontermann, Curr. Op 40 in. Mol. Ther. 9:319-326 (2007); Roovers et al., Cancer Immunol. Immunother. 56:303-317 (2007), and Holt et al., Prot. Eng. Design Sci. 21:283-288 (2008), the entire contents of which are incorporated herein by reference. An example of such an albumin-binding moiety is 2-(3-maleimidopropanamido)-6-(4-(4-iodophenyl)butanamido)hexanoate ("Albu" tag), disclosed in Trussel et al., Bioconjugate Chem. 20:2286-2292 (2009).

[0367] Fatty acids, particularly long-chain fatty acids (LCFAs) and long-chain fatty acid-like albumin-binding compounds can be used to extend the in vivo half-life of the FVIII proteins of the present disclosure. An example of an LCFA-like albumin-binding compound is 16-(1-(3-(9-(((2,5-dioxopyrrolidin-1-yloxy)carbonyloxy)-methyl)-7-sulfo-9H-fluoren-2-ylamino)-3-oxopropyl)-2,5-dioxopyrrolidin-3-ylthio)hexadecanoic acid (see, for example, WO2010 / 140148).

[0368] B.3.g.PAS Sequence In another embodiment, the heterologous moiety is a PAS sequence. As used herein, a PAS sequence refers to an amino acid sequence that contains primarily alanine and serine residues, or primarily alanine, serine, and proline residues, and that forms a random coil conformation under physiological conditions. Thus, a PAS sequence is a building block, amino acid polymer, or sequence cassette that contains, consists essentially of, or consists of alanine, serine, and proline, and can be used as part of a heterologous moiety in a chimeric protein. However, those skilled in the art will be aware that even when residues other than alanine, serine, and proline are added as minor components in a PAS sequence, the amino acid polymer can also form a random coil conformation.

[0369] The term "minor component" as used herein means that amino acids other than alanine, serine, and proline may be added to a PAS sequence to a certain extent, for example, up to about 12%, i.e., about 12 of the 100 amino acids of the PAS sequence, up to about 10%, i.e., about 10 of the 100 amino acids of the PAS sequence, up to about 9%, i.e., about 9 of the 100 amino acids, up to about 8%, i.e., about 8 of the 100 amino acids, about 6%, i.e., about 6 of the 100 amino acids, about 5%, i.e., about 5 of the 100 amino acids, about 4%, i.e., about 4 of the 100 amino acids, about 3%, i.e., about 3 of the 100 amino acids, about 2%, i.e., about 2 of the 100 amino acids, and about 1%, i.e., about 1 of the 100 amino acids. Amino acids different from alanine, serine, and proline can be selected from the group consisting of Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Thr, Trp, Tyr, and Val.

[0370] Under physiological conditions, the PAS sequence stretch forms a random coil conformation, thereby mediating increased in vivo and / or in vitro stability for the FVIII protein. Because the random coil domain itself does not have a stable structure or function, the biological activity mediated by the FVIII protein is essentially retained. In another embodiment, the PAS sequence forming the random coil domain is biologically inert, particularly with respect to proteolysis in plasma, immunogenicity, isoelectric point / electrostatic behavior, binding to cell surface receptors, or internalization, yet remains biodegradable, which provides a distinct advantage over synthetic polymers such as PEG.

[0371] Non-limiting examples of PAS sequences that form a random coil conformation include amino acid sequences selected from the group consisting of ASPAAPAPASPAAPAPSAPA (SEQ ID NO: 55), AAPASPAPAAPSAPAPAAPS (SEQ ID NO: 56), APSSPSPSAPSSPSPSPASPSS (SEQ ID NO: 57), APSSPSPSAPSSPSPASPS (SEQ ID NO: 58), SSPSAPSPSSPASPSPSSPA (SEQ ID NO: 59), AASPAAPSAPPAAASPAAPSAPPA (SEQ ID NO: 60), and ASAAAAPAAASAAASAPSAAA (SEQ ID NO: 61), or any combination thereof. Further examples of PAS sequences are known, for example, from U.S. Patent Application Publication No. 2010 / 0292130A1 and PCT Patent Application Publication No. WO2008 / 155134A1.

[0372] B.3.h.HAP sequence In certain embodiments, the heterologous moiety is a glycine-rich homoamino acid polymer (HAP). The HAP sequence may comprise a glycine repeat sequence having a length of at least 50 amino acids, at least 100 amino acids, 120 amino acids, 140 amino acids, 160 amino acids, 180 amino acids, 200 amino acids, 250 amino acids, 300 amino acids, 350 amino acids, 400 amino acids, 450 amino acids, or 500 amino acids. In one embodiment, the HAP sequence can extend the half-life of the moiety fused or linked to the HAP sequence. Non-limiting examples of HAP sequences include (Gly) n , (Gly4Ser) n or S(Gly4Ser) n In one embodiment, n is 20, 21, 22, 23, 24, 25, 26, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. In another embodiment, n is 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200.

[0373] B.3.i. Transferrin or a fragment thereof In certain embodiments, the heterologous moiety is transferrin or a fragment thereof. Any transferrin can be used to produce the FVIII protein of the present disclosure. As an example, wild-type human TF (TF) is a protein of approximately 75 KDa and 679 amino acids (not considering glycosylation), with two major domains, N (approximately 330 amino acids) and C (approximately 340 amino acids), which are thought to result from gene duplication. See GenBank accession numbers NM001063, XM002793, M12530, XM039845, XM039847, and S95936 (www.ncbi.nlm.nih.gov / ), all of which are incorporated herein by reference in their entireties. Transferrin comprises two domains, the N domain and the C domain. The N domain comprises two subdomains, the N1 domain and the N2 domain, and the C domain comprises two subdomains, the C1 domain and the C2 domain.

[0374] In one embodiment, the transferrin heterologous moiety includes a transferrin splice variant. In one example, the transferrin splice variant can be a splice variant of human transferrin, e.g., GenBank accession AAA61140. In another embodiment, the transferrin portion of the chimeric protein includes one or more domains of the transferrin sequence, e.g., the N domain, the C domain, the N1 domain, the N2 domain, the C1 domain, the C2 domain, or any combination thereof.

[0375] B.3.j. Clearance receptors In certain embodiments, the heterologous moiety is a clearance receptor, its fragment, variant, or derivative. LRP1 is a 600 KDa integral membrane protein involved in receptor-mediated clearance of various proteins, such as factor X. See, for example, Narita et al., Blood 91:555-560 (1998).

[0376] B.3.k. von Willebrand factor or a fragment thereof In certain embodiments, the heterologous moiety is von Willebrand factor (VWF) or one or more fragments thereof.

[0377] VWF (also known as F8VWF) is a large multimeric glycoprotein present in plasma and constitutively produced in endothelium (within Weibel-Palade bodies), megakaryocytes (in platelet α-granules), and subendothelial connective tissue. The basic VWF monomer is a 2813-amino acid protein. Each monomer contains several unique domains with distinct functions: the D' and D3 domains (which together bind factor VIII), the A1 domain (which binds platelet GPIb receptors, heparin, and / or possibly collagen), the A3 domain (which binds collagen), the C1 domain (which, upon activation, binds the RGD domain to platelet integrin αIIbβ3), and a "cysteine ​​knot" domain at the C-terminus of the protein (VWF shares this domain with platelet-derived growth factor (PDGF), transforming growth factor-β (TGFβ), and β-human chorionic gonadotropin (βHCG)).

[0378] The 2813 monomer amino acid sequence of human VWF is reported in GenBank under accession number NP000543.2. The nucleotide sequence encoding human VWF is reported in GenBank under accession number NM00552.3. SEQ ID NO: 62 is the amino acid sequence reported in GenBank under accession number NM00552.3. The D' domain comprises amino acids 764 to 866 of SEQ ID NO: 62. The D3 domain comprises amino acids 867 to 1240 of SEQ ID NO: 44.

[0379] In plasma, 95-98% of FVIII circulates as a tight, non-covalent complex with full-length VWF. Formation of this complex is important for maintaining adequate plasma levels of FVIIII in vivo. Lenting et al., Blood. 92(11):3983-96 (1998); Lenting et al., J. Thromb. Haemost. 5(7):1353-60 (2007). Upon FVIII activation by proteolysis at positions 372 and 740 of the heavy chain and at position 1689 of the light chain, VWF bound to FVIII is released from activated FVIII.

[0380] In certain embodiments, the heterologous moiety is full-length von Willebrand factor. In other embodiments, the heterologous moiety is a von Willebrand factor fragment. As used herein, the term "VWF fragment" or "VWF fragments" refers to any VWF fragment that interacts with FVIII and retains at least one or more properties normally conferred to FVIII by full-length VWF, such as preventing premature activation to FVIIIa, preventing premature proteolysis, preventing association with phospholipid membranes that could lead to premature clearance, preventing binding to FVIII clearance receptors that can bind naked FVIII but not VWF-bound FVIII, and / or stabilizing the interaction of the heavy and light chains of FVIII. In a specific embodiment, the heterologous moiety is a (VWF) fragment comprising the D' and D3 domains of VWF. A VWF fragment comprising the D' and D3 domains can further comprise a VWF domain selected from the group consisting of the A1 domain, the A2 domain, the A3 domain, the D1 domain, the D2 domain, the D4 domain, the B1 domain, the B2 domain, the B3 domain, the C1 domain, the C2 domain, the CK domain, one or more fragments thereof, and any combination thereof. Further examples of polypeptides having FVIII activity fused to VWF fragments are disclosed in U.S. Provisional Patent Application No. 61 / 667,901, filed July 3, 2012, and U.S. Patent Application Publication No. 2015 / 0023959A1, both of which are incorporated herein by reference in their entireties.

[0381] B.3.1. Linker Moiety In certain embodiments, the heterologous moiety is a peptide linker.

[0382] As used herein, the term "peptide linker" or "linker moiety" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) that connects two domains in the linear amino acid sequence of a polypeptide chain.

[0383] In some embodiments, a heterologous nucleotide sequence encoding a peptide linker can be inserted between the optimized FVIII polynucleotide sequence of the present disclosure and a heterologous nucleotide sequence encoding one of the above heterologous moieties, such as albumin. The peptide linker can provide flexibility to the chimeric polypeptide molecule. Although the linker is typically not cleaved, such cleavage may be desirable. In one embodiment, these linkers are not removed during processing.

[0384] One type of linker that can be present in the chimeric proteins of the present disclosure is a protease-cleavable linker that contains a cleavage site (i.e., a protease cleavage site substrate, e.g., Factor XIa, Factor Xa, or thrombin cleavage site) and can include additional linkers at either the N-terminus or C-terminus or both of the cleavage site. These cleavable linkers, when incorporated into constructs of the present disclosure, result in chimeric molecules with heterologous cleavage sites.

[0385] In one embodiment, a FVIII polypeptide encoded by a nucleic acid molecule of the present disclosure comprises two or more Fc domains or Fc moieties linked via a cscFc linker to form an Fc region contained in a single polypeptide chain. The cscFc linker is adjacent to at least one intracellular processing site, i.e., a site that is cleaved by an intracellular enzyme. Cleavage of the polypeptide at the at least one intracellular processing site results in a polypeptide comprising at least two polypeptide chains.

[0386] Other peptide linkers can optionally be used in the constructs of the present disclosure, for example, to connect the FVIII protein to the Fc region. Some exemplary linkers that can be used in the context of the present disclosure include, for example, polypeptides containing a GlySer amino acid, as described in further detail below.

[0387] In one embodiment, the peptide linker is synthetic, i.e., non-naturally occurring. In one embodiment, the peptide linker comprises a peptide (or polypeptide) (which may or may not be naturally occurring) comprising an amino acid sequence linking or genetically fusing a first linear sequence of amino acids to a second linear sequence of amino acids that are not linked or genetically fused in nature. For example, in one embodiment, the peptide linker can comprise a non-naturally occurring polypeptide that is a modified form of a naturally occurring polypeptide (e.g., containing mutations such as additions, substitutions, or deletions). In another embodiment, the peptide linker can comprise non-naturally occurring amino acids. In another embodiment, the peptide linker can comprise naturally occurring amino acids that are present in a linear sequence that is not naturally occurring. In yet another embodiment, the peptide linker can comprise a naturally occurring polypeptide sequence.

[0388] For example, in certain embodiments, a peptide linker can be used to fuse to the same Fc portion, thereby forming a homodimeric scFc region, while in other embodiments, a peptide linker can be used to fuse to different Fc portions (e.g., a wild-type Fc portion and an Fc portion variant), thereby forming a heterodimeric scFc region.

[0389] In another embodiment, the peptide linker comprises or consists of a gly-ser linker. In one embodiment, the scFc or cscFc linker comprises at least a portion of an immunoglobulin hinge and a gly-ser linker. As used herein, the term "gly-ser linker" refers to a peptide consisting of glycine and serine residues. In certain embodiments, the gly-ser linker can be inserted between two other sequences of the peptide linker. In other embodiments, the gly-ser linker is attached to one or both ends of another sequence of the peptide linker. In still other embodiments, two or more gly-ser linkers are incorporated in tandem into the peptide linker. In one embodiment, the peptide linker of the present disclosure comprises at least a portion upstream of the hinge region (e.g., derived from an IgG1, IgG2, IgG3, or IgG4 molecule), at least a portion of the center of the hinge region (e.g., derived from an IgG1, IgG2, IgG3, or IgG4 molecule), and a stretch of gly / ser amino acid residues.

[0390] Peptide linkers of the present disclosure are at least one amino acid long and can vary in length. In one embodiment, peptide linkers of the present disclosure are about 1 to about 50 amino acids long. As used in this context, the term "about" refers to + / - 2 amino acid residues. Linker lengths must be positive integers, so a length of about 1 to about 50 amino acids refers to a length of 1 to 3 to 48 to 52 amino acids. In another embodiment, peptide linkers of the present disclosure are about 10 to about 20 amino acids long. In another embodiment, peptide linkers of the present disclosure are about 15 to about 50 amino acids long. In another embodiment, peptide linkers of the present disclosure are about 20 to about 45 amino acids long. In another embodiment, peptide linkers of the present disclosure are about 15 to about 35 or about 20 to about 30 amino acids long. In another embodiment, the peptide linker of the present disclosure is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1000, or 2000 amino acids in length. In one embodiment, the peptide linker of the present disclosure is 20 or 30 amino acids in length.

[0391] In some embodiments, the peptide linker can comprise at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 amino acids. In other embodiments, the peptide linker can comprise at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 amino acids. In some embodiments, the peptide linker can comprise at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 amino acids. The peptide linker can contain 1 to 5 amino acids, 1 to 10 amino acids, 1 to 20 amino acids, 10 to 50 amino acids, 50 to 100 amino acids, 100 to 200 amino acids, 200 to 300 amino acids, 300 to 400 amino acids, 400 to 500 amino acids, 500 to 600 amino acids, 600 to 700 amino acids, 700 to 800 amino acids, 800 to 900 amino acids, or 900 to 1000 amino acids.

[0392] Peptide linkers can be introduced into polypeptide sequences using techniques known in the art. Modifications can be confirmed by DNA sequence analysis. Plasmid DNA can be used to transform host cells so that the polypeptides produced are stable.

[0393] B.3.m. Monomer-dimer hybrid In some embodiments, the isolated nucleic acid molecule of the present disclosure further comprising a heterologous nucleotide sequence encodes a monomer-dimer hybrid molecule comprising FVIII.

[0394] As used herein, the term "monomer-dimer hybrid" refers to a chimeric protein comprising a first polypeptide chain and a second polypeptide chain associated with each other by disulfide bonds, wherein the first chain comprises Factor VIII and a first Fc region, and the second chain comprises, consists essentially of, or consists of a second Fc region that does not comprise FVIII. Thus, a monomer-dimer hybrid construct is a hybrid that includes a monomeric embodiment having only one coagulation factor and a dimeric embodiment having two Fc regions.

[0395] B.3.n. Expression control elements In some embodiments, the nucleic acid molecule or vector of the present disclosure further comprises at least one expression control sequence. As used herein, an expression control sequence is any regulatory nucleotide sequence, such as a promoter sequence or a promoter-enhancer combination, that promotes the efficient transcription and translation of the encoding nucleic acid to which it is operably linked. For example, the isolated nucleic acid molecule of the present disclosure is operably linked to at least one transcription control sequence.

[0396] The gene expression control sequence may be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter. Mammalian constitutive promoters include, but are not limited to, promoters for the following genes: hypoxanthine phosphoribosyltransferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, and other constitutive promoters. Exemplary viral promoters that function constitutively in eukaryotic cells include, for example, promoters from cytomegalovirus (CMV), simian virus (e.g., SV40), papillomavirus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, Moloney leukemia virus long terminal repeat (LTR), and other retroviruses, as well as the herpes simplex virus thymidine kinase promoter.

[0397] Other constitutive promoters are known to those skilled in the art.The promoters useful as gene expression sequences of the present disclosure also include inducible promoters.Inducible promoters are expressed in the presence of an inducer.For example, metallothionein promoters are induced to promote transcription and translation in the presence of certain metal ions.Other inducible promoters are known to those skilled in the art.

[0398] In one embodiment, the present disclosure includes expressing a transgene under the control of a tissue-specific promoter and / or enhancer. In another embodiment, the promoter or other expression control sequence selectively enhances expression of the transgene in hepatocytes. Examples of liver-specific promoters include, but are not limited to, the mouse thyretin promoter (mTTR), the endogenous human factor VIII promoter (F8), the human alpha-1-antitrypsin promoter (hAAT), the human albumin minimal promoter, and the mouse albumin promoter. In certain embodiments, the promoter comprises the mTTR promoter. The mTTR promoter is described in RH Costa et al., 1986, Mol. Cell. Biol. 6:4697. The F8 promoter is described in Figueiredo and Brownlee, 1995, J. Biol. Chem. 270:11828-11838.

[0399] One or more enhancers can be used to further increase expression levels and achieve therapeutic efficacy. One or more enhancers can be provided alone or together with one or more promoter elements. Typically, expression control sequences include multiple enhancer elements and tissue-specific promoters. In one embodiment, the enhancer includes one or more copies of the α1-microglobulin / bikunin enhancer (Rouet et al., 1992, J. Biol. Chem. 267:20765-20773; Rouet et al., 1995, Nucleic Acids Res. 23:395-404; Rouet et al., 1998, Bioch em. J. 334:577-584; Ill et al., 1997, Blood Coagulation Fibrinolysis 8:S23-S30). In another embodiment, the enhancer is derived from a liver-specific transcription factor binding site such as EBP, DBP, HNF1, HNF3, HNF4, or HNF6, and Enh1 comprises HNF1, (sense)-HNF3, (sense)-HNF4, (antisense)-HNF1, (antisense)-HNF6, (sense)-EBP, (antisense)-HNF4 (antisense).

[0400] In one particular example, a promoter useful for the present disclosure comprises SEQ ID NO: 63 (i.e., the ET promoter), which sequence is also known as GenBank number AY661265. See also Vigna et al., Molecular Therapy 11(5):763 (2005). Examples of other suitable vectors and gene regulatory elements are described in WO02 / 092134, EP1395293, or U.S. Patent Nos. 6,808,905, 7,745,179, or 7,179,903, which are incorporated herein by reference in their entireties.

[0401] In general, expression control sequences will include, as necessary, 5' non-transcribed and 5' non-translated sequences involved in initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, etc. In particular, such 5' non-transcribed sequences include a promoter region containing a promoter sequence for transcriptional control of an operably linked encoding nucleic acid. Gene expression sequences optionally include enhancer sequences or upstream activator sequences, as desired. [Example]

[0402] Recombinant lentiviral vector (LV) preparation The stability of lentiviral vector pharmaceutical products was determined by exposing the vector to various stress conditions (e.g., freezing and thawing (F / T), high temperature (37°C), agitation) and monitoring changes over time. Methods for determining stability included: ddPCR for functional titer, p24 ELISA for p24 concentration, and NanoSight for particle size distribution and particle concentration. Functional titer is a cell-based assay (HEK293) in which LV is incubated with cells to allow integration into the cellular genome, extracted, and DNA is measured by ddPCR. The ELISA-based p24 method is a kit-based method (Invitrogen) that measures the viral capsid protein p24 and correlates it with total particle concentration. NanoSight is a method that uses Brownian motion of particles to assess the size and concentration of LV particles in solution.

[0403] Functional potency is a dose-defining parameter and an important measure. It provides information on whether LV is stable and therefore can incorporate its payload into cells (related to the stability and mechanism of action of the drug). Functional potency is the criterion for dose definition.

[0404] Vector production and measurement VSV-pseudotyped third-generation lentiviral vectors (LVs) were generated by transient four-plasmid cotransfection into HEK293T cells and purified by anion exchange as described in the patent to OXB (U.S. Patent No. 9,169,491 B2). Vector particles were first analyzed for functional titer and HIV-I gag p24 antigen immunocapture (NEN Life Science Products) to ensure proper transfection, production, and purification yields. Concentrated vector expression titers or functional titers ranged from 1 to 10E8 TU / mL transducing units for all vectors. 293T (TU) / ml.

[0405] cell culture Functional titers were measured by transducing adherent HEK293T cells with the lentivector. Cells were split three times and then harvested for genomic DNA isolation. LV integration was measured in genomic DNA by droplet digital PCR (ddPCR) using lentivector-specific primers and probes. HEK293T adherent cells were maintained in Iscove's modified Dulbecco's medium (IMDM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) and a combination of penicillin-streptomycin and glutamine.

[0406] Processing (formulation) of LV into a vehicle After purification, the LV material (drug substance-DS) was pooled and buffer exchanged into the respective formulation buffer using a hollow fiber membrane. The DS was first concentrated approximately 10-fold, followed by exchange into the respective formulation buffer at 6 times the volume of the concentrated DS (e.g., 6 mL of buffer for every 1 mL of concentrated DS). The final formulated LV was considered a drug product (DP) and tested for stability. Figures 7A-7B and 8A-8B show the characterization of the formulation upon reprocessing from the vehicle TSSM (20 mM Tris, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3) to a phosphate vehicle (Formulation 1) (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3). In addition to TSSM, four alternative formulations were tested here: Formulation 2 (Phosphate HigherSalt), 10 mM phosphate, 130 mM NaCl, 1% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3; Formulation 3 (Histidine), 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5; Formulation 4 (Phosphate pH 7.0), 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.0; and Formulation 5 (Histidine pH 7.0). 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.0. [Example]

[0407] In vivo administration of lentiviral vector (LV) preparations Five-week-old CD-1 and C57BL6 mice were purchased from Charles River Laboratories and maintained under specific pathogen-free conditions. Six male HemA mice were obtained from our colony housed at Charles River. Mice were administered vector plus vehicle or vehicle alone via tail or temporal vein injection. All animal procedures were performed in accordance with a protocol approved by the Bioverativ / Sanofi IACUC (Animal Protocol 547). Three formulations were tested: (1) 20 mM Tris, 100 mM NaCl, 1% (w / v) sucrose, 1% (w / v) mannitol, pH 7.3 (TSSM); (2) 10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3 (phosphate); and (3) 20 mM histidine, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 6.5 (histidine) (Table 4).

[0408] [Table 4]

[0409] Formulations: Vehicle (TSSM) only and vehicle with LV (TSSM) A dose-response study of LV-coFIX was conducted in adult C57BL6 and CD-1 mice after a single intravenous administration. Eleven male C57BL6 mice (5 weeks old) and eleven male CD-1 mice (5 weeks old) were used. The doses administered were as follows: 6E10 (n=3), 2E10 (n=4), and 7.5E9 (n=4) TU / kg. TSSM buffer was used as the formulation vehicle.

[0410] C57BL6 and CD-1 mice were administered the LV-FIX vector formulated in TSSM buffer. The 6E10 TU / kg dose was administered undiluted at 13.3–15 ml / kg. The other two lower doses were diluted in PBS before administration. Three mice of each strain were administered the high dose. One C57BL6 mouse died of cardiac arrest immediately after injection of the 6E10 TU / kg dose. Other mice in this group developed adverse effects approximately 30 minutes later. Excessive grooming was followed by coarse fur, lethargy, and inactivity. These mice appeared to recover several hours after injection. Only mice in the high-dose (6E10 TU / kg) group showed adverse effects. Mice receiving the diluted doses showed no adverse effects. Two CD-1 mice and two C57BL6 mice were then administered 10–15 ml / kg of TSSM vehicle formulation buffer alone. These mice also exhibited adverse effects after injection (excessive grooming followed by rough fur, lethargy, and inactivity) but normalized approximately 1 hour later. The results are summarized in Table 4.

[0411] Formulation: Vehicle (phosphate) only A dose-response study was conducted using HemA mice. Three male HemA mice (9 weeks old) were used. The administered dose was 15 ml / kg. The formulation vehicle was phosphate buffer.

[0412] To test for in vivo adverse effects, three HemA mice were administered 15 ml / kg of phosphate formulation buffer. The mice were closely observed over the next two days. No adverse effects were observed with TSSM formulation buffer, including excessive grooming, coarse fur, lethargy, and inactivity.

[0413] Formulation: Vehicle (phosphate) with LV A dose-response study using LV-coFVIII-6XTEN was conducted in HemA pups via temporal vein injection. Twenty-two male and female HemA pups (2 days old) were used. The doses administered were as follows: 3E9 and 1.5E9 TU / kg. The formulation vehicle was phosphate buffer.

[0414] Two-day-old mice were administered LV-FVIIIXTEN formulated in phosphate buffer at 3E9 or 1.5E9 TU / kg via temporal vein injection. The higher dose (3E9) was administered undiluted. No adverse effects were observed after injection in these mice.

[0415] Formulation: Vehicle (histidine) only A dose-response study was performed using HemA mice. Three male HemA mice (19 weeks old) were used. The administered dose was 15 ml / kg. The formulation vehicle was histidine buffer.

[0416] To test for in vivo adverse effects, three HemA mice were administered 15 ml / kg of histidine formulation buffer. The mice were closely observed over the next two days. No adverse effects were observed with TSSM formulation buffer, including excessive grooming, coarse fur, lethargy, and inactivity.

[0417] Formulation: Vehicle (histidine) with LV A dose-response study using LV-coFVIII-6XTEN was conducted in tolerized adult HemA mice via tail vein injection. Four male HF8 mice (12 weeks old) were used. The administered dose was 15 ml / kg. The formulation vehicle was histidine buffer.

[0418] Four tolerized HemA mice (HF8) received 15 ml / kg of LV-FVIIIXTEN vector formulated in histidine formulation buffer. Adverse effects observed with the TSSM formulation, including excessive grooming, coarse coat, lethargy, and inactivity, were not observed.

[0419] In summary, for each formulation, mice were injected with either vector plus vehicle or vehicle alone. Table 4 shows that TSSM injection caused adverse toxic effects in mice, including one death, with both vector plus vehicle and vehicle alone. In contrast, the phosphate and histidine formulations did not cause any reactions (toxic effects) in mice, either with vector plus vehicle or vehicle alone. [Example]

[0420] Testing of formulations using the vehicle TSSM Agitation, freeze-thaw, and temperature conditions The stability of TSSM formulations (vector + vehicle) with or without the addition of 1% (w / v) P188 at a final concentration of 1% (w / v) P188 was tested by subjecting the formulations to agitation, freeze-thaw (F / T) cycles (5 and 10 times), and 6 hours of room temperature incubation (Figures 3A-B, 4, 5A-B, Table 5). Vector stability was measured by determining functional titer, p24 concentration, and particle size and distribution (NanoSight). As shown in Figures 3A-B, 4, 5A-B, and Table 5, no significant changes in vector stability were observed under various conditions for formulations in the presence and absence of P188. Vector integrity was determined by particle size measurements using NanoSight.

[0421] [Table 5]

[0422] Dilution conditions TSSM formulations (vector + vehicle) were diluted 1x, 20x, and 100x, incubated at 37°C, and stability was determined by measuring functional titer via ddPCR on days 0, 3, 7, and 14. Figures 6A and 6B show that dilution did not affect stability over two weeks at elevated temperature.

[0423] Incubation for various periods TSSM formulations (vector + vehicle) were incubated at 37°C for 0, 3, 7, or 14 days. Stability was measured by determining functional titer via ddPCR, while particle integrity (particle concentration) was measured using Nanosight or p24 ELISA. Stability and vector integrity (particle concentration) were assessed as a function of incubation time, as shown in Figures 7A-7B and 8A-8B. Vector stability decreased with longer incubation times, while particle concentration increased.

[0424] Long-term incubation at 37°C TSSM formulations (vector + vehicle) were incubated at 37°C for 0 days, 3 days, 1 week, or 2 weeks. Particle size distribution was measured using a Nanosight microscope. As shown in Figures 7A-7B and 8A-8B, longer incubation times resulted in a broader particle size distribution, while particle concentration increased. These results can be explained as follows: Infectivity decreased with increasing total particle concentration because prolonged exposure to 37°C caused capsid disruption, resulting in an increase in apparent p24 as measured by ELISA. Furthermore, viral disruption also led to an increase in smaller-sized species. [Example]

[0425] Testing formulations using phosphate vehicles and histidine Phosphate preparations Lentiviral vector (LV) formulations were characterized after processing in a phosphate vehicle (10 mM phosphate, 100 mM NaCl, 3% (w / v) sucrose, 0.05% (w / v) P188, pH 7.3). Particle size and distribution were measured using a Nanosight™ microscope (Figure 1). Figure 1 shows a plot of the Nanosight™ results, showing a clear monomeric peak in the bulk drug substance (DS) pool, which shifts somewhat toward larger particle sizes after UF / DF (after tangential flow filtration - TFF) into the final vehicle buffer, with the presence of a smaller fraction of larger particles. Without being bound by theory, this may be due to physical degradation of particles during the stress of processing the material. Upon filtration of the final drug product (DP) through a 0.22 μm filter membrane, the particle size and particle distribution profile revert to match the DS pool at the start of processing. The TFF stress is depicted graphically in Figures 2A-B.

[0426] For phosphate formulations (vector + vehicle), vector stability was tested under various conditions, including agitation, incubation at 37°C, duration, and dilution (Figures 9 and 10A-10B).

[0427] Figures 10A-10B show NanoSight size data for phosphate buffer over a one-week period at 37°C. There is a slight increase in higher molecular weight species with incubation time, along with an overall decrease in total particle number. This data suggests that the loss in functional titer shown in Figure 9 over the course of stability at RT or 37°C may correspond to the physical loss of particles observed in Figures 10A-10B.

[0428] A simulated practical study was conducted to determine the stability of the phosphate formulation during a typical infusion scenario during clinical administration. LVV material was diluted with phosphate vehicle and infused into an empty IV bag. Data were collected over 6 hours at room temperature, Figure 13. The stability study showed no signs of loss of functional titer or p24, indicating that the vector was stable over the study period.

[0429] To examine compatibility with anticipated container closure systems, studies were conducted to examine the stability of vector and phosphate vehicle in Schott Type 1 glass vials and West CZ COP vials (Figures 14, 15, and 16A-16C). The data show that neither Type 1 nor CZ vials produced significant particles when treated with the vehicle alone (Figure 14). To determine the strain on the vials during freezing and thawing, strain gauges were adhesively attached to glass vials and placed in a -80°C freezer for 2 hours, followed by rapid warming in a 37°C water bath (Figure 15). This test showed no measurable distortion in the vials, suggesting that the phosphate formulation did not impose high levels of stress on the container at this relatively large fill volume of 5 mL, which has been shown in the literature to damage certain vials. The LVV materials were also examined for compatibility with each container, as shown in Figures 16A-16C. Comparative stability and integrity of the vectors was observed across transduction titer (Figure 16A), p24 (Figure 16B), and particle concentration (Figure 16C) studies, demonstrating compatibility with both glass and plastic vial container closure formats.

[0430] Comparison of phosphate and histidine preparations The phosphate formulations (Formulations 1 and 2) and histidine formulation (Formulation 3) (vector + vehicle) were examined for vector stability under various stress conditions (Figures 11A-11B, 12A-12B). In freeze-thaw cycling tests, both phosphate formulations exhibited a decrease in functional titer with repeated cycles. In contrast, the histidine formulation remained stable without any functional loss. Under stress conditions of room temperature and agitation, the phosphate formulation exhibited a high level of functional loss (down to the limit of quantification). Surprisingly, the histidine formulation remained unaffected by both 3-day incubation at room temperature and 3-day agitation. Furthermore, the addition of sodium chloride and the reduction of sucrose to the phosphate formulation (Formulations 1 and 2) did not affect vector stability.

[0431] The stability studies in Figures 11A-11B were repeated in another preparation of material and reported in Figure 17. The loss of functional potency was less severe than with the phosphate formulation, but the trend was consistent between the histidine and phosphate formulations.

[0432] In frozen (-80°C) stability studies over the course of 9 months, both phosphate formulation 1 and histidine formulation 3 buffers appeared to allow for stable LVV DP, Figure 18. Based on functional potency, the data suggest that, within assay variability, there was no loss of material over storage at -80°C.

[0433] Finally, to evaluate the effect of buffer only (phosphate and histidine), two formulations were prepared identically at the same pH of 7.0; that is, the only difference between formulations 4 and 5 is the buffer component (either phosphate or histidine). In the context of the manufacturing process, the two formulations appear to behave similarly through ultrafiltration and diafiltration (TFF) and final sterile filtration, Table 6.

[0434] [Table 6]

[0435] After each formulation was prepared, stability studies were performed to compare buffer components. Figures 19A-19D summarize the findings that there were only minor differences between the LVV stability of either formulation as a function of stability criteria across functional and normalized functional titers, p24, and particle concentrations. This suggests that the results presented in Figures 11A-11B, 12A-12B, and 13 likely reflect the varying levels of stability due to differences in pH (7.3 and 6.5) rather than buffer composition (phosphate or histidine).

Claims

1. A recombinant lentiviral particle preparation for systemic administration to a human patient, comprising: (a) a therapeutically effective dose of recombinant lentiviral particles; (b) a TRIS-free buffer system containing a phosphate buffer; (c) salt; (d) surfactants including poloxamer 188 (P188); and (e) carbohydrates The recombinant lentiviral particle preparation comprising:

2. 2. The recombinant lentiviral particle preparation of claim 1, wherein the pH of the buffer system or preparation is 6.0-8.0, 6.0-7.5, 6.0-7.0, or 6.5, or 7.0-8.0, or 7.

3.

3. The recombinant lentiviral particle preparation according to claim 1 or 2, wherein the recombinant lentiviral particle comprises a nucleotide sequence encoding VSV-G or a fragment thereof.

4. A recombinant lentiviral particle preparation described in any one of claims 1 to 3, wherein the concentration of the phosphate buffer is 5 mM to 30 mM, 10 mM to 20 mM, 10 mM to 15 mM, 20 mM to 30 mM, 20 mM to 25 mM, or 15 mM to 20 mM.

5. The concentration of the salt is 80 mM to 150 mM, or 100 mM, 110 mM, 130 mM, or 150 mM; the salt is a chloride salt; and / or the salt is NaCl. The recombinant lentiviral particle preparation according to any one of claims 1 to 4.

6. The recombinant lentiviral particle preparation according to any one of claims 1 to 5, wherein the concentration of the surfactant is 0.01% (w / v) to 0.1% (w / v), 0.03% (w / v), 0.05% (w / v), 0.07% (w / v), or 0.09% (w / v).

7. 7. The recombinant lentiviral particle preparation of any one of claims 1 to 6, wherein the concentration of the carbohydrate is in the range of 0.5% (w / v) to 5% (w / v), or is 1% (w / v), 2% (w / v), 3% (w / v), or 4% (w / v); and the carbohydrate is sucrose.

8. The following: (a) a therapeutically effective dose of recombinant lentiviral particles; (b) 10 mM phosphate; (c) 100 mM sodium chloride or 130 mM sodium chloride; (d) 0.05% (w / v) poloxamer 188; and (e) 3% (w / v) sucrose wherein the pH of the preparation is 7.3, and wherein the preparation is suitable for systemic administration to a human patient.

9. The following: (a) a therapeutically effective dose of recombinant lentiviral particles; (b) 10 mM phosphate; (c) 100 mM sodium chloride; (d) 0.05% (w / v) poloxamer 188; and (e) 3% (w / v) sucrose wherein the pH of the preparation is 7.0, and wherein the preparation is suitable for systemic administration to a human patient.

10. The recombinant lentiviral particle comprises a nucleic acid comprising a nucleotide sequence that is at least 90%, at least 95%, at least 99%, or 100% identical to the Factor VIII (FVIII) coding sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; or 10. The recombinant lentiviral particle preparation of any one of claims 1 to 9, wherein the recombinant lentiviral particle comprises a nucleic acid comprising a nucleotide sequence that is at least 90%, at least 95%, at least 99%, or 100% identical to the Factor IX (FIX) coding sequence set forth in SEQ ID NO:

3.

11. Recombinant lentiviral particles an enhanced transthyretin (ET) promoter; and / or The recombinant lentiviral particle preparation according to any one of claims 1 to 10, comprising a nucleotide sequence that is at least 90% identical to the target sequence of miR-142 shown in SEQ ID NO:

7.

12. The recombinant lentiviral particle preparation of any one of claims 1 to 11, wherein the recombinant lentiviral particles are isolated from transfected host cells selected from the following group: CHO cells, HEK293 cells, BHK21 cells, PER.C6 cells, NSO cells, CAP cells, and combinations thereof; and the host cells are CD47-positive host cells.

13. Use of a recombinant lentiviral particle preparation according to any one of claims 1 to 12 in the manufacture of a medicament for treating a human patient with a disorder, comprising: The use, wherein the recombinant lentiviral particle preparation is in a form for systemic and / or intravenous administration to a human patient having a disorder; the disorder is a bleeding disorder; and the disorder is hemophilia A or hemophilia B.

14. The recombinant lentiviral particle preparation according to any one of claims 1 to 7, wherein systemic administration of said recombinant lentiviral particle preparation to a patient exhibits reduced in vivo toxicity compared to a recombinant lentiviral particle preparation comprising a TRIS buffer.

Citation Information

Patent Citations

  • Recombinant lentiviral vector formulation

    EP2829285A1

  • VCN enhancer compositions and methods of using the same

    WO2017139576A1