A novel compound that induces the expression of the anti-aging gene klotho

Abstract

The present invention relates to a novel compound that induces the expression of the anti-aging gene klotho. The compound according to the present invention is not only excellent in the effect of increasing the expression level of the klotho gene, which is an aging-related gene, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), and therefore can be usefully used as a pharmaceutical composition for preventing or treating macular degeneration, or a functional health food composition.

Description

Detailed Description of the Invention

[0001] [Technical field] This application claims priority from Korean Patent Application No. 10-2022-0035142, filed on March 22, 2023, the entire specification of which is incorporated herein by reference.

[0002] The present invention relates to novel compounds that induce the expression of the anti-aging gene klotho. [Background technology] The possibility of genes that can regulate aging in animals was first discovered in 1981 with the discovery of senescence-accelerated mice (SAM). These rats, created by chance during the crossbreeding of AKR / J rats, aged much faster than rats of the same lineage. It was confirmed that these rats carried mutations in multiple genes. The discovery of a group of aging-related genes was subsequently reported in the 1990s. These genes were genes in the RecQ family that express enzymes called DNA helicases. Mutations in these genes have been reported to result in premature aging and cancer, which was found to occur by affecting DNA repair. The klotho gene, reported in 1997, is a single gene associated with aging. The klotho gene was discovered by chance while creating a transgenic animal model of hypertensive rats. Rats that lost expression of this gene exhibited premature aging and a shortened lifespan. An even more interesting fact is that rats in which the expression of this gene was later increased showed a 20.0-30.8% increase in lifespan for males and an 18.8-19.0% increase in lifespan for females. This was the first time that the world was made aware of the fact that the expression of a single gene may increase or decrease a rat's lifespan. It was also reported that the base sequence of the Klotho gene is very similar between animals, with approximately 98% identity between rats and humans. This indicates that lifespan can also be controlled by the expression of the Klotho gene in humans.

[0003] In humans, the klotho gene is located on chromosome 13 and produces a membrane protein with a nucleotide sequence similar to that of β-glucosidase. Klotho protein is primarily expressed in ureteral epithelial cells in the kidney and choroidal canaliculi in the brain, and has been reported to be expressed in some parathyroid glands. Klotho is involved in various aging phenotypes, and klotho-deficient rats exhibit symptoms similar to those of aging, including reduced lifespan, decreased activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. Klotho mutant rats exhibit atherosclerosis in all arteries, from the aorta to the small arteries, similar to the Monckeberg-type arteriosclerosis caused by aging in humans, and exhibit impaired angiogenesis and vasculogenesis.

[0004] Klotho mRNA expression is significantly higher in kidney tissue than in other tissues, but is reduced in the kidneys of disease model rats with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure. Klotho-deficient rats exhibit reduced production of nitric oxide (NO), a vascular endothelium-derived relaxing factor. Viral gene transfer of the klotho gene into Otsuka Long-Evans Tokushima fatty rats (OLETF) with numerous cardiovascular risk factors improves vascular intimal dysfunction, increases NO production, suppresses vascular thickening and fibrosis, and lowers blood pressure. Furthermore, the Klotho gene also affects glucose and insulin metabolism in rats, and statins, a well-known antihypercholesterolemia drug, increase Klotho mRNA expression in renal myotubular cells. Klotho-deficient rats develop osteopenia, a hyposkeletal condition due to impaired differentiation of both osteoblasts and osteoclasts. Furthermore, Klotho mutant rats exhibited abnormal kidneys and abnormal bone histology in the epiphyseal region on micro-CT scans, which is attributed to impaired bone resorption. Klotho gene mutations in humans result in a variety of clinical phenotypes. The KL-VS (functional variant of klotho) modification, which contains three mutations in exon 2 of the Klotho gene, is associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease. Microsatellite polymorphisms and single-nucleotide polymorphisms in the Klotho gene have also been associated with bone mineral density. It has also been reported that single-nucleotide polymorphisms in the Klotho gene are associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, several papers have reported an association between the Klotho gene and Alzheimer's disease. Overexpression of Klotho in a rat model of Alzheimer's dementia increased lifespan by 30% and suppressed cognitive decline. Furthermore, it was observed that klotho expression reduced the production of amyloid beta protein in the brain by 50%.In humans, Klotho expression levels are inversely correlated with the progression of Alzheimer's disease, and Klotho protein has been reported to reduce the levels of inflammatory cytokines in the blood of Alzheimer's patients. Several studies have also shown that Klotho promotes retinal pigment epithelial (RPE) function and protects RPE cells from oxidative stress. Retinas from Klotho-deleted (KL- / -) rats exhibited photoreceptor degeneration and reduced pigment production in RPE cells. Klotho expression was also confirmed in cultured RPE cells, and experiments demonstrated that the expressed Klotho protein increased L-3,4-dihydroxyphenylalanine (L-DOPA) synthesis and inhibited vascular endothelial growth factor (VEGF) production from the basement membrane. Furthermore, research has demonstrated that Klotho reduces reactive oxygen species (ROS) production in RPE cells, protecting RPE cells from oxidative stress. Experiments on patients with age-related macular degeneration (AMD) showed that klotho expression in the ocular retinal fluid was reduced, and this reduction was associated with oxidative stress and inflammation.

[0005] As a result of continuous research into compounds that induce klotho expression, the inventors have experimentally confirmed that the novel compounds they have developed are highly stable and have excellent protective effects against oxidative stress (oxidative toxicity) in retinal pigment epithelial cells (RPE), thereby completing the present invention.

[0006] [Summary of the Invention] [Problem to be solved by the invention] An object of the present invention is to provide novel compounds represented by Chemical Formula 1 and pharmaceutically acceptable salts thereof.

[0007] However, the technical problems that the present invention aims to achieve are not limited to the above problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description. [Means for solving the problem] In order to achieve the above object, the present invention provides a compound represented by the following chemical formula 1, or a pharmaceutically acceptable salt thereof:

[0008] [ka]

[0009] In the above chemical formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched chain alkyl R3 and R4 can each be -H or halogen.

[0010] In a preferred embodiment of the present invention, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0011] [ka]

[0012] In the above chemical formula 1-1, R1 and R2 are each -H, halogen, or C 1-6 It may be a straight or branched chain alkyl. In another preferred embodiment of the present invention, the compound represented by the above chemical formula 1-1 is A compound represented by the following chemical formula 1-1A:

[0013] [ka]

[0014] A compound represented by the following chemical formula (1-1B):

[0015] [ka]

[0016] A compound represented by the following chemical formula 1-1C:

[0017] [ka]

[0018] A compound represented by the following chemical formula 1-1D:

[0019] [ka] It may be any one or more selected from the group consisting of: In another preferred embodiment of the present invention, the compound is capable of increasing the expression of the Klotho gene.

[0020] In another preferred embodiment of the present invention, the compound is capable of protecting retinal pigment epithelial cells from oxidative stress. [Effects of the invention] The compound according to the present invention not only has an excellent effect of increasing the expression level of the Klotho gene, which is a gene related to aging, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), and can therefore be usefully used as a pharmaceutical composition for preventing or treating macular degeneration, or as a functional health food composition. [Brief explanation of the drawings]

[0021] [Figure 1] FIG. 1 shows the results of MS / MS analysis of the stability of the KS compounds according to Example 1 of the present invention: KS101 (compound of formula 1-1A), KS102 (compound of formula 1-1B), KS103 (compound of formula 1-1C), and KS104 (compound of formula 1-1D). [Figure 2a] FIG. 2 shows the results of PCR confirmation of the expression level of the klotho gene by the KS compound according to Example 1 of the present invention. [Figure 2b]FIG. 2 shows the results of PCR confirmation of the expression level of the klotho gene by the KS compound according to Example 1 of the present invention. [Figure 3] FIG. 3 shows the results of confirming the cytotoxicity of the KS compound according to Example 1 of the present invention. [Figure 4] FIG. 4 shows the results of examining the change in the amount of reactive oxygen species (ROS) in the cells after treating renal tubular epithelial cells (RPTEC) with the KS compound of Example 1 of the present invention. [Figure 5] FIG. 5 shows the results of confirming changes in the expression of oxidative stress-related genes caused by the KS compound of Example 1 of the present invention. [Figure 6] FIG. 6 shows the results of confirming changes in the expression of oxidative stress-related genes caused by the KS compound of Example 1 of the present invention. [Figure 7] FIG. 7 shows the results of confirming the cell protective effect of the KS compound of Example 1 of the present invention against oxidative stress. DETAILED DESCRIPTION OF THE INVENTION

[0022] The present invention will be described in detail below. Compounds that induce expression of the anti-aging gene klotho The present invention relates to a compound represented by the following chemical formula (1), or a pharmaceutically acceptable salt thereof:

[0023] [ka]

[0024] (In the above chemical formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched chain alkyl R3 and R4 can each be -H, or halogen).

[0025] Preferably, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0026] [ka]

[0027] (In the above chemical formula 1-1, R1 and R2 are each -H, halogen, or C 1-6 (which may be a straight or branched chain alkyl). More preferably, the compound represented by the above chemical formula (1-1) is A compound represented by the following chemical formula 1-1A:

[0028] [ka]

[0029] A compound represented by the following chemical formula (1-1B):

[0030] [ka]

[0031] A compound represented by the following chemical formula 1-1C:

[0032] [ka]

[0033] A compound represented by the following chemical formula 1-1D:

[0034] [ka]

[0035] It may be any one or more selected from the group consisting of: The compounds of the present invention can be used in the form of pharmaceutically acceptable salts, and useful salts include acid addition salts formed with pharmaceutically acceptable free acids. The term "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of the base compound of Formula 1 that is relatively non-toxic and harmless to patients, and whose side effects do not diminish the beneficial effects of the base compound of Formula 1. These salts can be made with inorganic or organic acids, including hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, and phosphoric acid, and organic acids such as citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, glyconic acid, succinic acid, tataric acid, glucuronic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethynyl 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, and malonic acid. These salts also include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salts (calcium salt, magnesium salt, etc.), etc. For example, acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hybenzeate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malonate, mesylate, methylsulfate, naphthylate, 2- These may include napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, potassium, sodium, tromethamine, zinc salts, and the like, of which the hydrochloride or trifluoroacetate is preferred.

[0036] Furthermore, the compounds of the present invention include not only pharmaceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods. The addition salts according to the present invention can be prepared by a conventional method, for example, by dissolving the compound in a water-miscible organic solvent such as acetone, methanol, ethanol, acetonitrile, etc. and adding an excess of an organic acid thereto, or by adding an aqueous solution of an inorganic acid thereto, followed by precipitation and crystallization. The solvent or excess acid is then evaporated from the mixture, and the mixture is dried to obtain the addition salt, or the precipitated salt can be filtered off under suction.

[0037] The compounds of the present invention can increase the expression of the Klotho gene. Furthermore, oxidative stress experiments using retinal pigment epithelium confirmed that the compound exhibits the effect of protecting cells from oxidative stress, indicating that the compound of the present invention can be useful as a preventive or therapeutic agent for macular degeneration.

[0038] Pharmaceutical composition for preventing or treating macular degeneration In another aspect, the present invention relates to a pharmaceutical composition for preventing or treating macular degeneration, comprising, as an active ingredient, a compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof:

[0039] [ka]

[0040] (In the above chemical formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched chain alkyl R3 and R4 can each be -H, or halogen).

[0041] Preferably, the compound represented by Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0042] [ka]

[0043] (In the above chemical formula 1-1, R1 and R2 are each -H, halogen, or C 1-6 (which may be a straight or branched chain alkyl). More preferably, the compound represented by the above chemical formula (1-1) is A compound represented by the following chemical formula 1-1A:

[0044] [ka]

[0045] A compound represented by the following chemical formula (1-1B):

[0046] [ka]

[0047] A compound represented by the following chemical formula 1-1C:

[0048] [ka]

[0049] A compound represented by the following chemical formula 1-1D:

[0050] [ka] It may be any one or more selected from the group consisting of: The macular degeneration may be age-related macular degeneration. The composition of the present invention can increase the expression level of the Klotho gene.

[0051] Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress. The compound of the present invention can be administered in various oral and parenteral formulations at the time of clinical administration, and when formulated, they are produced using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0052] Solid formulations for oral administration include tablets, tablets, powders, granules, capsules, and lozenges. They are prepared by mixing sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, liquids, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavorings, and preservatives may be used.

[0053] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions that can be used include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases that can be used include witepsol, macrogol, Tween 61, cocoa powder, laurin, glycerol, and gelatin.

[0054] Furthermore, the effective dosage of the compound of the present invention for the human body varies depending on the patient's age, weight, sex, dosage form, health condition, and severity of the disease, but is generally about 0.001 to 100 mg / kg / day, preferably 0.01 to 35 mg / kg / day. For an adult patient weighing 70 kg, the dosage is generally 0.07 to 7000 mg / day, preferably 0.7 to 2500 mg / day, and can be administered once or several times a day at regular intervals according to the judgment of a physician or pharmacist.

[0055] Food composition for preventing or improving macular degeneration From another aspect, the present invention relates to a food composition or a health functional food composition for preventing or improving macular degeneration, which comprises the compound represented by the above chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0056] The composition of the present invention can increase the expression level of the Klotho gene. Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.

[0057] The macular degeneration may be age-related macular degeneration. There are no particular limitations on the type of food, and examples of foods to which the active substance of the present invention can be added include energy drinks, meat, sausages, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, drinking water, alcoholic beverages, vitamin complexes, dairy products, and dairy products, etc., including all health foods and health functional foods in the usual sense.

[0058] The health food and functional health food compositions containing the active substance according to the present invention can be added directly to food or used in combination with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of the active substance to be added can be determined appropriately depending on the intended use (prevention or improvement). Generally, the amount of the composition in a food or functional health food can be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food (based on a total of 100 parts by weight). However, in the case of long-term intake for the purpose of maintaining or regulating health, the amount may be less than the above range, and since there is no safety issue, the active substance can be used in an amount greater than the above range.

[0059] The food and health functional food compositions of the present invention contain the active substance of the present invention as an essential ingredient in the indicated ratio, but other ingredients are not particularly limited. They may contain various flavorings or natural carbohydrates as additional ingredients in addition to ordinary beverages. Examples of the natural carbohydrates mentioned above include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. Other flavorings that can be advantageously used include natural flavorings (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin), and synthetic flavorings (saccharin, aspartame, etc.). The proportion of the natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the health functional food composition of the present invention.

[0060] In addition to the above, the health food and health functional food compositions containing the active substances of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, the health food and health functional food compositions of the present invention may contain fruit pulp for producing natural fruit juices and fruit juice drinks and vegetable drinks.

[0061] These ingredients can be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the active substance of the present invention.

[0062] The present invention will be described in more detail below with reference to the following examples, but the following examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0063] Example 1. Compound synthesis 1-1: Synthesis of KS101 compound Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) Under an Ar atmosphere, 2-aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL), and then 3,4-difluorophenyl isothiocyanate (224 μL, 1.65 mmol) was slowly added. The mixture was stirred at room temperature for 13 hours. After confirming the completion of the reaction by thin-layer chromatography (TLC), the methanol was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% acetone / n-hexane) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) as a pale yellow solid (354 mg, 92%).

[0064] 1 H-NMR (400MHz, MeOH-d4) δ 7.62 (d, J = 8.0 Hz, 1H), 7.55 (ddd, J= 2.4 Hz, 1H), 7.25-7.13 (m, 2H), 7.11-7.05 (m, 1H), 6.92-6.82 (m, 2H); ESI-(+) 281.3 [M+H] + .

[0065] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) Under an Ar gas atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) obtained in step 1 above and potassium superoxide (KO2) (284 mg, 4.00 mmol) were dissolved in acetonitrile (MeCN) (25 mL) and stirred at room temperature for 14 h. After confirming the completion of the reaction by thin-layer chromatography (TLC), the acetonitrile (MeCN) was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10–20% ethyl acetate / n-hexane) to obtain the target compound, N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025), as a white solid (160 mg, 82%).

[0066] [ka]

[0067] 1 H-NMR (400MHz, MeOH-d4) δ 7.82 (ddd, J= 2.8 Hz, 1H), 7.42 (d, ■ ESI-(+) 247.2 [M+H] + .

[0068] 1-2: Synthesis of KS102 compound 2-Aminophenol (1.0 equiv.) and 3,4-difluorophenyl isothiocyanate (1.2 equiv.) were mixed in THF (2 mL / mmol) and stirred at room temperature. After stirring for 3 hours, ferric chloride (FeCl3·6H2O) was added to the solution, and the reaction mixture was stirred at 90 °C for 12 hours. The reaction mixture was cooled to room temperature and extracted with ethyl acetate (EtOAc). The combined organic layer was treated with magnesium sulfate (MgSO 4) The residue was dried over 1000 kJ / h and concentrated in vacuo. 2) Trituration with HCl, filtration and washing with dichloromethane gave the desired product (3,4-difluorophenyl isothiocyanate) as a solid.

[0069] Next, 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) and 2-amino-4-fluorophenol (130 mg, 1.02 mmol) were reacted to obtain the KS102 compound (N-(3,4-difluorophenyl)-5-fluorobenzo[d]oxazol-2-amine) represented by the following chemical formula 1-1B as a light brown solid (195 mg, 72%).

[0070] [ka]

[0071] mp 222.9-223.9℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.15 min (purity: 99.7%); 1H-NMR (DMSO-d6, 800 MHz) δ 6.97 (ddd, J = 9.8, 8.7, 2.6 Hz, 1H), 7.36 (dd, J = 9.0, 2.6 Hz, 1H), 7.43-7.48 (m, 2H), 7.52 (dd, J = 8.7, 4.4 Hz, 1H), 7.91 (ddd, J = 12.8, 7.1, 2.3 Hz, 1H), 11.0 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 159.4 (J CF = 234.9 Hz), 159.1, 149.2 (J CF = 241.9, 13.0 Hz), 144.7 (J CF = 239.0, 12.4 Hz), 143.4, 143.2 (J CF = 13.7 Hz), 135.5 (J CF = 9.2, 2.2 Hz), 117.8 (J CF = 17.9 Hz), 114.1 (J CF = 5.8, 3.1 Hz), 109.5 (J CF = 10.3 Hz), 108.5 (J CF = 25.6 Hz), 106.7 (J CF = 22.1 Hz), 103.9 (J CF = 26.3 Hz) ppm, LR-MS (FAB) m / z 265 (M+H) + HR-MS (FAB) calcd for C 13 H8F3N2O (M+H) + 265.0589, found 265.0588.

[0072] 1-3: Synthesis of KS103 compound The KS103 compound (N-(3,4-difluorophenyl)-6-fluorobenzo[d]oxazol-2-amine), represented by the following chemical formula 1-1C, was obtained as an ivory solid (203 mg, 75%) by reacting 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) obtained in Example 1-2 above with 2-amino-5-fluorophenol (130 mg, 1.02 mmol).

[0073] [ka]

[0074] mp 231.7-232.6℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.12 min (purity: 98.4%); 1 H-NMR (DMSO-d6, 800 MHz) δ 7.10 (ddd, J = 10.1, 8.6, 2.5 Hz, 1H), 7.42-7.45 (m, 2H), 7.47 (dd, J = 8.6, 4.9 Hz, 1H), 7.54 (dd, J = 8.4, 2.5 Hz, 1H), 7.91 (ddd, J = 12.6, 7.0, 2.1 Hz, 1H), 10.9 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 158.1, 158.0 (J CF = 235.9 Hz), 149.2 (J CF = 241.8, 13.2 Hz), 146.8 (J CF = 15.0 Hz), 144.6 (J CF = 238.8, 12.6 Hz), 138.4. 135.7 (J CF = 7.3 Hz), 117.8 (J CF = 17.9 Hz), 116.8 (J CF= 9.6 Hz), 113.8 (J CF = 5.5, 3.3 Hz), 111.0 (J CF = 23.7 Hz), 106.4 (J CF = 22.1 Hz), 98.0 (J CF = 28.9 Hz) ppm, LR-MS (FAB) m / z 265 (M+H) + ; HR-MS (FAB) calculation for C 13 H8F3N2O (M+H) + 265.0589, found 265.0586.

[0075] 1-4: Synthesis of KS104 compound The KS104 compound (N-(3,4-difluorophenyl)-5,6-difluorobenzo[d]oxazol-2-amine), represented by the following chemical formula 1-1D, was obtained as a bright purple solid (187 mg, 64%) by reacting 3,4-difluorophenyl isothiocyanate (212 mg, 1.24 mmol) obtained in Example 1-2 above with 2-amino-4,5-difluorophenol (150 mg, 1.03 mmol).

[0076] [ka]

[0077] mp 242.1-243.2℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.44 min (purity: 99.1%); 1H-NMR (DMSO-d6, 800 MHz) δ 7.41-7.42 (m, 1H), 7.46 (dd, J = 19.3, 9.0 Hz, 1H), 7.62 (dd, J = 10.5, 7.5 Hz, 1H), 7.83 (dd, J = 9.8, 6.9 Hz, 1H), 7.89 (ddd, J = 13.0, 7.2, 2.5 Hz, 1H), 11.0 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 158.9, 149.2 (J CF = 242.0, 13.1 Hz), 147.3 (J CF = 237.0, 13.7 Hz), 145.5 (J CF = 238.0, 14.7 Hz), 144.8 (J CF = 239.0 (13.5 Hz), 142.1 (J CF = 12.6 Hz), 138.0 (J CF = 11.5, 1.5 Hz), 135.4 (J CF = 13.2, 1.8 Hz), 117.8 (J CF = 17.8 Hz), 114.0 ((J CF = 5.7, 3.1 Hz), 106.6 (J CF = 22.1 Hz), 104.9 (J CF = 21.7 Hz), 99.5 (J CF = 24.1 Hz) ppm, LR-MS (FAB) m / z 283 (M+H) + ; HR-MS (FAB) calculation for C 13 H7F4N2O (M+H) + 283.0495, found 283.0505.

[0078] Experimental Example 1: Evaluation of compound stability Each KS compound in Example 1 was dissolved in 10 mM DMSO before use, and tolbutamide used as a standard substance was dissolved in methanol at a concentration of 10 mM before use.

[0079] A glass test tube (13 × 100 mm) was filled with 0.1 M KH2PO4 (147.5 μl), 0.1 M MgCl2 (25 μl), and 50 μl of 0.5 mg / mL human liver microsomes (mixed-gender pool) purchased from Corning Life Sciences. Each KS compound solution was mixed to a final concentration of 1 μM. The mixture was pre-incubated in a shaking water bath (37°C, 40 rpm) for 3 minutes, and then incubated for 30 minutes with or without the addition of 25 μl of 10 mM NADPH.

[0080] Before and after the reaction, 50 μl samples were taken, and 2 mL of acetonitrile was added to stop the reaction. The mixture was then vortexed for 1 minute. The mixture was centrifuged for 20 minutes (4,000 rpm, 4°C), and each supernatant was transferred to a new glass test tube and dried for 2 hours using a centrifugal concentrator. After confirming complete drying, 200 μl of 40% acetonitrile was added to each glass test tube and vortexed for 1 minute to resuspend the sample. The resuspended solution was centrifuged for 10 minutes (4,000 rpm, 4°C), and 150 μl of the supernatant was taken and used for HPLC-UV analysis. HPLC-UV analysis was performed using an Agilent 1200 series column, and MS / MS analysis was performed using an Agilent 6410 column. The analytical conditions were as follows:

[0081] [Table 1]

[0082] [Table 2]

[0083] Figure 1 shows the quantitative confirmation of KS compounds incubated with human liver microsomes by MS / MS analysis. Because microsomal enzymes depend on the coenzyme NADPH(+) to function, compound metabolism occurred only in the presence of NADPH(+). KS compounds exhibited higher stability than tolbutamide, which was used as a control, and KS104 in particular demonstrated the best microsomal stability.

[0084] Experimental Example 2: Comparison of Klotho gene expression effects Each KS compound in Example 1 was applied to human renal proximal tubular epithelial cells (RPTEC) at different concentrations. After 6 hours, mRNA was collected from the cells, and klotho mRNA expression was confirmed by PCR. Renal proximal tubular epithelial cells (RPTEC) were purchased from Lonza and cultured at 37°C and 5% CO2 for use in the experiment. After 6 hours of exposure to each KS compound in the cell culture medium, RNA was isolated from the cells and converted to cDNA using reverse transcriptase. The clot was then amplified by PCR to confirm expression levels. DMSO was added to the control group instead of the compound.

[0085] The information on the primers used in the experiment is as follows: KL-F: GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1) KL-R: GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2) GAPDH-F: TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3) GAPDH-R: AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)

[0086] Figure 2 shows the results of PCR analysis of klotho gene expression. The expression levels of the bands shown in the gel photograph were quantified using Image J and displayed as a graph. In the gel photograph, the upper band represents the secreted form of klotho, and the lower band represents the membrane-like form of klotho. The quantitative graph shows both bands together. KS104 demonstrated the most effective expression effect, demonstrating a more than two-fold increase in klotho gene expression compared to KS101 and other fluorine-conjugated compounds.

[0087] Experimental Example 3: Cytotoxicity evaluation Cultured human retinal epithelial cells (ARPE) were treated with various concentrations of the KS compounds from Example 1 and incubated for 24 hours. After incubation, EX-cytox (GOGEN) was added and the cells were incubated for 1 hour, after which the change in absorbance was measured. A decrease in absorbance indicated toxic destruction of the cells. As shown in Figure 3, KS104 was confirmed to have the lowest cytotoxicity.

[0088] Experimental Example 4: Analysis of Intracellular Reactive Oxygen Species (ROS) Renal tubular epithelial cells (RPTEC) were treated with each of the KS compounds of Example 1, and the changes in the amount of intracellular reactive oxygen species (ROS) were examined.

[0089] Each KS compound was added at 2.5 μM to cultured RPTEC cells and incubated for 6 hours. After incubation, the amount of ROS present in the cells was measured by adding Invitrogen's Reactive Oxygen Detection Reagents and incubating for 1 hour. The change in fluorescence was then measured using a spectrophotometer.

[0090] Figure 4 is a graph showing the amount of ROS remaining in RPTEC cells. It can be seen that the amount of ROS in cells treated with KS103 and KS104 compounds was reduced by about 30% compared to cells treated with only the solvent (DMSO).

[0091] Experimental Example 5: Confirmation of changes in expression of oxidative stress-related genes Relatively senescent, passage 7 (#7) renal tubular epithelial cells (RPTEC) were incubated with 2.5 μM of each compound for 6 hours, and mRNA was collected and global gene expression was analyzed using a next-generation sequencer (NGS). To confirm changes in gene expression due to senescence, gene expression was compared with that of relatively young passage 4 (#4) RPTEC cells to identify genes whose expression increased in young cells (TXN, AKT1, NR4A3, NLRP3, and FOXP3 genes). The expression levels of these genes in young cells were compared with the expression changes following treatment with the compound of Example 1 (senescent cells treated with the compound of Example 1). The results confirmed that treatment with the KS104 compound induced the expression of these genes to a greater extent in senescent cells than in young cells (Figures 5 and 6).

[0092] Experimental Example 6: Protective effect on retinal pigment epithelial cells In order to confirm the preventive or therapeutic effect of the KS compound of Example 1 on macular degeneration, the effect of protecting retinal pigment epithelial cells from oxidative stress was examined. First, experiments were performed using human retinal pigment epithelial cells (ARPE) purchased from ATCC in the United States. 10,000 ARPE cells were placed in each well and cultured for 18 hours, after which the medium was replaced with serum-free (FBS)-free DMEM F-12 medium.

[0093] Each KS compound was added at a concentration of 2.5 μM, and then treated with buthionine sulfoximine (BSO) at a concentration of 50 mM for 6 hours to induce oxidative stress. To measure the viability of these cells, a Cyto X (Cell viability assay kit) was added and the absorbance at 450 nm was measured over time.

[0094] As a result, it was confirmed that both the KS103 and KS104 compounds inhibited apoptosis caused by oxidative stress (Fig. 7).

Claims

1. A compound represented by the following chemical formula 1-1D, or a pharmaceutically acceptable salt thereof: 【Chemistry 1】

2. 2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, which increases the expression of the Klotho gene.

3. 2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, which protects retinal pigment epithelial cells from oxidative stress.

4. 2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, which is used as a pharmaceutical composition for preventing or treating macular degeneration.

5. 2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, which is used as a food composition for preventing or improving macular degeneration.

6. A pharmaceutical composition for preventing or treating macular degeneration, comprising a compound represented by the following chemical formula 1-1D or 1-1C or a pharmaceutically acceptable salt thereof: 【Chemistry 2】

7. A food composition for preventing or ameliorating macular degeneration, comprising a compound represented by the following chemical formula 1-1D or 1-1C or a pharmaceutically acceptable salt thereof: 【Transformation 3】

Images