A method for determining the possibility of contamination with type II cytolethal distending toxin-producing bacteria.
The use of specific PCR primers for single-step amplification of the cdt-II gene addresses detection challenges, enhancing the accuracy and efficiency of identifying type II cytolethal distending toxin-producing bacteria, including genetic variations and contamination sources.
Patent Information
- Application Number
- JP2024186469
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-10-23
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2040-09-25
AI Technical Summary
Existing methods for detecting type II cytolethal distending toxin-producing bacteria, such as E. albertii, face challenges including insufficient detection limits, the need for multi-step PCR processes, and the inability to differentiate cdt-II genes from other types in a single amplification step, especially due to potential single nucleotide polymorphisms.
A method utilizing specific PCR primers that can bind complementarily to the cdt-II gene, allowing for single-step amplification and detection of type II cytolethal distending toxin-producing bacteria, including live or dead bacteria, and contamination by foreign matter containing the gene, using primer sets that accommodate variations in the cdt-II gene sequence.
Enables rapid and specific detection of type II cytolethal distending toxin genes, improving detection accuracy and efficiency by allowing differentiation from other bacterial species and accommodating genetic polymorphisms, with a preferred method being real-time PCR and intercalator analysis.
Smart Images

Figure 0007813438000010 
Figure 0007813438000011 
Figure 0007813438000012
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for determining the possibility of contamination with type II cytolethal distending toxin-producing bacteria. [Background technology]
[0002] In recent years, Escherichia albertii has been attracting attention as a causative agent of food poisoning. This bacterium (hereinafter sometimes referred to as "Escherichia albertii") has a high possibility of causing intestinal bleeding, similar to Escherichia coli O157. It is necessary to strictly distinguish between the two because it shares similar biochemical properties with E. coli, as well as the common pathogenic factors eae gene, which encodes intimin, involved in adhesion to the intestinal mucosa, and cdt gene, which encodes cytolethal distending toxin (CDT).
[0003] As a method for distinguishing between the two, Patent Document 1 discloses a medium containing a sugar that is not decomposed by Lactobacillus albertii and a pH indicator. Cultivation using this medium makes it possible to detect E. albertii from bacteria of the genus Escherichia. However, because Shigella and Lactobacillus providencia also form similar colonies in this medium, it is necessary to specifically detect E. albertii.
[0004] It is known that many bacteria other than E. coli and P. albertii exist that produce CDT. However, it has been revealed that of the five types of cdt genes (cdtI-V) believed to be produced by E. coli, the cdt-I gene, cdt-III gene, cdt-IV gene, and cdt-V gene have low homology to the cdt genes possessed by P. albertii and high homology to the cdt-II gene possessed by certain strains of E. coli (Non-Patent Document 1). Based on this knowledge, Non-Patent Document 1 reveals that a PCR method (Eacdt PCR) and a nested PCR method (Nested Eacdt PCR) have been developed that can detect the cdt-II gene possessed by P. albertii, targeting the cdt-III and cdt-V genes as well as the cdt genes of P. alcalifaciens. Furthermore, Non-Patent Document 2 discloses a primer consisting of the nucleotide sequence shown in SEQ ID NO: 69 and a primer consisting of the nucleotide sequence shown in SEQ ID NO: 70, which were used in the Eacdt PCR method.
[0005] However, the former Eacdt PCR method has an insufficient lower limit of detection, and the latter nested PCR method requires two-step amplification, so new primers are needed that can distinguish and detect the cdt-II gene from the other four types of cdt genes in a single amplification step. Furthermore, because mutations such as single nucleotide polymorphisms are expected to occur in the cdt-II gene, a method that can detect as many cdt-II genes as possible is desired. [Prior art documents] [Patent documents]
[0006] [Patent Document 1] Patent Publication No. 2019-024418 [Non-patent literature]
[0007] [Non-Patent Document 1] Yasuda, Noritomo, Development and application of a detection method for Escherichia albertii discovered by re-identification of E. coli carrying the type II cytolethal distending toxin gene, Internet,<URL:https: / / www.osakafu-u.ac.jp / osakafu-content / uploads / sites / 428 / k1798.pdf> [Non-patent document 2] Atsushi Hinenoya et al., Diagnostic Microbiology and Infection Disease 95(2019) 119-124 Summary of the Invention [Problem to be solved by the invention]
[0008] The present invention has been made in view of the above-mentioned background art, and aims to provide PCR primers that can specifically detect type II cytolethal toxin-producing bacteria by PCR that enables detection through a single amplification step rather than nested PCR. [Means for solving the problem]
[0009] The present invention is a method for determining the possibility of contamination with type II cytolethal toxin-producing bacteria, which includes a step of contacting a sample to be determined or DNA extracted from the sample to amplify a target gene fragment in the sample, and the step of amplifying the target gene fragment uses a specific primer set. [Effects of the Invention]
[0010] According to the present invention, the type II cytolethal distending toxin (type II CDT) gene (cdt-II gene) can be specifically detected from various CDT-producing bacteria, and the possibility of contamination with the CDT-producing bacteria can be rapidly determined. [Brief explanation of the drawings]
[0011] [Figure 1] FIG. 1 is an explanatory diagram showing the sites where primers bind to the cdt-II gene and the amplified region. [Figure 2] FIG. 2 is an explanatory diagram showing a part of the base sequence of the cdt-II gene and the site where the primer binds. [Figure 3] Figure 3 shows electrophoretic images of the amplified products using various primer sets. Lane 1 shows P. albertii, lane 2 shows Providencia rustiganii, lane 3 shows E. coli, lane 4 shows distilled water as a control, and lanes M1 and M2 show the markers. [Figure 4] Figure 4 shows representative images of melting curves obtained using various primer sets. DETAILED DESCRIPTION OF THE INVENTION
[0012] The method of the present invention is a method for determining the possibility of contamination with type II cytolethal toxin-producing bacteria, and includes a step of contacting a sample to be determined or DNA extracted from the sample to amplify a target gene fragment in the sample, and the step of amplifying the target gene fragment uses a specific primer set.
[0013] The type II cytolethal distending toxin gene (cdt-II gene) is known. According to Non-Patent Document 1, the cdt-II gene is possessed by CTEC-II (type II cytolethal distending toxin-producing E. coli), a type of Escherichia coli. However, CTEC-II is highly likely to be Bacillus albertii, and when cdt-II is detected, it can be assumed that contamination with Bacillus albertii has occurred.
[0014] In the present invention, contamination with type II CDT-producing bacteria means not only the presence of bacteria carrying the cdt-II gene in a sample, whether live or dead, but also the presence of the target gene in a sample due to contamination by bacteria carrying the cdt-II gene or contamination by foreign matter containing the target gene, and "possible contamination" means that it is presumed that the sample has been contaminated with the bacteria in question for some reason. Therefore, even if contamination is determined using the method of the present invention, it cannot necessarily be concluded that live bacteria were present, and confirmation of bacterial contamination using another method is required.
[0015] The method of the present invention includes a step of contacting a target gene fragment in a sample to be evaluated or DNA extracted from the sample with the target gene fragment, which is a method known as PCR (Polymerase Chain Reaction). In this step, the following primer set is used in the present invention.
[0016] The primer set used preferably has a base sequence capable of binding complementarily to the cdt-II gene. "Able to bind complementarily" is used in the sense commonly used by those skilled in the art of PCR, meaning that the bases of each primer can bind to the cdt-II gene at opposite positions. However, the primers of the present invention do not necessarily need to bind perfectly complementarily, as long as they can amplify a partial region of the cdt-II gene even if one to three bases are inserted, deleted, or substituted. The cdt-II gene is a gene that produces type II CDT, and various polymorphisms of the cdt-II gene exist, each differing by a single base. The primer set of the present invention complementarily binds to the cdt-II gene having the consensus sequence shown in Figure 2 (SEQ ID NO: 71), but can also amplify a partial region of the cdt-II gene having a base sequence different from the consensus sequence. The base sequence shown in SEQ ID NO: 71 represents 641 bases, from base 1300 to 1940, counting from the 5' end of the consensus sequence (sense strand) of the cdt-II gene.
[0017] The primer set according to the present invention comprises one forward primer selected from the group consisting of primer group 6F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 1 and each having 20 to 24 bases, primer group 7F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 3 and each having 17 to 21 bases, primer group 8F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 5 and each having 17 to 22 bases, and primer (1845F) having the nucleotide sequence shown in SEQ ID NO: 68 (TAATGATTCGAACGCCAAAC), primer group 6R consisting of primers having the nucleotide sequence shown in SEQ ID NO: 2 and each having 16 to 20 bases, primer group 7R consisting of primers having the nucleotide sequence shown in SEQ ID NO: 4 and each having 17 to 21 bases, and primer group 8F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 5 and each having 17 to 22 bases. No. 6 and one reverse primer selected from the group consisting of primer group 8R, which consists of primers having 16 to 21 bases and the base sequence shown in SEQ ID NO: 70 (CTATTTCCCATCCAATAGTCT), and primer group 1845F and one reverse primer selected from the group consisting of primer group 6F and primer group 6R, primer group 6F and primer group 7R, primer group 6F and primer group 8R, primer group 7F and primer group 7R, primer group 8F and primer group 7R, primer group 8F and primer group 8R, primer group 6F and primer IchiR, and primer 1845F and primer group 7R.
[0018] More specifically, the forward primer may be selected from primers having the nucleotide sequences shown in SEQ ID NOs: 7 to 15 in primer group 6F, from primers having the nucleotide sequences shown in SEQ ID NOs: 27 to 36 in primer group 7F, and from primers having the nucleotide sequences shown in SEQ ID NOs: 48 to 58 in primer group 8F. The reverse primer may be selected from primers having the nucleotide sequences shown in SEQ ID NOs: 17 to 22, 24, and 25 in primer group 6R, from primers having the nucleotide sequences shown in SEQ ID NOs: 38 to 46 in primer group 7R, and from primers having the nucleotide sequences shown in SEQ ID NOs: 59 to 67 in primer group 8R.
[0019] In the present invention, the terms forward primer and reverse primer are used in the sense commonly used by those skilled in the art, where a forward primer refers to a primer designed to bind to the antisense strand of the cdt-II gene, and a reverse primer refers to a primer designed to bind to the sense strand of the cdt-II gene.
[0020] The binding position of each primer in the cdt-II gene is shown in Figures 1 and 2. The numbers shown in Figure 1 indicate the base position from the 5' end of the cdt-II gene. 1 and 2 indicate the binding positions of representative primers in each of the primer groups 6F, 7F, 8F, 6R, 7R, and 8R, respectively: primer (6F) consisting of the nucleotide sequence (TCAGATAGATGAATTAGGAAAAG) set forth in SEQ ID NO: 7; primer (7F) consisting of the nucleotide sequence (TGTGAAAACACCTGAAGAAG) set forth in SEQ ID NO: 27; primer (8F) consisting of the nucleotide sequence (GAGAGACTATTGGATGGGAAA) set forth in SEQ ID NO: 48; primer (6R) consisting of the nucleotide sequence (TTCTTCAGGTGTTTTCACA) set forth in SEQ ID NO: 17; primer (7R) consisting of the nucleotide sequence (CGTCATTTTTAGCAGGTTCC) set forth in SEQ ID NO: 38; and primer (8R) consisting of the nucleotide sequence (TGGTCTGTGTTTGGCGTTCG) set forth in SEQ ID NO: 59.
[0021] In the present invention, the combination of the forward primer and the reverse primer may be any combination as long as it is one of the above-mentioned combinations, but is preferably a combination of primer group 7F and primer group 7R, or a combination of primer group 8F and primer group 8R, and desirably a combination of primer group 8F and primer group 8R.
[0022] The target sample is not limited to samples in which bacteria (whether live or dead) carrying the cdt-II gene may be present, but may also be any sample in which the cdt-II gene may be present, such as vomit, feces, or food from various animals, including humans, cows, pigs, dogs, and cats. While these samples may be used directly as samples for amplification, it is preferable to use template DNA (template DNA) for amplification extracted from these samples. The extraction and preparation of template DNA are also not particularly limited and can be obtained by conventional methods.
[0023] The concentration of the primers used and the amount of template used are not limited and can be adjusted as appropriate. In the present invention, in addition to the primers (primer set), buffers and DNA polymerases commonly used in PCR are also used for amplification. These buffers and DNA polymerases are also not limited, and their concentrations can be determined as appropriate by those skilled in the art.
[0024] Examples of buffers include TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, TAPS, PIPES, and CAPS. The PCR reaction solution may contain approximately 1.0 to 5 mM Mg. 2+ It is preferable to carry out the reaction in the presence of KCl, and the reaction can also be carried out in the presence of KCl.
[0025] As the DNA polymerase, known polymerases, preferably those derived from thermostable bacteria, can be used. Examples of commercially available polymerases (hereinafter referred to as trade names) include Taq DNA polymerase and Tth DNA polymerase, which belong to Family A (Pol I type), and KOD DNA polymerase, Pfu DNA polymerase, Pwo DNA polymerase, Ultima DNA polymerase, and PrimeSTAR DNA polymerase, which belong to Family B (α type). The thermostable DNA polymerase is not limited to an extract, and may be a recombinant one, or may be a mutant having an amino acid sequence in which one to several amino acids are deleted, substituted, added, or inserted in the amino acid sequence of a natural polymerase. One or more types of DNA polymerase may be used.
[0026] The amplification conditions (such as amplification temperature, amplification cycle, and holding time) in the amplification step can be set based on the common sense of a person skilled in the art of PCR. Examples of such conditions are shown in the Examples.
[0027] The possibility of contamination is determined based on the presence or absence of an amplification product amplified in the amplification step and its amount. Methods for determining the presence or absence or amount of an amplification product include electrophoresis, which electrophoreses the amplification product in the reaction solution after the amplification step, the cycling probe method or probe method (5' nuclease method) using a fluorescent substance, and the intercalator method. All of these determination methods are known. While any of these determination methods can be used to determine the possibility of contamination, the intercalator method is preferred as it is a relatively simple method that can be used in real-time PCR.
[0028] The intercalator used in the intercalator method is not particularly limited, as long as it is a fluorescent substance that emits fluorescence upon insertion into double-stranded DNA and is quenched upon dissociation of the double-stranded DNA. Examples of commercially available intercalators (hereinafter referred to as trade names) include, but are not limited to, ethidium bromide, cyanine dyes (e.g., TOTO, YOYO, BOBO, POPO), SYBR Green I, SYBR Green ER, SYBR Green Gold, SYBR DX, PicoGreen, LCGreen, EvaGreen, SYTOX Green, ResoLight, Acridine orange, CyQUANT GR, SYTO 9, SYTO 10, SYTO 13, SYTO 14, SYTO 82, and FUN-1. Of course, any method other than the exemplified methods may be used as long as it can determine the presence or absence of an amplification product. Furthermore, the intercalator method involves melting curve analysis, and the conditions for the melting curve analysis can be set based on the common sense of those skilled in the art. A commercially available real-time PCR device is used for PCR amplification and melting curve analysis, and the conditions for melting curve analysis can be set according to the operating manual of the real-time PCR device used.
[0029] The measurement kit of the present invention is a measurement kit for determining the possibility of contamination with the cdt-II gene, and includes at least one of the primer sets. This measurement kit is used to amplify the cdt-II gene present in a target sample and examine the possibility of contamination with bacteria carrying the cdt-II gene, and may include, in addition to the primer set, a buffer, DNA polymerase, a cycling probe for detecting the amplification product, an intercalator, etc.
[0030] Next, the present invention will be further explained based on the following examples, but it goes without saying that the present invention is not limited to the following examples. [Example]
[0031] The nucleotide sequences of the cdt-II gene (consensus sequence: majority sequence) were determined by analyzing the nucleotide sequences of the cdt-II gene for 38 strains shown in Table 1 that were identified as E. albertii strains of known origin. Note that the 38 E. albertii strains for which consensus sequences were determined include the type strain (ATCC) E. albertii (Albert 19982). However, not all of the other 37 strains had the same nucleotide sequence as the type strain; single nucleotide polymorphisms were observed throughout the cdt-II gene, including the region of the nucleotide sequence shown in Figure 1 (bases 1300 to 1940, which were found to be relatively highly conserved). Primer sets Set 1 to Set 8 shown in Table 2 were created from the consensus sequence of this cdt-II gene, as well as the base sequences of the cdt-I gene (NT3363-cdtI), cdt-III gene (PII4-cdtIII), cdt-IV gene (P159-cdtIV), and cdt-V gene (P336-cdtV), and the base sequences of the cdt gene of Providencia rustigianii (JHI strain) (JHI-Prcdt), which is considered to be relatively homologous to the cdt-II gene of P. alcalifaciens (AH31 strain) (AH31-Pacdt). Real-time PCR was performed.For each set in the sample name (Sample Name) in Table 2, the start position of the forward side (upper row) and the number of bases of the primer and the start position of the reverse side (lower row) are shown. For example, the forward primer of Set 6 is a primer (6F) having the base sequence shown in SEQ ID NO: 7, which consists of 23 bases starting from the 1672nd base, and the reverse primer is a primer (6R) having the base sequence shown in SEQ ID NO: 17, which consists of 19 bases starting from the 1816th base. The forward primer of Set 7 is a primer (7F) having the base sequence shown in SEQ ID NO: 27, which consists of 20 bases starting from the 1798th base, and the reverse primer is a primer (7R) having the base sequence shown in SEQ ID NO: 38, which consists of 20 bases starting from the 1915th base. The forward primer of Set 8 is a primer (8F) having the base sequence shown in SEQ ID NO: 48, which consists of 21 bases starting from the 1770th base, and the reverse primer is a primer (8R) having the base sequence shown in SEQ ID NO: 59, which consists of 20 bases starting from the 1872nd base. As a result, the primer sets Set 1 to Set 5 did not show sufficient separation in the Tm values (the temperature at which 50% of double-stranded DNA is judged to dissociate into single-stranded DNA: °C) in melting curve analysis, and it was determined that the electrophoresis images of the amplified products (not shown) did not allow detection of M. albertii strains in distinction from other bacterial species.
[0032] [Table 1]
[0033] [Table 2]
[0034] Next, primer sets Set 6 to Set 8 were used to examine specificity, that is, to examine whether they could be used to distinguish between E. albertii and other bacterial species. The target bacterial species were 67 strains in total, including 39 strains of E. albertii and 28 strains of 26 species other than E. albertii, as shown in Table 3.
[0035] Template DNA was prepared from bacteria according to standard methods, and a reaction solution was prepared by adding water to 1 μL of template DNA solution, 10 μL of DNA polymerase solution (Go Taq qPCR Master Mix: product name of Promega Corporation), 7 μL each of forward primer solution (10 μM) and reverse primer solution (10 μM) to a total volume of 20 μL.
[0036] The solution was amplified under the conditions shown in Table 4, followed by melting curve analysis (hereinafter, real-time PCR was performed under the same conditions). As a result, regardless of which primer set was used, Tm values were observed for all strains of Bacillus albertii, and the cdt-II gene was amplified. On the other hand, no Tm values were observed for the other 28 strains, confirming that only the cdt-II gene possessed by Bacillus albertii could be detected. [Table 3]
[0037] [Table 4]
[0038] Next, we compared real-time PCR using the Set8 primer set with the Eacdt method (real-time PCR using the IchiF and IchiR primer set) described in Non-Patent Document 1. Raccoons, which are commonly infected with C. albertii, were used as subjects. Raccoon rectal swabs were used to collect samples, which were then suspended in PBS and diluted 10-fold with TSB. After centrifugation, the precipitate was decomposed with sodium hydroxide and neutralized with acid to prepare template DNA. The results are shown in Table 5. As a result, the positive detection rate improved from 67% with the Eacdt method to 77%. The IchiF and IchiR primer set described in Non-Patent Document 1 was designed from a highly conserved region of the cdt-II gene found in E. coli strains classified as CTEC-II (cdt-II gene-carrying E. coli).
[0039] [Table 5] [Example]
[0040] Modified primers shown in Tables 6-8 were prepared based on the primer sets of Sets 6-8, and detection of E. albertii AKT5 was attempted. Table 6 shows modified primers based on the primers of Set 6 (1672F: 6F in Figure 1 and 1816R: 6R in Figure 1), Table 7 shows modified primers based on the primers of Set 7 (1798F: 7F in Figure 1 and 1915R: 7R in Figure 1), and Table 8 shows modified primers based on the primers of Set 8 (1770F: 8F in Figure 1 and 1872R: 8R in Figure 1). The top row of each table shows the forward primer, and the bottom row shows the reverse primer. Real-time PCR was performed using a primer set combining the modified forward primer with the unmodified reverse primer in each table, and real-time PCR was performed using a primer set combining the modified reverse primer with the unmodified forward primer in each table. The numbers in parentheses in the tables indicate Tm values.
[0041] [Table 6]
[0042] [Table 7]
[0043] [Table 8] [Example]
[0044] Each primer set (Set 6 to Set 8) amplifies a region of approximately 250 bp at most. Using Sets A to I (see Figure 3), which consisted of combinations of forward and reverse primers from these sets, we attempted to detect E. albertii (Eacdt), P. rustigainii (Prcdt), and E. coli (CTEC-III). The forward and reverse primers used were primer 6F (SEQ ID NO: 7), primer 7F (SEQ ID NO: 27), primer 8F (SEQ ID NO: 48), primer 1845F (SEQ ID NO: 68), primer 6R (SEQ ID NO: 17), primer 7R (SEQ ID NO: 38), primer 8R (SEQ ID NO: 59), and primer IchiR (SEQ ID NO: 70). The combinations of primers (8F) and (6R) and primers (7F) and (6R) were not detected due to the narrow amplification regions. The results are shown in Figures 3 and 4. Furthermore, we attempted to detect E. albertii (Eacdt) in raccoon feces for Sets A, B, D, and I, which showed particularly good detection. The results are shown in Table 9. The strain names (Strain ID) in Table 9 indicate the strains detected in the rectums of raccoons captured in the wild.
[0045] [Table 9]
Claims
1. 1. A method for determining possible contamination with Escherichia albertii, comprising: a step of contacting a target sample or DNA extracted from the sample with the target gene fragment to amplify the target gene fragment in the sample; A method using the following primer set in the step of amplifying the target gene fragment: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer consisting of the base sequence shown in SEQ ID NO: 59; A primer set consisting of
2. A primer set for amplifying a partial region of the type II cytolethal distending toxin gene of Escherichia albertii, comprising: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer consisting of the base sequence shown in SEQ ID NO: 59; A primer set consisting of:
3. A measurement kit for determining the possibility of contamination with Escherichia albertii, comprising: A measurement kit comprising the primer set according to claim 2.
Citation Information
Patent Citations
Culture medium for preferential segregation
JP2019024418A