Compounds and methods for modulating angiotensinogen expression

Oligomeric compounds targeting angiotensinogen RNA and protein expression offer an alternative to current RAAS inhibitors, effectively managing hypertension and related conditions by modulating the RAAS pathway and reducing blood pressure.

JP7820374B2Active Publication Date: 2026-02-25IONIS PHARMACEUTICALS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023529940
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-08-11
Filing Date
2021-11-18
Publication Date
2026-02-25
Estimated Expiration
2041-11-18

AI Technical Summary

Technical Problem

Current treatments for hypertension, particularly those targeting the renin-angiotensin-aldosterone system (RAAS), have limitations in inhibiting the RAAS pathway and are ineffective for a significant proportion of hypertensive patients, including those with renal disease, and there is a need for alternative therapies to manage hypertension and related conditions.

Method used

Development of compounds and pharmaceutical compositions that reduce angiotensinogen (AGT) RNA and protein expression using oligomeric compounds, particularly modified oligonucleotides, to modulate the RAAS pathway and treat hypertension and related diseases.

Benefits of technology

These compounds effectively decrease AGT activity, providing therapeutic benefits for hypertension, resistant hypertension, and other RAAS-related conditions, including heart failure and kidney diseases, by reducing blood pressure and ameliorating symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007820374000001
    Figure 0007820374000001
  • Figure 0007820374000002
    Figure 0007820374000002
  • Figure 0007820374000003
    Figure 0007820374000003
Patent Text Reader

Abstract

Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of AGT RNA in a cell or a subject, and in certain instances, for reducing the amount of AGT in a cell or a subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of cardiovascular disease. Such compounds and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a RAAS pathway-related disease or disorder. Such symptoms and characteristics include hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, valvular heart disease, vascular aneurysm, peripheral arterial disease, and organ damage. Such cardiovascular diseases include hypertension, resistant hypertension, Marfan syndrome, and heart failure.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application has been filed with a Sequence Listing in electronic format. The Sequence Listing is provided under the filename BIOL0393WOSEQ_ST25.txt, created on November 3, 2021, and is 32 KB in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of angiotensinogen RNA in a cell or a subject, and in certain examples, for reducing the amount of angiotensinogen (AGT) in a cell or a subject. Such compounds and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a RAAS pathway-related disease or disorder. Such diseases and disorders include hypertension, hypertensive emergency (i.e., malignant hypertension), resistant hypertension, kidney disease (e.g., chronic kidney disease, polycystic kidney disease), pre-eclampsia, Marfan syndrome, stroke, heart disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, pulmonary arterial hypertension, obesity, metabolic syndrome, NASH, NAFLD, and other RAAS-related diseases, disorders, and / or conditions, or symptoms thereof. [Background technology]

[0003] Angiotensinogen (AGT), also known as SERPINA8 or ANHU, is a member of the serpin family and a component of the renin-angiotensin-aldosterone system (RAAS). It is primarily produced in the liver and released into the circulation, where renin converts it to angiotensin I. Angiotensin I is then converted to angiotensin II by angiotensin-converting enzyme (ACE). Angiotensin II is a peptide hormone that can cause vasoconstriction and increase blood pressure. Angiotensin II also stimulates the secretion of the hormone aldosterone from the adrenal cortex. Aldosterone increases sodium and water reabsorption in the kidney, increasing fluid volume in the body and increasing blood pressure. Stimulation or overactivity of the RAAS pathway can lead to high blood pressure. Chronic high blood pressure is known as hypertension. High blood pressure in hypertensive subjects requires the heart to work harder to circulate blood through the blood vessels.

[0004] Hypertension remains a leading cause of death and disability worldwide due to cardiovascular disease and stroke. Despite extensive research and the availability of multiple effective treatments, hypertension remains a significant public health challenge in the United States (Sigmund et al., Hypertension 2020, 75:902-917). Currently approved treatments for hypertension have limitations, and a significant proportion of all hypertensive patients do not achieve adequate blood pressure control. For example, drugs such as ACE inhibitors and angiotensin receptor blockers (ARBs), which target parts of the renin-angiotensin system (RAS) pathway, have limited ability to inhibit the RAAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359). Furthermore, certain antihypertensive medications, such as ACE inhibitors, are contraindicated in hypertensive patients with renal disease because they may impair renal function.

[0005] Therefore, there is a need to find alternative therapies to inhibit the RAAS pathway and treat hypertension. Accordingly, it is an object of the present invention to provide compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0006] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of AGT RNA, and in certain embodiments, reducing the expression of AGT protein in a cell or a subject. In certain embodiments, the subject has cardiovascular disease. In certain embodiments, the subject has hypertension. In certain embodiments, the subject has resistant hypertension. In certain embodiments, the subject has Marfan syndrome. In certain embodiments, the subject has kidney disease. In certain embodiments, a compound useful for reducing the amount or activity of AGT RNA is an oligomeric compound. In certain embodiments, a compound useful for reducing the amount or activity of AGT RNA is a modified oligonucleotide. In certain embodiments, a compound useful for reducing the expression of AGT protein is an oligomeric compound. In certain embodiments, a compound useful for reducing the expression of AGT protein is a modified oligonucleotide.

[0007] Also provided are methods useful for ameliorating at least one symptom or characteristic of a RAAS pathway-related disease or indication. In certain embodiments, the disease is hypertension. In certain embodiments, the disease is resistant hypertension. In certain embodiments, the disease is Marfan syndrome. In certain embodiments, the indication is heart failure. In certain embodiments, the symptom or characteristic includes hypertension, hypertensive emergency (i.e., malignant hypertension), pre-eclampsia, stroke, heart disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), vascular aneurysm, abdominal aneurysm, organ damage, pulmonary arterial hypertension, obesity, and other RAAS pathway-related diseases, disorders, and / or conditions, or symptoms thereof. DETAILED DESCRIPTION OF THE INVENTION

[0008] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" and other forms such as "comprises" and "included" is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components comprising two or more subunits, unless expressly stated otherwise.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, listed in this application, including but not limited to patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0010] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise indicated, the following terms have the following meanings:

[0012] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having the β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0015] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. As used herein, a "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to a sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0018] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0019] As used herein, "about" means within ±10% of a value. For example, if it is stated that "the compound caused about 70% inhibition of AGT," it implies that AGT levels are inhibited within a range of 63% to 77%.

[0020] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0021] As used herein, "angiotensinogen" and "AGT" are used interchangeably herein. Angiotensinogen is also known as SERPINA8 and ANHU.

[0022] As used herein, "antihypertensive agent" refers to a drug that can lower blood pressure. Examples of such drugs include, but are not limited to, RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists, and vasodilators. In one example, the antihypertensive agent captopril can be used in combination with the AGT compounds described herein to treat an animal having or at risk of having a RAAS pathway-related disease, disorder, and / or condition.

[0023] As used herein, "antisense activity" refers to any detectable and / or measurable change attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0024] As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of achieving at least one antisense activity.

[0025] As used herein, "improvement" in relation to treatment means that at least one symptom is improved compared with the same symptom without treatment.In certain embodiments, improvement is a decrease in the severity or frequency of symptoms, or a delay in the onset of symptoms or a slowing down in the progression of severity or frequency.The progression or severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

[0026] As used herein, "blood pressure" refers to the pressure of blood in the circulatory system against the walls of blood vessels. Blood pressure in animals is primarily due to the beating of the heart. During each heartbeat, blood pressure varies between maximum (systolic) blood pressure (SBP) and minimum (diastolic) blood pressure (DBP). Mean arterial pressure (MAP) is the average arterial pressure during the cardiac cycle. Blood pressure can be measured by a blood pressure measuring device (i.e., a sphygmomanometer). Normal resting blood pressure is less than 120 mmHg systolic and less than 80 mmHg diastolic, and is generally expressed as systolic blood pressure (upper blood pressure) / diastolic blood pressure (lower blood pressure) mmHg.

[0027] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0028] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0029] As used herein, "cEt" means a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge being in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety having a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge being in the S configuration. "cEt" means constrained ethyl.

[0030] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0031] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, in a cell, subject, animal, or human.

[0032] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide, or one or more portions thereof, and another nucleic acid, or one or more portions thereof, are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite directions. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C). mComplementary oligonucleotides and / or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are permitted. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to another oligonucleotide or target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or at every nucleoside if the oligonucleotides are the same length.

[0033] As used herein, "conjugate group" means a group of atoms directly or indirectly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0034] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0035] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0036] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.

[0037] As used herein, "chiral enriched population" refers to a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules in the population that contain a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules that would be expected to contain the same specific stereochemical configuration at the same specific chiral center in the population if the specific chiral center were stereorandom. A chiral enriched population of molecules having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide.

[0038] As used herein, "chirally controlled" with respect to an internucleoside linkage means that the chirality of that linkage is enriched for a particular stereochemical configuration.

[0039] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, at least 70% of the nucleosides being 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0040] As used herein, "gapmer" refers to a modified oligonucleotide in which an internal region having multiple nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, where the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings." The internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counted from the 5' end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides in the gap being 2'-β-D-deoxynucleosides. As used herein, "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0041] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0042] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0043] As used herein, "hypertension" or "HTN" refers to a chronic medical condition in which an animal's blood pressure is elevated. High blood pressure requires the heart to work harder to circulate blood through the blood vessels. High blood pressure is said to be persistently present at or above 130 / 80 mmHg (stage 1) or 140 / 90 mmHg (stage 2). Hypertension is classified as primary (essential) or secondary. Primary hypertension has no clear cause and is thought to be related to genetics, diet, lack of exercise, and obesity. Secondary hypertension is caused by another medical condition. Hypertension is a major risk factor for shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, vascular aneurysms (e.g., aortic aneurysms), peripheral arterial disease, organ damage (e.g., cardiac hypertrophy or hypertrophy), and other cardiovascular diseases, disorders, and / or conditions, or their symptoms. Antihypertensive medications, dietary changes, and lifestyle changes can reduce hypertension and the diseases, disorders, and / or conditions associated with hypertension. Hypertension can be non-refractory to drug intervention (i.e., controllable with over-the-counter medications) or resistant to drug intervention.

[0044] As used herein, the term "internucleoside bond" refers to the covalent bond between consecutive nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond.A "phosphorothioate internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0045] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly connects an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0046] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0047] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.

[0048] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0049] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.

[0050] As used herein, "nucleoside" refers to a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides linked in a contiguous sequence (i.e., there are no additional nucleosides between linked nucleosides).

[0051] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0052] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0053] As used herein, "organ damage" or "end-organ damage" refers to damage caused to major organs supplied by the circulatory system, such as the heart (e.g., myocardial hypertrophy, cardiac dysfunction, and / or heart failure), kidney (e.g., albuminurea, proteinurea, renal dysfunction, and / or renal failure), eye (e.g., hypertensive retinopathy), and brain (e.g., stroke). Organs can be damaged by hypertension in animals. In certain embodiments, the cardiac damage is fibrosis, cardiac cell hypertrophy, and / or muscle hypertrophy, resulting in cardiac hypertrophy.

[0054] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to a subject. Certain such carriers allow the pharmaceutical composition to be formulated as, for example, pills, tablets, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0055] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects to the parent compound.

[0056] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0057] As used herein, "prodrug" refers to a therapeutic agent in an ex vivo form that is converted to a different form within the subject or cells thereof. Generally, the conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0058] As used herein, "reducing the amount or activity" refers to a reduction or blocking of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0059] As used herein, "renin-angiotensin-aldosterone system," "renin-angiotensin-aldosterone system pathway," "RAAS pathway," or "RAAS" refers to a multicomponent enzymatic pathway in which a precursor component (angiotensinogen) is converted to downstream components such as angiotensin I and angiotensin II by various enzymes, such as renin and the enzyme angiotensin-converting enzyme (ACE). Angiotensin I stimulates the secretion of the steroid aldosterone in the pathway. The RAAS pathway regulates blood pressure and fluid balance.

[0060] As used herein, " renin-angiotensin system " or " RAS " or " RAS pathway " refers to a part of the RAAS pathway.Various components of this pathway are targeted by agonist or antagonist to block the production of components.For example, renin inhibitors, ACE inhibitors, angiotensin receptor blockers (ARBs) and the like have been developed to inhibit or block the RAS pathway.However, the commercially available therapies that target various RAS pathway components have not been effective in completely inhibiting or blocking the RAS pathway due to different mechanisms or adverse effects (Nobakht et al., Nat Rev Nephrol, 2011,7:356-359).

[0061] As used herein, "RAAS-related diseases, disorders, and / or conditions" or "RAAS pathway-related diseases, disorders, and / or conditions" refer to any disease, disorder, or condition associated with RAAS in an animal. Examples of RAAS-related diseases, disorders, and / or conditions include reduced life expectancy, hypertension (e.g., non-resistant hypertension, resistant hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), stroke, heart disease (e.g., myocardial infarction, heart failure, valvular heart disease), vascular aneurysm (e.g., aortic aneurysm), peripheral arterial disease, organ damage (e.g., cardiac damage or hypertrophy), tissue fibrosis, and other cardiovascular diseases, disorders, and / or conditions, or symptoms thereof. In certain embodiments, RAAS-related diseases, disorders, and / or conditions do not include hypertension.

[0062] As used herein, "resistant hypertension" or "RHTN" is defined as either a) blood pressure above therapeutic goals (typically 130 / 80 mmHg or greater) despite the concurrent use of three or more antihypertensive agents from different drug classes administered at maximum tolerated doses, or b) blood pressure that is controlled below therapeutic goals only after administration of at least four antihypertensive agents from different classes to achieve control.

[0063] As used herein, "RNA" means RNA transcript and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0064] As used herein, "RNAi compound" refers to an antisense compound that acts to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid, at least in part, through RISC or Ago2. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound regulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0065] As used herein with respect to an oligonucleotide, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.

[0066] As used herein, "standard in vitro assay" means the assay described in the Examples and reasonable variations thereof.

[0067] As used herein, "standard in vivo assay" means the assay described in the Examples and reasonable variations thereof.

[0068] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center having a random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0069] As used herein, "subject" means a human or non-human animal.

[0070] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0071] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be conjugated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.

[0072] As used herein, "symptom" or "characteristic" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or a medical professional examining or testing the subject. In certain embodiments, the characteristic is apparent by invasive diagnostic testing, including but not limited to post-mortem examination.

[0073] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid to which an antisense compound is designed to act.

[0074] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0075] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0076] As used herein, "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic effect to a subject. For example, a therapeutically effective amount ameliorates the symptoms of a disease.

[0077] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0078] Embodiment 1: An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0079] Embodiment 2: consisting of 14 to 30 linked nucleosides; an isometric portion of nucleobases 2046 to 2061 of SEQ ID NO: 1; an isometric portion of nucleobases 2271 to 2286 of SEQ ID NO: 1; an isometric portion of nucleobases 2272 to 2287 of SEQ ID NO: 1; 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 14, at least 15, or at least 16 consecutive nucleobases complementary to:

[0080] Embodiment 3: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0081] Embodiment 4: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0082] Embodiment 5: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 14, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0083] Embodiment 6: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0084] Embodiment 7: The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any of SEQ ID NO: 1 or SEQ ID NO: 2, when measured across the nucleobase sequence of the modified oligonucleotide.

[0085] Embodiment 8: The oligomeric compound of any of embodiments 1-7, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.

[0086] Embodiment 9: The oligomeric compound of embodiment 8, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.

[0087] Embodiment 10: The oligomeric compound of any of embodiments 1 to 9, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.

[0088] Embodiment 11: The oligomeric compound of embodiment 10, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0089] Embodiment 12: The oligomeric compound of any of embodiments 1 to 11, wherein the modified oligonucleotide comprises at least one sugar surrogate.

[0090] Embodiment 13: The oligomeric compound of embodiment 12, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0091] Embodiment 14: The oligomeric compound according to any of embodiments 1 to 13, wherein the modified oligonucleotide is a gapmer.

[0092] Embodiment 15: The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of embodiment 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0093] Embodiment 16: The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of embodiment 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.

[0094] Embodiment 17: The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of embodiment 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety or a cEt modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0095] Embodiment 18: The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of embodiment 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE or cEt modified sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0096] Embodiment 19: The oligomeric compound of any of embodiments 1-18, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddddkkk, kkkdddyddddddddkkk, kkkddddddddddddkkk, or eeeeeddddddddddeeeee, wherein "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0097] Embodiment 20: The oligomeric compound according to any of embodiments 1 to 19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0098] Embodiment 21: The oligomeric compound of embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0099] Embodiment 22: The oligomeric compound of embodiment 20 or embodiment 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0100] Embodiment 23: The oligomeric compound according to any of embodiments 20 and 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0101] Embodiment 24: The oligomeric compound of any of embodiments 20, 22, and 23, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0102] Embodiment 25: The oligomeric compound of embodiment 21, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0103] Embodiment 26: A modified oligonucleotide having an internucleoside linkage motif of soossssssssssos, wherein 25. The oligomeric compound of any of embodiments 1-20 or 22-24, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.

[0104] Embodiment 27: The oligomeric compound according to any of embodiments 1 to 26, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0105] Embodiment 28: The oligomeric compound of embodiment 27, wherein the modified nucleobase is 5-methylcytosine.

[0106] Embodiment 29: The oligomeric compound according to any of embodiments 1 to 28, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, or 16 to 20 linked nucleosides.

[0107] Embodiment 30: The oligomeric compound according to any of embodiments 1 to 28, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0108] Embodiment 31: An oligomeric compound according to any one of embodiments 1 to 30, comprising a conjugate group.

[0109] Embodiment 32: The oligomeric compound of embodiment 31, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0110] Embodiment 33: The oligomeric compound according to any one of embodiments 31 and 32, wherein the conjugate group comprises a conjugate linker consisting of a single bond.

[0111] Embodiment 34: The oligomeric compound according to any one of embodiments 31 to 33, wherein the conjugate group comprises a cleavable linker.

[0112] Embodiment 35: The oligomeric compound according to any one of embodiments 31 to 34, wherein the conjugate group comprises a conjugate linker comprising 1 to 3 linker nucleosides.

[0113] Embodiment 36: The oligomeric compound according to any one of embodiments 31 to 35, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0114] Embodiment 37: The oligomeric compound according to any one of embodiments 31 to 35, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0115] Embodiment 38: The oligomeric compound according to any of embodiments 1 to 37, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0116] Embodiment 39: An oligomeric compound according to any of embodiments 1 to 30 or 38, consisting of a modified oligonucleotide.

[0117] Embodiment 40: An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1 to 37.

[0118] Embodiment 41: An antisense compound comprising or consisting of an oligomeric compound according to any of embodiments 1 to 39 or an oligomeric duplex according to embodiment 40.

[0119] Embodiment 42: A pharmaceutical composition comprising an oligomeric compound according to any of embodiments 1 to 39 or an oligomeric duplex according to embodiment 40, and a pharmaceutically acceptable carrier or diluent.

[0120] Embodiment 43: A compound having the following chemical structure:

[0121] [ka]

[0122] (SEQ ID NO: 12), or a salt thereof.

[0123] Embodiment 44: A compound having the following chemical structure:

[0124] [ka]

[0125] (SEQ ID NO: 12).

[0126] Embodiment 45: A compound having the following chemical structure:

[0127] [ka]

[0128] (SEQ ID NO: 13), or a salt thereof.

[0129] Embodiment 46: A compound having the following chemical structure:

[0130] [ka]

[0131] (SEQ ID NO: 13).

[0132] Embodiment 47: A compound having the following chemical structure:

[0133] [ka]

[0134] (SEQ ID NO: 14), or a salt thereof.

[0135] Embodiment 48: A compound having the following chemical structure:

[0136] [ka]

[0137] (SEQ ID NO: 14).

[0138] Embodiment 49: A compound having the following chemical structure:

[0139] [ka]

[0140] (SEQ ID NO: 15), or a salt thereof.

[0141] Embodiment 50: A compound having the following chemical structure:

[0142] [ka]

[0143] (SEQ ID NO: 15).

[0144] Embodiment 51: The modified oligonucleotide of any of embodiments 43, 45, 47, and 49, which is a sodium or potassium salt of the chemical structure:

[0145] Embodiment 52: A pharmaceutical composition comprising a modified oligonucleotide according to any of embodiments 43 to 51 and a pharmaceutically acceptable carrier or diluent.

[0146] Embodiment 53: The following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e 1. A compound comprising a modified oligonucleotide according to (SEQ ID NO: 12), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; A compound wherein o is a phosphodiester internucleoside linkage.

[0147] Embodiment 54: A compound having the following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m Cds T ko T ks T e 1. A compound comprising a modified oligonucleotide according to (SEQ ID NO: 13), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; A compound wherein o is a phosphodiester internucleoside linkage.

[0148] Embodiment 55: A compound having the following chemical notation: G ks T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k 1. A compound comprising a modified oligonucleotide according to (SEQ ID NO: 15), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; A compound wherein s is a phosphorothioate internucleoside linkage.

[0149] Embodiment 56: A compound having the following chemical notation: T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k 1. A compound comprising a modified oligonucleotide according to (SEQ ID NO: 14), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; U is a uracil nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage; A compound wherein o is a phosphodiester internucleoside linkage.

[0150] Embodiment 57: The compound of any of embodiments 53-56, comprising a modified oligonucleotide covalently attached to a conjugate group.

[0151] Embodiment 58: A pharmaceutical composition according to any one of embodiments 53 to 56, and a pharmaceutically acceptable diluent or carrier.

[0152] Embodiment 59: A chirally enriched population of modified oligonucleotides according to any of embodiments 53 to 56, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0153] Embodiment 60: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0154] Embodiment 61: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.

[0155] Embodiment 62: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0156] Embodiment 63: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0157] Embodiment 64: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0158] Embodiment 65: The chirally enriched population of embodiment 59, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp configuration, the Sp configuration, and the Rp configuration in the 5' to 3' direction.

[0159] Embodiment 66: A population of modified oligonucleotides according to any of embodiments 59 to 65, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0160] Embodiment 67: A method comprising administering to an individual a pharmaceutical composition described in any preceding embodiment.

[0161] Embodiment 68: A method of treating a disease associated with the RAAS pathway, comprising administering to an individual having or at risk of having a disease associated with the RAAS pathway a therapeutically effective amount of a pharmaceutical composition of any preceding embodiment, thereby treating the disease associated with the RAAS pathway.

[0162] Embodiment 69: The method of embodiment 68, wherein the disease is a cardiovascular disease.

[0163] Embodiment 70: The method of any of embodiments 68 and 69, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.

[0164] Embodiment 71: The method of any of embodiments 68-70, wherein at least one symptom or feature of the disease is ameliorated.

[0165] Embodiment 72: The method of embodiment 71, wherein the symptom or characteristic is any of hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, pre-eclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary arterial hypertension.

[0166] Embodiment 73: The method of any of embodiments 67-72, wherein the pharmaceutical composition is administered systemically.

[0167] Embodiment 74: The method of any of embodiments 73, wherein the pharmaceutical composition is administered either subcutaneously or intramuscularly.

[0168] Embodiment 75: Use of an oligomeric compound according to any of embodiments 1 to 37 or an oligomeric duplex according to embodiment 40 for reducing AGT expression in a cell.

[0169] Embodiment 76: The use of embodiment 75, wherein the level of AGT RNA is reduced.

[0170] Embodiment 77: The use of embodiment 75, wherein the level of AGT protein is reduced.

[0171] Embodiment 78. An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0172] Embodiment 79. Consists of 14 to 30 linked nucleosides; a. an isometric portion of nucleobases 2046 to 2061 of SEQ ID NO: 1; b. an isometric portion of nucleobases 2271 to 2286 of SEQ ID NO: 1; c. an isometric portion of nucleobases 2272 to 2287 of SEQ ID NO: 1; 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 14, at least 15, or at least 16 consecutive nucleobases complementary to:

[0173] Embodiment 80. An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0174] Embodiment 81. An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0175] Embodiment 82. An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 14, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0176] Embodiment 83. An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0177] Embodiment 84. The oligomeric compound of any of embodiments 78 to 83, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any of SEQ ID NO: 1 or SEQ ID NO: 2, when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0178] Embodiment 85. The oligomeric compound of any of embodiments 78-84, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.

[0179] Embodiment 86. The oligomeric compound of embodiment 85, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.

[0180] Embodiment 87. The oligomeric compound according to any of embodiments 78 to 86, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.

[0181] Embodiment 88 The oligomeric compound of embodiment 87, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0182] Embodiment 89. The oligomeric compound of any of embodiments 78 to 88, wherein the modified oligonucleotide comprises at least one sugar surrogate.

[0183] Embodiment 90 The oligomeric compound of embodiment 89, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0184] Embodiment 91. The oligomeric compound of any of embodiments 78 to 90, wherein the modified oligonucleotide is a gapmer.

[0185] Embodiment 92. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising 92. The oligomeric compound of any of embodiments 78-91, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0186] Embodiment 93. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising 92. The oligomeric compound of any of embodiments 78-91, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.

[0187] Embodiment 94. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; and having a glycomotif comprising 92. The oligomeric compound of any of embodiments 78-91, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE or cEt sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0188] Embodiment 95. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of 43 linked 3' region nucleosides; and having a glycomotif comprising 92. The oligomeric compound of any of embodiments 78-91, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE or cEt sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0189] Embodiment 96. The oligomeric compound of any of embodiments 78-95, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddddkkk, kkkdddyddddddddkkk, kkkddddddddddkkk, or eeeeeddddddddddeeeee, wherein "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0190] Embodiment 97. The oligomeric compound according to any of embodiments 78 to 96, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0191] Embodiment 98. The oligomeric compound of embodiment 97, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0192] Embodiment 99. The oligomeric compound of embodiment 97 or embodiment 98, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0193] Embodiment 100. The oligomeric compound according to any of embodiments 97 and 99, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0194] Embodiment 101. The oligomeric compound of any of embodiments 97, 99, and 100, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0195] Embodiment 102 The oligomeric compound of embodiment 98, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0196] Embodiment 103. The modified oligonucleotide has an internucleoside linkage motif of soossssssssssos, wherein: s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound of any of embodiments 78 to 97 or 99 to 101.

[0197] Embodiment 104. The oligomeric compound according to any of embodiments 78 to 103, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0198] Embodiment 105. The oligomeric compound according to embodiment 104, wherein the modified nucleobase is 5-methylcytosine.

[0199] Embodiment 106. The oligomeric compound according to any of embodiments 78 to 105, wherein the modified oligonucleotide consists of 14 to 30, 14 to 22, 14 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, or 16 to 20 linked nucleosides.

[0200] Embodiment 107. The oligomeric compound according to any of embodiments 78 to 106, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0201] Embodiment 108. An oligomeric compound according to any one of embodiments 78 to 107, comprising a conjugate group.

[0202] Embodiment 109. The oligomeric compound according to embodiment 108, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0203] Embodiment 110. The oligomeric compound according to any one of embodiments 108 and 109, wherein the conjugate group comprises a conjugate linker consisting of a single bond.

[0204] Embodiment 111. The oligomeric compound according to any one of embodiments 108 to 110, wherein the conjugate group comprises a cleavable linker.

[0205] Embodiment 112. The oligomeric compound according to any one of embodiments 108 to 111, wherein the conjugate group comprises a conjugate linker comprising 1 to 3 linker nucleosides.

[0206] Embodiment 113. The oligomeric compound according to any one of embodiments 108 to 112, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-nucleoside of the modified oligonucleotide.

[0207] Embodiment 114. The oligomeric compound according to any one of embodiments 108 to 113, wherein the conjugate group is attached to the modified oligonucleotide at the 3'-nucleoside of the modified oligonucleotide.

[0208] Embodiment 115. The oligomeric compound of any one of embodiments 78 to 114, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0209] Embodiment 116. An oligomeric compound according to any of embodiments 78 to 107 or 115, consisting of a modified oligonucleotide.

[0210] Embodiment 117. The following chemical structure:

[0211] [ka]

[0212] (SEQ ID NO: 12), or a salt thereof.

[0213] Embodiment 118. The following chemical structure:

[0214] [ka]

[0215] An oligomeric compound according to (SEQ ID NO: 12).

[0216] Embodiment 119. The following chemical structure:

[0217] [ka]

[0218] (SEQ ID NO: 13), or a salt thereof.

[0219] Embodiment 120. The following chemical structure:

[0220] [ka]

[0221] An oligomeric compound according to (SEQ ID NO: 13).

[0222] Embodiment 121. The following chemical structure:

[0223] [ka]

[0224] An oligomeric compound according to (SEQ ID NO: 14), or a salt thereof.

[0225] Embodiment 122. The following chemical structure:

[0226] [ka]

[0227] An oligomeric compound according to (SEQ ID NO: 14).

[0228] Embodiment 123. The following chemical structure:

[0229] [ka]

[0230] (SEQ ID NO: 15), or a salt thereof.

[0231] Embodiment 124. The following chemical structure:

[0232] [ka]

[0233] An oligomeric compound according to (SEQ ID NO: 15).

[0234] Embodiment 125. The oligomeric compound of any of embodiments 117, 119, 121, or 123, which is a sodium or potassium salt.

[0235] Embodiment 126. The following chemical notation: m C es G eo m C ko Tds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 12), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0236] Embodiment 127. The following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 13), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0237] Embodiment 128. The following chemical notation: G ks T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 15), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; An oligomeric compound wherein s is a phosphorothioate internucleoside linkage.

[0238] Embodiment 129. The following chemical notation: T ks m C ko G ko G ds U ys T ds Gds G ds A ds A ds T ds T ds m C ds T ko T ks T k 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 14), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; U is a uracil nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0239] Embodiment 130. An oligomeric compound according to any of embodiments 126 to 129, comprising a modified oligonucleotide covalently attached to a conjugate group.

[0240] Embodiment 131. An oligomeric duplex comprising the oligomeric compound of any one of embodiments 78 to 130.

[0241] Embodiment 132. An antisense compound comprising or consisting of an oligomeric compound according to any of embodiments 78 to 130 or an oligomeric duplex according to embodiment 131.

[0242] Embodiment 133. A chirally enriched population of oligonucleotide compounds according to any of embodiments 117 to 130, wherein the population is enriched for compounds comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0243] Embodiment 134. A chirally enriched population according to embodiment 133, wherein the population is enriched for compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0244] Embodiment 135. A chirally enriched population according to embodiment 133, wherein the population is enriched for compounds comprising at least one specific phosphorothioate internucleoside linkage having the (Rp) configuration.

[0245] Embodiment 136. The chirally enriched population of embodiment 133, wherein the population is enriched for compounds having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0246] Embodiment 137. The chirally enriched population of embodiment 133, wherein the population is enriched for compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage, or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0247] Embodiment 138. A chirally enriched population according to embodiment 133, wherein the population is enriched for compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0248] Embodiment 139. The chirally enriched population of embodiment 133, wherein the population is enriched for compounds having at least three consecutive phosphorothioate internucleoside linkages in the Sp configuration, the Sp configuration, and the Rp configuration in the 5' to 3' direction.

[0249] Embodiment 140. A population of oligomeric compounds according to any of embodiments 117-130, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom.

[0250] Embodiment 141. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 78 to 130, an oligomeric duplex according to embodiment 131, an antisense compound according to embodiment 132, or a population according to any one of embodiments 133 to 140, and a pharmaceutically acceptable carrier or diluent.

[0251] Embodiment 142. A method comprising administering to an individual the pharmaceutical composition of embodiment 141.

[0252] Embodiment 143. A method for treating a disease associated with the RAAS pathway, comprising administering a therapeutically effective amount of the pharmaceutical composition described in embodiment 142 to an individual having or at risk of having a disease associated with the RAAS pathway, thereby treating the disease associated with the RAAS pathway.

[0253] Embodiment 144. The method of embodiment 143, wherein the disease is a cardiovascular disease.

[0254] Embodiment 145. The method of any of embodiments 143 and 144, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.

[0255] Embodiment 146. The method of any of embodiments 143 to 145, wherein at least one symptom or characteristic of the disease is ameliorated.

[0256] Embodiment 147. The method of embodiment 146, wherein the symptom or characteristic is any of hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary arterial hypertension.

[0257] Embodiment 148. The method of any one of embodiments 142 to 147, wherein the pharmaceutical composition is administered systemically.

[0258] Embodiment 149. The method of any of embodiments 142 to 148, wherein the pharmaceutical composition is administered subcutaneously or intramuscularly.

[0259] Embodiment 150. Use of an oligomeric compound according to any one of embodiments 78 to 130, an oligomeric duplex according to embodiment 131, an antisense compound according to embodiment 132, or a population according to any one of embodiments 133 to 140, for reducing AGT expression in a cell.

[0260] Embodiment 151. The use of embodiment 150, wherein the level of AGT RNA is reduced.

[0261] Embodiment 152. The use according to embodiment 150, wherein the level of AGT protein is reduced.

[0262] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.

[0263] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0264] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions corresponding to other types of modified sugar moieties.

[0265] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents on the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents on non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 The 2'-substituents are alkyl, and are described in Cook et al., US Pat. No. 6,531,584, Cook et al., US Pat. No. 5,859,221, and Cook et al., US Pat. No. 6,005,087. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, e.g., 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0266] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is alkyl.

[0267] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CHOCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0268] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0269] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, the 2'-deoxyfuranosyl sugar moiety may have seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. Compared to the 2'-deoxyfuranosyl sugar moiety, the 2'-modified sugar moiety has an additional stereocenter at the 2'-position; therefore, such sugar moieties have a total of 16 possible isomeric configurations. The 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0270] Certain modified sugar moieties include a substituent bridging two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 7,741,457). al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), al., US Pat. No. 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R b are independently H, a protecting group, or C1-C 12alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0271] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(Ra)=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, and During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0272] It is also possible to generate a large amount of nucleic acids from the solvent system, as described in Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al al.,J.Am.Chem.Soc.,2007,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al al.,US6,794,499, Wengel et al.,US6,670,461, Wengel et al.,US7,034,133,Wengel et al.,US8,080,644,Wengel et al.,US8,034,909,Wengel et al.,US8,153,365 al., US7,572,582, Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al al.,US7,547,684 Seth et al.,US7,666,854 Seth et al.,US8,088,746 Seth et al.,US7,750,131 Seth et al.,US8,030,467 Seth et al al.,US8,546,556;Seth et al.,USSee U.S. Pat. Nos. 8,530,640, Migawa et al., U.S. Pat. No. 9,012,421, Seth et al., U.S. Pat. No. 8,501,805, and U.S. Patent Publication Nos. US2008 / 0039618 (Allerson et al.) and US2015 / 0191727 (Migawa et al.).

[0273] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.

[0274] [ka]

[0275] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a specific bicyclic nucleoside (e.g., LNA or cEt) is identified in exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0276] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).

[0277] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, the modified sugar moiety also includes bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.

[0278] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0279] [ka]

[0280] ("F-HNA", see, e.g., Swayze et al., US 8,088,904, Swayze et al., US 8,440,803, Swayze et al., US 8,796,437, and Swayze et al., US 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides containing additional modified THP compounds having the formula:

[0281] [ka]

[0282] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0283] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0284] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685, Summerton et al., US 5,166,315, Summerton et al., US 5,185,444, and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a group having the structure:

[0285] [ka]

[0286] means a sugar surrogate having the formula:

[0287] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures described above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0288] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0289] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.

[0290] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, which are called abasic nucleosides.

[0291] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8- Selected from substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0292] Publications teaching certain preparations of the above modified nucleobases, as well as other modified nucleobases, include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al. al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. al., US 5,587,470, Cook et al., US 5,457,191, Matteucci et al., US 5,763,588, Froehler et al., US 5,830,653, Cook et al., US 5,808,027, Cook et al., US 6,166,199, and Matteucci et al., US 6,005,096.

[0293] 3. Certain modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, including phosphodiester linkages ("P(O2)=O") (also referred to as unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P(O2)=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to natural phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0294] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 99% of the molecules in the population.Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulae, where "B" represents a nucleobase:

[0295] [ka]

[0296] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0297] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580, Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH constituent moieties.

[0298] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides containing modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moiety, nucleobase, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0299] 1. A specific glycomotif In certain embodiments, oligonucleotides comprise one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or portions thereof in a defined pattern or sugar motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.

[0300] In certain embodiments, the modified oligonucleotides have a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moieties of each nucleoside in the wing being different from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that are different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0301] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each gapmer wing comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each gapmer wing comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each gapmer wing comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each gapmer wing comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each gapmer wing comprise a modified sugar moiety. In certain embodiments, at least five nucleosides in each gapmer wing comprise a modified sugar moiety.

[0302] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, at least 6 nucleosides of the gapmer gap comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0303] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, nucleosides on the gap side of each wing / gap junction comprise a 2'-deoxyribosyl sugar moiety, and nucleosides on the wing side of each wing / gap junction comprise a modified sugar moiety. In certain embodiments, at least six nucleosides of the gap of the gapmer comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety.

[0304] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, and each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0305] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides are composed of a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of five linked nucleosides with modified sugar moieties in the 5'-wing, eight linked 2'-deoxynucleosides in the gap, and five linked nucleosides with modified sugar moieties in the 3'-wing. A mixed-wing gapmer has at least two different modified sugars in the 5' and / or 3' wings. A 5-8-5 or 5-8-4 mixed-wing gapmer has at least two different modified sugar moieties in the 5' and / or 3' wings.

[0306] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1, 2, 3, 4, 5, or 6 linked 2'-MOE nucleosides, and Y is 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0307] In certain embodiments, the modified oligonucleotide has a sugar motif selected from the following (5' to 3'): meeemddddddddddmmmmm, where "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, and "m" represents a 2'-OMe sugar moiety.

[0308] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of a modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0309] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0310] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0311] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or portion thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P(O2)=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O2)=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within a wing are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate internucleoside linkages in a wing are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0312] In certain embodiments, all of the internucleoside linkages are either phosphodiester or phosphorothioate internucleoside linkages and the chiral motif is (5' to 3'): Sp-ooo-Sp-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, where each "Sp" represents an (Sp) phosphorothioate internucleoside linkage, each "Rp" is an Rp internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0313] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):sooooossssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):soooossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):sooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):sooossssssssssoooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of (5' to 3'):sooosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0314] C. A certain total length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of target nucleic acids in an oocyte injection model. 25 nucleobase-long oligonucleotides with 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of target nucleic acids, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0315] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, an oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 2 Consisting of 2 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0316] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif can be modified or unmodified, and the sugar modification may or may not follow the gapmer modification pattern. For example, the internucleoside linkages within the wing regions of a sugar gapmer can be the same or different from one another and the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides can contain one or more modified nucleobases regardless of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0317] E. Certain populations of modified oligonucleotides A population of modified oligonucleotides, in which all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides in the stereorandom population are stereorandom. In a chirally enriched population, at least one specific chiral center is not stereorandom among the modified oligonucleotides in the population. In certain embodiments, the modified oligonucleotides in the chirally enriched population are enriched in β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0318] F. Nucleic Acid Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence.In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain embodiments, the nucleobase sequence of a portion or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0319] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. The conjugate group may be attached to either or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both ends of an oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5'-end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0320] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.

[0321] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties and clearance properties.In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows the oligonucleotide to be detected. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0322] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0323] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.

[0324] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker.In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond).In certain oligomeric compounds, the conjugate moiety is linked to the oligonucleotide via a more complex conjugate linker, which comprises one or more conjugate linker moieties, which are the subunits that make up the conjugate linker.In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0325] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0326] In certain embodiments, the conjugate linker, including the conjugate linkers described above, is a bifunctional linking moiety, e.g., one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide, provided herein. Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups and nucleophilic groups for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0327] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0328] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0329] As used herein, linker nucleosides are not considered part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker containing linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound exceeds 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise specified, the conjugate linker contains 10 or less linker nucleosides. In certain embodiments, the conjugate linker contains 5 or less linker nucleosides. In certain embodiments, the conjugate linker contains 3 or less linker nucleosides. In certain embodiments, the conjugate linker contains 2 or less linker nucleosides. In certain embodiments, the conjugate linker contains 1 or less linker nucleoside.

[0330] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, and after the oligomeric compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome.In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0331] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0332] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxyribonucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphodiester internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0333] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0334] [ka]

[0335] In the formula, n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or more, j is 1 or 0, and k is 1 or 0.

[0336] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0337] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0338] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0339] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of the oligomeric duplex may comprise non-complementary overhanging nucleosides.

[0340] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid to confer at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to confer one or more desired antisense activities, but does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.

[0341] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein as being "DNA-like" enough to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides within the gap of a gapmer are tolerated.

[0342] In certain antisense activity, antisense compound or antisense compound part is incorporated into RNA-induced silencing complex (RISC), and finally leads to the cleavage of target nucleic acid.For example, certain antisense compound leads to the cleavage of target nucleic acid by Argonaute.The antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0343] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0344] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.

[0345] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, which comprise introns, exons, and untranslated regions. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0346] A. Complementarity / Mismatch with Target Nucleic Acid It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotide, for their ability to terminate the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest degree than the 28 or 42 nucleobase oligonucleotides.

[0347] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide.In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid.In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and comprises a portion that is 100% or completely complementary to the target nucleic acid.In certain embodiments, the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.

[0348] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against non-targets is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the gap region. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, or 6 from the 5' end of the 5' wing region or the 3' wing region.

[0349] B.AGT In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to a target nucleic acid, wherein the target nucleic acid is an AGT nucleic acid. In certain embodiments, the AGT nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_000029.3) or SEQ ID NO: 2 (the complement of GENBANK Accession No. NC_000001.11 truncated at nucleotides 230700001 to 230718000).

[0350] In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NOs: 1 and 2 reduces the amount of AGT RNA, and in certain embodiments, reduces the amount of AGT protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NOs: 1 and 2 reduces the amount of AGT RNA in the cell, and in certain embodiments, reduces the amount of AGT protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is within a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to any of SEQ ID NOs: 1 and 2 ameliorates one or more symptoms or features of cardiovascular disease. In certain embodiments, the disease is hypertension. In certain embodiments, the disease is resistant hypertension. In certain embodiments, the disease is Marfan syndrome. In certain embodiments, the disease is heart failure. In certain embodiments, the condition or characteristic is selected from hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, valvular heart disease, vascular aneurysm, peripheral arterial disease, and organ damage.

[0351] In certain embodiments, oligomeric compounds complementary to either of SEQ ID NOs: 1 and 2, when administered according to a standard cellular assay, can reduce the amount of AGT RNA detectable in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NOs: 1 or 2, when administered according to a standard in vitro assay, can reduce the amount of AGT in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of AGT RNA detectable in a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0352] VI. Certain Conjugated Compounds In certain embodiments, the oligomeric compounds described herein comprise or consist of an oligonucleotide (modified or unmodified), and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both ends of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both ends of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3'-end and / or 5'-end of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5'-end of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0353] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleic acid base sequence that is complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to pre-mRNA. In certain embodiments, the oligonucleotide is complementary to sense transcript.

[0354] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified. In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties, and clearance properties.In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows the oligonucleotide to be detected. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0355] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0356] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.

[0357] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker.In certain compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond).In certain compounds, the conjugate moiety is linked to the oligonucleotide via a more complex conjugate linker, which comprises one or more conjugate linker moieties, which are the subunits that make up the conjugate linker.In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0358] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0359] In certain embodiments, the conjugate linker, including the conjugate linkers described above, is a bifunctional linking moiety, e.g., one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide, provided herein. Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups and nucleophilic groups for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0360] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0361] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleoside to be cleaved from the compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0362] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where a compound includes an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the compound also includes a conjugate group containing a conjugate linker that includes linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound may include (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group containing 1 to 10 linker nucleosides contiguous with a nucleoside of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is greater than 30. Alternatively, a compound may include a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0363] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, a compound containing a specific conjugate moiety is better taken up by a specific cell type, and once the compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome.In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0364] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0365] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0366] 3. Certain cell-targeting conjugate moieties In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0367] [ka]

[0368] In the formula, n is 1 to about 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0369] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0370] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0371] In certain embodiments, the cell targeting moiety comprises a branched group comprising one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain embodiments, the branched group comprises a branched aliphatic group comprising a group selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain such embodiments, the branched aliphatic group comprises a group selected from alkyl, amino, and ether groups. In certain such embodiments, the branched aliphatic group comprises a group selected from alkyl and ether groups. In certain such embodiments, the branched group comprises a monocyclic or polycyclic ring system.

[0372] In certain embodiments, each tether of the cell targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or a neutral linking group. In certain embodiments, each tether comprises a chain length of about 6 to about 20 atoms. In certain embodiments, each tether comprises a chain length of about 10 to about 18 atoms. In certain embodiments, each tether comprises a chain length of about 10 atoms.

[0373] In certain embodiments, each ligand of the cell-targeting moiety has affinity for at least one receptor type on the target cell. In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and fucose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises two GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises one GalNAc ligand.

[0374] In certain embodiments, each ligand of the cell targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, for example, Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, 47, 5798-5808). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, the amino sugar can be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, the thio sugar can be selected from 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

[0375] In certain embodiments, the conjugate group has the following formula:

[0376] [ka]

[0377] The cell-targeting moiety comprises:

[0378] In certain embodiments, the conjugate group has the following formula:

[0379] [ka]

[0380] The cell-targeting moiety comprises:

[0381] In certain embodiments, the conjugate group has the following formula:

[0382] [ka]

[0383] The cell-targeting moiety comprises:

[0384] In certain embodiments, the conjugate group has the following formula:

[0385] [ka]

[0386] The cell-targeting moiety comprises:

[0387] In certain embodiments, the conjugate group has the following formula:

[0388] [ka]

[0389] The cell-targeting moiety comprises:

[0390] In certain embodiments, the compound comprises a conjugate group described herein as "LICA-1." LICA-1 has the following formula:

[0391] [ka]

[0392] It has. In certain embodiments, the compounds described herein comprise LICA-1, and the cleavable moiety in the conjugate linker has the following formula:

[0393] [ka]

[0394] and where oligo is an oligonucleotide.

[0395] Representative U.S. patents, U.S. patent application publications, international patent application publications, and other publications that teach the specific preparation of compounds containing the above-described conjugate groups, conjugate groups, tethers, conjugate linkers, branching groups, ligands, cleavable moieties, and other modifications include, but are not limited to, U.S. Pat. No. 5,994,517, U.S. Pat. No. 6,300,319, U.S. Pat. No. 6,660,720, U.S. Pat. No. 6,906,182, U.S. Pat. No. 7,262,177, U.S. Pat. No. 7,491,805, U.S. Pat. No. 8,106,022, U.S. Pat. No. 7,723,509, U.S. Pat. No. 2006 / 0148740, U.S. Pat. No. 2011 / 0123520, WO2013 / 033230, and WO2012 / 037254; Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee ... al., Bioorganic & Medicinal Chemistry 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; and Valentijn et al., Tetrahedron, 1997, 53, 759-770.

[0396] In certain embodiments, the modified oligonucleotide comprises a gapmer or a fully modified sugar motif and a conjugate group comprising at least one, two, or three GalNAc ligands. In certain embodiments, the compound is selected from the group consisting of hydroxybenzoates, hydroxybenzoates, and hydroxybenzoates, as described in the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., al., Tetrahedron,1997,53,759-770, Kim et al., Tetrahedron Lett,1997,38,3487-3490, Lee et al.,Bioconjug Chem,1997,8,762-765, Kato et al.,Glycobiol,2001,11,821-829, Rensen et al. al., J Biol Chem,2001,276,37577-37584, Lee et al.,Methods Enzymol,2003,362,38-43, Westerlind et al.,Glycoconj J,2004,21,227-241, Lee et al.,Bioorg Med Chem Lett,2006,16(19),5132-5135, Maierhofer et al.,Bioorg Med Chem,2007,15,7661-7676, Khorev et al.,Bioorg Med Chem,2008,16,5216-5231, Lee et al.,Bioorg Med Chem,2011,19,2494-2500,Kornilova et al.,Analyt Biochem,2012,425,43-46,Pujol et al.,Angew Chemie Int Ed Engl,2012,51,7445-7448、Biessen et al.,J Med Chem,1995,38,1846-1852、Sliedregt et al.,J Med Chem,1999,42,609-618、Rensen et al.,J Med. Chem,2004,47,5798-5808、Rensen et al.,Arterioscler Thromb Vasc Biol,2006,26,169-175、van Rossenberg et al.,Gene Ther,2004,11,457-464、Sato et al.,J Am Chem. Soc,2004,126,14013-14022、Lee et al.,J Org Chem,2012,77,7564-7571、Biessen et al.,FASEB J,2000,14,1784-1792、Rajur et al.,Bioconjug Chem,1997,8,935-940、Duff et al.,Methods Enzymol,2000,313,297-321、Maier et al.,Bioconjug Chem,2003,14,18-29、Jayaprakash et al.,Org Lett,2010,12,5410-5413、Manoharan,Antisense Nucleic Acid Drug Dev,2002,12,103-128、Merwin et al.,Bioconjug Chem,1994,5,612-620、Tomiya et al.,Chem Bioorg,20135275-5281, International Application Nos. WO1998 / 013381, WO2011 / 038356, WO1997 / 046098, WO2008 / 098788, WO2004 / 101619, WO2012 / 037254, WO2011 / 120053, WO2011 / 100131, WO2011 / 163121, WO2012 / 177947, WO2013 / 033230, WO2013 / 075035, WO 2012 / 083185, WO2012 / 083046, WO2009 / 082607, WO2009 / 134487, WO2010 / 144740, WO2010 / 148013, WO1997 / 020 563, WO2010 / 088537, WO2002 / 043771, WO2010 / 129709, WO2012 / 068187, WO2009 / 126933, WO2004 / 024757, WO Nos. 2010 / 054406, WO2012 / 089352, WO2012 / 089602, WO2013 / 166121, WO2013 / 165816, U.S. Patent Nos. 4,751,219, 8,552,163, 6,908,903, 7,262,177, 5,994,517, 6,300,319, 8,106,022, 7,491,805, 7,491,805, 7,582,744, and 8,137 , 695, 6,383,812, 6,525,031, 6,660,720, 7,723,509, 8,541,548, 8,344,125, 8,313,772, 8,349,308, No. 8,450,467, No. 8,501,930, No. 8,158,601, No. 7,262,177, No. 6,906,182, No. 6,620,916, No. 8,435,491, No. 8,404,862, No. 7,851,615, published U.S. patent applications US2011 / 0097264, US2011 / 0097265, US2013 / 0004427, US2005 / 0164235, US2006 / 0148740, US2008 / 0281044, US2010 / 0240730, US200 US2003 / 0119724, US2006 / 0183886, US2008 / 0206869, US2011 / 0269814, US2009 / 0286973, US2011 / 0207799, US2012 / 0136042, US2012 / 0165393, US2008 / 02810 41, US2009 / 0203135, US2012 / 0035115, US2012 / 0095075, US2012 / 0101148 , US2012 / 0128760, US2012 / 0157509, US2012 / 0230938, US2013 / 0109817, U and US2009 / 0203132.

[0397] VII. Certain Pharmaceutical Compositions In certain embodiments, provided herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a saline solution and one or more oligomeric compounds. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical-grade PBS.

[0398] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0399] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0400] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure also covers pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs contain one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0401] Lipid moieties are used in various ways in nucleic acid therapy.In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids.In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0402] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0403] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0404] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components may be varied; for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0405] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0406] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in a protonated (free acid) form or an ionized (salt) form associated with a cation, and aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms, all in equilibrium at multiple positions. The term "oligonucleotide" is intended to encompass all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are intended to encompass corresponding forms as well. Herein, structures depicting the free acid form of a compound followed by the term "or a salt thereof" explicitly encompass all such forms, which may be fully or partially protonated, deprotonated, or associated with a cation. In certain instances, one or more specific cations are identified.

[0407] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0408] Certain doses are described herein. The dose may be in the form of a dosage unit. For clarity, the dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when a modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still counted in the weight of the dose, and the mass of the Na+ ions is not counted in the weight of the dose. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such an oligomeric compound. If the conjugate group also bears an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating dosage.

[0409] VIII. Certain Compositions 1. Compound number 1205407 In certain embodiments, compound No. 1205407 is characterized as a 3-10-3 MOE / cEt mixed wing gapmer conjugated to a conjugate group at the 5' end. Compound 1205407 has the sequence (5' to 3') CGCTGATTTGTCCGGG (SEQ ID NO: 12), nucleosides 1-3 have (5' to 3') eek sugar modifications, nucleosides 14-16 have kke sugar modifications, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, nucleosides 4-13 are each 2'-β-D-deoxynucleosides, and between nucleosides 2 and 3, between 3 and 4, The internucleoside linkages between nucleosides 1 and 2, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, and 15 and 16 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine. Compound No. 1205407 has a 5'-trishexylamino-(THA)-C6GalNAc3 end cap represented by the following structure, with the phosphate group attached to the 5'-oxygen atom of the 5'-nucleoside.

[0410] [ka]

[0411] In certain embodiments, compound number 1205407 has the following chemical notation: THA-C6-GalNAc3- m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds Gko G ks G e (SEQ ID NO: 12), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0412] In certain embodiments, compound number 1205407 has the following chemical structure:

[0413] [ka]

[0414] (SEQ ID NO: 12), or a salt thereof.

[0415] In certain embodiments, the sodium salt of compound number 1205407 has the following chemical structure:

[0416] [ka]

[0417] (SEQ ID NO: 12). In certain embodiments, compound number 1205407 is in anionic form.

[0418] 2. Compound number 1205408 In certain embodiments, compound No. 1205408 is characterized as a 3-10-3 MOE / cEt mixed wing gapmer conjugated to a conjugate group at the 5' end. Compound 1205408 has the sequence (5' to 3') TCGGTTGGAATTCTTT (SEQ ID NO: 13), nucleosides 1-3 have (5' to 3') ekk sugar modifications, nucleosides 14-16 have kke sugar modifications, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, nucleosides 4-13 are each 2'-β-D-deoxynucleosides, and between nucleosides 2 and 3, between 3 and 4, The internucleoside linkages between nucleosides 1 and 2, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, and 15 and 16 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine. Compound No. 1205408 has a 5'-trishexylamino-(THA)-C6GalNAc3 end cap, represented by the following structure, in which the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside.

[0419] [ka]

[0420] In certain embodiments, compound number 1205408 has the following chemical designation: THA-C6-GalNAc3-T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ksT e (SEQ ID NO: 13), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0421] In certain embodiments, compound number 1205408 has the following chemical structure:

[0422] [ka]

[0423] (SEQ ID NO: 13), or a salt thereof.

[0424] In certain embodiments, the sodium salt of compound number 1205408 has the following chemical structure:

[0425] [ka]

[0426] (SEQ ID NO: 13). In certain embodiments, compound number 1205408 is in anionic form.

[0427] 3. Compound No. 1250837 In certain embodiments, compound No. 1250837 is characterized as a 3-10-3 gapmer conjugated at its 5' end to a conjugate group. Compound 1250837 has the sequence (5' to 3') of GTCGGTTGGAATTCTT (SEQ ID NO: 15), in which nucleosides 1-3 and 14-16 have a cEt sugar modification, nucleoside 5 has a 2'-OMe ribose sugar, nucleosides 4 and 6-13 are each 2'-β-D-deoxynucleosides, each internucleoside linkage between the nucleosides is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine. Compound No. 1250837 has a 5'-trishexylamino-(THA)-C6GalNAc3 end cap, represented by the following structure, in which the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside.

[0428] [ka]

[0429] In certain embodiments, compound number 1250837 has the following chemical designation: THA-C6-GalNAc3-G ks T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k (SEQ ID NO: 15), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage.

[0430] In certain embodiments, compound number 1250837 has the following chemical structure:

[0431] [ka]

[0432] (SEQ ID NO: 15), or a salt thereof.

[0433] In certain embodiments, the sodium salt of Compound No. 1250837 has the following chemical structure:

[0434] [ka]

[0435] (SEQ ID NO: 15). In certain embodiments, compound number 1250837 is in anionic form.

[0436] 4. Compound No. 1250851 In certain embodiments, compound No. 1250851 is characterized as a 3-10-3 gapmer conjugated at the 5' end to a conjugate group. Compound 1250851 has the sequence (5' to 3') of TCGGUTGGAATTCTTT (SEQ ID NO: 14), in which nucleosides 1-3 and 14-16 have a cEt sugar moiety, nucleoside 5 has a 2'-OMe ribose sugar, nucleosides 4 and 6-13 are each 2'-β-D-deoxynucleosides, and the internucleoside moieties between nucleosides 2 and 3, 3 and 4, and 14 and 15 are 2'-β-D-deoxynucleosides. The internucleoside linkages are phosphodiester, and the internucleoside linkages between nucleosides 1 and 2, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, and 15 and 16 are phosphorothioate, and each cytosine is a 5-methylcytosine. Compound No. 1250851 has a 5'-trishexylamino-(THA)-C6GalNAc3 end cap, represented by the following structure, with the phosphate group attached to the 5'-oxygen atom of the 5'-nucleoside.

[0437] [ka]

[0438] In certain embodiments, compound number 1250851 has the following chemical designation: THA-C6-GalNAc3-T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k (SEQ ID NO: 14), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; U is a uracil nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0439] In certain embodiments, compound number 1250851 has the following chemical structure:

[0440] [ka]

[0441] (SEQ ID NO: 14), or a salt thereof.

[0442] In certain embodiments, the sodium salt of compound number 1250851 has the following chemical structure:

[0443] [ka]

[0444] (SEQ ID NO: 14). In certain embodiments, compound number 1250851 is in anionic form.

[0445] VI. Certain Comparative Compositions In certain embodiments, Compound No. 757456 is a comparative compound. Compound No. 757456 was previously described in WO2017062816, which is incorporated herein by reference, and has the sequence (5' to 3') CACAAACAAGCTGGTCGGTT (SEQ ID NO: 28), wherein the compound comprises a conjugate group and a modified oligonucleotide, the modified oligonucleotide being a 5-10-5 MOE gapmer, the central gap segment consisting of 10 2'-β-D-deoxynucleosides, and the 5' and 3' wing segments each consisting of 5 2'-MOE modified nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. Compound No. 757456 has a 5'-trishexylamino-(THA)-C6GalNAc3 endcap, represented by the following structure, in which the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside.

[0446] [ka]

[0447] In certain embodiments, Compound No. 568637 is a comparative compound. Compound No. 568637 has been previously described in WO2017062816, which is incorporated herein by reference, and has the sequence (5' to 3') CGCTGATTTGTCCGGG (SEQ ID NO: 12), where the compound is composed of a modified oligonucleotide, the modified oligonucleotide being a 16-nucleoside long nucleoside with mixed sugar moieties, as described by the sugar motif eekddddddddddkke, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.

[0448] In certain embodiments, Compound No. 1176644 is a comparative compound. Compound No. 1176644 is Compound No. 568637, which has a 5'-trishexylamino-(THA)-C6GalNAc3 endcap. Compound No. 1176644, like Compound No. 568637, has the sequence (5' to 3') CGCTGATTTGTCCGGG (SEQ ID NO: 12), and the compound comprises a modified oligonucleotide, which is 16 nucleosides in length and has mixed sugar moieties, as described by the sugar motif eekddddddddddkke, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosines.

[0449] In certain embodiments, the compounds described herein are superior to the compounds described in WO2017062816 because they exhibit one or more improved properties, such as potency.

[0450] For example, Compound No. 1205407 demonstrated improved in vivo efficacy compared to Compound No. 757456. As shown in Example 5, Compound No. 1205407 achieved 93% and 90% inhibition of AGT RNA and protein, respectively, at a dose of 2.7 mg / kg. In contrast, Compound No. 757456 achieved 65% and 60% inhibition of AGT RNA and protein, respectively, at a dose of 3.3 mg / kg. Thus, Compound No. 1205407 is more potent than Compound No. 757456 in this assay. For example, as shown in Study 1 of Example 6, Compound No. 1205407 demonstrated an EDTA of 0.1 in liver and plasma. 50 In contrast, compound No. 757456 achieved an ED of 1.3 in liver and plasma. 50 Thus, compound no. 1205407 is more potent than compound no. 757456 in this assay.

[0451] For example, Compound No. 1205407 demonstrated improved potency ex vivo compared to Compound No. 757456. As shown in Example 8, Compound No. 1205407 exhibited an IC of 0.04 nM ex vivo using the Hepatopac system. 50 In contrast, compound 757456 achieved an IC of >20 μM ex vivo. 50 Thus, compound no. 1205407 is more potent than compound no. 757456 in this assay.

[0452] For example, Compound No. 1205407 demonstrated improved potency in vitro compared to Compound No. 757456 or Compound No. 1176644. As shown in Example 7, Compound No. 1205407 exhibited IC values ​​of 8 nM and 12 nM when tested with two different primer-probe sets in vitro. 50 In contrast, compound No. 757456 achieved IC values ​​of 868 nM and 709 nM under the same culture conditions in vitro. 50 In contrast, compound No. 1176644 achieved IC values ​​of 35 nM and 43 nM under the same in vitro culture conditions. 50 Thus, Compound No. 1205407 is more potent than Compound No. 757456 or Compound No. 1176644 in this assay.

[0453] For example, Compound No. 1205407 demonstrated improved efficacy in vivo compared to Compound No. 757456 or Compound No. 1176644. As shown in Study 2 of Example 6, Compound No. 1205407 had an EDTA of 0.11 in a transgenic mouse study. 50 and ED of 0.38 75 In contrast, compound No. 757456 achieved an ED of 2.1. 50 and 2.68 ED 75 In contrast, compound number 1176644 achieved an ED of 0.38. 50 and ED of 0.61 75Thus, Compound No. 1205407 is more potent than Compound No. 757456 or Compound No. 1176644 in this assay.

[0454] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0455] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each of the references, GenBank accession numbers, etc. listed in this application is incorporated herein by reference in its entirety.

[0456] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA," as appropriate, in practice, these sequences can be modified with any combination of chemical modifications. Those of skill in the art will readily understand that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar moiety (2'-OH instead of the single 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of the uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids comprising any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG," whether modified or unmodified, can be used in combination with such compounds containing RNA bases, such as, but not limited to, those having the sequence "AUCGAUCG," as well as those having some DNA bases and some RNA bases, such as "AUCGATCG." m and oligomeric compounds having other modified nucleobases such as "AACGAUCG", m C denotes a cytosine base containing a methyl group at the 5-position.

[0457] Certain compounds (e.g., modified oligonucleotides) described herein possess one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms) unless otherwise specified. Similarly, all cis and trans isomers and tautomeric forms of the compounds herein are included unless otherwise indicated. Oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0458] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S,34 S, 35 S, or 36 Examples include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution may impart new properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution may make the compounds suitable for research or diagnostic purposes, such as imaging. [Example]

[0459] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors have intended the general application of those specific embodiments.

[0460] Example 1: Design of modified oligonucleotides complementary to human AGT nucleic acids Modified oligonucleotides complementary to human AGT nucleic acids were designed as described in the tables below. In all tables below, "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Stop Site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_000029.3), or SEQ ID NO: 2 (the complement of GENBANK Accession No. NC_000001.11 truncated from nucleotides 230700001 to 230718000), or both.

[0461] The modified oligonucleotides in Table 1 are 16 nucleosides in length with the mixed sugar moieties shown in the table below, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. 568637 is a comparative compound previously described in WO2017 / 062816.

[0462] [Table 1]

[0463] All modified oligonucleotides in Tables 2-6 have a 5'-trishexylamino-(THA)-C6GalNAc3 end cap, represented by the following structure, in which the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside.

[0464] [ka]

[0465] The modified oligonucleotides in Table 2 are 16 nucleosides in length with the mixed sugar moieties shown, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" refers to a cEt sugar moiety. The gapmer internucleoside linkage motif is (5' to 3') soossssssssssos, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.

[0466] [Table 2]

[0467] The modified oligonucleotides in Table 3 are 16 nucleosides in length with the mixed sugar moieties shown, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" refers to a cEt sugar moiety, and each "y" refers to a 2'-OMe ribose sugar. The gapmer internucleoside linkage motif is (5' to 3') soossssssssssos, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage. All cytosine residues are shown in bold and underlined.

[0468]

number

[0469] Unless indicated by a , it is a 5-methylcytosine; if bold and underlined, the cytosine is unmethylated.

[0470] [Table 3]

[0471] The modified oligonucleotides in Table 4 are 16 nucleosides in length with the mixed sugar motifs shown, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, and "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.

[0472] [Table 4]

[0473] The modified oligonucleotides in Table 5 are 16 nucleosides in length with the mixed sugar motifs shown, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, and "y" refers to a 2'-OMe ribose sugar. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are represented by bold underlined letters.

[0474]

number

[0475] Unless indicated by a , it is a 5-methylcytosine; if bold and underlined, the cytosine is unmethylated.

[0476] [Table 5]

[0477] The modified oligonucleotides in Table 6 are 5-10-5MOE gapmers with uniform phosphorothioate internucleoside linkages. The compounds are 20 nucleosides long, with the central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of five 2'-MOE modified nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. 757456 is a comparative compound previously described in WO2017 / 062816.

[0478] [Table 6]

[0479] Example 2: Dose-dependent in vitro inhibition of human AGT in HepG2 cells HepG2 cells cultured at a density of 10,000 cells per well were treated by electroporation with modified oligonucleotides diluted to different concentrations, as specified in the table below. After a treatment period of approximately 24 hours, AGT RNA levels were measured as described above using the human AGT primer probe set RTS3721 (described hereinabove). AGT RNA levels were normalized to human GAPDH expression levels using primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 9; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 10; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 11). The results are expressed in the table below as percent inhibition of AGT compared to untreated control cells. As used herein, a value of "0" indicates that treatment with the modified oligonucleotides did not inhibit AGT mRNA levels.

[0480] [Table 7]

[0481] Example 3: Tolerance of modified oligonucleotides targeting human AGT in CD-1 mice CD1 mice are a versatile mouse model frequently used for safety and efficacy testing. Mice were treated with modified oligonucleotides selected from the studies described above and evaluated for changes in the levels of various plasma chemical markers.

[0482] treatment Groups of 6-8 week old male CD-1 mice were injected subcutaneously with 15 mg / kg of the modified oligonucleotide once a week for 6 weeks (7 treatments total). One group of male CD-1 mice was injected with saline. Mice were euthanized 72 hours after the final injection.

[0483] Plasma chemical markers To assess the effects of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), albumin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (CREA), and total bilirubin (TBIL) were measured using a clinical chemistry automated analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below.

[0484] [Table 8]

[0485] Blood obtained from the mouse groups at week 6 was sent to IDEXX BioResearch for blood cell counts. Counts measured included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), and platelets (PLT). The results are shown in the table below.

[0486] [Table 9]

[0487] Mice were weighed on days 1 and 35, and the average weight for each group is presented in the table below. Liver, spleen, and kidney weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused changes in organ weights outside the expected range for the modified oligonucleotide were excluded from further studies.

[0488] [Table 10]

[0489] Example 4: Tolerance of modified oligonucleotides targeting human AGT in Sprague-Dawley rats Sprague-Dawley rats are a versatile model used for safety and efficacy evaluation. Rats were treated with Ionis-modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemical markers.

[0490] Research 1 treatment Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow ad libitum. Groups of four Sprague-Dawley rats each received a weekly subcutaneous injection of 15 mg / kg Ionis oligonucleotide for six weeks (six doses total). 72 hours after the last dose, the rats were euthanized and organs, urine, and plasma were collected for further analysis.

[0491] Plasma chemical markers To assess the effect of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using a clinical chemistry automated analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured, and the results are presented in the table below, expressed in IU / L. Plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the table below.

[0492] [Table 11]

[0493] Organ weight Liver, heart, spleen, and kidney weights were measured at the end of the study and are presented in the table below.

[0494] [Table 12]

[0495] renal function To assess the effect of Ionis-modified oligonucleotides on renal function, urinary levels of total protein and creatinine were measured using a clinical chemistry automated analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratios (P / C ratios) are presented in the table below.

[0496] [Table 13]

[0497] Research 2 treatment Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow ad libitum. Groups of four Sprague-Dawley rats each received a weekly subcutaneous injection of 15 mg / kg Ionis oligonucleotide for six weeks (six doses total). 72 hours after the last dose, the rats were euthanized and organs, urine, and plasma were collected for further analysis.

[0498] Plasma chemical markers To assess the effect of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using a clinical chemistry automated analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured, and the results are presented in the table below, expressed in IU / L. Plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the table below.

[0499] [Table 14]

[0500] Organ weight Liver, heart, spleen, and kidney weights were measured at the end of the study and are presented in the table below.

[0501] [Table 15]

[0502] renal function To assess the effect of Ionis-modified oligonucleotides on renal function, urinary levels of total protein and creatinine were measured using a clinical chemistry automated analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratios (P / C ratios) are presented in the table below.

[0503] [Table 16]

[0504] Example 5: Activity of modified oligonucleotides complementary to human AGT in transgenic mice The AGT transgenic mouse model was developed in Dr. Curt Sigmund's laboratory by inserting a 14 kb transgenic construct containing the entire human angiotensinogen gene (approximately 11.5 kb) and 5' (1.2 kb) and 3' (1.4 kb) flanking sequences (Yang G; et al. 1994. J Biol Chem 269(51):32497-502), and was used for further testing of the modified oligonucleotides described above.

[0505] treatment AGT transgenic mice were divided into two groups of mice. Each mouse was subcutaneously injected once a week with 2.7 mg / kg of the modified oligonucleotide (a total of two doses on days 0 and 7). Two groups of mice were administered saline as a negative control. In addition, two groups of mice were administered 3.3 mg / kg of the comparative modified oligonucleotide 757456 (a total of two doses on days 0 and 7). The mice were sacrificed three days after the last administration (day 10). Livers and plasma were collected for analysis.

[0506] RNA and protein analysis RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described hereinabove). Results were normalized to the total RNA content measured by RIBOGREEN® and expressed as the percent inhibition of AGT RNA compared to saline control. In addition, plasma was extracted and the human AGT protein level in plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, Cat. No. 27412). Results were expressed as the percent inhibition of AGT protein compared to saline control.

[0507] [Table 17]

[0508] Example 6: Efficacy of modified oligonucleotides complementary to human AGT RNA in transgenic mice, multiple doses The modified oligonucleotides were further tested in a dose-dependent manner in the transgenic mouse model described above.

[0509] treatment AGT transgenic mice were divided into groups of two mice each. Each mouse was subcutaneously injected with two doses (on days 0 and 7) of the modified oligonucleotide at the concentrations shown in the table below. A group of four mice was administered PBS as a negative control. 72 hours after the last administration (day 10), the mice were euthanized. Livers and plasma were collected for analysis. In some studies, compound number 757456 was included as a comparative compound.

[0510] Research 1 RNA and protein analysis RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described hereinabove). Results were normalized to the total RNA content measured by RIBOGREEN® and expressed as the percent inhibition of AGT RNA compared to saline control. In addition, plasma was extracted and the human AGT protein level in plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, Cat. No. 27412). Results were expressed as the percent inhibition of AGT protein compared to saline control.

[0511] [Table 18-1]

[0512] [Table 18-2]

[0513] Research 2 RNA and protein analysis RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described hereinabove). Results were normalized to the total RNA content measured by RIBOGREEN® and expressed as the percent inhibition of AGT RNA compared to saline control. In addition, plasma was extracted and the human AGT protein level in plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, Cat. No. 27412). Results were expressed as the percent inhibition of AGT protein compared to saline control.

[0514] [Table 19]

[0515] Research 3 RNA and protein analysis RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described hereinabove). Results were normalized to total RNA content, measured by RIBOGREEN®, and expressed as percent inhibition of AGT RNA compared to saline controls. In addition, plasma was extracted and human AGT protein levels in plasma were measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, Cat. No. 27412). Results were expressed as percent inhibition of AGT protein compared to saline controls. As used herein, a value of "0" indicates that treatment with the modified oligonucleotide did not inhibit AGT levels.

[0516] [Table 20]

[0517] Example 7: Dose-dependent in vitro inhibition of human AGT in transgenic mouse hepatocytes The transgenic AGT mouse model described above was used in this study, and the modified oligonucleotides described in the study were tested at various doses for inhibition of AGT RNA in primary mouse hepatocytes extracted from these transgenic mice.

[0518] Primary mouse transgenic hepatocytes were seeded at a density of 20,000 cells per well and treated with modified oligonucleotides diluted to different concentrations by free uptake, as shown in the table below. After overnight incubation, AGT RNA levels were measured using human AGT primer probe set RTS3721 (forward sequence CCCTGATGGGAGCCAGTGT, designated herein as SEQ ID NO: 3; reverse sequence AGCAGGGAGAAGCCCTTCA, designated herein as SEQ ID NO: 4; probe sequence CCCTGGCTTTCAACACCTACGTCCACT, designated herein as SEQ ID NO: 5). In addition, data confirmed that a second human AGT primer set RTS4039 (forward sequence GGACAAGGTGGGAGGGTCTCA, designated herein as SEQ ID NO: 6; reverse sequence AGATCCTTGCAGCACCAGTTG, designated herein as SEQ ID NO: 7; probe sequence ATGAAGAAACTATCTCCCCGGACCATCCA, designated herein as SEQ ID NO: 8) was used to measure human AGT RNA levels. AGT RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the table below as percent inhibition of AGT compared to untreated control cells. As used herein, a value of "0" indicates that treatment with the modified oligonucleotide did not inhibit AGT mRNA levels. The half maximal inhibitory concentration (IC) of each modified oligonucleotide was calculated. 50 ) is also shown. IC 50was calculated using nonlinear regression with a four-parameter variable slope method of log(inhibitor) versus response, with the low and high ends fixed at 0 and 100, respectively (Prism).

[0519] [Table 21]

[0520] [Table 22]

[0521] Example 8: Dose-dependent ex vivo inhibition of human AGT in HepatoPac® The HepatoPac® kit is a commercially available liver model system available from BIOIVT, consisting of micropatterned "islands" of hepatocytes co-cultured with supporting stromal cells. 96-well HepatoPac plates were equilibrated in fresh maintenance medium at 37°C and 10% CO2 for 48 hours prior to treatment. Modified oligonucleotides were diluted into maintenance medium at the concentrations listed in the table below for 48 hours. After 48 hours, the medium was replaced with fresh maintenance medium without additional oligonucleotides. Cell lysates were collected 96 hours after oligonucleotide addition and analyzed by RT-PCR using primer probe set RTS3721 (described hereinabove). Results are presented in the table below as percent inhibition of AGT compared to untreated control cells. As used herein, a value of "0" indicates that treatment with the modified oligonucleotides did not inhibit AGT mRNA levels. IC 50 was calculated using variable slope 4-parameter logistic regression in Prism, with the low and high ends of the curve set to 5 and 100, respectively.

[0522] [Table 23]

[0523] Example 9: Effects of modified oligonucleotides targeting human AGT in cynomolgus monkeys Cynomolgus monkeys were treated with modified oligonucleotides selected from the studies described in the Examples above.

[0524] treatment Prior to the study, monkeys were quarantined, followed by an acclimation period during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Nine groups of four male cynomolgus monkeys were randomly assigned to receive subcutaneous injections of Ionis oligonucleotide or saline, each in a clockwise rotation between four different sites on the back. Following loading doses on days 1, 4, and 8, the monkeys received 20 mg / kg of Ionis oligonucleotide once a week (days 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85). A control group of four cynomolgus monkeys was similarly injected with 0.9% saline and served as a control group.

[0525] During the study period, monkeys were observed at least once daily for signs of illness or distress. Animals showing signs of severe weakness or toxicity, especially if death appeared imminent, were euthanized as soon as possible for humane reasons in consultation with the attending veterinarian. Scheduled euthanasia of animals was performed by exsanguination under deep anesthesia on day 87, approximately 48 hours after the last dose. The protocol described in the Examples was approved by the Institutional Animal Care and Use Committee (IACUC).

[0526] Body and organ weight measurements Body and organ weights were measured to assess the impact of Ionis oligonucleotides on the overall health of the animals. Final body weights were measured prior to necropsy. Organ weights were also measured, and all weight measurements are presented in the table below.

[0527] [Table 24]

[0528] Renal and liver function To assess the effects of Ionis oligonucleotides on liver and kidney function, blood samples were collected from all study groups on Day 87. Monkeys were fasted overnight before blood collection. Blood was collected into anticoagulant-free tubes for serum isolation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3,000 rpm for 10 minutes to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), calculated albumin / globulin (A / G) ratio, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured, and the results are shown in the table below.

[0529] [Table 25]

[0530] Pro-inflammatory protein analysis To assess any inflammatory effects of Ionis-modified oligonucleotides in cynomolgus monkeys, blood samples were collected for analysis. Monkeys were fasted overnight before blood collection. On day 85 (pre-dose and 24 hours post-dose), approximately 0.8 mL of blood was collected from each animal in a tube without anticoagulant for serum isolation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3,000 rpm for 10 minutes at room temperature to obtain serum. Complement C3 was measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). C-reactive protein (CRP), another inflammatory marker, was tested alongside the clinical chemistry parameters tested for liver function above.

[0531] [Table 26]

[0532] Hematological tests To assess any effects of Ionis-modified oligonucleotides on hematological parameters in cynomolgus monkeys, approximately 0.5 mL of blood samples were collected from each available study animal on Day 87. Samples were collected in tubes containing K2-EDTA. Samples were analyzed using an ADVIA2120i hematology analyzer (Siemens, USA) for red blood cell (RBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet count (PLT), white blood cell (WBC) count, and individual white blood cell counts, including monocytes (MON), neutrophils (NEU), and lymphocytes (LYM).

[0533] [Table 27]

[0534] urine analysis The day before fresh urine collection, food was removed overnight, but water was provided. On day 87 (first thing in the morning), fresh urine samples for urinalysis and urine chemistry were collected from all animals using clean cage pans on wet ice. Urinalysis / urine chemistry parameters included creatinine (UCRE), protein / creatinine (P / C) ratio, microprotein (UTP), and urinary microalbumin (UALB) measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Co., Japan).

[0535] [Table 28] In one aspect, the present invention may be as follows. [Aspect 1] An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12 to 15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 2] Consists of 14 to 30 linked nucleosides, an isometric portion of nucleobases 2046 to 2061 of SEQ ID NO: 1; an isometric portion of nucleobases 2271 to 2286 of SEQ ID NO: 1; an isometric portion of nucleobases 2272 to 2287 of SEQ ID NO: 1; 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 14, at least 15, or at least 16 contiguous nucleobases complementary to SEQ ID NO: 1, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 3] An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 4] An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 5] An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 14, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 6] An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 7] The oligomeric compound of any of Aspects 1 to 6, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide. [Aspect 8] The oligomeric compound according to any one of Aspects 1 to 7, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety. [Aspect 9] The oligomeric compound of Aspect 8, wherein the bicyclic sugar moiety has a 4'-2' bridge, and the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-. [Aspect 10] The oligomeric compound of any one of Aspects 1 to 9, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety. [Aspect 11] The oligomeric compound of Aspect 10, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. [Aspect 12] The oligomeric compound according to any one of Aspects 1 to 11, wherein the modified oligonucleotide comprises at least one sugar surrogate. [Aspect 13] The oligomeric compound of Aspect 12, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA. [Aspect 14] The oligomeric compound according to any one of Aspects 1 to 13, wherein the modified oligonucleotide is a gapmer. [Aspect 15] The modified oligonucleotide is a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of embodiment 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety. [Aspect 16] The modified oligonucleotide is a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; and having a glycomotif comprising

[0033] Aspect 15. The oligomeric compound of aspect 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety. [Aspect 17] The modified oligonucleotide is a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of claim 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE or cEt modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety. [Aspect 18] The modified oligonucleotide is a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; and having a glycomotif comprising 15. The oligomeric compound of claim 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE or cEt modified sugar moiety, and at least six of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety. [Aspect 19] The oligomeric compound of any one of Aspects 1 to 18, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddddkkk, kkkdddyddddddddkkk, kkkddddddddddddkkk, or eeeeeddddddddddeeeee, wherein "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety. [Aspect 20] The oligomeric compound according to any one of Aspects 1 to 19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [Aspect 21] The oligomeric compound of aspect 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [Embodiment 22] The oligomeric compound of embodiment 20 or 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 23] The oligomeric compound according to any one of Aspects 20 and 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [Aspect 24] The oligomeric compound of any one of Aspects 20, 22, and 23, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Embodiment 25] The oligomeric compound of embodiment 21, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 26] The modified oligonucleotide has an internucleoside linkage motif of soossssssssssos, s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; 25. The oligomeric compound according to any one of aspects 1 to 20 or 22 to 24. [Aspect 27] The oligomeric compound according to any one of Aspects 1 to 26, wherein the modified oligonucleotide comprises at least one modified nucleobase. [Aspect 28] The oligomeric compound of Aspect 27, wherein the modified nucleobase is 5-methylcytosine. [Aspect 29] The oligomeric compound according to any one of Aspects 1 to 28, wherein the modified oligonucleotide consists of 14 to 30, 14 to 22, 14 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, or 16 to 20 linked nucleosides. [Aspect 30] The oligomeric compound according to any one of Aspects 1 to 28, wherein the modified oligonucleotide consists of 16 linked nucleosides. [Aspect 31] The oligomeric compound according to any one of Aspects 1 to 30, which comprises a conjugate group. [Aspect 32] The oligomeric compound of Aspect 31, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands. [Aspect 33] The oligomeric compound according to any one of Aspects 31 and 32, wherein the conjugate group comprises a conjugate linker consisting of a single bond. [Aspect 34] The oligomeric compound of any one of Aspects 31 to 33, wherein the conjugate group comprises a cleavable linker. [Aspect 35] The oligomeric compound of any one of Aspects 31 to 34, wherein the conjugate group comprises a conjugate linker comprising 1 to 3 linker nucleosides. [Aspect 36] The oligomeric compound of any one of Aspects 31 to 35, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-nucleoside of the modified oligonucleotide. [Aspect 37] The oligomeric compound of any one of Aspects 31 to 35, wherein the conjugate group is attached to the modified oligonucleotide at the 3'-nucleoside of the modified oligonucleotide. [Aspect 38] The oligomeric compound according to any one of Aspects 1 to 37, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 39] The oligomeric compound according to any one of Aspects 1 to 30, which comprises the modified oligonucleotide. [Aspect 40] The following chemical structure: [ka] (SEQ ID NO: 12), or a salt thereof. [Aspect 41] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 12). [Aspect 42] The following chemical structure: [ka] (SEQ ID NO: 13), or a salt thereof. [Aspect 43] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 13). [Aspect 44] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 14), or a salt thereof. [Aspect 45] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 14). [Aspect 46] The following chemical structure: [ka] (SEQ ID NO: 15), or a salt thereof. [Aspect 47] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 15). [Aspect 48] The oligomeric compound according to any one of Aspects 40, 42, 44, and 47, which is a sodium salt or a potassium salt. [Embodiment 49] The following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 12), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound. [Embodiment 50] The following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 13), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound. [Aspect 51] The following chemical notation: G ks T ks m Cks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 15), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound. [Embodiment 52] The following chemical notation: T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 14), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; U is a uracil nucleobase; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; y is a 2'-OMe ribose sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound. [Aspect 53] The oligomeric compound of any one of Aspects 49 to 52, comprising the modified oligonucleotide covalently bound to a conjugate group. [Aspect 54] An oligomeric duplex comprising the oligomeric compound according to any one of aspects 1 to 53. [Aspect 55] An antisense compound comprising or consisting of the oligomeric compound according to any one of Aspects 1 to 53 or the oligomeric duplex according to Aspect 54. [Embodiment 56] A chirally enriched population of oligomeric compounds according to any one of embodiments 40 to 53, wherein the population is enriched for compounds comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. [Embodiment 57] A chirally enriched population according to embodiment 56, wherein the population is enriched for compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration. [Embodiment 58] A chirally enriched population according to embodiment 56, wherein the population is enriched for compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration. [Embodiment 59] A chirally enriched population according to embodiment 56, wherein the population is enriched for compounds having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Embodiment 60] A chirally enriched population according to embodiment 56, wherein the population is enriched for compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 61] A chirally enriched population according to embodiment 56, wherein the population is enriched for compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [Embodiment 62] The chirally enriched population of embodiment 56, wherein the population is enriched for compounds having at least three consecutive phosphorothioate internucleoside linkages in the Sp configuration, the Sp configuration, and the Rp configuration in the 5' to 3' direction. [Aspect 63] The population of oligomeric compounds according to any one of Aspects 40 to 53, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Aspect 64] A pharmaceutical composition comprising an oligomeric compound according to any one of aspects 1 to 53, an oligomeric duplex according to aspect 54, an antisense compound according to aspect 55, or a population according to any one of aspects 56 to 63, and a pharmaceutically acceptable carrier or diluent. [Embodiment 65] A method comprising administering the pharmaceutical composition described in embodiment 64 to an individual. [Aspect 66] A method for treating a disease associated with the RAAS pathway, comprising administering a therapeutically effective amount of the pharmaceutical composition described in aspect 64 to an individual having or at risk of having a disease associated with the RAAS pathway, thereby treating the disease associated with the RAAS pathway. [Aspect 67] The method described in Aspect 66, wherein the disease is a cardiovascular disease. [Aspect 68] A method according to any one of aspects 66 and 67, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD. [Aspect 69] A method according to any one of aspects 66 to 68, wherein at least one symptom or characteristic of the disease is ameliorated. [Aspect 70] The method of aspect 69, wherein the symptom or characteristic is any of hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary arterial hypertension. [Aspect 71] A method described in any one of aspects 65 to 70, wherein the pharmaceutical composition is administered systemically. [Aspect 72] A method described in any one of aspects 65 to 71, wherein the pharmaceutical composition is administered subcutaneously or intramuscularly. [Aspect 73] Use of an oligomeric compound according to any one of aspects 1 to 53, an oligomeric duplex according to aspect 54, an antisense compound according to aspect 55, or a population according to any one of aspects 56 to 63, for reducing AGT expression in a cell. [Embodiment 74] The use according to embodiment 73, wherein the level of AGT RNA is reduced. [Aspect 75] The use according to aspect 73, wherein the level of AGT protein is reduced. [Aspect 76] The following chemical structure: [ka] (SEQ ID NO: 12), or a salt thereof. [Embodiment 77] The oligomeric compound according to embodiment 76, which is a sodium salt or a potassium salt. [Embodiment 78] The following chemical structure: [ka] An oligomeric compound according to (SEQ ID NO: 12). [Embodiment 79] The following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G dsT ds m C ds m C ds G ko G ks G e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 12), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound. [Aspect 80] The oligomeric compound of Aspect 79, comprising the modified oligonucleotide covalently attached to a conjugate group. [Embodiment 81] The population of oligomeric compounds of embodiment 76, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Embodiment 82] A pharmaceutical composition comprising the oligomeric compound according to embodiment 76 and a pharmaceutically acceptable carrier or diluent. [Aspect 83] The pharmaceutical composition described in Aspect 82, wherein the pharmaceutically acceptable diluent is water or PBS. [Embodiment 84] A pharmaceutical composition comprising the population described in embodiment 81 and a pharmaceutically acceptable carrier or diluent. [Embodiment 85] The population of oligomeric compounds of embodiment 77, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Embodiment 86] A pharmaceutical composition comprising the oligomeric compound according to embodiment 77 and a pharmaceutically acceptable carrier or diluent. [Aspect 87] The pharmaceutical composition described in Aspect 86, wherein the pharmaceutically acceptable diluent is water or PBS. [Embodiment 88] A pharmaceutical composition comprising the population described in embodiment 85 and a pharmaceutically acceptable carrier or diluent. [Embodiment 89] The population of oligomeric compounds of embodiment 78, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Embodiment 90] A pharmaceutical composition comprising the oligomeric compound according to embodiment 78 and a pharmaceutically acceptable carrier or diluent. [Aspect 91] A pharmaceutical composition according to Aspect 90, wherein the pharmaceutically acceptable diluent is water or PBS. [Embodiment 92] A pharmaceutical composition comprising the population described in embodiment 89 and a pharmaceutically acceptable carrier or diluent. [Embodiment 93] The population of oligomeric compounds of embodiment 79, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Embodiment 94] A pharmaceutical composition comprising the oligomeric compound according to embodiment 79 and a pharmaceutically acceptable carrier or diluent. [Aspect 95] A pharmaceutical composition according to Aspect 94, wherein the pharmaceutically acceptable diluent is water or PBS. [Aspect 96] A pharmaceutical composition comprising the population described in aspect 93 and a pharmaceutically acceptable carrier or diluent. [Aspect 97] The population of oligomeric compounds according to aspect 80, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom. [Embodiment 98] A pharmaceutical composition comprising the oligomeric compound according to embodiment 80 and a pharmaceutically acceptable carrier or diluent. [Aspect 99] The pharmaceutical composition described in Aspect 98, wherein the pharmaceutically acceptable diluent is water or PBS. [Embodiment 100] A pharmaceutical composition comprising the population described in embodiment 97 and a pharmaceutically acceptable carrier or diluent.

Claims

1. A nucleic acid having the nucleic acid base sequence of SEQ ID NO: 12 and the following chemical structure: 【Chemistry 1】 1. An oligomeric compound according to claim 1, or a salt thereof.

2. A nucleic acid having the nucleic acid base sequence of SEQ ID NO: 12 and the following chemical structure: 【Chemistry 2】 An oligomeric compound according to

3. A nucleic acid having the nucleic acid base sequence of SEQ ID NO: 12 and the following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e 1. An oligomeric compound comprising a modified oligonucleotide according to the formula: A is an adenine nucleobase; m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-β-D-MOE sugar moiety; k is a cEt sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; The oligomeric compound.

4. 10. The oligomeric compound of claim 1, which is a sodium or potassium salt.

5. 4. The oligomeric compound of claim 3, comprising a modified oligonucleotide covalently attached to a conjugate group.

6. An oligomeric duplex comprising the oligomeric compound of any one of claims 1 to 5.

7. An antisense compound comprising or consisting of an oligomeric compound according to any one of claims 1 to 5 or an oligomeric duplex according to claim 6.

8. 6. A chirally enriched population of oligomeric compounds according to any one of claims 1 to 5, wherein the population is enriched for compounds containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

9. the population is enriched for compounds containing at least one particular phosphorothioate internucleoside linkage having an (Sp) configuration; the population is enriched for compounds containing at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration; the population is enriched for compounds having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage; the population is enriched for compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage, or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage; the population is enriched for compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages; the population is enriched for compounds having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations in the 5' to 3' direction; 9. The chirally enriched population of claim 8.

10. 6. The population of oligomeric compounds of any one of claims 1 to 5, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom.

11. 11. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 5, an oligomeric duplex according to claim 6, an antisense compound according to claim 7, or a population according to any one of claims 8 to 10, and a pharmaceutically acceptable carrier or diluent.

12. 12. The pharmaceutical composition of claim 11, wherein the pharmaceutically acceptable diluent is water or PBS.

13. 11. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 5, an oligomeric duplex according to claim 6, an antisense compound according to claim 7, or a population according to any one of claims 8 to 10.

14. 14. A pharmaceutical composition for treating a disease associated with the renin-angiotensin-aldosterone system (RAAS) pathway, comprising the oligomeric compound of any one of claims 1 to 5, the oligomeric duplex of claim 6, the antisense compound of claim 7, the population of any one of claims 8 to 10, or the pharmaceutical composition of any one of claims 11 to 13.

15. The pharmaceutical composition of claim 14, wherein the disease is a cardiovascular disease.

16. 16. The pharmaceutical composition of claim 14 or 15, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.

17. The pharmaceutical composition of any one of claims 14 to 16, wherein at least one symptom or characteristic of the disease is ameliorated.

18. 18. The pharmaceutical composition of claim 17, wherein the condition or characteristic is any one of hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, pre-eclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ injury, or pulmonary arterial hypertension.

19. The pharmaceutical composition according to any one of claims 13 to 18, which is administered systemically.

20. The pharmaceutical composition according to any one of claims 13 to 19, which is administered subcutaneously or intramuscularly.

21. A pharmaceutical composition for reducing AGT expression in a cell, comprising an oligomeric compound according to any one of claims 1 to 5, an oligomeric duplex according to claim 6, an antisense compound according to claim 7, a population according to any one of claims 8 to 10, or a pharmaceutical composition according to any one of claims 11 to 13.

22. 22. The pharmaceutical composition according to claim 21, wherein the level of AGT RNA is reduced.

23. 22. The pharmaceutical composition according to claim 21, wherein the level of AGT protein is reduced.

Citation Information

Patent Citations

  • Compounds and methods for modulating angiotensinogen expression

    JP2018530325A

  • Polynucleotide agents targeting angiotensinogen (AGT) and methods of use thereof

    WO2016196111A1

  • Modified compounds and uses thereof

    WO2019157531A1