mRNA therapy for argininosuccinate synthase deficiency

Abstract

Improved methods and compositions for the treatment of argininosuccinate synthetase deficiency (ASD) based on mRNA therapy are provided. [Solution] The present invention provides methods and compositions based on mRNA therapy for treating argininosuccinate synthase deficiency (ASD). Specifically, the present invention provides methods for treating ASD by administering to a subject in need of treatment a composition comprising mRNA encoding argininosuccinate synthase (ASS) at an effective dose and interval to reduce the intensity, severity, or frequency of, or delay the onset of, at least one symptom or characteristic of ASD. In some embodiments, the mRNA is encapsulated in one or more liposomes. In some embodiments, liposomes suitable for the present invention contain cationic or non-cationic lipid(s), cholesterol-based lipid(s), and PEG-modified lipid(s).

Description

[Technical Field]

[0001] Related Applications This application is a continuation of U.S. Provisional Patent Application No. 61 / 894,299, filed October 22, 2013. No. 4, the disclosure of which is incorporated herein by reference. [Background technology]

[0002] Argininosuccinate synthase deficiency (ASD) is an autosomal recessive genetic metabolic disorder characterized by mutations in the gene encoding the enzyme argininosuccinate synthase (ASS1), affecting the enzyme's ability to bind citrulline, aspartate, and other molecules. Defective ASS proteins disrupt the urea cycle, preventing the liver from properly processing excess nitrogen into urea. The accumulation of ammonia and other by-products of the urea cycle (e.g., citrulline) is toxic, and this accumulation, evident within the first few days of life, can cause symptoms such as weakness (lethargy), poor feeding, vomiting, seizures, and loss of consciousness. Currently, there is no cure for this disorder, and standard treatment involves dietary management, minimizing high-protein diets, and arginine and phenylacetic acid supplements. Summary of the Invention [Means for solving the problem]

[0003] In particular, the present invention provides improved methods and compositions for treating argininosuccinate synthetase deficiency (ASD) based on mRNA therapy. The present invention encompasses the discovery that administration of liposomally encapsulated mRNA encoding the human ASS1 protein results in highly efficient and sustained in vivo production of the protein, successfully reducing plasma ammonia levels, a clinically significant disease marker.

[0004] In one aspect, the present invention provides a method for treating ASD, comprising administering to a subject in need thereof a composition comprising mRNA encoding argininosuccinate synthase (ASS1) at an effective dose and at an interval sufficient to reduce the intensity, severity, or frequency of, or delay the onset of, at least one symptom or characteristic of ASD. In some embodiments, the mRNA is encapsulated in a liposome.

[0005] In another aspect, the present invention provides a composition for treating ASD, comprising an effective dose of mRNA encoding ASS1 encapsulated in liposomes.

[0006] In some embodiments, suitable liposomes include one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

[0007] In some embodiments, the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0008] In some embodiments, the one or more cationic lipids are compounds of formula I-c1-a thing [ka] or a pharmaceutically acceptable salt thereof, wherein Each R 2 are independently hydrogen or C 1-3 is an alkyl group, each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group, Each R L are independent of each other and C 8-12 It is an alkyl group.

[0009] In some embodiments, the one or more cationic lipids include cKK-E12 [ka] Includes:

[0010] In some embodiments, the one or more non-cationic lipids suitable for the present invention are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (2-dioleoyl-sn-glycero-3-phospho-(1′-rac-glycerol)), and combinations thereof.

[0011] In some embodiments, the one or more cholesterol-based lipids are selected from cholesterol, PEGylated cholesterol, and DC-Chol (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine.

[0012] In some embodiments, the liposome further comprises one or more PEG-modified lipids. In some embodiments, the one or more PEG-modified lipids have a chain length of C6-C20 The PEG-modified lipid comprises a poly(ethylene) glycol chain of up to 5 kDa covalently attached to a lipid having alkyl chain(s). In some embodiments, the PEG-modified lipid is a derivatized ceramide, such as N-octanoylsphingosine-1-[succinyl(methoxypolyethylene glycol)-2000]. In some embodiments, the PEG-modified, i.e., PEGylated, lipid is PEGylated cholesterol or dimyristoylglycerol (DMG)-PEG-2K.

[0013] In some embodiments, suitable liposomes comprise a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol, and DMG-PEG2K.

[0014] In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% of the liposome by molar ratio.

[0015] In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) can be about 30:60:25:35:20:30:1:15, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is about 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is about 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is about 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is about 50:25:20:5.

[0016] In some embodiments, liposome size is determined by the longest diameter of the liposome particle. In some embodiments, suitable liposomes are less than about 500 nM, 400 nM, 300 nM, 250 nM, 200 nM, 150 nM, 100 nM, 75 nM, or 50 nM in size. In some embodiments, suitable liposomes are less than about 100 nM, 90 nM, 80 nM, 70 nM, or 60 nM in size.

[0017] In some embodiments, the mRNA is administered at a dose in the range of about 0.1-5.0 mg / kg body weight, for example, about 0.1-4.5, 0.1-4.0, 0.1-3.5, 0.1-3.0, 0. 1~2.5, 0.1~2.0, 0.1~1.5, 0.1~1.0, 0.1~0.5, 0. 1~0.3, 0.3~5.0, 0.3~4.5, 0.3~4.0, 0.3~3.5, 0. 3~3.0, 0.3~2.5, 0.3~2.0, 0.3~1.5, 0.3~1.0, 0. 3~0.5, 0.5~5.0, 0.5~4.5, 0.5~4.0, 0.5~3.5, 0. 5~3.0, 0.5~2.5, 0.5~2.0, 0.5~1.5, or 0.5~1.0 In some embodiments, the mRNA is administered at about 5.0, 4.5, 6.0, 7.5, 8.0, 9.5, 10.0, 11.5, 12.5, 13.0, 14.5, 15.0, 16.5, 17.5, 18.5, 19.5, 20.5, 21.5, 22.5, 23.5, 24 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, 0.8, 0.6, 0.5, 0 Administer at doses of 0.4, 0.3, 0.2, or 0.1 mg / kg body weight or less.

[0018] In some embodiments, provided compositions are administered intravenously. In some embodiments, provided compositions are administered by pulmonary delivery. In certain embodiments, pulmonary delivery is achieved by aerosolization, inhalation, nebulization, or eye drops. In some embodiments, provided compositions are formulated as inhalable particles, nebulizable lipids, or inhalable dry powders.

[0019] In some embodiments, provided compositions are administered daily, weekly, twice monthly, monthly, hi some embodiments, provided compositions are administered once every 7 days, once every 10 days, once every 14 days, once every 28 days, or once every 30 days.

[0020] In some embodiments, ASS1 protein is expressed in the liver. In some embodiments, administration of a provided composition results in expression of ASS1 protein in an amount of about 100 ng / mg or more (e.g., about 200 ng / mg, 400 ng / mg, 500 ng / mg, 1000 ng / mg, 2000 ng / mg, or 3000 ng / mg or more) of total liver protein.

[0021] In some embodiments, administering the composition increases the ASS1 protein serum concentration, ie, by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold compared to the baseline ASS1 protein serum concentration before treatment.

[0022] In some embodiments, administering the composition reduces the subject's citrulline levels below pre-treatment baseline citrulline levels.In some embodiments, administering the composition reduces plasma citrulline levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline plasma citrulline levels.In some embodiments, administering the composition reduces plasma citrulline levels to less than about 2000 μM, 1500 μM, 1000 μM, 750 μM, 500 μM, 250 μM, 100 μM, 90 μM, 80 μM, 70 μM, 60 μM, 50 μM, 40 μM, or 30 μM.

[0023] In some embodiments, administering the composition reduces the ammonia concentration in the subject below the baseline ammonia concentration before treatment. Administration of a provided composition reduces plasma or serum ammonia concentrations to about 3000 μmol / L or less, about 2750 μmol / L or less, about 2500 μmol / L or less, about 2250 μmol / L or less, about 2000 μmol / L or less, about 1750 μmol / L or less, about 1500 μmol / L or less, about 1250 μmol / L or less, about 1000 μmol / L or less, about 750 μmol / L or less, about 500 μmol / L or less, about 250 μmol / L or less, about 100 μmol / L or less, or about 50 μmol / L or less. In certain embodiments, administration of a provided composition reduces plasma or serum ammonia concentrations to about 50 μmol / L or less.

[0024] In some embodiments, administration of a provided composition reduces ammonia concentrations in a biological sample by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to the baseline ammonia concentration before treatment. Suitable biological samples may be whole blood, serum, plasma, or urine.

[0025] In some embodiments, the mRNA is codon-optimized. In some embodiments, the codon-optimized mRNA comprises SEQ ID NO:3, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15 (corresponding to the codon-optimized human ASS1 mRNA sequence). In some embodiments, the mRNA comprises the 5' UTR sequence of SEQ ID NO:4 (corresponding to 5' UTR sequence X). In some embodiments, the mRNA comprises the 3' UTR sequence of SEQ ID NO:5 (corresponding to 3' UTR sequence Y). In some embodiments, the mRNA comprises the 3' UTR sequence of SEQ ID NO:6 (corresponding to 3' UTR sequence Y). In some embodiments, the codon-optimized mRNA comprises SEQ ID NO:7 or SEQ ID NO:8 (corresponding to the human ASS1 mRNA sequence with codon-optimized 5' UTR and 3' UTR sequences).

[0026] In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides comprise pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine. In some embodiments, the mRNA is unmodified.

[0027] In certain embodiments, the present invention provides a composition for treating ASD comprising an effective dose of mRNA encoding argininosuccinate synthase (ASS1) encapsulated in a liposome, wherein the mRNA comprises SEQ ID NO:3, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0028] In certain embodiments, the present invention provides a composition for treating ASD, comprising an effective dose of mRNA encoding argininosuccinate synthase (ASS1) encapsulated in a liposome, wherein the mRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and and PEG-modified lipids.

[0029] Other features, objects, and advantages of the present invention will be apparent in the detailed description, drawings, and claims set forth hereinafter. It should be understood, however, that the detailed description, drawings, and claims, while referring to embodiments of the present invention, are given by way of example only and are not limiting. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art. In certain embodiments, for example, the following are provided: (Item 1) A method for treating argininosuccinate synthase deficiency (ASD), comprising administering to a subject in need of treatment a composition comprising mRNA encoding argininosuccinate synthase (ASS1) at an effective dose and at an administration interval such that at least one symptom or characteristic of ASD is reduced in intensity, severity, or frequency, or the onset is delayed. (Item 2) Item 1. The method according to item 1, wherein the mRNA is encapsulated in a liposome. (Item 3) 3. The method according to item 2, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. (Item 4) 4. The method of item 3, wherein the one or more cationic lipids comprise a cationic lipid selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLiN-K-XTC2-DMA, HGT4003, and combinations thereof. (Item 5) One or more cationic lipids may be cKK-E12 [ka] Item 5. The method according to item 4, comprising: (Item 6) The one or more non-cationic lipids may be selected from the group consisting of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine (p 6. The method according to any one of items 3 to 5, wherein the glycerol is selected from the group consisting of 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), and DOPG (2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)). (Item 7) 7. The method according to items 3 to 6, wherein the one or more cholesterol-based lipids are cholesterol and / or PEGylated cholesterol. (Item 8) One or more PEG-modified lipids have a chain length of C6-C 208. The method of any one of items 3 to 7, wherein the lipid comprises a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to the lipid having alkyl chain(s). (Item 9) 9. The method of any one of items 1 to 8, wherein the cationic lipid constitutes about 30 to 50% of the liposome by weight. (Item 10) Item 11. The method of item 9, wherein the cationic lipid comprises about 40% by weight of the liposome. 11. The method according to any one of items 3 to 10, wherein the molar ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is about 40:30:20:10. (Item 12) 11. The method of any one of items 3 to 10, wherein the ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is about 40:30:25:5 by weight. (Item 13) 11. The method of any one of items 3 to 10, wherein the ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is about 40:32:25:3 by weight. (Item 14) The liposomes cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol and DMG-PEG2K 14. The method according to any one of items 2 to 13, comprising a combination selected from: (Item 15) 15. The method of any one of items 2 to 14, wherein the size of the liposomes is less than about 100 nM. (Item 16) 16. The method of any one of items 1 to 15, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 5.0 mg / kg body weight. (Item 17) 17. The method of any one of items 1 to 16, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 3.0 mg / kg body weight. (Item 18) 18. The method of any one of items 1 to 17, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 1.0 mg / kg body weight. (Item 19) 19. The method of any one of items 1 to 18, wherein the composition is administered intravenously. (Item 20) 20. The method of any one of items 1 to 19, wherein the composition is administered once a week. (Item 21) 20. The method of any one of items 1 to 19, wherein the composition is administered twice a week. (Item 22) 20. The method of any one of items 1 to 19, wherein the composition is administered twice a month. (Item 23) 20. The method of any one of items 1 to 19, wherein the composition is administered once a month. (Item 24) 20. The method of any one of items 1 to 19, wherein the composition is administered once every 14 days. (Item 25) The method according to any one of Items 1 to 24, wherein the ASS1 protein is expressed in the liver. (Item 26) 26. The method according to any one of items 1 to 25, wherein administration of the composition results in an expression level of ASS1 protein of about 100 ng / mg or more relative to the total protein amount in the liver. (Item 27) 27. The method of any one of items 1 to 26, wherein administration of the composition increases the serum concentration of ASS1 protein. (Item 28) 28. The method according to any one of items 1 to 27, wherein administration of the composition reduces the subject's citrulline levels compared to pre-treatment baseline citrulline levels. (Item 29) 29. The method of any one of items 1 to 28, wherein administration of the composition reduces the ammonia concentration in the subject compared to the ammonia concentration at the pre-treatment baseline. (Item 30) 30. The method of any one of items 1 to 29, wherein administration of the composition reduces ammonia plasma concentrations to about 50 μmol / L or less. (Item 31) 31. The method of any one of items 1 to 30, wherein administration of the composition reduces ammonia plasma concentrations to about 300 μmol / L or less. (Item 32) 32. The method of any one of items 1 to 31, wherein administration of the composition reduces ammonia plasma concentrations to about 1500 μmol / L or less. (Item 33) 33. The method according to any one of items 1 to 32, wherein the mRNA is codon-optimized mRNA. (Item 34) 34. The method of item 33, wherein the codon-optimized mRNA comprises SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15. (Item 35) 35. The method of item 34, wherein the mRNA further comprises the 5'UTR sequence of SEQ ID NO:4. (Item 36) 35. The method of item 34, wherein the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 5 or SEQ ID NO: 6. (Item 37) 37. The method of any one of items 1 to 36, wherein the mRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8. (Item 38) 38. The method of any one of items 1 to 37, wherein the mRNA comprises one or more modified nucleotides. (Item 39) One or more modified nucleotides may be pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyl 39. The method of claim 38, comprising C-aminoadenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine. (Item 40) 33. The method of any one of items 1 to 32, wherein the mRNA is unmodified. (Item 41) Cationic lipid cKK-E12 [ka] A composition for treating argininosuccinate synthase deficiency (ASD), comprising an effective dose of mRNA encoding argininosuccinate synthase (ASS1) encapsulated in a liposome comprising: (Item 42) 42. The composition of claim 41, wherein the liposome further comprises one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. (Item 43) 43. The composition of claim 42, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)). (Item 44) 44. The composition according to item 42 or 43, wherein the one or more cholesterol-based lipids are selected from cholesterol and / or PEGylated cholesterol. (Item 45) One or more PEG-modified lipids have a chain length of C6-C 20 45. The composition of any one of items 42 to 44, comprising a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to a lipid having alkyl chain(s). (Item 46) 46. ​​The composition according to any one of items 41 to 45, wherein the liposome comprises cKK-E12, DOPE, cholesterol and DMG-PEG2K. (Item 47) 47. The composition according to any one of items 41 to 46, wherein the cationic lipid constitutes about 30 to 50% of the liposome by molar ratio. (Item 48) 48. The composition according to item 47, wherein the cationic lipid constitutes about 40% of the liposome by molar ratio. (Item 49) 49. The composition of any one of items 46 to 48, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is about 40:30:20:10 in molar ratio. (Item 50) 49. The composition of any one of items 42 to 48, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is about 40:30:25:5 in molar ratio. (Item 51) 49. The composition of any one of items 42 to 48, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is about 40:32:25:3 in molar ratio. (Item 52) 52. The composition of any one of items 41 to 51, wherein the size of the liposomes is less than about 100 nM. (Item 53) 53. The composition according to any one of items 41 to 52, wherein the composition is formulated for intravenous administration. (Item 54) 54. The composition of any one of items 41 to 53, wherein the mRNA comprises SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15. (Item 55) 55. The composition of item 54, wherein the mRNA further comprises the 5'UTR sequence of SEQ ID NO:4. (Item 56) 55. The composition of item 54, wherein the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 5 or SEQ ID NO: 6. (Item 57) 57. The composition of any one of items 41 to 56, wherein the mRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8. (Item 58) A composition for treating argininosuccinate synthase deficiency (ASD), comprising an effective dose of mRNA encoding argininosuccinate synthase (ASS1) encapsulated in a liposome, wherein the mRNA comprises SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid and a PEG-modified lipid. (Item 59) A composition for treating argininosuccinate synthase deficiency (ASD), comprising an effective dose of mRNA encoding argininosuccinate synthase (ASS1) encapsulated in a liposome, wherein the mRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid. [Brief explanation of the drawings]

[0030] The drawings are for illustrative purposes only and are not limiting. [Figure 1] FIG. 1 shows exemplary ASS1 protein levels detected by ELISA after treatment with human ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles at various doses. [Figure 2A]Figures 2A-2D show exemplary Western blots comparing the amount of human ASS1 protein in the liver as a function of dose after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA. CD1 mice were sacrificed 24 hours after administration, and each liver was harvested and analyzed as described above. Human ASS1 protein was detected using the 2H8 mouse monoclonal antibody. Fifty micrograms of total liver protein was loaded into each well. Recombinant human ASS1 protein was loaded on each gel as a positive control (R5 control). [Figure 2B] Figures 2A-2D show exemplary Western blots comparing the amount of human ASS1 protein in the liver as a function of dose after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA. CD1 mice were sacrificed 24 hours after administration, and each liver was harvested and analyzed as described above. Human ASS1 protein was detected using the 2H8 mouse monoclonal antibody. Fifty micrograms of total liver protein was loaded into each well. Recombinant human ASS1 protein was loaded on each gel as a positive control (R5 control). [Figure 2C] Figures 2A-2D show exemplary Western blots comparing the amount of human ASS1 protein in the liver as a function of dose after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA. CD1 mice were sacrificed 24 hours after administration, and each liver was harvested and analyzed as described above. Human ASS1 protein was detected using the 2H8 mouse monoclonal antibody. Fifty micrograms of total liver protein was loaded into each well. Recombinant human ASS1 protein was loaded on each gel as a positive control (R5 control). [Figure 2D]Figures 2A-2D show exemplary Western blots comparing the amount of human ASS1 protein in the liver as a function of dose after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA. CD1 mice were sacrificed 24 hours after administration, and each liver was harvested and analyzed as described above. Human ASS1 protein was detected using the 2H8 mouse monoclonal antibody. Fifty micrograms of total liver protein was loaded into each well. Recombinant human ASS1 protein was loaded on each gel as a positive control (R5 control). [Figure 3] Figure 3 shows an exemplary graph of human argininosuccinate synthase (ASS1) protein accumulation measured by ELISA over time following delivery of ASS1 mRNA via a single intravenous injection of lipid nanoparticles (1.0 mg / kg of ASS1 mRNA). [Figure 4A] 4A to 4E show exemplary Western blots showing the amount of human ASS1 protein in the liver over time after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA (at a dose of 1.0 mg / kg). [Figure 4B] 4A to 4E show exemplary Western blots showing the amount of human ASS1 protein in the liver over time after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA (at a dose of 1.0 mg / kg). [Figure 4C] 4A to 4E show exemplary Western blots showing the amount of human ASS1 protein in the liver over time after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA (at a dose of 1.0 mg / kg). [Figure 4D] 4A to 4E show exemplary Western blots showing the amount of human ASS1 protein in the liver over time after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA (at a dose of 1.0 mg / kg). [Figure 4E]4A to 4E show exemplary Western blots showing the amount of human ASS1 protein in the liver over time after a single intravenous administration of lipid nanoparticles encapsulating human ASS1 mRNA (at a dose of 1.0 mg / kg). [Figure 5A] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5B] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5C] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5D] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5E]Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5F] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5G] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5H] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 5I] Figures 5A-5I show the detection of human ASS1 messenger RNA by in situ hybridization in the livers of treated mice. Exogenous mRNA is detectable for at least 7 days after a single administration (1.0 mg / kg) of ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. Human ASS1 mRNA is detectable in sinusoidal cells as well as hepatocytes. [Figure 6A]Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6B] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6C] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6D] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6E]Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6F] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6G] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6H] Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 6I]Figures 6A-6I show exemplary immunohistochemical staining of ASS1 protein levels in mouse liver at various time points after administration of 1 mg / kg of ASS1 mRNA containing cKK-E12 lipid nanoparticles. Human ASS1 protein is detectable in sinusoidal cells and hepatocytes. Human ASS1 protein is detectable for at least one week after a single administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 7A] Figures 7A-7B show low-magnification (4x) immunohistochemical staining of ASS1 protein levels in mouse livers 24 hours after administration of 1 mg / kg of ASS1 mRNA-containing cKK-E12 liposomes. Compared to the liver of an untreated mouse (left), this shows widespread distribution of human ASS1 protein throughout the liver. [Figure 7B] Figures 7A-7B show low-magnification (4x) immunohistochemical staining of ASS1 protein levels in mouse livers 24 hours after administration of 1 mg / kg of ASS1 mRNA-containing cKK-E12 liposomes. Compared to the liver of an untreated mouse (left), this shows widespread distribution of human ASS1 protein throughout the liver. [Figure 8] Figure 8 shows an exemplary graph of human argininosuccinate synthase (ASS1) protein levels measured by ELISA, which were produced as a result of ASS1 mRNA delivery via a single intravenous injection of various lipid nanoparticles. [Figure 9] Figure 9 shows the incorporation of C-arginine into proteins after transfection of ASS1 mRNA into the ASS1KO cell line (SK(-)), compared with a stable AS1 cell line (SK(+), clone #5). The control was SK(-) cells treated with Lipofectamine alone. [Figure 10] FIG. 10 shows the amount of human ASS1 protein in rat liver 24 hours after administration of ASS1 mRNA-loaded lipid nanoparticles. [Figure 11] FIG. 11 shows the ammonia plasma concentration in ASS1 knockout mice administered 1.0 mg / kg of ASS1 mRNA-loaded lipid nanoparticles once every 14 days for 30 days. DETAILED DESCRIPTION OF THE INVENTION

[0031] definition In order that the present invention may be more readily understood, certain terms are first defined below. Further definitions of these terms and other terms are set forth throughout the specification. Publications and other reference materials referred to herein to describe the background of the invention or to provide further details regarding its practice are hereby incorporated by reference.

[0032] Alkyl: As used herein, "alkyl" refers to the radical of a straight or branched chain saturated hydrocarbon group having from 1 to 15 carbon atoms ("C 1-15 In some embodiments, an alkyl group has 1 to 3 carbon atoms ("C 1-3 alkyl). C 1-3 Examples of alkyl groups include methyl (C1), ethyl (C2), N-propyl (C3), and isopropyl (C3) groups. In some embodiments, the alkyl group has 8 to 12 carbon atoms ("C 8-12 alkyl). C 8-12 Examples of alkyl groups include n-octyl (C8), N-nonyl (C9), and N-decyl (C 10 ), N-undecyl group (C 11 ), N-dodecyl group (C 12 ), etc. The prefix "N-" (normal) refers to an unbranched alkyl group. For example, an N-C8 alkyl group would be -(CH2)7CH3, and NC 10 An alkyl group refers to -(CH2)9CH3, etc.

[0033] Amino Acid: As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure HN-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid, and in some embodiments, the amino acid is a d-amino acid, and in some embodiments, the amino acid is an l-amino acid. A "standard amino acid" refers to any of the 20 standard l-amino acids commonly found in naturally occurring peptides. A "non-standard amino acid" refers to any amino acid other than the above standard amino acids, whether synthetically prepared or obtained from a natural source. As used herein, "synthetic amino acid" encompasses chemically modified amino acids, including, but not limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including those at the carboxy and / or amino termini of a peptide, can be modified by methylation, amidation, acetylation, protecting groups, and / or substitution with other chemical groups, which can alter the circulating half-life of the peptide without adversely affecting its activity. Amino acids may participate in disulfide bonds. Amino acids may include mono- or post-translational modifications such as association with one or more chemical entities (e.g., methyl groups, acetate groups, acetyl groups, phosphate groups, formyl moieties, isoprenoid groups, sulfate groups, polyethylene glycol moieties, lipid moieties, carbohydrate moieties, biotin moieties, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and can refer to free amino acids and / or amino acid residues of a peptide. Whether a term refers to a free amino acid or a residue of a peptide will be clear from the context in which the term is used.

[0034] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, such non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, animals may be transgenic, genetically engineered, and / or clones.

[0035] Approximately or about: As used herein, the term "approximately" or "about," when applied to one or more subject values, refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a numerical range that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) from the stated reference value, unless otherwise specified or otherwise clear from the context (except where such numerical value exceeds 100% of possible values).

[0036] Biologically active: As used herein, the phrase "biologically active" refers to the property of any agent that is active in a biological system, particularly an organism. For example, an agent is considered to be biologically active if, when administered to an organism, it has a biological effect on that organism.

[0037] Delivery: As used herein, the term "delivery" encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which the mRNA is delivered to a target tissue, where the encoded protein is expressed and retained within the target tissue (also referred to as "local distribution" or "local delivery"), and situations in which the mRNA is delivered to a target tissue, where the encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), where it is distributed throughout the body, and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0038] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into a complete protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or a fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production," and grammatical equivalents, are used interchangeably.

[0039] Functional: As used herein, a "functional" biological molecule is a biological molecule that is in a form in which it exhibits a property and / or activity by which it is characterized.

[0040] Half-life: As used herein, the term "half-life" is the time it takes for a quantity, such as the concentration or activity of a nucleic acid or protein, to decrease to half of its measured value at the start of a period of time.

[0041] Improve, increase, or reduce: As used herein, the terms "improve," "increase," ("reduce"), or grammatical equivalents refer to a value compared to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) not receiving a treatment described herein. A "control subject" is a subject suffering from the same disease type as the subject being treated and who is approximately the same age as the subject being treated.

[0042] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in cell culture, and not within a multicellular organism.

[0043] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as humans and non-human animals. In the context of cell-derived systems, such terms may be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0044] Isolated: As used herein, the term "isolated" refers to a substance and / or entity that (1) is separated from at least some of the components with which it was associated when originally produced (in nature and / or in an experimental setting) and / or (2) is created, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were originally associated. In some embodiments, an isolated material is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a material is "pure" if it is substantially free of other components. As used herein, purity calculations for isolated materials and / or entities do not include additives (e.g., buffers, solvents, water, etc.).

[0045] Local distribution or delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires that the protein (e.g., an enzyme) encoded by the mRNA be translated and expressed intracellularly or secreted in a limited manner so as not to enter the patient's circulatory system.

[0046] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise specified. In some embodiments, the mRNA is designed to contain natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcyt ...bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bromouridine, C5-bro 6-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., thiophosphate linkages and 5'-N-phosphoramidite linkages).

[0047] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA and single- and / or double-stranded DNA and / or cDNA.

[0048] Patient: As used herein, the term "patient" or "subject" refers to any living organism to which a provided composition can be administered, for example, for testing, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include both prenatal and postnatal forms.

[0049] Pharmaceutically acceptable: The term "pharmacologically acceptable," as used herein, refers to a substance that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable level of benefit / risk.

[0050] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmacologically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmacologically acceptable salts of the compounds of the present invention include salts derived from suitable inorganic and organic acids and bases. Examples of pharmacologically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed using other methods used in the art, such as ion exchange methods. Other pharmacologically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N-methyl-N ... + (C 1-4Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmacologically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations, formed, where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharmacologically acceptable salts include salts formed by the quaternization of amines using suitable electrophiles, e.g., alkyl halides, to form quaternized alkylamino salts.

[0051] Systemic distribution or delivery: As used herein, the terms "systemic distribution," "systemic delivery," or grammatical equivalents refer to a mechanism or method of delivery or distribution that affects the entire body or organism. Typically, systemic distribution or delivery is achieved via the body's circulatory system, e.g., the bloodstream. Contrast with the definition of "local distribution or delivery."

[0052] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. A subject may be a patient, which refers to a person who visits a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be a subject suffering from or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0053] Substantially: As used herein, the term "substantially" refers to the qualitative condition of a complete or near-complete display of the extent or degree of a characteristic or property of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, run to complete completion and / or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential for lack of completeness inherent in many biological and chemical phenomena.

[0054] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by a disease to be treated. In some embodiments, target tissues include tissues that exhibit pathology, symptoms, or characteristics associated with the disease.

[0055] Therapeutically effective amount: As used herein, a "therapeutically effective amount" of a therapeutic agent means an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent, and / or delay the onset of a symptom(s) of the disease, disorder, and / or condition. It will be understood by those skilled in the art that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.

[0056] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely ameliorate, improve, alleviate, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not show signs of disease and / or who show only early signs of disease, with the goal of reducing the risk of developing pathology associated with the disease.

[0057] (Detailed explanation) The present invention provides, inter alia, methods and compositions based on mRNA therapy for treating argininosuccinate synthase deficiency (ASD). Specifically, the present invention provides methods for treating ASD by administering to a subject in need of treatment a composition comprising mRNA encoding argininosuccinate synthase (ASS) at an effective dose and interval to reduce the intensity, severity, or frequency of, or delay the onset of, at least one symptom or characteristic of ASD. In some embodiments, the mRNA is encapsulated within one or more liposomes. As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticulate vesicle. Typically, a liposome, as used herein, comprises a mixture of one or more lipids or a mixture of one or more lipids and a polymer(s). Thus, the term "liposome," as used herein, encompasses both lipid-based and polymer-based nanoparticles. In some embodiments, liposomes suitable for the present invention contain cationic or non-cationic lipid(s), cholesterol-based lipid(s), and PEG-modified lipid(s).

[0058] Argininosuccinate synthase deficiency (ASD) The present invention may be used to treat subjects suffering from or susceptible to argininosuccinate synthase deficiency (ASD). ASD is an autosomal recessive inherited genetic metabolic disorder characterized by mutations in the gene encoding the enzyme argininosuccinate synthase (ASS1). At least 50 mutations that cause type 1 ASD have been identified in the ASS1 gene. Most of these mutations involve the substitution of a single amino acid. Many mutations in the ASS1 gene likely affect the structure of the resulting protein and its ability to bind to citrulline, aspartate, and other molecules. A small number of mutations in the ASS1 gene result in an enzyme that is abnormally shorter than normal, preventing it from effectively fulfilling its role in the urea cycle.

[0059] Defects in the ASS1 protein disrupt the urea cycle, preventing the liver from properly converting excess nitrogen, produced when protein is used for energy, into urea. The accumulation of ammonia and other by-products of the urea cycle (such as citrulline) is toxic, and if this accumulation occurs within the first few days of life, it can cause symptoms such as weakness (lethargy), poor feeding, vomiting, seizures, and loss of consciousness. These medical problems are often life-threatening.

[0060] The compositions and methods described herein may be used to treat at least one symptom or feature of ASD.

[0061] Argininosuccinate synthase (ASS1) In some embodiments, the present invention provides methods and compositions for delivering mRNA encoding ASS1 to a subject to treat argininosuccinate synthase deficiency (ASD). Suitable ASS1 mRNA encodes any full-length, fragment, or portion of the ASS1 protein that is capable of replacing naturally occurring ASS1 protein activity and / or reducing the intensity, severity, and / or frequency of one or more symptoms associated with ASD.

[0062] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding the human ASS1 protein. The naturally occurring human ASS1 mRNA sequence and the corresponding amino acid sequence are shown in Table 1. [Table 1-1] [Table 1-2]

[0063] In some embodiments, a suitable mRNA is the wild-type hASS1 mRNA of the sequence (SEQ ID NO: 1). In some embodiments, a suitable mRNA may be a codon-optimized hASS1 sequence, such as the sequence shown below: AUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUGCCUACCUGGCCCAACAUCGGCCAGAAGGAGGACUUCGAGGGACCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGGUGUUCAUCGAGGACGUGCCGCGA (SEQ ID NO: 3).

[0064] Further exemplary mRNA sequences are described in the Examples section below, for example, SEQ ID NO:7 and SEQ ID NO:8 both include 5' and 3' untranslated regions framing the codon-optimized mRNA encoding ASS1.

[0065] In some embodiments, a suitable mRNA sequence may be a homolog or analog mRNA sequence of the human ASS1 protein. For example, a homolog or analog of the human ASS1 protein may be a modified human ASS1 protein that contains one or more amino acid substitutions, deletions, and / or insertions compared to the wild-type or naturally occurring human ASS1 protein, while maintaining substantial ASS1 protein activity. In some embodiments, a suitable mRNA for the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 2. In some embodiments, a suitable mRNA for the present invention encodes a protein that is substantially identical to the human ASS1 protein. In some embodiments, mRNA suitable for the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 2. In some embodiments, mRNA suitable for the present invention encodes a fragment or portion of the human ASS1 protein. In some embodiments, mRNA suitable for the present invention encodes a fragment or portion of the human ASS1 protein, wherein such a fragment or portion of the protein retains ASS1 activity similar to that of the wild-type protein. In some embodiments, mRNA suitable for the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 2. have a nucleotide sequence that is 5%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15.

[0066] In some embodiments, a suitable mRNA encodes a fusion protein comprising the full-length, fragment, or portion of the ASS1 protein fused to another protein (e.g., an N- or C-terminal fusion). In some embodiments, the protein fused to the mRNA encoding the full-length, fragment, or portion of the ASS1 protein encodes a signal or cellular targeting sequence.

[0067] Delivery Vehicle According to the present invention, the mRNA encoding the ASS1 protein (e.g., full-length, fragments, or portions of the ASS1 protein) described herein may be delivered as naked RNA (unencapsulated) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "transfer vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.

[0068] In some embodiments, the mRNA encoding the ASS1 protein may be delivered via a single delivery vehicle. In some embodiments, the mRNA encoding the ASS1 protein may be delivered via one or more delivery vehicles, each of which has a different composition. According to various embodiments, suitable delivery vehicles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and lipid liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, naturally-derived and synthetically-derived exosomes, natural, synthetic, and semi-synthetic lamellar bodies, nanoparticles, calcium phosphate or calcium silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly(D-arginine), sols or gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multidomain-block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polycomplexes), dry powders, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vector tags.

[0069] Liposomal Delivery Vehicles In some embodiments, a suitable delivery vehicle is a liposome delivery vehicle, e.g., a lipid nanoparticle. As used herein, a liposome delivery vehicle, e.g., a lipid nanoparticle, is typically characterized as a microscopic vesicle having an internal aqueous compartment separated from the external medium by a membrane consisting of one or more bilayers. The liposome bilayer is typically formed from amphiphilic molecules, such as synthetic or naturally occurring lipids, containing spatially separated hydrophilic and hydrophobic regions (Lasic, Trends Biotechnol., 16:307-321, 1998). The liposome bilayer can also be formed from amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, a liposome delivery vehicle typically functions to transport a desired mRNA to a target cell or tissue.

[0070] cationic lipids In some embodiments, liposomes may contain one or more cationic lipids. As used herein, the term "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, and many are commercially available. Particularly suitable for use in the compositions and methods of the present invention are: Cationic lipids are described in International Patent Publication WO2010 / 053572 (and in particular in paragraph [00 225] and WO2012 / 170930 In some embodiments, the compositions and methods of the present invention include, for example, (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine Lipid nanoparticles containing ionizable cationic lipids described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012 (incorporated herein by reference), such as (HGT5001), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002), and the like, are used.

[0071] In some embodiments, provided liposomes comprise cationic lipids as described in WO2013063468, as well as in the concurrently filed U.S. provisional application of even date herewith, entitled "Lipid Formulations for Delivery of Messenger RNA," both of which are incorporated herein by reference.

[0072] In some embodiments, the cationic lipid is represented by formula I-c1-a [ka] or a pharmaceutically acceptable salt thereof, wherein Each R 2 are independently hydrogen or C 1-3 is an alkyl group, each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group, Each R L are independent of each other and C 8-12 It is an alkyl group.

[0073] In some embodiments, each R 2 are each independently a hydrogen, a methyl group, or an ethyl group. In some embodiments, each R 2 are each independently hydrogen or a methyl group. In some embodiments, each R 2 is hydrogen.

[0074] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0075] In some embodiments, each R' is independently hydrogen, a methyl group, or an ethyl group. In some embodiments, each R' is independently hydrogen or a methyl group. In some embodiments, each R' is independently hydrogen.

[0076] In some embodiments, each R L are independent of each other and C 8-12 In some embodiments, each R L are independent of each other and are NC 8-12 In some embodiments, each R L are independent of each other and C 9-11 In some embodiments, each R L are independent of each other and are NC 9-11 In some embodiments, each R L are independent of each other and C 10 In some embodiments, each R L are independent of each other and are NC 10 It is an alkyl group.

[0077] In some embodiments, each R 2 are each independently a hydrogen atom or a methyl group; each q is independently 3 to 5; each R' is independently a hydrogen atom or a methyl group; and , each R Lare independent of each other and C 8-12 It is an alkyl group.

[0078] In some embodiments, each R 2 are hydrogen; each q is independently 3 to 5; each R' is hydrogen; and each R L are independent of each other and C 8-12 It is an alkyl group.

[0079] In some embodiments, each R 2 is hydrogen; each q is 4; each R' is hydrogen ; and each R L are independent of each other and C 8-12 It is an alkyl group.

[0080] In some embodiments, the cationic lipid has the formula Ig [ka] or a pharmaceutically acceptable salt thereof, wherein each R L are independent of each other and C 8-12 In some embodiments, each R L are independent of each other and are NC 8-12 In some embodiments, each R L are independent of each other and C 9-11 In some embodiments, each R L are independent of each other and are NC 9-11 In some embodiments, each R L are independent of each other and C 10 In some embodiments, each R L is NC 10 It is an alkyl group.

[0081] In certain embodiments, provided liposomes include the cationic lipid cKK-E12, or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below: [ka]

[0082] In some embodiments, the one or more cationic lipids may be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA." (Feigner et al. (Proc. Nat'l Ac Ad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355. DOTMA can be formulated alone or in combination with neutral lipids, dioleylphosphatidylethanolamine ("DOPE"), or other cationic or non-cationic lipids, and placed into liposome transfer vehicles or lipid nanoparticles; such liposomes can be used to facilitate nucleic acid delivery into target cells. Other suitable cationic lipids include, for example, 5-carboxyspermylglycinedioctadecylamide ("DOGS"), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium ("DOSPA") (Behr et al. Proc. Nat. Acad. Sci. 86, 6982 (1989); US Pat. No. 5,171,678; US Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"), and 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0083] Further exemplary cationic lipids include 1,2-stearyloxy(distearyloxy)-N,N-dimethyl-3-aminopropane ("DSDMA"), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"), 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"), N-dioleyl-N,N-dimethylammonium chloride ("DODAC"), N,N-distearyl- N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane ("CLinDMA"), 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy]-3-dimethyl-l-(cis,cis-9',l-2'-octadecadienoxy)propane Octadecadienoxy)propane ("CpLinDMA"), N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"), 1,2-N,N'-dioleylcarbamate Dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"), 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP"), 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane ("DLinCDAP"), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane ("DLiN"). --DMA"), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-diamino Xolane ("DLiN-K-XTC2-DMA"), and 2-(2,2-di((9Z,12Z)octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl) -N,N-dimethylethanamine (DLiN-KC2-DMA) (see WO2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010)), or mixtures thereof. (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO2005 / 121348A1). In some embodiments, one or more cationic lipids comprise at least one imidazole, dialkylamino, or guanidinium moiety.

[0084] In some embodiments, the one or more cationic lipids include XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19- yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (US Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), aminoalcohol lipidoids such as those disclosed in WO2010 / 053572 lipidoid), DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular lipidoids" delivery of encapsulated nucleic acids” J.Contr.Rel.2005,107,276-287), DLin-KC2-DMA(Semple,SCet al.”Rational Design of Cationic Lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al. "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869).

[0085] In some embodiments, the percentage of cationic lipids in the liposomes is greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60% In some embodiments, the cationic lipid(s) constitute about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by weight. In some embodiments, the cationic lipid (e.g., cKK-E12) constitutes about 30%, about 35%, about 40%, about 45%, or about 50% of the liposome by molar ratio.

[0086] Non-cationic / Helper Lipids In some embodiments, provided liposomes contain one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any lipid that is neutral, zwitterionic, or anionic. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (D ... Examples of suitable phosphatidylethanolamines include, but are not limited to, 1-(N-maleimidomethyl)cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof.

[0087] In some embodiments, such non-cationic lipids may be used alone, but are preferably used in combination with other additives, such as cationic lipids. In some embodiments, the non-cationic lipids may comprise, by molar ratio, about 5% to about 90%, or about 10% to about 70% of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that have no net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the proportion of non-cationic lipids in the liposomes may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0088] Cholesterol-based lipids In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include DC-Chol (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao, et al., BioChem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23, 139 (1997); US Pat. No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise, by molar ratio, about 2% to about 30%, or about 5% to about 20%, of the total lipid present in the liposome. In some embodiments, the proportion of cholesterol-based lipid in the lipid nanoparticle may be greater than 5%, 10%, greater than 20%, greater than 30%, or greater than 40%.

[0089] PEGylated lipids In some embodiments, provided liposomes comprise one or more PEGylated lipids. Also contemplated herein are polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), such as N-octanoylsphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (CPEG-2000 ceramide), in combination with one or more cationic lipids, and in some embodiments, other lipids, in liposome formation. Contemplated PEG-modified lipids include those with chain lengths of C6-C8. 20Examples of suitable PEG-modified or PEGylated lipids include, but are not limited to, polyethylene glycol chains up to 5 kDa in length covalently attached to lipids having alkyl chain(s). In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. The addition of such moieties can prevent aggregation of the complex and may also provide a means to increase the circulating lifetime and delivery of lipid-nucleic acid conjugate compositions to target cells (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or in Additional components may be selected to allow rapid clearance from the formulation in vivo (see US Pat. No. 5,885,613).

[0090] In some embodiments, particularly useful exchangeable lipids are those with short acyl chains (e.g., C 14 or C 18 The PEG-modified phospholipids and derivatized lipids of the present invention may constitute, by molar ratio, about 0% to about 15%, about 0.5% to about 15%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome.

[0091] According to various embodiments, the selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids that make up the lipid nanoparticles, as well as the relative molar ratios of such lipids, is based on the characteristics of the selected lipid(s), the nature of the intended target cells, and the characteristics of the mRNA to be delivered. Additional considerations include, for example, the degree of saturation of the alkyl chain, as well as the size, charge, pH, pKa, fusogenicity, and toxicity of the selected lipid(s). Therefore, the molar ratios may be adjusted accordingly.

[0092] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, either alone or in combination with other carriers, such as various lipids described herein. Thus, in some embodiments, liposome delivery vehicles, as used herein, also encompass nanoparticle-containing polymers. Suitable polymers may include, for example, polyacrylate, polyalkylcyanoacrylate, polylactic acid, polylactic acid-polyglycolic acid copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be branched PEI with a molecular weight ranging from 10 to 40 kDa, e.g., 25 kDa branched PEI (Sigma #408727).

[0093] Liposomes suitable for the present invention may contain one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEGylated lipids, and / or polymers described herein in various ratios. As a non-limiting example, a suitable liposome formulation may include a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol, and DMG-PEG2K.

[0094] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is present in a molar ratio of about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%) of the liposome. In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome by molar ratio.

[0095] In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s), respectively, is about 40:30:20:10. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s), respectively, is about 40:30:25:5. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s), respectively, is about 40:32:25:3. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEGylated lipid(s) is about 50:25:20:5.

[0096] mRNA synthesis The mRNA of the present invention may be synthesized according to any of a wide variety of known methods. For example, the mRNA of the present invention may be synthesized by in vitro transcription (IVT). Briefly, IVT is typically carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleoside triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., RNA polymerase T3, T7, or SP6), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary depending on the specific application.

[0097] In some embodiments, to prepare mRNA according to the present invention, a DNA template is prepared in Transcribed in vitro. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence of the desired mRNA and a termination signal.

[0098] The desired mRNA sequence(s) according to the present invention may be determined using standard methods and incorporated into a DNA template. For example, starting from the desired amino acid sequence (e.g., an enzyme sequence), virtual reverse translation is performed based on the degenerate genetic code. Then, an optimization algorithm may be used to select suitable codons. Typically, on the one hand, the G / C content is optimized to achieve the highest possible G / C content, and on the other hand, the frequency of tRNAs according to the codons used is taken into account as much as possible. Once the optimized RNA sequence is established, it can be displayed, for example, using a suitable display device, and compared with the original (wild-type) sequence. Secondary structure analysis can also be performed to calculate the stabilizing and destabilizing properties of regions of the RNA, respectively.

[0099] modified mRNA In some embodiments, mRNA according to the present invention may be synthesized as unmodified or modified mRNA. Typically, mRNA is modified to increase stability. Modifications of mRNA can include, for example, modifications of the nucleotides of the RNA. Thus, modifications of mRNA according to the present invention include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, mRNA can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)). and modified nucleotides such as 1-methyladenine, 2-methyladenine, 2-methylthio-N-6-isopentenyladenine, N6-methyladenine, N6-isopentenyladenine, 2-thiocytosine, 3-methylcytosine, 4-acetylcytosine, 5-methylcytosine, 2,6-diaminopurine, 1-methylguanine, 2-methylguanine, 2,2-dimethylguanine, 7-methylguanine, inosine, 1-methylinosine, pseudouracil (5-uracil), dihydrouracil, 2-thiouracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-(carboxyhydroxymethyl)uracil, 5-fluorouracil, 5-bromo ... Purine and pyrimidine analogs or derivatives, such as aminomethyluracil, 5-methyl-2-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 1-methyl-pseudouracil, queuosine, β-D-mannosylqueuosine, wybutoxosine, and phosphoramidate, thiophosphates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. Nos. 5,262,530 and 5,700,642, the disclosures of which are incorporated by reference in their entireties.

[0100] In some embodiments, an mRNA (e.g., an mRNA encoding ASS1) may contain an RNA backbone modification. Typically, the backbone modification is a chemical modification of the phosphate group of the backbone of a nucleotide contained in the RNA. Exemplary backbone modifications include, but are not limited to, modifications in which a group consisting of a methylphosphonate group, a methylphosphoramidate group, a phosphoramidate group, a thiophosphate group (e.g., cytidine 5'-O-(1-thiophosphate)), a boranophosphate group, a positively charged guanidinium group, or the like is substituted for the phosphodiester bond with another anionic, cationic, or neutral group.

[0101] In some embodiments, an mRNA (e.g., an mRNA encoding ASS1) may contain sugar modifications. Exemplary sugar modifications are chemical modifications of the sugar contained in the nucleotide, and include 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotides, 2'-deoxy-2' Sugar modifications include, but are not limited to, -C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-arauidine 5'-triphosphate), or azidotriphosphate (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0102] In some embodiments, the mRNA (e.g., the mRNA encoding ASS1) is a nucleic acid sequence. The base of the nucleotide may be modified (base modified). Modified nucleotides containing base modifications are also called base-modified nucleotides. Examples of such base-modified nucleotides include 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, and 5-methyluridine 5'-triphosphate. and 6-azacytidine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0103] Typically, mRNA synthesis involves the addition of a "cap" to the N-terminus (5') and a "tail" to the C-terminus (3'). The presence of the cap is important in conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" functions to protect the mRNA from degradation by exonucleases.

[0104] Thus, in some embodiments, an mRNA (e.g., an mRNA encoding ASS1) includes a 5'-end cap structure. The 5'-end cap is typically added as follows: an RNA terminal phosphatase removes one terminal phosphate group from the 5' nucleotide, leaving two terminal phosphate groups; a guanylyltransferase then adds guanosine triphosphate (GTP) to the terminal phosphate group, creating a 5'5'5 triphosphate bond; and a methyltransferase then methylates the nitrogen at position 7 of guanine. Examples of cap structures include, but are not limited to, mG(5')ppp(5'(A), G(5')ppp(5')A, and G(5')ppp(5')G.

[0105] In some embodiments, an mRNA (e.g., an mRNA encoding ASS1) comprises a 3' poly(A) tail structure. A typical poly(A) tail at the 3' end of an mRNA is Typically, about 10 to 300 adenosine-type nucleotides (SEQ ID NO: 9) (e.g., about 10 to 200 adenosine-type nucleotides, about 10 to 150 adenosine-type nucleotides, about 10 to 100 adenosine-type nucleotides, about 20 to 70 adenosine-type nucleotides, or about 20 to 60 adenosine-type nucleotides) are included. In some embodiments, the mRNA includes a 3' poly(C) tail structure. A poly-C tail at the 3' end of a suitable mRNA is typically includes about 10 to 200 cytosine-type nucleotides (SEQ ID NO: 10) (e.g., about 10 to 150 cytosine-type nucleotides, about 10 to 100 cytosine-type nucleotides, about 20 to 70 cytosine-type nucleotides, about 20 to 60 cytosine-type nucleotides, or about 10 to 40 cytosine-type nucleotides). A poly-C tail may be added to the poly-A tail or may replace the poly-A tail.

[0106] In some embodiments, the mRNA includes 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region includes one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0107] In some embodiments, the 3' untranslated region includes one or more polyadenylation signals, binding sites for proteins that affect the stability of mRNA in its subcellular location, or one or more miRNA binding sites. In some embodiments, the 3' untranslated region can be 50 to 500 or more nucleotides in length.

[0108] Cap Structure In some embodiments, the mRNA comprises a 5'-end cap structure. The 5'-end cap is typically added as follows: first, an RNA terminal phosphatase removes one terminal phosphate group from the 5' nucleotide, leaving two terminal phosphate groups; then, a guanylyltransferase adds guanosine triphosphate (GTP) to the terminal phosphate group, creating a 5'5'5 triphosphate bond; and then, a methyltransferase methylates the nitrogen at position 7 of guanine. An example of a cap structure is m7G(5')ppp( 5'(A, G(5')ppp(5')A and G(5')ppp(5')G. However, the present invention is not limited to the above.

[0109] The naturally occurring cap structure contains a triphosphate linkage at the 5' end of the first transcribed nucleotide. It contains 7-methylguanosine linked by a bridge, which is 7 The dinucleotide cap is G(5')ppp(5')N (where N is any nucleoside). In vivo, the cap is added enzymatically. The cap is added in the cell nucleus and is catalyzed by the enzyme guanylyltransferase. The addition of a cap to the 5' end of RNA is essential for transcription initiation. The terminal nucleoside is typically a guanosine and is in the reverse orientation relative to all other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0110] The general cap of mRNA produced in vitro is m 7 G(5')pp p(5')G, which is a nucleotide sequence that encodes the nucleotide sequence of the T7 or SP6 RNA polymerase in vitro. In transcription by ribozyme, a dinucleotide is synthesized to obtain RNA with a cap structure at the 5' end. The most common method for synthesizing capped mRNA in vitro involves the use of preformed mRNA. 7 G(5')ppp(5')G("m 7 It uses a dinucleotide of the type GpppG as a transcription initiation factor.

[0111] To date, the typical type of synthetic dinucleotide cap used in in vitro translation experiments is the anti-reverse cap analog (ARCA) or modified ARCA, which is generally a modified cap analog in which the OH group at the 2' or 3' position is replaced with -OCH3.

[0112] Further cap analogs include m 7 GpppG, m 7 GpppA, m 7 a chemical structure selected from the group consisting of GpppC; an unmethylated cap analog (e.g., GpppG); a dimethylated cap analog (e.g., m 2、7 GpppG), trimethylated cap analogs (e.g., m 2、2、7 GpppG), symmetrically dimethylated cap analogs (e.g., m 7 Gpppm 7 G), or anti-reverse cap analogs (e.g., ARCA; m 7 , 2'Ome GpppG, m 72'd GpppG, m 7、3'Ome GpppG, m7、3'd GpppG and their tetraphosphate derivatives) (see, for example, Jemielity, J. et al., "Novel 'anti-reverse' cap analogs with superior translational properties", RNA, 9:1108-1122 (2003)).

[0113] In some embodiments, a suitable cap is located at the 5' end of the first transcribed nucleotide. 7-methylguanylic acid ("m") is attached to the end of the 7 G"), which is m 7 G(5')ppp(5')N (where N is any nucleoside). m used in the state 7 The preferred embodiment of the G-cap is m 7 G(5')ppp(5')G.

[0114] In some embodiments, the cap is a Cap0 structure. A Cap0 structure has no 2'-O-methyl residues on the ribose attached to bases 1 and 2. In some embodiments, the cap is a Cap1 structure. A Cap1 structure has a 2'-O-methyl residue on base 2. In some embodiments, the cap is a Cap2 structure. A Cap2 structure has 2'-O-methyl residues attached to both bases 2 and 3.

[0115] A wide variety of m 7 G-cap analogs are known in the art and many are commercially available. These include the m 7 These include GpppG and ARCA 3'-OCH3 and 2'-OCH3 cap analogs (Jemielity, J. et al., RNA, 9:1108-1122 (2003)). Additional cap analogs for use in embodiments of the present invention include N7-benzylated dinucleoside tetraphosphates (N7-benzylated dinucleoside tetraphosphates). nucleosidetetraphosphate cap analogs (described in Grudzien, E. et al., RNA, 10:1479-1487 (2004)), thiophosphate cap analogs (described in Grudzien-Nogalska, E., et al., RNA, 13:1745-1755 (2007)), and cap analogs (including biotinylated cap analogs) described in US Patent Nos. 8,093,367 and 8,304,529, which are incorporated herein by reference.

[0116] Tail Structure Typically, the presence of a "tail" functions to protect mRNA from degradation by exonucleases. Poly-A tails are thought to stabilize natural messenger and synthetic sense RNA. Thus, in certain embodiments, long poly-A tails can be added to mRNA molecules, thereby making the RNA more stable. Poly-A tails can be added using a variety of techniques recognized in the art. For example, long poly-A tails can be added to synthetic or in vitro transcribed RNA using poly-A polymerase (Yokoe, et al. Nature Biotechnology. 1996;14:1252-1256). Transcription vectors can also encode long poly(A) tails. Furthermore, poly(A) tails can be added by direct transcription from PCR products. Poly(A) is added to the 3' end of the sense RNA by adding R Ligation may be performed using NA ligase (see, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0117] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. Typically, the length of the poly(A) tail can be at least about 10, 50, 100, 200, 300, 400, or at least 500 nucleotides (SEQ ID NO: 11). In some embodiments, the poly(A) tail at the 3' end of the mRNA typically contains about 10 to 300 adenosine-type nucleotides. The mRNA comprises a nucleotide sequence of SEQ ID NO: 9 (e.g., about 10-200 adenosine-type nucleotides, about 10-150 adenosine-type nucleotides, about 10-100 adenosine-type nucleotides, about 20-70 adenosine-type nucleotides, or about 20-60 adenosine-type nucleotides). In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly(C) tail at the 3' end of the mRNA typically comprises about 10-200 cytosine-type nucleotides. The poly-C tail may be added to or may replace the poly-A tail.

[0118] In some embodiments, the length of the poly-A or poly-C tail is adjusted to control the stability of the modified sense mRNA molecules of the present invention, thereby controlling protein transcription. For example, because the length of the poly-A tail affects the half-life of the sense mRNA molecule, the length of the poly-A tail can be adjusted to modify the resistance of the mRNA to nucleases, thereby controlling the time course of polynucleotide expression and / or polypeptide production in target cells.

[0119] 5' and 3' untranslated regions In some embodiments, the mRNA includes 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region includes one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0120] In some embodiments, the 3' untranslated region includes one or more polyadenylation signals, binding sites for proteins that affect the stability of mRNA in its subcellular location, or one or more miRNA binding sites. In some embodiments, the 3' untranslated region can be 50 to 500 or more nucleotides in length. Exemplary 3' and / or 5' UTR sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or enzymes of the citric acid cycle) to enhance the stability of the sense mRNA molecule. For example, the 5' UTR sequence can include a subsequence of the CMV immediate-early 1 (IE1) gene, or a fragment thereof, to improve nuclease resistance and / or half-life of the polynucleotide. It is also contemplated to include a sequence encoding human growth hormone (hGH), or a fragment thereof, in the 3' end or untranslated region of a polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to the unmodified polynucleotide, and include, for example, modifications made to improve the resistance of such polynucleotides to digestion by nucleases in vivo.

[0121] Liposome formation Liposome transfer vehicles for use in the compositions of the present invention can be prepared by a variety of techniques currently known in the art. Liposomes for use in the provided compositions can be prepared by a variety of techniques currently known in the art. For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques, such as dissolving selected lipids in an appropriate solvent and depositing the lipids on the inside wall of a suitable container or vessel, followed by evaporating the solvent to dryness, leaving a thin film on the inside of the vessel, or by spray drying. An aqueous phase can then be added to the vessel while vortexing, thereby forming MLVs. Unilamellar vesicles (ULVs) can then be formed by homogenizing, sonicating, or extruding the multilamellar vesicles. Additionally, unilamellar vesicles can be formed by detergent removal methods.

[0122] In some embodiments, the provided composition comprises liposomes, wherein mRNA is associated with both sides of the liposome and encapsulated within the same liposome.For example, during the preparation of the composition of the present invention, cationic liposomes can be associated with mRNA through electrostatic interaction.For example, during the preparation of the composition of the present invention, cationic liposomes can be associated with mRNA through electrostatic interaction.

[0123] In some embodiments, the compositions and methods of the present invention comprise mRNA encapsulated within liposomes. In some embodiments, one or more such mRNA species are present in the same liposome. In some embodiments, the one or more mRNA species may be encapsulated within different liposomes. In some embodiments, the mRNA is encapsulated within one or more liposomes, which differ in lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, the one or more liposomes may differ in composition of cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, the one or more liposomes may differ in the molar ratios of cationic lipids, neutral lipids, cholesterol, and PEG-modified lipids used to prepare the liposomes.

[0124] The process of incorporating a desired mRNA into liposomes is often referred to as "loading." An exemplary method is described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. The liposome-incorporated nucleic acid may be located, completely or partially, in the interior space of the liposome, within the liposome bilayer, or associated with the outer surface of the liposome membrane. The incorporation of a nucleic acid into a liposome is also referred to herein as "encapsulation," in which the nucleic acid is contained entirely within the interior space of the liposome. The purpose of incorporating mRNA into a transfer vehicle such as a liposome is often to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid and / or systems or receptors that rapidly excrete the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate delivery of the mRNA to target cells or tissues.

[0125] Liposome size Suitable liposomes of the present invention may be made in a variety of sizes. In some embodiments, the provided liposomes may be smaller than previously known mRNA-encapsulating liposomes. In some embodiments, reduced liposome size correlates with higher efficiency of mRNA delivery. Selection of the appropriate liposome size may take into account the target cell or tissue site and, to some extent, the application for which the liposomes are made.

[0126] In some embodiments, liposomes of appropriate size are selected to promote the systemic distribution of the antibody encoded by the mRNA. In some embodiments, it may be desirable to restrict the transfection of mRNA to specific cells or tissues. For example, to target hepatocytes, liposomes may be sized to be smaller than the pores of the endothelial cell layer of the liver sinusoidal lining, and in such cases, liposomes may be able to easily pass through these pores of the endothelial cell to reach the targeted hepatocytes.

[0127] Alternatively or additionally, liposomes may be sized to provide liposomes of sufficient diameter to limit or significantly avoid distribution to particular cells or tissues, for example, liposomes may be sized to be larger than the pores of the endothelial cell layer lining the liver sinusoids, thereby limiting liposome distribution to hepatocytes.

[0128] In some embodiments, liposome size is determined by the longest diameter of the liposome particle. In some embodiments, suitable liposomes are about 250 nM or less in size (e.g., about 225 nM, 200 nM, 175 nM, 150 nM, 125 nM, 100 nM, 75 nM, or 50 nM or less). In some embodiments, suitable liposomes are in the range of about 10 to 250 nM (e.g., about 10 to 225 nM, 10 to 200 nM, 10 to 175 nM, 10 to 150 nM, 10 to 125 nM, 10 to 100 nM, 10 to 75 nM, or 10 to 50 nM). In some embodiments, suitable liposomes are The size of the liposomes is in the range of about 100 to 250 nM (e.g., in the range of about 100 to 225 nM, 100 to 200 nM, 100 to 175 nM, or 100 to 150 nM). In some embodiments, the size of the liposomes is in the range of about 10 to 100 nM (e.g., in the range of about 10 to 90 nM, 10 to 80 nM, 10 to 70 nM, 10 to 60 nM, or 10 to 50 nM).

[0129] A wide variety of alternative methods known in the art are available for size control of liposome populations. One such method of size control is described in U.S. Pat. No. 4,737,323, incorporated herein by reference. Sonication of a liposome suspension using bath or probe sonication results in a stepwise size reduction, producing small ULVs with diameters of less than about 0.05 microns. Homogenization is another method that utilizes shear energy to reduce large liposomes. A typical homogenization procedure involves passing MLVs through a standard emulsion homogenizer and recirculating them until liposomes of a selected size are obtained, typically about 0.1 to 0.5 microns. Liposome size can be determined using quasi-electric light scattering, as described in Bloomfield, Ann. Rev. Biophys. BioEng., 10:421-150 (1981). The average liposome size may be measured by quantum elucidation scattering (QELS), which is incorporated herein by reference. Sonication of formed liposomes can reduce the average liposome size. Intermittent sonication cycles may be alternated with QELS assessment to efficiently synthesize liposomes.

[0130] Pharmaceutical Composition To facilitate expression of mRNA in vivo, delivery vehicles such as liposomes can be formulated into pharmacological compositions in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizing agents, or mixed with suitable additives. Techniques for drug formulation and administration are described in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition.

[0131] The provided liposome-encapsulated or -associated mRNAs and compositions containing same may be administered and dosed according to current medical practice, taking into account factors relevant to a clinician of ordinary skill, such as the subject's clinical condition, the site and method of administration, the administration schedule, and the subject's age, sex, and weight. For purposes herein, an "effective amount" may be determined taking into account relevant factors known to those skilled in the art of pilot clinical studies, pharmacology, clinical, and medical science. In some embodiments, the amount administered is an amount effective to achieve at least some stabilization, improvement, or elimination of symptoms, as well as other indicators selected by those skilled in the art as appropriate measures of disease progression, regression, or improvement. For example, a suitable amount and administration regimen is one that results in at least transient production of a protein (e.g., an enzyme).

[0132] Suitable routes of administration include, for example, oral, enteral, vaginal, transmucosal, intratracheal or pulmonary, including inhalation, or enteral administration; parenteral delivery by intradermal, transdermal (topical), intramuscular, subcutaneous, intramedullary injection, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal parenteral delivery.

[0133] Alternatively or additionally, liposome-encapsulated mRNA and compositions of the invention may be administered locally rather than systemically, for example, by direct injection of the pharmaceutical composition into the target tissue, preferably in a sustained release formulation. Local delivery can be affected in a variety of ways and will vary depending on the target tissue. For example, aerosols containing compositions of the invention can be inhaled (intranasal, tracheal, or bronchial delivery); compositions of the invention can be injected, for example, at the site of injury, disease manifestation, or pain; compositions can be administered as pharmaceuticals for oral, tracheal, or esophageal indications. The compositions can be provided in the form of liquid, tablets, or capsules for gastric or intestinal administration, or in suppository form for rectal or vaginal application; or the compositions can be delivered to the eye using creams, eye drops, or even by injection. Formulations containing the provided compositions complexed with therapeutic molecules or ligands can also be administered during surgical procedures, for example, in association with polymers or other structures or substances that allow the compositions to spread from the implantation site to surrounding tissues. Alternatively, they can be applied during surgical procedures without the use of polymers or supports.

[0134] The provided methods of the present invention contemplate single as well as frequent administration of a therapeutically effective amount of a therapeutic agent (e.g., an mRNA encoding an ASS1 protein) described herein. The therapeutic agent can be administered at regular intervals depending on the nature, severity, and extent of the subject's condition (e.g., ASD). In some embodiments, a therapeutically effective amount of a therapeutic agent of the present invention (e.g., an mRNA encoding an ASS1 protein) may be administered intrathecally at regular intervals (e.g., once a year, once every six months, once every five months, once every three months, every other month (every two months), monthly (once a month), every other week (once every two weeks), once every 30 days, once every 28 days, once every 14 days, once every 10 days, once every 7 days, weekly, daily, or continuously).

[0135] In some embodiments, the provided liposomes and / or compositions are formulated for sustained release of the mRNA contained therein. Such sustained-release compositions can be conveniently administered to a subject over extended dosing intervals. For example, in one embodiment, a composition of the present invention is administered to a subject twice daily, daily, or every other day. In preferred embodiments, a composition of the present invention is administered to a subject twice weekly, once weekly, once every 7 days, once every 10 days, once every 14 days, once every 28 days, once every 30 days, once every 2 weeks, once every 3 weeks, or, more preferably, once every 4 weeks, once monthly, once every 6 weeks, once every 8 weeks, once every 2 months, once every 3 months, once every 4 months, once every 6 months, once every 8 months, once every 9 months, or annually. Compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) to deliver or release mRNA over extended periods of time are also contemplated. Preferably, the sustained release means used is combined with modifications made to the mRNA to enhance stability.

[0136] As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of the therapeutic agent contained in the pharmaceutical composition of the present invention. Generally, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject (e.g., treatment, regulation, cure, prevention, and / or amelioration of ASD). For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. Generally, the amount of a therapeutic agent (e.g., mRNA encoding an ASS1 protein) administered to a subject in need thereof will vary depending on the subject's characteristics. Such characteristics include the subject's pathology, disease severity, overall health, age, sex, and weight. Those skilled in the art will readily be able to determine appropriate dosages depending on these and other relevant factors. Furthermore, objective and subjective assessments may optionally be used to ascertain optimal dosage ranges.

[0137] A therapeutically effective amount is generally administered in a dosage regimen that may include multiple unit doses. For any particular therapeutic protein, the therapeutically effective amount (and / or the appropriate unit dose within the effective dosage regimen) may vary depending on, for example, the route of administration, the use in combination with other pharmaceutical preparations, etc. In addition, the specific therapeutically effective amount (and / or unit dose) for any particular patient may depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific preparation used; the specific composition used; the patient's age, weight, general health, sex, and diet; the administration time, administration route, and / or excretion rate or metabolic rate of the specific protein used; the duration of treatment; and similar factors well known in the medical field.

[0138] In some embodiments, the therapeutically effective dose range is from about 0.005 mg / kg body weight to 5 mg / kg body weight. 00mg / kg body weight, for example, about 0.005mg / kg body weight to 400mg / kg body weight, about 0.005mg / kg body weight to 300mg / kg body weight, about 0.005mg / kg body weight to 200mg / kg body weight, about 0.005mg / kg body weight to 100mg / kg body weight, about 0.005mg / kg body weight to 90mg / kg body weight, about 0.005mg / kg body weight to 80mg / kg body weight, about 0.005mg / kg body weight to 70mg / kg body weight, about 0.0 0.005mg / kg body weight to 60mg / kg body weight, about 0.005mg / kg body weight to 50mg / kg body weight, about 0.005mg / kg body weight to 40mg / kg body weight, about 0.005mg / kg body weight to 30mg / kg body weight, about 0.005mg / kg body weight to 25mg / kg body weight, about 0.005mg / kg body weight to 20mg / kg body weight, about 0.005mg / kg body weight to 15mg / kg body weight, about 0.005mg / kg body weight to 10mg / kg body weight.

[0139] In some embodiments, the therapeutically effective dose is greater than about 0.1 mg / kg body weight, greater than about 0.5 mg / kg body weight, greater than about 1.0 mg / kg body weight, greater than about 3 mg / kg body weight, greater than about 5 mg / kg body weight, greater than about 10 mg / kg body weight, greater than about 15 mg / kg body weight, greater than about 20 mg / kg body weight, greater than about 30 mg / kg body weight, greater than about 40 mg / kg body weight, greater than about 50 mg / kg body weight, greater than about 60 mg / kg body weight, greater than about 70 mg / kg body weight, greater than about 80 mg / kg body weight, greater than about 90 mg / kg body weight, greater than about 100 mg / kg body weight, greater than about 150 mg / kg body weight, greater than about 200 mg / kg body weight, greater than about 250 mg / kg body weight, greater than about 300 mg / kg body weight, greater than about 350 mg / kg body weight, greater than about 400 mg / kg body weight, greater than about 450 mg / kg body weight, or greater than about 500 mg / kg body weight.

[0140] Also contemplated herein are lyophilized pharmaceutical compositions comprising one or more liposomes disclosed herein, and methods relating to the use of such compositions, e.g., as disclosed in U.S. Provisional Application No. 61 / 494,882, filed June 8, 2011, the teachings of which are incorporated herein by reference in their entirety. For example, the lyophilized pharmaceutical compositions of the present invention may be prepared prior to administration or can be prepared in vivo. For example, the lyophilized pharmaceutical compositions can be formulated into an appropriate dosage form (e.g., an intradermal dosage form such as a disk, rod, or membrane) and administered such that the dosage form is rehydrated in vivo by an individual's bodily fluids over time.

[0141] The provided liposomes and compositions may be administered to any desired tissue. In some embodiments, the mRNA delivered in the provided liposomes or compositions is expressed in the tissue to which the liposomes and / or compositions are administered. In some embodiments, the delivered mRNA is expressed in a tissue different from the tissue to which the liposomes and / or compositions are administered. Exemplary tissues to which the delivered mRNA may be delivered and / or expressed include, but are not limited to, the liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid.

[0142] According to the present invention, a therapeutically effective dose, when administered at regular intervals, results in an increase in the amount of ASS1 in the liver. In some embodiments, a therapeutically effective dose, when administered at regular intervals, results in a decrease in serum citrulline levels compared to pre-treatment baseline serum citrulline levels. In some embodiments, a therapeutically effective dose, when administered at regular intervals, results in a decrease in serum ammonia levels compared to pre-treatment baseline serum ammonia levels.

[0143] In some embodiments, administration of a provided composition increases the expression level of ASS1 protein in the liver compared to the pre-treatment baseline level. In some embodiments, administration of a provided composition increases the amount of ASS1 protein in the total liver protein by about 3000 ng / mg or more, about 2000 ng / mg or more, about 1000 ng / mg or more, about 500 ng / mg or more, about 400 ng / mg or more, about 200 ng / mg or more, or about 100 ng / mg or more. In certain embodiments, administration of provided compositions results in an ASS1 protein level of 120 ng / mg or greater of total liver protein.

[0144] In some embodiments, administration of a provided composition increases the amount of ASS1 protein in plasma or serum from a pre-treatment baseline amount, hi some embodiments, administration of a provided composition increases the amount of ASS1 protein in plasma or serum by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% from a pre-treatment baseline amount.

[0145] In some embodiments, administration of the composition reduces the subject's citrulline and / or ammonia levels below the baseline levels before treatment. Typically, the baseline levels are measured immediately before treatment. Typically, the citrulline and / or ammonia levels are measured in a biological sample. Suitable biological samples include, for example, whole blood, plasma, serum, urine, or cerebrospinal fluid.

[0146] In some embodiments, administration of the composition reduces the amount of citrulline in a biological sample (e.g., a serum, plasma, or urine sample) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline citrulline amount immediately before treatment. In some embodiments, administration of the composition reduces the amount of citrulline in plasma to less than about 2000 μM, 1500 μM, 1000 μM, 750 μM, 500 μM, 250 μM, 100 μM, 90 μM, 80 μM, 70 μM, 60 μM, 50 μM, 40 μM, or 30 μM.

[0147] In some embodiments, administration of the composition reduces the ammonia concentration in a biological sample (e.g., a serum, plasma, or urine sample) by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% from the baseline concentration immediately before treatment.

[0148] In some embodiments, administration of a provided composition reduces plasma or serum ammonia levels from baseline ammonia levels immediately prior to treatment. In some embodiments, administration of a provided composition reduces plasma or serum ammonia levels relative to ammonia levels in an untreated subject. In some embodiments, administration of a provided composition reduces plasma or serum ammonia levels to about 3000 μmol / L or less, about 2750 μmol / L or less, about 2500 μmol / L or less, about 2250 μmol / L or less, about 2000 μmol / L or less, about 1750 μmol / L or less, about 1500 μmol / L or less, about 1250 μmol / L or less, about 1000 μmol / L or less, about 750 μmol / L or less, about 500 μmol / L or less, about 250 μmol / L or less, about 100 μmol / L or less, or about 50 μmol / L or less. In certain embodiments, administration of the composition reduces plasma or serum ammonia levels to about 50 μmol / L or less.

[0149] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit specific medical needs. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1, 2, 3, 6, 12, 24, 48, 72, and / or 96 hours after administration of provided liposomes and / or compositions. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1 week, 2 weeks, and / or 1 month after administration. [Example]

[0150] While certain compounds, compositions and methods of the present invention have been specifically described according to certain embodiments, the following examples are merely illustrative of the compounds of the present invention and are not intended to be limiting thereof.

[0151] Example 1. Exemplary liposome formulations for delivery and expression of ASS1 mRNA This example provides an exemplary liposome formulation for effective delivery and expression of ASS1 mRNA in vivo.

[0152] lipid substances The formulations described herein include multi-component lipid mixtures using one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol-based lipids), and PEGylated lipids in different ratios designed to encapsulate mRNA encoding the mRNA ASS1 protein. Cationic lipids include (but are not limited to) DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLiNDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLiN-KC2-DMA (Semple, SC et al. "Rational Design of Cationic lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al. "Lipid-like materials for low-dose in vivo gene delivery" "Silicone Silencing" PNAS 2010, 107, 1864-1869), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione), HGT5000, HGT5001, HGT4003, ICE, dialkylamino-based, imidazole-based, guanidinium-based, etc.Helper lipids include (but are not limited to) DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), cholesterol, etc. PEGylated lipids include (but are not limited to) those with chain lengths of C6-C6. 20 Examples of suitable lipids include poly(ethylene) glycol chains up to 5 kDa in length covalently attached to lipids having alkyl chain(s).

[0153] Codon-optimized human argininosuccinate synthase (ASS1) messenger RNA was synthesized by in vitro transcription from a plasmid DNA template encoding the gene, and then a 5'-terminal cap structure (Cap 1) was added to it (Fechter, P.; Brownlee, G.G., "Recognition of mRNA cap structures by viral and cellular proteins"). J. Gen. Virology 2005, 86, 1239-1249), and a 3' poly(A) tail (SEQ ID NO: 12) approximately 250 nucleotides in length as determined by gel electrophoresis was added. The 5' and 3' untranslated regions within each mRNA product are designated X and Y, respectively, and were defined as described (see below). Example construct design of codon-optimized human argininosuccinate synthase (ASS1) mRNA: X-SEQ ID NO:3-Y, X-SEQ ID NO: 13-Y, X—SEQ ID NO: 14-Y; and X-SEQ ID NO: 15-Y. 5' and 3' UTR sequences X(5'UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 4] Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 5] or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 6)

[0154] Examples of codon-optimized human ASS1 mRNA sequences include SEQ ID NO: 3 in the Detailed Description of the Invention section, and SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15 below: SEQ ID NO: 13 。 UGCGACACUGCAUUGCCAAGAGCCAGGAGCGGGUGGAAGGAAAGGUCCAGGUGUCCGUGCUGAAGGGUCAAGUGUACAUCCUGGGGCGGGAGUCCCCUCUUUCCCUGUACAACGAAGAACUGGUGUCGAUGAACGUGCAGGGAGACUACGAGCCGACCGACGCCACGGGUUUCAUUAACAUCAAUUCCCUGAGACUGAAGGAGUACCACCGGCUCCAGUCCAAAGUCACCGCUAAGUGA (SEQ ID NO: 13), SEQ ID NO: 第十四 (SEQ ID NO: 14), SEQ ID NO: 15 AUGAGCUCGAAAGGAUCCGUGGUUUUGGCAUACUCCGGUGGACUUGACACUUCAUGCAUUUUGGUUUGGCUCAAAGAACAGGGCUACGAUGUGAUCGCCUACCUGGCGAACAUCGGACAGAAAGAGGACUUUGAAGAGGCCCGCAAGAAGGCACUGAAGCUGGGUGCCAAGAAAGUGUUUAUCGAGGAUGUGUCGAGAGAAUUCGUGGAAGAAUUCAUUUGGCCAGCCAUUCAAAGCUCCGCGCUGUACGAGGACAGAUACCUCCUCGGCACCUCACUGGCCCGCCCUUGCAUCGCGCGCAAACAGGUCGAGAUCGCUCAAAGAGAAGGAGCUAAAUACGUGUCACACGGCGCCACCGGA AAGGGAAAUGACCAAGUCCGCUUCGAGCUGUCUUGCUACUCACUCGCUCCGCAAAUCAAGGUCAUCGCACCGUGGAGGAUGCCCGAGUUCUACAACCGGUUCAAGGGGCGGAACGACCUGAUGGAGUACGCGAAGCAGCACGGUAUCCCGAUCCCUGUCACCCCAAAGAACCCCUGGAGCAUGGACGAAAAUCUGAUGCACAUCAGCUACGAAGCAGGA AUCCUGGAGAACCCGAAAAAUCAAGCACCUCCUGGACUGUACACUAAGACCCAGGACCCAGCCAAGGCCCCGAAUACCCCGGACAUCUUGGAAAUCGAGUUCAAGAAGGGGGGCCAGUGAAGGUUACCAAUGUCAAGGAUGGGACCACUCACCAAACUAGCCUGGAACUGUUCAUGUACCUGAACGAAGUGGCUGGAAAACAUGGCGUGGGAAGAAUCG AUAUCGUGGAGAACCGCUUCAUCGGCAUGAAGUCAAGGGGAAUCUACGAAACUCCGGCCGGGACGAUACUGUAUCAUGCGCAUCUCGACAUUGAAGCCUUUACUAUGGAUCGGGAAGUCCGAAAGAUCAAACAGGGCUUGGGCCUCAAGUUUGCCGAGCUGGUGUACACGGGAUUCUGGCACUCGCCGGAAUGCGAAUUCGUGCGCCACUGUAUUGCGAA GUCCCAGGAGCGCUGGAAGGGAAGGUCCAAGUCUCCGUGCUCAAAGGACAGGUCUACAUCCUUGGACGGGAGUCGCCCCUGUCGCUCUACAACGAAGAACUGGUGUCGAUGAACGUGCAGGGAGACUAUGAACCAACGGAUGCUACUGGUUUCAUCAACAUCAAUUCGCUGCGGCUUAAGGAGUACCAUCGGCUGCAGUCCAAGGUCACCGCGAAGUAG (SEQ ID NO: 15).

[0155] An example of a codon-optimized full-length human argininosuccinate synthase (ASS1) messenger RNA sequence is shown below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACGAUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCA (SEQ ID NO: 7).

[0156] In another example, the codon-optimized full-length human argininosuccinate synthase (ASS1) messenger RNA sequence is shown below: UCAAACAGCCUGCGCCUGAAGGAGUACCACCGCCUGCAGAGCAAGGUGACCGCCAAGUGAGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 8).

[0157] Exemplary Formulation Protocol A.cKK-E12 Aliquots of 50 mg / mL ethanol solutions of cKK-E12, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution (10 mM citrate / 150 mM NaCl, pH 4.5) of ASS1 mRNA was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution. The nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.64 mg / mL ASS1 mRNA (encapsulated). Z ave =78nM(Dv (50)) = 46nM;Dv (90) =96nM).

[0158] 12 B.C.-200 Aliquots of 50 mg / mL ethanol solutions of C12-200, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution (10 mM citrate / 150 mM NaCl, pH 4.5) of ASS1 mRNA was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution. The nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.82 mg / mL ASS1 mRNA (encapsulated). ave=86nM(Dv (50) = 50 nM; Dv (90) =101nM).

[0159] C.HGT4003 Aliquots of 50 mg / mL ethanol solutions of HGT4003, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution (10 mM citrate / 150 mM NaCl, pH 4.5) of ASS1 mRNA was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution. The nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.82 mg / mL ASS1 mRNA (encapsulated). ave =86nM(Dv (50) = 50 nM; Dv (90) =101nM).

[0160] D.ICE Aliquots of 50 mg / mL ethanol solutions of ICE, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution of ASS1 mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution and stirred. The final suspension was obtained in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Concentration = 0.91 mg / mL ASS1 mRNA (encapsulated). ave =81nM(Dv (50) = 48nM;Dv (90) =96nM).

[0161] E.HGT5001 Aliquots of 50 mg / mL ethanol solutions of HGT5001, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. An aqueous buffer solution (10 mM citrate / 150 mM NaCl, pH 4.5) of ASS1 mRNA was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution. The nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL ASS1 mRNA (encapsulated). ave =87.0nM(Dv (50) = 75nM;Dv (90) =103nM).

[0162] F.HGT5000 Aliquots of 50 mg / mL ethanol solutions of HGT5000, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution (10 mM citrate / 150 mM NaCl, pH 4.5) of ASS1 mRNA was prepared from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution. The nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL ASS1 mRNA (encapsulated). Zave = 81 nM (Dv (50) = 67nM;Dv (90) =97nM).

[0163] G.DLinKC2DMA Aliquots of 50 mg / mL ethanol solutions of DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer solution of ASS1 mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was quickly added to the aqueous mRNA solution. The nanoparticle suspension was then filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL ASS1 mRNA (encapsulated). (50) = 60nM;Dv (90) =92nM).

[0164] H.DODAP Aliquots of 50 mg / mL ethanol solutions of DODAP, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, ASS1 mRNA was prepared from a 1 mg / mL stock solution in an aqueous buffer (10 mM citrate / 150 mM DMSO). The lipid solution was quickly injected into the aqueous mRNA solution. The final suspension was obtained in 20% ethanol by stirring. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL ASS1 mRNA (encapsulated). Zave=84nM(Dv (50) = 62nM;Dv (90) =92nM).

[0165] I.DODMA Aliquots of 50 mg / mL ethanol solutions of DODMA, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, ASS1 mRNA was prepared from a 1 mg / mL stock solution in an aqueous buffer (10 mM citrate / 150 mM EDTA). The lipid solution was quickly injected into the aqueous mRNA solution. The final suspension was obtained in 20% ethanol by stirring. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL ASS1 mRNA (encapsulated). (50) = 69nM;Dv (90) =98nM).

[0166] Example 2. Administration of ASS1 mRNA-loaded liposomal nanoparticles In this example, a method for administering ASS1 mRNA-loaded liposomal nanoparticles and a method for analyzing the protein expressed in various target tissues in vivo will be described as an example.

[0167] All studies were performed using male CD-1 mice approximately 6-8 weeks old at the start of each experiment. The samples were administered via a single bolus tail vein injection at a total dose of 1.0 mg / kg (or other designated dose) of encapsulated ASS1 mRNA. Mice were sacrificed and perfused with saline at the designated time points.

[0168] Tissues including liver, spleen, kidney and heart from each mouse were collected, divided into individual portions and preserved in 10% neutral buffered formalin or snap frozen and stored at -80°C for analysis.

[0169] All animals were euthanized by CO2 asphyxiation at designated time points (±5%) after dose administration, followed by thoracotomy and terminal cardiac blood collection. Whole blood (maximum volume possible) was collected by cardiac puncture from euthanized animals into serum separator tubes and allowed to clot for at least 30 minutes at room temperature. Serum was then extracted by centrifugation at 9300 g for 10 minutes at 22°C ± 5°C. Approximately 40–50 μL of whole blood was collected via facial vein puncture or tail snip. Samples collected from untreated animals served as baseline ASS1 levels for comparison with test animals.

[0170] Enzyme-linked immunosorbent assay (ELISA) analysis - Human ASS1 ELISA Standard ELISA procedures were followed using mouse anti-ASS1 2D1-2E12 IgG as the capture antibody and rabbit anti-ASS1 #3285 IgG as the secondary antibody (detection) (Shire Human Genetic Therapies). 3,3',5',6',7',8',9',10',11',12',13',14',15',16',17',18',19 ... The reaction was activated with 5'-tetramethylbenzidine (TMB) substrate solution. After 20 minutes, the reaction was stopped using 2N H2SO4. Absorbance (450 nM) detection was monitored using a Molecular Devices SpectraMax instrument. Serum and organs from untreated mice and human ASS1 protein were used as negative and positive controls, respectively.

[0171] Example 3. Efficient in vivo expression of ASS1 protein In this example, administration of ASS1 mRNA resulted in good protein production and It is shown that this drug leads to clinical efficacy in vivo.

[0172] Human ASS1 protein production by codon-optimized hASS1 mRNA-loaded lipid nanoparticles was tested in CD-1 mice after a single bolus intravenous injection. Figure 1 shows the amount of human ASS1 protein detected by ELISA after treatment of mice with various doses of human ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles. 24 hours after injection, mice were sacrificed and organs were harvested (as described above).

[0173] As shown in Figure 1, a clear dose-response was observed when measuring human ASS1 protein levels in the liver. The dose range was 0.10–2.0 mg / kg of encapsulated human ASS1 mRNA. These data indicate that lipid nanoparticles accumulate in the liver, release the loaded mRNA, and the liver can process this exogenous mRNA through translation to produce human ASS1 protein. The raw values ​​of human ASS1 protein measured by ELISA analysis (shown in Figure 1) are shown in Table 1 below. [Table 1-3] Codon-optimized human ASS1 mRNA was delivered via cKK-E12-based lipid nanoparticles. Doses are based on encapsulated ASS1 mRNA. Values ​​represent nanograms of human ASS1 protein per milligram of total liver protein. BLD = ELISA lower limit of detection.

[0174] Although ELISA has limited sensitivity at low doses, Western blot analysis clearly showed human ASS1 protein even at low doses (0.30 mg / kg) (Figures 2A-2D).

[0175] To further understand the ability of ASS1 mRNA-loaded lipid nanoparticles to promote mRNA delivery to the selected organ (liver), we performed a pharmacokinetic study to monitor the amount of human ASS1 protein in the liver over a one-week period. Figure 3 shows the amount of human ASS1 protein detected in the liver at various time points after administration of human ASS1-loaded lipid nanoparticles (cKK-E12). This result was obtained after a single intravenous administration (1.0 mg / kg of loaded mRNA).

[0176] In this example, maximum serum concentrations of human ASS1 protein were observed approximately 24–48 hours after administration, and measurable amounts of protein were still observed by both ELISA and Western blot 1 week after administration (Figures 3 and 4A–4E, respectively).

[0177] Using an in situ hybridization (ISH)-based method, we directly detected the active pharmaceutical ingredient (ASS1 mRNA) in the livers of each treated mouse. As shown in Figures 5A-5I, exogenous human ASS1 messenger RNA was detectable at high concentrations at the first measurement time point of the study (30 min), and the signal intensity remained unchanged up to 48 h after administration. Furthermore, human ASS1 mRNA was still detectable 7 days after administration.

[0178] In addition to ISH, we also used immunohistochemical (IHC) techniques to detect the previously obtained human ASS1 protein. Using a mouse monoclonal antibody (02D2-2E12) for specific binding, the target human ASS1 protein was readily observed in the cytoplasm of treated liver hepatocytes. A faint signal was initially observed in the treated liver within 30 minutes of administration, but was clearly evident within 3 hours of administration. Figures 6A-6I show the time course of human ASS1 protein staining in the livers of treated mice after administration.

[0179] Furthermore, human ASS1 protein was strongly detected in both sinusoidal cells and target hepatocytes, demonstrating widespread distribution throughout the liver. Figures 7A-7B show low-magnification images of positive IHC staining for human ASS1 protein 24 hours after administration.

[0180] Delivery of human ASS1 mRNA and subsequent protein production is not limited to a single lipid nanoparticle system. Several cationic lipid nanoparticle systems were explored for their ability to deliver mRNA and produce the desired protein. Ten different cationic lipid systems were screened using human ASS1 mRNA as the analyte of choice. The cationic lipid components for each formulation are listed in Table 2 and shown in Figure 8. A single intravenous injection was administered, and liver samples were collected 24 hours after administration.

[0181] The dose of each formulation was 1.0 mg / kg based on the encapsulated mRNA, and values ​​are based on liver samples taken 24 hours after administration. [Table 2] Raw human ASS1 protein levels measured by ELISA analysis for various cationic lipid-based nanoparticle systems (shown in Figure 9). All systems were administered intravenously at a dose of 1.0 mg / kg. Protein levels are expressed in nanograms of human ASS1 protein per milligram of total liver protein. cKK-E12(1) contains a lower percentage of PEG-lipid than cKK-E12(2) (3% vs. 5%).

[0182] Although protein production by mRNA-loaded lipid nanoparticles was detectable, we further investigated whether the resulting protein was active and whether it could function properly. 14 C-citrulline addition to cellular proteins 14 An in vitro activity assay was performed to measure C-arginine uptake. Radioactive citrulline was detected in the presence of active ASS1 protein. 14 C-argininosuccinic acid, and then 14 The activity of ASS1 protein derived from each exogenous mRNA was measured by comparing cells transfected with human ASS1 mRNA with untreated cells. Figure 9 shows the activity of ASS1 protein derived from each exogenous mRNA in cellular proteins. 14 C arginine incorporation is expressed as radioactivity counts per minute. When SK(-) cells (an ASS1 protein knockout cell line) transfected with human ASS1 mRNA were exposed to depleted medium (without arginine or leucine), radioactivity was higher than that observed in untreated SK(-) cells. The activity measured in these transfected cells was comparable to that of a stably transfected ASS1-positive cell line (SK(+)).

[0183] Example 4. Human ASS1 protein levels after treatment with ASS1 mRNA-loaded lipid nanoparticles This example demonstrates that administration of ASS1 mRNA results in efficient production of ASS1 protein in the liver.

[0184] Male CD-1 mice were treated with a single intravenous injection of 1.0 mg / kg of lipid nanoparticles (ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles), or with the same method as in Example 2. The mice were untreated (i.e., control) mice. The mice were sacrificed, and their organs were harvested 24 hours after administration. Human argininosuccinate synthase (ASS1) protein levels in the liver were measured by ELISA. These data indicate that higher levels of ASS1 protein were detected compared to the control, and that the protein produced was due to intravenous delivery of ASS1 mRNA (Figure 10).

[0185] Example 5: Ammonia plasma concentrations after treatment with ASS1 mRNA-loaded lipid nanoparticles This example demonstrates that administration of ASS1 mRNA successfully reduced plasma ammonia levels.

[0186] ASS1 knockout mice were administered 1.0 mg / kg of ASS1 mRNA lipid nanoparticles (ASS1 mRNA-loaded cKK-E12-based lipid nanoparticles) or empty lipid nanoparticles once every 14 days for 30 days, as described in Example 2 above. Mice administered empty lipid nanoparticles served as vehicle controls. Additional control groups included untreated wild-type and untreated ASS1 knockout mice. Plasma samples were collected prior to each dose on days 1, 15, and 29 (i.e., pre-dose). Plasma samples were also collected within 24 hours after each dose on days 2, 16, and 30. Additional plasma samples were collected on days 8 and 22. Quantification of ammonia plasma concentrations in all samples showed that ammonia plasma concentrations reproducibly decreased to levels similar to those observed in wild-type mice for at least 24 hours after treatment.

[0187] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not limited to the above Detailed Description, but rather is set forth in the following claims.

Claims

1. 1. A composition comprising mRNA encoding argininosuccinate synthase (ASS1) for use in treating argininosuccinate synthase deficiency (ASD), wherein said treatment comprises administering said composition to a subject in need thereof at an effective dose and at an interval such that at least one symptom or characteristic of ASD is reduced in intensity, severity, or frequency, or the onset is delayed, and wherein the subject's ammonia concentration is reduced compared to a pre-treatment baseline ammonia concentration, the mRNA has a nucleotide sequence at least 90% identical to SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, and the mRNA is codon-optimized; The mRNA is encapsulated in a liposome, (i) the liposome comprises a cationic lipid, a non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid, (ii) the cationic lipid constitutes about 30-50% of the liposome by molar ratio, and (iii) the liposome has a size of less than 100 nm.

2. (i) the cationic lipid comprises a cationic lipid selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof; and optionally, the one or more cationic lipids are selected from the group consisting of cKK-E12: 【Chemistry 1】 and / or (ii) the non-cationic lipid is selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphatidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (2-dioleoyl-sn-glycero-3-phospho-(1′-rac-glycerol)); and / or (iii) the cholesterol-based lipid is cholesterol and / or PEGylated cholesterol; and / or (iv) The PEG-modified lipid has a chain length C ６ -C ２０ alkyl chain(s) of a poly(ethylene) glycol chain having a chain length of up to 5 kDa covalently attached to a lipid having the formula: A composition for use according to claim 1.

3. 3. The composition for use according to claim 2, wherein the ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is (i) about 40:30:20:10 by molar ratio, (ii) about 40:30:25:5 by molar ratio, or (iii) about 40:32:25:3 by molar ratio.

4. The liposome is cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; or ICE, DOPE, cholesterol and DMG-PEG2K including a combination selected from A composition for use according to any one of claims 2 or 3.

5. The mRNA (a) an effective dose in the range of 0.1 to 5.0 mg / kg body weight, for example, 0.1 to 3.0 mg / kg body weight, or 0.1 to 1.0 mg / kg body weight; and (b) once a week, twice a week, twice a month, once a month, or once every 14 days; The composition for use according to any one of claims 1 to 4, wherein the composition is administered intravenously.

6. The composition for use according to any one of claims 1 to 5, which is administered intravenously.

7. the ASS1 protein is expressed in the liver, and / or Administration of the composition (i) the expression level of ASS1 protein in the total protein of the liver is about 100 ng / mg or more; and / or (ii) the serum ASS1 protein concentration is elevated; and / or (iii) the subject's citrulline levels are reduced compared to pre-treatment baseline citrulline levels; and / or (iv) plasma ammonia concentration is reduced to about 50 μmol / L or less, about 300 μmol / L or less, or about 1500 μmol / L or less A composition for use according to any one of claims 1 to 6.

8. A composition for use according to any one of claims 1 to 7, comprising (i) the codon-optimized mRNA comprises SEQ ID NO:3, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, and optionally the mRNA further comprises (a) the 5′ UTR sequence of SEQ ID NO:4, or (b) the 3′ UTR sequence of SEQ ID NO:5 or SEQ ID NO:6; and / or (ii) the mRNA comprises SEQ ID NO:7 or SEQ ID NO:8; and / or (iii) the mRNA comprises one or more modified nucleotides, optionally wherein the one or more modified nucleotides comprise pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine; composition.

Images