Micro-dystrophin gene therapy constructs and uses thereof

Abstract

An invention is provided that is based in part on novel genetic constructs encoding micro-dystrophin proteins for use in gene therapy. The micro-dystrophin genetic constructs and expression cassettes are designed to result in improved therapeutic efficacy, potency, and safety for subjects when expressed by viral vectors in muscle and / or CNS cells.

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, the entire contents of which are incorporated herein by reference. The ASCII copy was created on November 25, 2020, is named 38013_0009P1_Sequence_Listing.txt, and is 249,417 bytes in size.

[0002] The present invention relates to novel micro-dystrophins and gene therapy vectors, such as recombinant AAV vectors, encoding the novel micro-dystrophins, as well as compositions and uses thereof, and methods of treatment using the same. [Background technology]

[0003] A group of neuromuscular disorders known as dystrophinopathies are caused by mutations in the DMD gene. Each dystrophinopathy has a distinct phenotype, with all patients suffering from muscle weakness and eventually developing cardiomyopathy of varying severity. Duchenne muscular dystrophy (DMD) is a severe, X-linked, progressive neuromuscular disorder affecting approximately 1 in 3,600–9,200 live male births. The disorder is caused by a frameshift mutation in the dystrophin gene that abolishes the expression of the dystrophin protein. Dystrophin deficiency leads to degeneration of skeletal muscle, ultimately cardiac muscle, and respiratory muscles (e.g., intercostal muscles and diaphragm), resulting in premature death. Progressive muscle weakness and atrophy begin in childhood. Affected individuals experience respiratory distress, respiratory infections, and swallowing difficulties. Nearly all DMD patients develop cardiomyopathy. Pneumonia complicated by cardiac involvement is the most common cause of death, often occurring within the first 30 years.

[0004] Becker muscular dystrophy (BMD) is less severe than DMD but still leads to early death. Compared to DMD, BMD is characterized by late-onset skeletal muscle wasting. DMD patients become wheelchair dependent by age 13, whereas BMD patients lose their ability to walk and require a wheelchair after age 16. BMD patients also exhibit preserved neck flexor strength, unlike DMD patients. Although skeletal muscle involvement is mild, heart failure due to dilated cardiomyopathy (DCM) associated with DMD is a common cause of mortality in BMD and is the most common cause of death, occurring on average in the mid-40s.

[0005] Dystrophin is a cytoplasmic protein encoded by the DMD gene that functions to link cytoskeletal actin filaments to membrane proteins. Normally, dystrophin protein is found primarily in skeletal and cardiac muscles, with small amounts expressed in the brain. It functions as a buffer during muscle fiber contraction by connecting the actin of the contractile apparatus to the connective tissue layer surrounding each muscle fiber. In muscle, dystrophin is localized on the cytoplasmic surface of the sarcolemma.

[0006] The DMD gene is the largest known human gene. The most common mutations causing DMD or BMD are large deletions of one or more exons (60-70%), but duplications (5-10%) and single-nucleotide variants (including small deletions or insertions, single-base changes, and splice-site alterations, which account for approximately 25-35% of pathogenic variants in men with DMD and approximately 10-20% of pathogenic variants in men with BMD) can also cause pathogenic dystrophin variants. In DMD, mutations often lead to frameshifts, resulting in premature stop codons or truncated, nonfunctional, or unstable proteins. Nonsense point mutations can also have the same effect by introducing premature stop codons. DMD-causing mutations can affect any exon, but exons 2-20 and 45-55 are common hotspots for large deletions and duplications. With in-frame deletions, patients express a truncated, partially functional dystrophin and develop less severe Becker muscular dystrophy (BMD).

[0007] Full-length dystrophin is a large (427 kDa) protein that contains multiple subdomains that contribute to its function: from the amino terminus to the carboxy terminus, these subdomains include an N-terminal actin-binding domain, a central so-called "rod" domain, a cysteine-rich domain, and finally a carboxy-terminal domain or region. The rod domain contains, in the following order: a first hinge domain (H1), three spectrin-like repeats (R1, R2, R3), a second hinge domain (H2), 16 or more spectrin-like repeats (R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19), a third hinge domain (H3), 5 or more spectrin-like repeats (R20, R21, R22, R23, R24), and a fourth hinge domain (H4) (which includes the WW domain), four proline-rich hinge domains (abbreviated as H) and 24 spectrin-like repeats (abbreviated as R). Following the rod domain is a cysteine-rich domain and a COOH (C)-terminal (CT) domain.

[0008] As the use of adeno-associated virus (AAV)-mediated gene therapy advances, there is hope and interest in the potential use of AAV for the treatment of DMD, BMD, and less severe dystrophinopathies. Because the payload size of AAV vectors is limited, attention has focused on generating micro- or mini-dystrophins, which are miniaturized dystrophins that retain at least some of the functionality of the full-length protein while removing non-essential subdomains. AAV-mediated mini-dystrophin gene therapy in mdx mice, an animal model of DMD, has been reported to demonstrate efficient muscle expression and improved muscle function (see, e.g., Wang et al., J. Orthop. Res. 27:421 (2009)).

[0009] Thus, there is a need in the art for AAV vectors encoding micro- or mini-dystrophins that are expressed at effective levels in transduced cells of subjects with DMD or BMD, and preferably that can minimize the immune response to the therapeutic protein. Summary of the Invention

[0010] An invention is provided that is based in part on novel gene constructs encoding micro-dystrophin proteins for use in gene therapy. The micro-dystrophin gene constructs and expression cassettes are designed to provide improved treatments with respect to efficacy, potency, and safety for subjects when expressed by viral vectors in muscle cells and / or CNS cells. Based on in vivo treatment models, the disclosed micro-dystrophin gene therapy has shown improvements in measures of grip strength, maximum muscle strength, and specific muscle strength, and / or reductions in organ and muscle weight. Accordingly, improved gene therapy vectors, e.g., recombinant AAV vectors such as recombinant AAV8 or AAV9 vectors, containing these constructs for gene therapy expression of micro-dystrophin proteins, as well as methods for using these gene therapy vectors in therapeutic methods, and methods for making these gene therapy vectors as described herein, are provided.

[0011] Provided are microdystrophin proteins and nucleic acid constructs encoding the proteins, which comprise an N-terminal actin-binding domain and a subset of the hinge, rod, and spectrin domains, followed by a cysteine-rich domain, and optionally, all or a portion of the C-terminal domain, e.g., a helix 1-containing portion. In certain embodiments, the microdystrophin comprises all or a portion of the C-terminal domain, or an α1-syntrophin and / or α-dystrobrevin-binding portion thereof. Microdystrophins comprising the C-terminal domain, or an α1-syntrophin and / or α-dystrobrevin-binding portion thereof, may have improved cardioprotective activity and / or may result in the improvement of, or the reduction / delay of, impaired myocardial function.

[0012] Exemplary microdystrophin-encoding constructs are shown in Figure 1A and Figure 22. The embodiments described herein contain, from amino to carboxy terminus:

[0013] ABD-H1-R1-R2-R3-H3-R24-H4-CR,

[0014] ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT

[0015] ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, or

[0016] a microdystrophin protein having the structure ABD-H1-R1-R2-R16-R17-R24-H4-CR;

[0017] wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin or at least the portion thereof that binds to β-dystroglycan, and CT is at least a portion of the C-terminal region of dystrophin, which portion includes the α1-syntrophin binding site and / or the α-dystrobrevin binding site. In certain embodiments, the CT domain has the amino acid sequence of SEQ ID NO: 35, 70, or 83. In certain embodiments, the H3 domain is the entire sequence of SEQ ID NO: 11. The CR domain can be a full-length CR domain or a truncated CR domain, particularly a truncated CR domain that binds to β-dystroglycan. In certain embodiments, the CR domain has the amino acid sequence of SEQ ID NO: 15 or 90. In certain embodiments, an endogenous linker sequence connects the domains, for example, all or a 3-amino acid portion of the linker between R23 and R24 of endogenous human dystrophin protein connects the H3 domain and the R24 domain. Alternatively, in some embodiments, H3 can be replaced with the hinge 2 region (H2) of dystrophin.

[0018] The micro-dystrophins provided herein exhibit dystrophin functions such as (1) binding to one, a combination, or all of actin, β-dystroglycan, α1-syntrophin, α-dystrobrevin, and nNOS (including nNOS indirectly bound via α1-syntrophin); (2) promoting improvement in muscle function or slowing the progression of muscle function decline in an animal model (e.g., the mdx mouse model described herein) or a human subject; and / or (3) having cardioprotective function or promoting improvement in myocardial function or alleviation of cardiac dysfunction or slowing the progression of cardiac function decline in an animal model or a human patient (see FIG. 13).

[0019] In certain embodiments, the microdystrophin has the amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93.

[0020] Provided herein are nucleic acids encoding microdystrophin, including transgenes or gene cassettes for use in gene therapy. In embodiments, microdystrophin is encoded by the nucleotide sequence of SEQ ID NO: 20, 21, 81, 101, 102, or 103, or any nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93. Exemplary constructs are shown in Figures 1A and 22. In certain embodiments, the construct comprises an intron 5' to the microdystrophin coding sequence. In some embodiments, the intron is less than 100 nucleotides in length. In certain embodiments, the construct comprises a human immunoglobulin heavy chain variable region (VH) 4 (VH4) intron, where the intron is located 5' to the microdystrophin coding sequence. The presence of the VH4 intron can result in improved expression of microdystrophin in cells compared to expression from a nucleic acid construct lacking the VH4 intron.

[0021] The transgenes provided herein contain a promoter that drives expression of microdystrophin in appropriate cell types, such as muscle cells (including skeletal, cardiac, and / or smooth muscle) and / or CNS cells. Reducing the size of transgenes used in gene therapy, such as recombinant AAV vector therapy, can improve the efficacy and efficiency of the recombinant AAV vector. Provided herein are transgenes in which the promoter is a muscle-specific promoter, a CNS-specific promoter, or both. In certain embodiments, the promoter is a muscle-specific promoter less than 350 kb in length. In some embodiments, the promoter is the SPc5-12 promoter (SEQ ID NO: 39). Provided herein are transgenes in which the promoter is a truncated SPc5-12 promoter (SEQ ID NO: 40), which drives expression of microdystrophin and is shorter than the SPc5-12 promoter described more fully herein. In certain embodiments, the promoter is a CNS-specific promoter.

[0022] Also provided are transgenes or gene cassettes in which the micro-dystrophin coding sequence is codon-optimized for increased expression. Additionally or alternatively, the micro-dystrophin coding sequence and / or transgene sequence may be CpG-depleted to reduce immunogenicity. In some embodiments, the micro-dystrophin transgene has fewer than two (2) CpG islands, or one (1) CpG island (particularly as defined herein), and in certain embodiments, no CpG islands. Transgenes with fewer than two, one, or no CpG islands have reduced immunogenicity, as measured by anti-drug antibody titers, compared to micro-dystrophin constructs with more than two CpG islands.

[0023] Provided herein are nucleic acids comprising the nucleotide sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106 that encode exemplary gene cassettes or transgenes.

[0024] Recombinant vectors for delivering the transgenes described herein include non-replicating recombinant adeno-associated viral vectors (rAAV), which may be AAV8 or AAV9 serotypes, or any other serotype suitable for delivery of microdystrophin coding sequences to muscle cells, including both skeletal and cardiac muscle, and / or CNS cells, which express microdystrophin and provide additional patient benefit, and / or delivery to muscle cells.

[0025] Also provided are pharmaceutical compositions comprising the recombinant vector encoding the microdystrophin provided herein, together with a pharmaceutically acceptable excipient, and methods of treating any dystrophinopathies, such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), X-linked dilated cardiomyopathy, and DMD or BMD female carriers, by administering the gene therapy vector described herein to a subject in need thereof. Also provided are methods of treating, ameliorating the symptoms of, or managing dystrophinopathies, such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy, by administering an rAAV containing the transgene or gene cassette described herein to a subject in need thereof, such that microdystrophin is delivered to muscle (including skeletal muscle, cardiac muscle, and / or smooth muscle) and / or the CNS. In certain embodiments, the rAAV is administered systemically.

[0026] Also provided are methods for producing viral vectors, particularly AAV-based viral vectors, and host cells that produce the vectors. In certain embodiments, a method for producing a recombinant AAV is provided, comprising culturing host cells containing an artificial genome comprising a cis expression cassette flanked by AAV ITRs, the cis expression cassette comprising a transgene encoding a therapeutic micro-dystrophin operably linked to expression control elements that control expression of the transgene in human cells, a trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of AAV rep and capsid proteins in the host cells in culture and provide the rep and cap proteins in trans, and sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by the AAV capsid proteins, and recovering recombinant AAV encapsidated with the artificial genome from the cell culture.

[0027] The invention is illustrated by the examples set forth below of the construction and production of micro-dystrophin vectors and in vitro and in vivo assays demonstrating their efficacy.

[0028] Illustrative Embodiments 1. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin domain. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin or the β-dystroglycan-binding portion thereof, and CT is the C-terminal region of dystrophin or a portion of the C-terminal region containing the α1-syntrophin-binding site or the dystrobrevin-binding site.

[0029] 2. The nucleic acid composition of embodiment 1, comprising: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 1 or 91, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof that encodes a therapeutically functional micro-dystrophin protein; or (2) a nucleic acid sequence of SEQ ID NO: 20 or 100, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid sequence encodes a therapeutically functional micro-dystrophin protein.

[0030] 3. The nucleic acid composition of embodiment 1, comprising: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 79, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof that encodes a therapeutically functional micro-dystrophin protein; or (2) a nucleic acid sequence of SEQ ID NO: 81, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional micro-dystrophin protein.

[0031] 4. A nucleic acid composition comprising a nucleic acid sequence comprising an intron (I) linked to the 5' end of a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to carboxy-terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin.

[0032] 5. The nucleic acid composition of embodiment 4, comprising: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 2, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof; or (2) a nucleic acid sequence of SEQ ID NO: 21, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof; wherein the nucleic acid encodes a therapeutically functional dystrophin.

[0033] 6. The nucleic acid composition of embodiments 1 to 3, further comprising an intron (I) linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein.

[0034] 7. A nucleic acid composition described in any of embodiments 4 to 6, wherein I is a human immunoglobin heavy chain variable region (VH) 4 intron (VH4) or an SV40 intron or a chimeric intron located 5' to the micro-dystrophin coding sequence.

[0035] 8. The nucleic acid composition of embodiment 7, wherein the nucleic acid sequence encoding a VH4 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 41, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking a VH4 intron sequence; or the nucleic acid sequence encoding a chimeric intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 75, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking a chimeric intron sequence; or the nucleic acid sequence encoding an SV40 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 76, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking a chimeric intron sequence.

[0036] 9. The nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or the reverse complement thereof, which increases binding of the microdystrophin to α1-syntrophin, β-syntrophin, and / or dystrobrevin compared to a reference microdystrophin lacking the CT domain sequence; or The nucleic acid sequence encoding the CT domain comprises the nucleic acid sequence of SEQ ID NO: 70, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or the reverse complement thereof; or 9. The nucleic acid composition of any of embodiments 1-3 or 6-8, wherein the nucleic acid sequence encoding the minimal CT domain consists of the nucleic acid sequence of SEQ ID NO: 80, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or the reverse complement thereof, and wherein the nucleic acid composition increases the binding of the micro-dystrophin to α1-syntrophin compared to a reference micro-dystrophin lacking the CT domain sequence.

[0037] 10. The nucleic acid composition of embodiment 9, wherein the CT domain has the amino acid sequence of SEQ ID NO: 16 or 83, or comprises the amino acid sequence of SEQ ID NO: 84.

[0038] 11. The nucleic acid composition of any of the preceding embodiments, wherein the nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 34 or 69, or a nucleic acid sequence that is at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases the binding of micro-dystrophin to beta-dystroglycan compared to a reference micro-dystrophin lacking the CR domain sequence; wherein the nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 100 or 109, or a nucleic acid sequence that is at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases the binding of micro-dystrophin to beta-dystroglycan compared to a reference micro-dystrophin lacking the CR domain sequence.

[0039] 12. The nucleic acid composition of embodiment 11, wherein the CR domain has the amino acid sequence of SEQ ID NO: 15 or 90.

[0040] 13. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 22 or 57, and the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 24 or 59. wherein the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26 or 61; and the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 27 or 62. the nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 29 or 64; and the nucleic acid sequence encoding H2 consists of SEQ ID NO: 38, or a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 38. the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 or 65, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 30 or 65; the nucleic acid sequence encoding R24 consists of SEQ ID NO: 32 or 67, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 32 or 67;the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 33 or 68; the nucleic acid sequence encoding CR consists of SEQ ID NO: 34, 69, 100 or 109, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 34, 69, 100 or 109; 10. The nucleic acid composition of any one of the preceding embodiments, wherein the nucleic acid sequence encoding microdystrophin, if present, consists of SEQ ID NO: 35, 70 or 80, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 35, 70 or 80, and optionally wherein the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 41, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 41, linked to the 5' end of the nucleic acid sequence encoding microdystrophin.

[0041] 14. The nucleic acid composition of any one of the preceding embodiments, wherein the nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, the nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, the nucleic acid sequence encoding H2 consists of SEQ ID NO: 38, the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 or 65, the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, the nucleic acid sequence encoding R24 consists of SEQ ID NO: 32 or 67, the nucleic acid sequence encoding CR consists of SEQ ID NO: 34, 69, 100 or 109, I consists of SEQ ID NO: 41, and / or the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80.

[0042] 15. The nucleic acid composition of any one of the preceding embodiments, wherein the micro-dystrophin protein comprises or consists of dystrophin sequences arranged from amino terminus to carboxy terminus as follows: ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR, wherein L1, L2, L3, and L4 are linkers.

[0043] 16. The nucleic acid composition of any one of the preceding embodiments, wherein the nucleic acid sequence encoding L1 comprises or consists of SEQ ID NO: 23 or 58, L2 comprises or consists of SEQ ID NO: 25 or 60, L3 comprises or consists of SEQ ID NO: 28 or 63, and L4 comprises or consists of SEQ ID NO: 31, 36, 37, 66, 71 or 72.

[0044] 17. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to carboxy-terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin.

[0045] 18. The nucleic acid composition of embodiment 17, comprising: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 93, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof; or (2) a nucleic acid sequence of SEQ ID NO: 103, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional micro-dystrophin.

[0046] 19. The nucleic acid composition of embodiment 17 or 18, further comprising a nucleotide sequence encoding a CT domain comprising an α1-syntrophin binding site and / or a dystrobrevin binding site at the C-terminal end of the CR domain.

[0047] 20. The nucleic acid composition of any one of embodiments 19, comprising: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 92, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof; or (2) a nucleic acid sequence of SEQ ID NO: 102, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional micro-dystrophin.

[0048] 21. The nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or the reverse complement thereof, and increases binding of the microdystrophin to α1-syntrophin, β-syntrophin, and / or dystrobrevin compared to a reference microdystrophin lacking the CT domain sequence; or the nucleic acid sequence encoding the CT domain comprises the nucleic acid sequence of SEQ ID NO: 70, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or the reverse complement thereof. or the nucleic acid sequence encoding the minimal CT domain consists of the nucleic acid sequence of SEQ ID NO: 80, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or the reverse complement thereof, and increases the binding of micro-dystrophin to α1-syntrophin compared to a reference micro-dystrophin lacking the CT domain sequence.

[0049] 22. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 22 or 57; and the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 24 or 59. wherein the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26 or 61; and the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 27 or 62. 99% identity to SEQ ID NO: 94 or 98, and the nucleic acid sequence encoding R16 consists of SEQ ID NO: 94 or 98, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 94 or 98, and the nucleic acid sequence encoding R17 consists of SEQ ID NO: 95 or 99, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to SEQ ID NO: 95 or 99. or a sequence having at least 99% identity thereto, wherein the nucleic acid sequence encoding R24 consists of SEQ ID NO: 32 or 67, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity thereto, and the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity thereto,The nucleic acid composition according to any one of embodiments 17 to 21, wherein the nucleic acid sequence encoding CR is SEQ ID NO: 34, 69, 100 or 109, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 34 or 69, and the nucleic acid sequence encoding CT is SEQ ID NO: 35, 70 or 80, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 35, 70 or 80, and encodes functionally active micro-dystrophin.

[0050] 23. The nucleic acid composition of any one of embodiments 17 to 22, wherein the nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, the nucleic acid sequence encoding R16 consists of SEQ ID NO: 94 or 98, the nucleic acid sequence encoding R17 consists of SEQ ID NO: 95 or 99, the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, R24 consists of SEQ ID NO: 32 or 67, the nucleic acid sequence encoding CR consists of SEQ ID NO: 34, 69, 100 or 109, and, if present, the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80.

[0051] 24. The nucleic acid composition of embodiments 17 to 23, further comprising an intron (I) linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein.

[0052] 25. The nucleic acid composition of any of embodiments 24, wherein I is a human immunoglobin heavy chain variable region (VH) 4 intron (VH4) or an SV40 intron or a chimeric intron located 5' to the microdystrophin coding sequence.

[0053] 26. The nucleic acid composition of embodiment 25, wherein the nucleic acid sequence encoding the VH4 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 41, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking the VH4 intron sequence; or the nucleic acid sequence encoding the chimeric intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 75, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking the chimeric intron sequence; or the nucleic acid sequence encoding the SV40 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 76, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases micro-dystrophin expression compared to a reference nucleic acid lacking the chimeric intron sequence.

[0054] 27. The nucleic acid composition of any one of embodiments 17 to 26, wherein the micro-dystrophin protein comprises or consists of a dystrophin sequence arranged from amino terminus to carboxy terminus as follows: ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR, wherein L1, L2, L3, L4.1 and L4.2 are linkers.

[0055] 28. The nucleic acid composition of embodiment 27, wherein the nucleic acid sequence encoding L1 comprises or consists of SEQ ID NO: 23 or 58, the nucleic acid sequence encoding L2 comprises or consists of SEQ ID NO: 25 or 60, the nucleic acid sequence encoding L3 comprises or consists of SEQ ID NO: 28 or 63, the nucleic acid sequence encoding L4.1 comprises or consists of SEQ ID NO: 107 or 125, and the nucleic acid sequence encoding L4.2 comprises or consists of SEQ ID NO: 108 or 126.

[0056] 29. The nucleic acid composition of any one of the preceding embodiments, wherein the nucleic acid is a nucleic acid vector comprising a transcriptional regulatory element operably linked to a nucleic acid sequence encoding a micro-dystrophin protein, the transcriptional regulatory element promoting expression in muscle and / or CNS tissue.

[0057] 30. The nucleic acid composition of embodiment 29, wherein the transcriptional regulatory element comprises a muscle-specific promoter, optionally a skeletal, smooth, or / and cardiac muscle-specific promoter.

[0058] 31. The nucleic acid composition of embodiment 29 or 30, wherein the promoter is SPc5-12 or a transcriptionally active portion thereof.

[0059] 32. The nucleic acid composition of embodiment 31, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39 or 40.

[0060] 33. The nucleic acid composition of embodiment 29, wherein the transcriptional regulatory element comprises a CNS-specific promoter.

[0061] 34. The nucleic acid composition of embodiment 29, wherein the promoter is an inducible promoter such as a CB7 promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter (SEQ ID NO: 118), a UB6 promoter, a chicken beta-actin promoter, a CAG promoter (SEQ ID NO: 116), an RPE65 promoter, an opsin promoter, a TBG (thyroxine-binding globulin) promoter, an APOA2 promoter, a SERPINA1 (hAAT) promoter, an MIR122 promoter, or a hypoxia-inducible or rapamycin-inducible promoter.

[0062] 35. The nucleic acid composition of embodiment 29 or 30, wherein the muscle-specific transcriptional regulatory element is one of the CK1 promoter, CK4 promoter, CK5 promoter, CK6 promoter, CK7 promoter, CK8 promoter (SEQ ID NO: 115), MCK promoter (or a truncated form thereof) (SEQ ID NO: 121), desmin promoter (SEQ ID NO: 119), MHCK7 promoter (SEQ ID NO: 120), enh358MCK promoter, dMCK promoter, or tMCK promoter.

[0063] 36. The nucleic acid composition of any of the preceding embodiments, wherein the nucleotide sequence comprises a polyadenylation signal 3' to the nucleotide sequence encoding micro-dystrophin.

[0064] 37. The nucleic acid composition of embodiment 36, wherein the polyadenylation signal has the nucleotide sequence of SEQ ID NO: 42.

[0065] 38. The nucleic acid is, from 5' to 3', (i) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged from the N-terminus to the C-terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT-polyadenylation sequence-AAV ITR; (ii) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged from the N-terminus to the C-terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-polyadenylation sequence-AAV ITR; (iii) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged from the N-terminus to the C-terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT-polyadenylation sequence-AAV ITR; or (iv) AAV 10. The nucleic acid composition of any one of the preceding embodiments, comprising an AAV vector nucleotide sequence comprising: ITR-transcriptional regulatory element-nucleic acid sequence encoding a micro-dystrophin domain arranged N-terminus to C-terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-polyadenylation sequence-AAV ITR, wherein the AAV ITR is optionally an AAV2 ITR.

[0066] 39. The nucleic acid composition of any of the preceding embodiments, wherein the nucleotide sequence is codon optimized and / or CpG sequence removed.

[0067] 40. The nucleic acid composition of any preceding embodiment, having less than two, one, or no CpG islands.

[0068] 41. The nucleic acid composition of embodiment 40, which, when administered to a human subject, exhibits reduced immunogenicity compared to a micro-dystrophin construct having more than 0 CpG islands, as measured by anti-drug antibody titers.

[0069] 42. The nucleic acid composition of any one of the preceding embodiments, comprising the nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106.

[0070] 43. The nucleic acid composition of any one of the preceding embodiments, comprising an AAV vector nucleotide sequence comprising AAV ITRs at the 5' and 3' ends of the nucleic acid sequence, wherein the AAV ITRs are optionally AAV2 ITRs.

[0071] 44. The nucleic acid composition of embodiment 43, wherein the 5' ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 73 and the 3' ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 74.

[0072] 45. An rAAV particle comprising an expression cassette comprising the nucleic acid composition of any one of the preceding embodiments.

[0073] 46. ​​The rAAV particles of embodiment 45, having capsid proteins derived from at least one AAV type selected from AAV type 1 (AAV1), type 2 (AAV2), type 3 (AAV3), type 4 (AAV4), type 5 (AAV5), type 6 (AAV6), type 7 (AAV7), type 8 (AAV8), type rh8 (AAVrh8), type 9 (AAV9), type PHP.B (AAVPHP.B), type hu37 (AAV.hu37), type hu31 (AAV.hu31), type hu32 (AAV.hu32), type rh10 (AAVrh10), type rh20 (AAVrh20), type rh39 (AAVrh39), and type rh74 (AAVrh74).

[0074] 47. The rAAV particle of embodiment 45 or 46, wherein the capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO: 77 (AAV8 capsid), or has the amino acid sequence of SEQ ID NO: 77.

[0075] 48. The rAAV particle of embodiment 45 or 46, wherein the capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO: 78 (AAV9 capsid), or has the amino acid sequence of SEQ ID NO: 78.

[0076] 49. A pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45 to 48 and a pharmaceutically acceptable carrier.

[0077] 50. A method for delivering a transgene to a cell, comprising contacting the cell with an rAAV particle described in any one of embodiments 45 to 49, wherein the cell is contacted with a vector.

[0078] 51. A pharmaceutical composition for treating a dystrophinopathy in a human subject in need thereof, comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45-49, optionally formulated for administration to the circulation, muscle tissue, or CNS of the subject.

[0079] 52. A method of treating a dystrophinopathy in a human subject in need thereof, comprising: 50. A method comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45-49, thereby forming a micro-dystrophin protein-releasing depot in the muscle of the subject.

[0080] 53. A method for preventing the transmission of a dystrophinopathy to offspring in a human subject in need thereof, comprising: 50. A method comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45 to 49, thereby integrating a nucleic acid encoding micro-dystrophin into the germ cells of the subject.

[0081] 54. The pharmaceutical composition or method according to any one of embodiments 51 to 53, wherein the dystrophinopathy is DMD, BMD, X-linked dilated cardiomyopathy, or the subject is a female DMD or BMD carrier.

[0082] 55. The pharmaceutical composition or method according to embodiments 51-54, wherein the composition is administered together with at least a second agent effective in treating a dystrophinopathy.

[0083] 56. The pharmaceutical composition or method of embodiment 55, wherein the second agent is selected from the group consisting of an antisense oligonucleotide that causes exon skipping of the DMD gene, an anti-myostatin antibody, an agent that promotes ribosomal readthrough of nonsense mutations, an agent that suppresses premature stop codons, an anabolic steroid, and a corticosteroid.

[0084] 57. A pharmaceutical composition or method according to any one of embodiments 51 to 56, wherein said administration improves grip strength, increases maximum and specific muscle strength, and / or reduces organ and muscle weight in the patient.

[0085] 58. A pharmaceutical composition or method described in any one of embodiments 51 to 57, wherein administration of the rAAV particles improves or maintains cardiac function or slows the decline in cardiac function.

[0086] 59. A pharmaceutical composition or method described in any one of embodiments 51 to 58, wherein administration of the rAAV particles increases muscle mass or strength, or maintains muscle mass or strength, or reduces the likelihood of loss of muscle mass or strength.

[0087] 60. A micro-dystrophin protein comprising or consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT is at least a portion of the C-terminal region of dystrophin containing the α1-syntrophin binding site, the β-syntrophin binding site, and / or the dystrobrevin site.

[0088] 61. The micro-dystrophin protein of embodiment 60, comprising or consisting of the amino acid sequence of SEQ ID NO: 1, 79, or 91.

[0089] 62. A micro-dystrophin protein according to embodiment 60 or 61, wherein the CT domain is a truncated CT domain comprising an α1-syntrophin binding site.

[0090] 63. A micro-dystrophin protein according to any one of embodiments 60 to 62, wherein the CT domain comprises or consists of the amino acid sequence of SEQ ID NO: 16 or 83, or comprises the amino acid sequence of SEQ ID NO: 84.

[0091] 64. A microdystrophin protein according to any one of embodiments 60 to 63, wherein the CR domain comprises a β-dystroglycan binding site.

[0092] 65. A micro-dystrophin protein according to any one of embodiments 60 to 64, wherein the CR domain comprises or consists of the amino acid sequence of SEQ ID NO: 15 or 90.

[0093] 66. ABD consists of SEQ ID NO: 3 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3; H1 consists of SEQ ID NO: 5 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5; R1 consists of the sequence R2 consists of SEQ ID NO: 8 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 8; H3 consists of SEQ ID NO: 11 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 8; R24 consists of SEQ ID NO: 13 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 13; H4 consists of SEQ ID NO: 14 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14; CR consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 15 or 90, and CT consists of SEQ ID NO: 16 or 83,Or the micro-dystrophin protein according to any one of embodiments 60 to 66, consisting of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83.

[0094] 67. The micro-dystrophin protein of any one of embodiments 60 to 66, wherein ABD consists of SEQ ID NO: 3, H1 consists of SEQ ID NO: 5, R1 consists of SEQ ID NO: 7, R2 consists of SEQ ID NO: 8, R3 consists of SEQ ID NO: 10, H3 consists of SEQ ID NO: 11, R24 consists of SEQ ID NO: 13, H4 consists of SEQ ID NO: 14, CR consists of SEQ ID NO: 15 or 90, or CT consists of SEQ ID NO: 16 or 83.

[0095] 68. A micro-dystrophin protein according to any one of embodiments 60 to 67, comprising dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT, wherein L1, L2, L3, and L4 are linkers.

[0096] 69. The micro-dystrophin protein of embodiment 68, wherein the amino acid sequences of L1, L2, L3, and L4 consist of SEQ ID NOs: 4, 6, 9, and 12, respectively.

[0097] 70. A micro-dystrophin protein comprising or consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, and CR is the cysteine-rich region of dystrophin.

[0098] 71. The micro-dystrophin protein of embodiment 70, comprising or consisting of the amino acid sequence of SEQ ID NO: 93.

[0099] 72. The micro-dystrophin protein of embodiment 70, comprising or consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, wherein CT is at least a portion of the C-terminal region of dystrophin comprising the α1-syntrophin binding site or the dystrobrevin binding site.

[0100] 73. The micro-dystrophin protein of embodiment 72, wherein the CT domain comprises or consists of the amino acid sequence of SEQ ID NO: 16 or 83, or comprises the amino acid sequence of SEQ ID NO: 84.

[0101] 74. The micro-dystrophin protein of embodiment 72 or 73, comprising or consisting of the amino acid sequence of SEQ ID NO: 92.

[0102] 75. A microdystrophin protein according to any one of embodiments 70 to 74, wherein the H4 domain comprises a β-dystroglycan binding site.

[0103] 76. ABD consists of SEQ ID NO: 3 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 3; H1 consists of SEQ ID NO: 5 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5; and R1 is R16 consists of SEQ ID NO: 86, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 86, R2 consists of SEQ ID NO: 86, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 86, or R17 consists of SEQ ID NO: 87 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 87; R24 consists of SEQ ID NO: 13, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 87; consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 13; H4 consists of SEQ ID NO: 14 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14; CR consists of SEQ ID NO: 15 or 90,Or the micro-dystrophin protein according to any one of embodiments 70 to 75, consisting of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 15 or 90.

[0104] 77. A micro-dystrophin protein according to any of embodiments 70 to 76, comprising or consisting of a CT domain at the C-terminus of the CR domain, wherein CT consists of SEQ ID NO: 16 or 83, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83.

[0105] 78. The micro-dystrophin protein of any one of embodiments 70-77, wherein ABD consists of SEQ ID NO: 3, H1 consists of SEQ ID NO: 5, R1 consists of SEQ ID NO: 7, R2 consists of SEQ ID NO: 8, R16 consists of SEQ ID NO: 86, R17 consists of SEQ ID NO: 87, R24 consists of SEQ ID NO: 13, H4 consists of SEQ ID NO: 14, CR consists of SEQ ID NO: 15 or 90, and / or CT consists of SEQ ID NO: 16 or 83.

[0106] 79. A microdystrophin protein according to any one of embodiments 70-78, wherein CT consists of SEQ ID NO: 16 or 83.

[0107] 80. The micro-dystrophin protein of any one of embodiments 70-80, comprising dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR, wherein L1, L2, L3, L4.1 and L4.2 are linkers.

[0108] 81. The micro-dystrophin protein of embodiment 80, wherein the amino acid sequences of L1, L2, L3, L4.1 and L4.2 consist of SEQ ID NOs: 4, 6, 9, 110 and 89, respectively.

[0109] 82. A method of treating a dystrophinopathy in a human subject in need thereof, comprising delivering a therapeutically effective amount of a micro-dystrophin protein according to any one of embodiments 60-81 to the circulation, muscle tissue and / or cerebrospinal fluid of the human subject.

[0110] 83. A pharmaceutical composition for the treatment of a dystrophinopathy in a human subject, comprising a therapeutically effective amount of a micro-dystrophin protein according to any one of embodiments 60-81, formulated for delivery to the circulation, muscle tissue and / or cerebrospinal fluid of said human subject.

[0111] 84. The method or pharmaceutical composition of embodiment 82 or 83, wherein the dystrophinopathy is DMD, BMD or X-linked dilated cardiomyopathy.

[0112] 85. The method or pharmaceutical composition according to any one of embodiments 82-84, wherein the CT domain comprises an α1-syntrophin binding site, a β-syntrophin binding site, and / or a dystrobrevin binding site.

[0113] 86. The method or pharmaceutical composition of embodiment 85, wherein the CT domain is a truncated CT domain comprising the α1-syntrophin binding site.

[0114] 87. The method or pharmaceutical composition according to any one of embodiments 82-86, wherein H4 comprises a β-dystroglycan binding site.

[0115] 88. A method for producing a recombinant AAV, comprising: (a) culturing a host cell, the host cell comprising: (i) an artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises a nucleic acid composition according to any one of embodiments 38 to 44; (ii) a trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in host cells in culture and supply the rep and cap proteins in trans; (iii) sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by AAV capsid proteins; and culturing the compound comprising: (b) recovering the recombinant AAV encapsidated with the artificial genome from the cell culture; A method comprising:

[0116] 89.a. An artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises a nucleic acid composition according to any one of embodiments 38 to 44; b. A trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in host cells in culture and provide the rep and cap proteins in trans; and c. Sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by AAV capsid proteins A host cell comprising: [Brief explanation of the drawings]

[0117] [Figure 1A]The vector gene expression cassette and micro-dystrophin constructs used in Cis plasmids for gene therapy are shown. The DNA length of each component and the complete transgene for each construct is listed. SPc5-12: synthetic muscle-specific promoter; Mini-SPc: truncated synthetic muscle-specific promoter; CT1.5: truncated / minimal CT domain; VH4: human immunoglobulin heavy chain variable region intron; ABD: actin-binding domain; H: hinge; R: rod; CR: cysteine-rich domain; CT: C-terminal domain; smPA: small poly(A); ABD: actin-binding domain 1 (ABD1). [Figure 1B] Protein bands detected by Western blot (antibody to dystrophin (1c7)) are shown, along with the relative sizes of micro-dystrophin proteins expressed from plasmids RGX-DYS1, RGX-DYS3, and RGX-DYS5. [Figure 1C] Protein bands detected by Western blot (antibody to dystrophin (1c7)) are shown, along with the relative sizes of micro-dystrophin proteins expressed from plasmids RGX-DYS1, RGX-DYS3, and RGX-DYS5. [Figure 2] Fluorescence microscopy of differentiated C2C12 cells 3 days after infection with reporter AAV vectors AAV8-GFP (A-C) and AAV8-VH4-GFP (D-F) at various doses (indicated above the images: 5 x 10e5 vg / cell (A, D), 1 x 10e5 vg / cell (B, E), and 0.2 x 10e5 vg / cell (C, F)). Scale bar: 200 μM. vg: vector genome. [Figure 3] Shown is the mean fluorescence intensity (units) of transduced C2C12 cells measured 3 days after infection with AAV8-GFP and AAV8-VH4-GFP vectors at three different doses: 5x10e5vg / cell, 1x10e5vg / cell, and 0.2x10e5vg / cell. [Figure 4]Fluorescence microscopy of differentiated C2C12 cells 6 days after infection with AAV8-CAG-GFP is shown. Images A–C were taken daily using an EVOS™ microscope with the same magnification in the transmitted light and GFP channels. A: Microscope image set to the GFP channel; B: Brightfield (or phase contrast) image to observe cell confluence; C: Merged image of A and B to observe the number of infected cells (approximately 50%). [Figure 5] In vitro efficacy testing of micro-dystrophin vectors (RGX-DYS1-03, E-H) compared to a reference control (RGX-DYS-RS, A-D) by immunofluorescence staining of dystrophin protein. Three replicates were performed for each dose (indicated above each image): 1e12 vg / ml (A, E), 4e11 vg / ml (B, F), 1.6e11 vg / ml (C, G), and 6.4e10 vg / ml (D, H). [Figure 6] As an indicator of vector efficacy, the infectivity data for each vector in the mouse muscle cell line C2C12 cells are shown. Normalized data (vector copy number / reference control) are shown for each vector batch: RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3-02, RGX-DYS4-01, and RGX-DYS1-RS. An internal control vector based on the initial batch of DYS1 (RGX-DYS1-RS) was used as the reference standard (1.0). [Figure 7]As an indicator of mRNA expression, microdystrophin data are shown in the mouse muscle cell line C2C12 cells for different production batches of each vector (RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3-02, RGX-DYS4-01, and RGX-DYS1-RS) using the same process. Two different vector doses were used to infect C2C12 cells (1e5 vg / cell and 5e4 vg / cell). The mRNA expression level for each batch was calculated as the fold change (delta CT) in qPCR between the primer / probe for microdystrophin and the endogenous control mouse GAPDH for the same cDNA sample. The graph shows the fold increase, with RGX-DYS1-RS as the 100% reference standard and set at 1. [Figure 8] Weekly changes in body weight (g) are shown. Data are presented as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. [Figure 9A] Mouse muscle and organ weight measurements are shown (normalized to body weight, g / kg). Quadriceps and soleus muscle weights are shown. Data are presented as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. ***P≦0.001 (one-way ANOVA); ###P≦0.001 (t-test). [Figure 9B] Mouse muscle and organ weight measurements are shown (normalized to body weight, g / kg). Triceps and TA weights are shown. Data are shown as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. ***P≦0.001 (one-way ANOVA); ###P≦0.001 (t-test). [Figure 10] Grip strength measurements are shown (KGF / kg). *: One-way ANOVA (***P≦0.001); #: t-test (###p≦0.001). Grip strength of the forearm muscles was normalized to muscle weight for each mouse. n=12 for the mdx RGX-DYS1 group; n=13 for the mdx vehicle group; n=14 for the BL10 vehicle group. [Figure 11] In vitro muscle contractile force analysis at 6 weeks post-treatment revealed significant improvement in muscle strength in mdx mice treated with RGX-DYS1 compared to vehicle-treated mdx mice. Maximum force (mN) and specific muscle strength (kN / m2) are shown. ***: p<0.001 by one-way ANOVA. ###: p<0.001 by t-test. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. [Figure 12] Vector copy numbers (vg / diploid genome) in skeletal muscle, cardiac muscle, and liver by ddPCR are shown. Stilla Technologies' Naica Crystal Digital PCR system was used. n=13 for each treatment tissue. Numbers shown are mean ± Standard Dev. Vector copy numbers were calculated as 2× microdystrophin transgene copy number / endogenous control mouse glucagon copy number. Uninjected mdx liver samples (n=13) were used as negative control samples. TA: tibialis anterior; EDL: extensor digitorum longus. [Figure 13] Figure 1 shows an illustration of the sarcolemma showing the interaction of wild-type dystrophin or dystrobrevin and micro-dystrophins containing α1-syntrophin and β1-syntrophin binding sites, such as RGX-DYS1, with the dystrophin-associated protein complex (DAPC) and the actin cytoskeleton. RGX-DYS1, which contains dystrobrevin, α1-syntrophin, and β1-syntrophin binding sites, is thought to recruit nNOS to some extent and anchor it to the sarcolemma via α1-syntrophin. [Figure 14-1] Immunofluorescence staining of gastrocnemius muscle from the mdx RGX-DYS1 group, mdx control group, and WT control group is shown. Cryosections were stained with anti-α-dystrobrevin, anti-dystroglycan, anti-nNos, anti-dystrophin (anti-dys), and anti-α-syntrophin. Secondary antibodies were labeled with CY3, and all sections were counterstained with DAPI before mounting. [Figure 14-2] Continuation of Figure 14-1 [Figure 15]Western blots for dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-μ-dystrophin vector are shown. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin serves as a loading control for each lane. Mdx (lane 13) represents an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution of 1:10,000, and a secondary (anti-rabbit) antibody was used at a dilution of 1:20,000. [Figure 16A] Quantification of μ-dystrophin bands by Western blot is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 16B] AAV-μ-Dys vector copy number by ddPCR is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 16C] Quantitation of μ-dystrophin bands normalized by AAV-μ-Dys vector copy number is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 17A] Figure 1 shows the mRNA expression of μ-dystrophin and wild-type (WT) dystrophin in skeletal muscle (gastrocnemius). Total RNA was extracted from skeletal muscle, and cDNA was synthesized. The mRNA copy numbers of μ-dystrophin, WT-dystrophin, and the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). Relative μ-dystrophin or WT-dystrophin mRNA expression was normalized to GAPDH. The ratio of WT-dystrophin to GAPDH in B6-WT skeletal muscle was considered to be 1. [Figure 17B]Relative μ-dystrophin or WT-dystrophin mRNA expression in single cells is shown. μ-dystrophin or WT-dystrophin mRNA expression copy number was normalized by GAPDH and genome copy number per cell. [Figure 18] Gastrocnemius muscles were excised from mdx mice, tissue sections were prepared, and immunofluorescence (IF) staining was performed for dystrophin and the dystrophin-associated protein complex, including dystrobrevin, β-dystroglycan, and syntrophin. Mice were treated as described: 16 (untreated wild-type mice); RGX-DYS1 (mouse ID3553 and mouse ID3588); RGX-DYS3 (mouse ID5 and mouse ID7); and RGX-DYS5 (mouse ID9 and mouse ID11). Objective: 40x magnification. [Figure 19A] Figure 1 shows syntrophin expression in skeletal muscle. Gastrocnemius muscles were excised from mdx mice, tissue sections were prepared, and immunofluorescence (IF) staining for syntrophin was performed. Mice were treated as described: 16 (untreated wild-type mice); RGX-DYS1 (mouse ID3553 and mouse ID3588); RGX-DYS3 (mouse ID5 and mouse ID7); and RGX-DYS5 (mouse ID9 and mouse ID11). Objective lens: 40x. [Figure 19B] Western blot for syntrophin from muscle tissue lysates is shown. [Figure 19C] Quantitation of Western blot bands is shown. *: p<0.05; ***: p<0.0001. [Figure 19D] Western blot for syntrophin from total muscle membrane protein is shown. [Figure 19E] Quantification of Western blot bands. [Figure 20A] 1 shows nNOS expression in skeletal muscle. Immunofluorescence staining for nNOS is shown. [Figure 20B] Western blot for nNOS is shown. [Figure 20C] Quantitation of Western blot bands is shown. [Figure 21-1]Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. (A-B) RNAScope images of mdx mice treated with RGX-DYS1 reveal co-expression of μ-dystrophin (red) and pax7 satellite cells (green). RNAscope multiplex fluorescence analysis of AAV transgene and Pax7 mRNA expression was performed by Advanced Cell Diagnostics Inc. (Newark, CA). [Figure 21-2] Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. C shows the percentage of satellite cells transduced with AAV-DMD. D shows the total satellite cell count in RNAscope images. [Figure 21-3] Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. E shows Pax7 mRNA expression in skeletal muscle of different groups revealed by ddPCR. The primers and probe for μ-dystrophin were the same as those described above. The ratio of pax7 to GAPDH in B6-WT skeletal muscle was considered to be 1. **: p<0.01; ***: p<0.001; ****: p<0.0001 when compared with untreated mdx mice. [Figure 22] Illustrations of additional modified μ-dystrophin constructs are shown: Truncated CR: cysteine-rich domain 150 bp shorter than wild-type dystrophin; R16 / R17: dystrophin spectrin-like repeats 16 and 17. [Figure 23A]Figure 1 shows in vitro infection of C2C12 myotubes with different versions of the AAV8-μ-dystrophin construct. C2C12 myoblasts were induced with differentiation medium and then infected with AAV vectors. Cells were harvested 5 days postinfection for Western blot or mRNA expression. 1: negative control; 2: RGX-DYS8; 3: RGX-DYS7; 4: RGX-DYS6; 5: RGX-DYS3; 6: RGX-DYS5; 7: RGX-DYS1; 8: RGX-DYS1; 9: RGX-DYS1; 10: RGX-DYS1; 11: RGX-DYS1. Western blot analysis of μ-dystrophin expression from C2C12 cells. [Figure 23B] Quantitation of Western blot analysis is shown. [Figure 23C] 1 shows detection of μ-dystrophin mRNA expression by ddPCR. DETAILED DESCRIPTION OF THE INVENTION

[0118] Provided are micro-dystrophin proteins, such as those shown in Figures 1A and 22, as well as nucleic acid compositions and rAAV vectors encoding the proteins, and pharmaceutical compositions and treatments related thereto.

[0119] 5.1.Definition The term "AAV" or "adeno-associated virus" refers to a dependent parvovirus within the viral genus Parvoviridae. The AAV may be derived from a naturally occurring "wild-type" virus, from a rAAV genome packaged in a capsid containing capsid proteins encoded by a naturally occurring cap gene, and / or from a rAAV genome packaged in a capsid containing capsid proteins encoded by a non-naturally occurring capsid cap gene. Examples of the latter include rAAVs with capsid proteins containing altered sequences and / or peptide insertions in the amino acid sequence of the naturally occurring capsid.

[0120] The term "rAAV" refers to "recombinant AAV." In some embodiments, a recombinant AAV has an AAV genome in which some or all of the rep and cap genes have been replaced with heterologous sequences.

[0121] The term "rep-cap helper plasmid" refers to a plasmid that provides viral rep and cap gene functions and aids in the production of AAV from rAAV genomes that lack functional rep and / or cap gene sequences.

[0122] The term "cap gene" refers to a nucleic acid sequence that encodes a capsid protein that forms or helps form the capsid coat of a virus. In the case of AAV, the capsid protein can be VP1, VP2, or VP3.

[0123] The term "rep gene" refers to a nucleic acid sequence that encodes a nonstructural protein necessary for viral replication and production.

[0124] The terms "nucleic acid" and "nucleotide sequence" include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations of DNA and RNA molecules or hybrid DNA / RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated, for example, using nucleotide analogs, which include, but are not limited to, inosine or tritylated bases. Such analogs can also include DNA or RNA molecules containing modified backbones that confer beneficial attributes on the molecule, such as, for example, increased nuclease resistance or ability to cross cell membranes. A nucleic acid or nucleotide sequence can be single-stranded, double-stranded, or contain both single- and double-stranded portions, or triple-stranded portions, but is preferably double-stranded DNA.

[0125] The amino acid residues disclosed herein can be modified by conservative substitutions that maintain or substantially maintain the overall polypeptide structure and / or function. As used herein, "conservative amino acid substitution" refers to the following: hydrophobic amino acids (i.e., Ala, Cys, Gly, Pro, Met, Val, Li, and Leu) can be substituted with other hydrophobic amino acids; hydrophobic amino acids with bulky side chains (i.e., Phe, Tyr, and Trp) can be substituted with other hydrophobic amino acids with bulky side chains; amino acids with positively charged side chains (i.e., Arg, His, and Lys) can be substituted with other amino acids with positively charged side chains; amino acids with negatively charged side chains (i.e., Asp and Glu) can be substituted with other amino acids with negatively charged side chains; and amino acids with polar, uncharged side chains (i.e., Ser, Thr, Asn, and Gln) can be substituted with other amino acids with polar, uncharged side chains.

[0126] The terms "subject," "host," and "patient" are used interchangeably. The subject is preferably a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans), and most preferably a human.

[0127] The term "therapeutically functional micro-dystrophin" means that the micro-dystrophin exhibits therapeutic efficacy in one or more of the assays of therapeutic utility described in Section 5.4 herein or in the evaluation of therapeutic methods described in Section 5.5 herein.

[0128] The terms "subject," "host," and "patient" are used interchangeably. The subject is preferably a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans), and most preferably a human.

[0129] The term "therapeutic agent" refers to any agent that can be used to treat, manage, or ameliorate symptoms associated with a disease or disorder, where the disease or disorder is related to the function provided by the transgene. A "therapeutically effective amount" refers to the amount of agent (e.g., the amount of product expressed by the transgene) that, when administered to an afflicted subject, provides at least one therapeutic benefit in the treatment or management of the disease or disorder of interest. Furthermore, a therapeutically effective amount with respect to an agent of the invention refers to the amount of agent alone, or in combination with other therapies, that provides at least one therapeutic benefit in the treatment or management of the disease or disorder.

[0130] The term "prophylactic agent" refers to any agent that can be used in preventing, reducing the likelihood of, delaying, or slowing the progression of a disease or disorder related to the function provided by the transgene. A "prophylactically effective amount" refers to the amount of a prophylactic agent (e.g., the amount of a product expressed by a transgene) that provides at least one prophylactic benefit when administered to a predisposed subject in preventing or delaying a disease or disorder of interest. A prophylactically effective amount can also refer to the amount of agent sufficient to prevent, reduce the likelihood of, or delay the occurrence of, or delay the progression of, a disease or disorder of interest, an amount sufficient to delay or minimize the onset of, or prevent or delay the recurrence or spread of, a disease or disorder of interest. A prophylactically effective amount can also refer to the amount of agent sufficient to prevent or delay the worsening of symptoms of a disease or disorder of interest. Furthermore, a prophylactically effective amount with respect to a prophylactic agent of the invention refers to the amount of prophylactic agent alone, or the amount in combination with other agents, that provides at least one prophylactic benefit in preventing or delaying a disease or disorder.

[0131] The prophylactic agents of the present invention can be administered to subjects "predisposed" to the disease or disorder of interest. A subject "predisposed" to a disease or disorder is one who exhibits symptoms associated with the development of the disease or disorder, or who has the genetic makeup, environmental exposure, or other risk factors for such a disease or disorder, but has not yet experienced symptoms at a level that would allow the disease or disorder to be diagnosed. For example, a patient with a family history of a disease associated with a defective gene (provided by the transgene) can be considered to be predisposed to the disease. Furthermore, a patient with a dormant tumor that persists after removal of the primary tumor can be considered to be predisposed to tumor recurrence.

[0132] The term "CpG island" refers to a characteristic region of a genome that contains a high frequency of the dinucleotide CpG (e.g., a C (cytosine) base immediately followed by a G (guanine) base (CpG)); therefore, the G+C content of CpG islands is significantly higher than that of non-island DNA. CpG islands can be identified by analyzing nucleotide length, nucleotide composition, and CpG dinucleotide frequency. The CpG island content in any particular nucleotide sequence or genome can be measured using the following criteria: island size greater than 100, GC percent greater than 50.0%, and a ratio of the observed number of CG dinucleotides to the expected number based on the number of Gs and Cs in the segment greater than 0.6 (Obs / Exp greater than 0.6). CpG actual / predicted = number of CpGs * N / (number of Cs * number of Gs)

[0133] where N = sequence length.

[0134] Various software tools are available for such calculations, such as world-wide-web.urogene.org / cgi-bin / methprimer / methprimer.cgi, world-wide-web.cpgislands.usc.edu / , world-wide-web.ebi.ac.uk / Tools / emboss / cpgplot / index.html, and world-wide-web.bioinformatics.org / sms2 / cpg_islands.html (see also Gardiner-Garden and Frommer, J Mol Biol. 1987 Jul 20;196(2):261-82; Li LC and Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002 Nov;18(11):1427-31). In one embodiment, an algorithm for identifying CpG islands can be found at www.urogene.org / cgi-bin / methprimer / methprimer.cgi.

[0135] 5.2. Microdystrophin transgene 5.2.1 Microdystrophin Embodiments described herein include microdystrophin proteins having, from amino terminus to carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR (e.g., SEQ ID NO: 2) or ABD1-H1-R1-R2-R16-R17-R24-H4-CR (SEQ ID NO: 93), where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, and R1 is the spectrin region of dystrophin. R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin.

[0136] As described above, the micro-dystrophin of the present disclosure comprises ABD-H1-R1-R2-R3-R24-H4 or ABD-H1-R1-R2-R16-R17-R24-H4. The NH2-terminus and regions within the rod domain of dystrophin directly bind to, but do not cross-link, cytoskeletal actin. The rod domain of wild-type dystrophin consists of 24 repeating units, similar to the triple-helical repeats of spectrin. This repeating unit accounts for the majority of the dystrophin protein and is thought to give the molecule a flexible, rod-like structure similar to that of β-spectrin. These α-helical coiled-coil repeats are interrupted by four proline-rich hinge regions. The end of the 24th repeat is the fourth hinge region, immediately followed by the WW domain [Blake, D. et al., Function and Genetics of Dystrophin and Dystrophin-Related Proteins in Muscle. Physiol. Rev. 82:291-329, 2002]. The micro-dystrophins disclosed herein do not include R4 through R23, or do not include R3 (or in some embodiments, R4) through R15 and R18 through R23 (i.e., micro-dystrophins include R16 and R17, and in certain embodiments, may not include R3), and contain only two or three of the four hinge regions or portions thereof. Embodiments may contain dystrophin spectrin-like repeats 16 and 17, which are believed to anchor nNOS to the sarcolemma. In some embodiments, no novel amino acid residues or linkers are introduced into micro-dystrophins.

[0137] In some embodiments, the microdystrophin comprises a microdystrophin H3 (e.g., SEQ ID NO: 1, 2, or 79). In embodiments, the H3 can be the entire endogenous H3 domain from the N-terminus to the C-terminus, e.g., SEQ ID NO: 11. In other words, some microdystrophin embodiments contain the entire H3 domain rather than a fragment of the H3 domain. In some embodiments, the C-terminal amino acid of the R3 domain is directly (or covalently) linked to the N-terminal amino acid of the H3 domain. In some embodiments, the C-terminal amino acid of the R3 domain linked to the N-terminal amino acid of the H3 domain is Q. In some embodiments, the 5' amino acid of the H3 domain linked to the R3 domain is Q.

[0138] In other embodiments, microdystrophin comprises an H2 domain instead of an H3 domain. The H2 domain can be the entire endogenous H2 domain (SEQ ID NO: 19). Such microdystrophin protein embodiments have, from amino to carboxy terminus: ABD-H1-R1-R2-R3-H2-R24-H4-CR. In some embodiments, the C-terminal amino acid of the R3 domain linked to the N-terminal amino acid of the hinge domain is Q. In other embodiments, the N-terminal amino acid of the H2 domain linked to the R3 domain is P. In certain embodiments, the C-terminal amino acid of the R3 domain is directly linked to the N-terminal amino acid of the hinge domain, where the N-terminal amino acid of the hinge domain is P or Q. In yet other embodiments, the C-terminal amino acid of the R3 domain is directly linked to the N-terminal amino acid of the H2 domain, where the N-terminal amino acid of the H2 domain is P.

[0139] Without being bound by any theory, a complete hinge domain may be suitable for any microdystrophin construct to achieve full activity based on the derived microdystrophin protein. It is recognized that the hinge segment of dystrophin is naturally rich in proline, which may impart flexibility to the protein product (Koenig and Kunkel, 265(6):4560-4566, 1990). Deleting part of the hinge, particularly removing one or more proline residues, may reduce its flexibility and therefore its effectiveness by preventing interaction with other proteins in the DAP complex.

[0140] The micro-dystrophin disclosed herein comprises the wild-type dystrophin H4 sequence (containing the WW domain) through the CR domain (containing the ZZ domain (UniProtKB-P11532 aa 3307-3354) represented by a single underline in SEQ ID NO: 15). The WW domain is a protein-binding module found in several signaling and regulatory molecules. The WW domain binds to proline-rich substrates in a manner similar to src homology 3 (SH3) domains. This region mediates the interaction between β-dystroglycan and dystrophin, as the cytoplasmic domain of β-dystroglycan is proline-rich. The WW domain is located within hinge 4 (H4 region). The CR domain contains two EF-hand motifs similar to those in α-actinin, which bind to intracellular Ca. 2+ The ZZ domain contains a number of conserved cysteine ​​residues, which can bind to Zn 2+ ZZ domains are predicted to form coordination sites for divalent metal cations such as α- and β-divalent metal cations. ZZ domains are similar to many types of zinc fingers and are present in both nuclear and cytoplasmic proteins. The ZZ domain of dystrophin is thought to bind Ca 2+ Thus, the ZZ domain may represent a functional calmodulin-binding site and may influence the binding of calmodulin to other dystrophin-associated proteins.

[0141] Certain embodiments include a truncated portion of the CR domain, including the ZZ domain. For example, the microdystrophin protein includes, from the amino terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR(truncated)-CT (e.g., SEQ ID NO: 91, see RGX-DYS6 in Figure 22). In certain embodiments, the CR domain has, for example, the amino acid sequence of SEQ ID NO: 90.

[0142] To overcome the packaging limitations typical of AAV vectors, many microdystrophin genes developed for clinical use lack the CT domain. Some researchers have even shown that the C-terminal domain is not required for DAPC assembly, or that the C-terminus is not essential [Crawford, et al., J Cell Biol, 2000, 150(6):1399-1409; and Ramos, JN, et al. Molecular Therapy 2019, 27(3):1-13]. However, the CT domain of the dystrophin protein may have beneficial effects on cardiomyopathy. A specific interaction between the CT domain of dystrophin and cardiac beta-dystroglycan has been demonstrated, and the existence of a direct molecular interaction at the plasma membrane interface indicates a direct role for the CT domain in anchoring the DAP complex on the cardiac muscle cell membrane [Stevenson, S., et al., Spatial relationship of the C-terminal domains of dystrophin and beta-dystroglycan in cardiac muscle support a direct molecular interaction at the plasma membrane interface. Circ Res, 1998.82(1):p.82-93]. Correction of dystrophin genotype and cardiac phenotype in a study of 274 patients with Duchenne and Becker muscular dystrophy revealed that the presence of the N-terminal actin-binding domain (ABD1) and the CR domain + CT domain reduced the risk of cardiomyopathy, and further pointed out a beneficial cardioprotective effect of the CT domain of the dystrophin protein [Tandon, A., et al., Dystrophin genotype-cardiac phenotype correlations in Duchenne and Becker muscular dystrophies using cardiac magnetic resonance imaging. Am J Cardiol, 2015.115(7):p.967-71].Thus, overexpression of the microdystrophin gene, which contains helix 1 of the coiled-coil motif in the C-terminal domain, in the skeletal muscles of mdx mice increases the recruitment of α1-syntrophin and α-dystrobrevin, members of the DAP complex that function as modular adaptors for signaling proteins recruited to the muscle cell membrane [Koo, T., et al., Delivery of AAV2 / 9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the levels of α1-syntrophin and α-dystrobrevin in skeletal muscles of mdx mice. Hum Gene Ther, 2011, 22(11):1379-88]. Overexpression of the longer version of microdystrophin also improved muscle resistance to eccentric contraction-induced muscle damage in mdx mice compared with the shorter version [Koo, T., et al. 2011, supra].

[0143] Patients with DMD are known to have persistently severely impaired cardiac function. Treatments that restore neuronal nitric oxide synthase (nNOS) function are thought to be beneficial by improving cardiac function, leading to significant improvements in systolic blood pressure, fractional shortening, and ejection fraction, as well as reduced myocardial fibrosis. Progression of myocardial fibrosis is manifested by patients initially exhibiting left ventricular (LV) dilation and hypertrophy, which progresses to a stage known as dilated cardiomyopathy (DCM).

[0144] The CT domain of dystrophin contains two polypeptide stretches predicted to form α-helical coiled coils similar to those in rod domains (see H1, single underlined, and H2, double underlined, in SEQ ID NO: 16 in Table 1 below). Each coiled coil consists of a conserved repeating heptad (a, b, c, d, e, f, g) similar to those found in leucine zippers. n The CC region of dystrophin forms a binding site for dystrobrevin and may regulate the interaction between α1-syntrophin and other dystrophin-associated proteins.

[0145] The syntrophin isoforms α1-syntrophin and β1-syntrophin are both thought to interact directly with dystrophin through two or more binding sites in dystrophin exons 73 and 74 (Yang et al., JBC 270(10):4975-8(1995)). α1-syntrophin and β1-syntrophin bind separately to the dystrophin C-terminal domain, with the binding site for α1-syntrophin located within at least amino acid residues 3447-3481 and the binding site for β1-syntrophin located within amino acid residues 3495-3535 (Table 1, SEQ ID NO: 16, italics). Alpha1-(α1-)syntrophin and alpha-syntrophin are used interchangeably herein.

[0146] Helix 1 of the coiled-coil motif in the C-terminal (CT) domain of the microdystrophin gene cassette (see H1, shown as the single-underlined sequence in SEQ ID NO: 16 in Table 1 below) may be beneficial for cardiomyocyte protection and otherwise stabilizing the dystrophin-associated (glyco)protein (DAP) complex (DAPC). The DAPC may be involved not only in structural roles but also in important signaling roles. Indeed, potential alterations in nitric oxide (NO) production and other functional changes resulting from the destabilization and loss of this complex have been suggested.

[0147] Unexpectedly, certain micro-dystrophin constructs disclosed herein have been found to bind to and recruit nNOS, as well as alpha-syntrophin, alpha-dystrobrevin, and beta-dystroglycan. In the context of micro-dystrophin constructs comprising binding of the dystrophin C-terminal domain to nNOS, binding to nNOS means that alpha-syntrophin, alpha-dystrobrevin, and nNOS are identified on or near the sarcolemma in sections of transduced muscle tissue by immunostaining the micro-dystrophin constructs expressed in muscle tissue with appropriate antibodies. See Examples 5 and 7 in Sections 6.5 and 6.7, below. In certain embodiments, the micro-dystrophin protein has a C-terminal domain that "increases binding" to α1-syntrophin, β-syntrophin, and / or dystrobrevin compared to an equivalent micro-dystrophin that does not contain the C-terminal domain (otherwise the same amino acid sequence, i.e., a "reference micro-dystrophin protein"), as demonstrated by immunostaining of muscle sections or Western blot analysis of muscle tissue lysates or muscle membrane preparations for one or more DAPC components, including α1-syntrophin, β-syntrophin, α-dystrobrevin, β-dystroglycan, or nNOS. This means that the DAPC is stabilized or anchored to the sarcolemma to a greater extent than reference microdystrophin without the C-terminal domain (which otherwise has the same amino acid sequence as microdystrophin), as determined by greater levels of one or more DAPC components in the muscle membrane in mdx mouse muscles treated with microdystrophin having a C-terminal domain compared to mdx mouse muscles treated with a reference microdystrophin protein (which has the same sequence and dystrophin components but lacks the C-terminal domain) (see sections 6.5 and 6.7 below).

[0148] In some embodiments, the micro-dystrophin construct comprising the C-terminal domain of dystrophin comprises a syntrophin-binding site and / or a dystrobrevin-binding site in the C-terminal domain. In some embodiments, the C-terminal domain comprising the α1-syntrophin-binding site is a truncated C-terminal domain. In certain embodiments, the amino acid sequence of the truncated C-terminal domain is SEQ ID NO: 83. In certain embodiments, the truncated C-terminal domain comprises the amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ (α1-syntrophin-binding site) (SEQ ID NO: 84). In certain embodiments, the truncated C-terminal domain comprises the α1-syntrophin-binding site, which has the amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ (SEQ ID NO: 84), but does not comprise the β1-syntrophin or dystrobrevin-binding site.

[0149] The micro-dystrophin constructs of the present disclosure may further prevent progressive ventricular fibrosis, as measured by a decrease in myocardial macrophage concentration, a decrease in adhesion molecule expression, and / or a normalization of electrocardiogram (ECG) measurements, such as end-systolic volume (left ventricle), end-diastolic volume, stroke volume, ejection fraction, heart rate, or cardiac output, following administration of the micro-dystrophin construct. End-systolic volume and other cardiac measurements can also be measured using MRI (magnetic resonance imaging), cardiac CT (computed tomography), or SPECT (single-photon emission computed tomography). Improved cardiac function following administration of the micro-dystrophin constructs of the present disclosure can also be tested in a DBA / 2J-mdx mouse model.

[0150] Thus, embodiments described herein may further comprise all or a portion of a CT domain comprising helix 1 of the coiled-coil motif. For example, a micro-dystrophin protein may comprise, from amino to carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT (e.g., SEQ ID NO: 1, 79, or 91) or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT (e.g., SEQ ID NO: 92). In some embodiments, the CT is at least a portion of the C-terminal domain of dystrophin comprising the α1-syntrophin and / or dystrobrevin binding sites, as shown in FIG. 14. In certain embodiments, the CT domain comprises the α1-syntrophin binding site but does not have the β1-syntrophin or dystrobrevin binding site, e.g., the amino acid sequence of SEQ ID NO: 83, and functions, in part, to recruit and anchor nNOS to the sarcolemma via α1-syntrophin. In some embodiments, CT comprises the amino acid sequence of SEQ ID NO: 16 or 83.

[0151] Microdystrophin embodiments may further include linkers (L1, L2, L3, L4, L4.1 and / or L4.2) connecting the domains, or portions thereof, as shown below: ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT (e.g., SEQ ID NOs: 1, 79, or 91), ABD1-L1-H1-L2-R1-R 2-L3-R3-H3-L4-R24-H4-CR (e.g., SEQ ID NO: 2), ABD1-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR (e.g., SEQ ID NO: 92), or ABD1-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR-CT (e.g., SEQ ID NO: 93). L1 can be an endogenous linker L1 (e.g., SEQ ID NO: 4) that can link ABD1 to H1. L2 can be an endogenous linker L2 (e.g., SEQ ID NO: 6) that can link H1 to R1. L3 can be an endogenous linker L3 (e.g., SEQ ID NO: 9) that can link R2 to R3 or R16.

[0152] L4 may also be an endogenous linker that can link H3 and R24. In some embodiments, L4 is three amino acids, such as TLE (SEQ ID NO: 12), that precede R24 in the native dystrophin sequence. In other embodiments, L4 may be four amino acids (SEQ ID NO: 17) or two amino acids (SEQ ID NO: 18) that precede R24 in the native dystrophin sequence. In other embodiments, there is no L4 or another linker between H3 and R24. At the 5' end of H3, as described above, there is no linker; rather, R3 is directly linked to H3 or, alternatively, to H2.

[0153] L4.1 can be an endogenous linker that can connect R16 and R17. In some embodiments, L4.1 is two amino acids, e.g., SV (SEQ ID NO: 110) that precedes R17 in the native dystrophin sequence. In other embodiments, L4.2 can be an endogenous linker or part of an endogenous linker that can connect R17 and R24. In some embodiments, L4.2 is four amino acids, e.g., Q following R17 and TLE (SEQ ID NO: 12) that precedes R24 (SEQ ID NO: 89).

[0154] The above components of other domains of microdystrophin not specifically described may have the amino acid sequences provided in Table 1 below. The amino acid sequences of the domains provided herein correspond to the dystrophin isoform of UniProtKB-P11532 (DMD_HUMAN), which is incorporated herein by reference. Other embodiments may include domains derived from naturally occurring functional dystrophin isoforms known in the art, such as UniProtKB-A0A075B6G3 (A0A075B6G3_HUMAN), which is incorporated herein by reference, e.g., R24 has R substituted for Q at amino acid 3 of SEQ ID NO: 13. [Table 1-1] Table 1-2 Table 1-3

[0155] The present disclosure also contemplates variants of such sequences, so long as the functionality of each domain and linker is substantially maintained and / or the therapeutic effect of microdystrophins containing these variants is substantially maintained. Functional activities include (1) binding to one, a combination, or all of actin, β-dystroglycan, α1-syntrophin, α-dystrobrevin, and nNOS; (2) improving muscle function in animal models (e.g., the mdx mouse model described herein) or human subjects; and / or (3) cardioprotection or improvement of myocardial function in animal models or human patients. In particular, micro-dystrophins include ABD consisting of SEQ ID NO:3 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:3; H1 consisting of SEQ ID NO:5 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:5; H2 consisting of SEQ ID NO:7 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:7. R2 consisting of SEQ ID NO:8 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:8; H2 consisting of SEQ ID NO:19 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:19; H3 consisting of SEQ ID NO:11 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:11;R24 consisting of SEQ ID NO: 13 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 13; H4 consisting of SEQ ID NO: 14 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14; or 90; a CT consisting of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83 or SEQ ID NO: 16 or 83, or a CT comprising SEQ ID NO: 84. Alternative embodiments may be similar to those described above, except that the H3 domain is replaced by an H2 domain consisting of SEQ ID NO: 19 or a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 19, and encode a microdystrophin with similar functional activity. In addition to the above, microdystrophin may comprise, at the above positions, linkers comprising or consisting of the following sequences: L1 consisting of SEQ ID NO:4 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:4; L2 consisting of SEQ ID NO:6 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:6;L3 consisting of SEQ ID NO: 9 or an amino acid sequence having at least 50% identity to SEQ ID NO: 9 or a variant having conservative substitutions for both residues of L3; and L4 consisting of SEQ ID NO: 12, 17, or 18 or an amino acid sequence having at least 50%, at least 75% sequence identity to SEQ ID NO: 12, 17, or 18.

[0156] In particular, micro-dystrophins include ABD consisting of SEQ ID NO:3 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:3; H1 consisting of SEQ ID NO:5 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:5; R1 consisting of SEQ ID NO:7 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:7; and SEQ ID NO:8 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:8. R2; R16 consisting of SEQ ID NO: 86 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 86; R17 consisting of SEQ ID NO: 87 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 87; R24 consisting of SEQ ID NO: 13 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 13; H4 consisting of SEQ ID NO: 14 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14;The CR may include a CR consisting of SEQ ID NO: 15 or 90 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 15 or 90; a CT consisting of SEQ ID NO: 16 or 83 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83, or a CT comprising SEQ ID NO: 84. In addition to the above, microdystrophin may include linkers at the above positions that comprise or consist of the following sequences: L1 consisting of SEQ ID NO:4 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:4; L2 consisting of SEQ ID NO:6 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:6; L3 consisting of SEQ ID NO:9 or an amino acid sequence having at least 50% identity to SEQ ID NO:9 or a variant having conservative substitutions at both residues in L3; L4.1 consisting of SEQ ID NO:110 or an amino acid sequence having at least 50%, at least 75% sequence identity to SEQ ID NO:110; and L4.2 consisting of SEQ ID NO:89 or an amino acid sequence having at least 50%, at least 75% sequence identity to SEQ ID NO:89.

[0157] Table 2 provides amino acid sequences of micro-dystrophin embodiments according to the present disclosure. Other embodiments are also contemplated as substitution variants of micro-dystrophins defined by SEQ ID NOs: 1, 2, 79, 91, 92, or 93. For example, conservative substitutions can be made in SEQ ID NOs: 1, 2, 79, 91, 92, or 93 while substantially maintaining its functional activity. In embodiments, the micro-dystrophin has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NOs: 1, 2, 79, 91, 92, or 93 and can maintain functional micro-dystrophin activity, e.g., as determined by one or more of the in vitro assays or in vivo assays in animal models disclosed in Section 5.4, below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7]

[0158] 5.2.2 Microdystrophin-Encoding Nucleic Acid Compositions Another aspect of the present disclosure is a nucleic acid comprising a nucleotide sequence encoding the micro-dystrophin described herein. Such nucleic acids include nucleotide sequences encoding micro-dystrophins having domains arranged from N-terminus to C-terminus as follows: ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R16-R17-R24-H4-CR-CT, or ABD1-H1-R1-R2-R16-R17-R24-H4-CR. The nucleotide sequence may be any nucleotide sequence encoding the domains. The nucleotide sequence may be codon-optimized and / or CpG islands removed for expression in appropriate circumstances. In certain embodiments, the nucleotide sequence encodes a micro-dystrophin having the amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93. The nucleotide sequence can be any sequence encoding a microdystrophin, including the microdystrophin of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:79, SEQ ID NO:91, SEQ ID NO:92, or SEQ ID NO:93, and the nucleotide sequence can vary due to code degeneracy. Tables 3 and 4 provide exemplary nucleotide sequences encoding the DMD domain. As follows, Table 3 provides wild-type DMD nucleotide sequences of the components, and Table 4 provides nucleotide sequences of DMD components used in the constructs herein, including sequences that have been codon-optimized and / or CpG-depleted in CpG islands. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] Table 3-5 Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5

[0159] In some embodiments, such compositions encode functionally active micro-dystrophins, and include a nucleic acid sequence encoding ABD1 consisting of SEQ ID NO:22 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:22; a nucleic acid sequence encoding H1 consisting of SEQ ID NO:24 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:24; a nucleic acid sequence encoding R1 consisting of SEQ ID NO:26 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:26; a nucleic acid sequence encoding R1 consisting of SEQ ID NO:27 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:27. a nucleic acid sequence encoding R2 consisting of a sequence having identity to SEQ ID NO:29; a nucleic acid sequence encoding R3 consisting of SEQ ID NO:29 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:29; a nucleic acid sequence encoding H3 consisting of SEQ ID NO:30 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:30; a nucleic acid sequence encoding R24 consisting of SEQ ID NO:32 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:32; a nucleic acid sequence encoding H4 consisting of SEQ ID NO:33 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:33;and / or a nucleic acid sequence encoding a CT consisting of SEQ ID NO: 35 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 35. Alternative embodiments are similar to those described above, except that the H3 nucleic acid sequence is replaced by a nucleic acid encoding an H2 consisting of SEQ ID NO: 38 or a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 38, which encodes a microdystrophin having similar functional activity.

[0160] In some embodiments, such compositions include a nucleic acid sequence encoding ABD1, consisting of SEQ ID NO:22 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:22, and encoding the ABD1 domain of SEQ ID NO:3; a nucleic acid sequence encoding H1, consisting of SEQ ID NO:24 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:24, and encoding the H1 domain of SEQ ID NO:5; a nucleic acid sequence encoding R1, consisting of SEQ ID NO:26 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:26, and encoding the R1 domain of SEQ ID NO:7; a nucleic acid sequence encoding R1, consisting of SEQ ID NO:27 or a sequence having at least 75%, at least 80%, at least 85%, at least 90% identity to SEQ ID NO:27 a nucleic acid sequence encoding R2, which consists of a sequence having at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 and encodes the R2 domain of SEQ ID NO: 8; a nucleic acid sequence encoding R3, which consists of SEQ ID NO: 29 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 and encodes the R3 domain of SEQ ID NO: 10; a nucleic acid sequence encoding H3, which consists of SEQ ID NO: 30 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 30 and encodes the H3 domain of SEQ ID NO: 11; a nucleic acid sequence encoding R24, which consists of SEQ ID NO: 32 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 32 and encodes the R24 domain of SEQ ID NO: 13;These include nucleic acid sequences encoding H4, which consist of SEQ ID NO: 33 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 33 and encode the H4 domain of SEQ ID NO: 14; nucleic acid sequences encoding CR, which consist of SEQ ID NO: 34 or 109 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 34 or 109 and encode the CR domain of SEQ ID NO: 15 or 90; and / or nucleic acid sequences encoding CT, which consist of SEQ ID NO: 35 or 80 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 35 or 80 and encode the CT domain of SEQ ID NO: 16 or 83. An alternative embodiment is the same as above, except that the H3 nucleic acid sequence is replaced by an H2-encoding nucleic acid consisting of SEQ ID NO:38 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:38, and encoding the H2 domain of SEQ ID NO:19;

[0161] In addition to the foregoing, the nucleic acid composition may optionally include, at the above-mentioned locations, a nucleotide sequence encoding a linker comprising or consisting of the following sequences: a nucleic acid sequence encoding an L1 (e.g., encoding the L1 domain of SEQ ID NO:4) consisting of SEQ ID NO:23 or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:23; SEQ ID NO:25 or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:25. a nucleic acid sequence encoding an L2 consisting of SEQ ID NO: 28 or a sequence having at least 50% identity to SEQ ID NO: 28, and encoding a variant having conservative substitutions in the L3 domain or both residues of L3 of SEQ ID NO: 9; and a nucleic acid sequence encoding an L4 consisting of SEQ ID NO: 31, 36, or 37, or a sequence having at least 50%, at least 75%, sequence identity to SEQ ID NO: 31, 36, or 37 (e.g., encoding a variant having conservative substitutions in the L4 domain or any of the L4 residues of SEQ ID NO: 12, 17, or 18).

[0162] In some embodiments, such compositions encode functionally active micro-dystrophins, and include a nucleic acid sequence encoding ABD1 consisting of SEQ ID NO:22 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:22; a nucleic acid sequence encoding H1 consisting of SEQ ID NO:24 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:24; a nucleic acid sequence encoding R1 consisting of SEQ ID NO:26 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:26; a nucleic acid sequence encoding R1 consisting of SEQ ID NO:27 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:27. a nucleic acid sequence encoding R2 consisting of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:94; a nucleic acid sequence encoding R16 consisting of SEQ ID NO:94 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:94; a nucleic acid sequence encoding R17 consisting of SEQ ID NO:95 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:95; a nucleic acid sequence encoding R24 consisting of SEQ ID NO:32 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:32; a nucleic acid sequence encoding H4 consisting of SEQ ID NO:33 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:33;and / or a nucleic acid sequence encoding a CT consisting of SEQ ID NO: 35 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 35. Alternative embodiments are similar to those described above, except that the H3 nucleic acid sequence is replaced by a nucleic acid encoding an H2 consisting of SEQ ID NO: 38 or a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 38, which encodes a microdystrophin having similar functional activity.

[0163] In some embodiments, such compositions include a nucleic acid sequence encoding ABD1, consisting of SEQ ID NO:22 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:22, and encoding the ABD1 domain of SEQ ID NO:3; a nucleic acid sequence encoding H1, consisting of SEQ ID NO:24 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:24, and encoding the H1 domain of SEQ ID NO:5; a nucleic acid sequence encoding R1, consisting of SEQ ID NO:26 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:26, and encoding the R1 domain of SEQ ID NO:7; a nucleic acid sequence encoding R1, consisting of SEQ ID NO:27 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 99% identity to SEQ ID NO:27. a nucleic acid sequence encoding R2, which consists of a sequence having at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 94 and encodes the R2 domain of SEQ ID NO: 8; a nucleic acid sequence encoding R16, which consists of SEQ ID NO: 94 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 94 and encodes the R16 domain of SEQ ID NO: 86; a nucleic acid sequence encoding R17, which consists of SEQ ID NO: 95 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 95 and encodes the R17 domain of SEQ ID NO: 87; a nucleic acid sequence encoding R24, which consists of SEQ ID NO: 32 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 32 and encodes the R24 domain of SEQ ID NO: 13;These include nucleic acid sequences encoding H4, which consist of SEQ ID NO: 33 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 33 and encode the H4 domain of SEQ ID NO: 14; nucleic acid sequences encoding CR, which consist of SEQ ID NO: 34 or 109 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 34 or 109 and encode the CR domain of SEQ ID NO: 15 or 90; and / or nucleic acid sequences encoding CT, which consist of SEQ ID NO: 35 or 80 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 35 or 80 and encode the CT domain of SEQ ID NO: 16 or 83. An alternative embodiment is the same as above, except that the H3 nucleic acid sequence is replaced by an H2-encoding nucleic acid consisting of SEQ ID NO:38 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:38, and encoding the H2 domain of SEQ ID NO:19;

[0164] In addition to the foregoing, the nucleic acid composition may optionally include, at the above-mentioned locations, a nucleotide sequence encoding a linker comprising or consisting of the following sequences: a nucleic acid sequence encoding an L1 (e.g., encoding the L1 domain of SEQ ID NO: 4) consisting of SEQ ID NO: 23 or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 23; a nucleic acid sequence encoding an L2 (e.g., encoding the L2 domain of SEQ ID NO: 6) consisting of SEQ ID NO: 25 or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 25; a nucleic acid sequence encoding an L2 (e.g., encoding the L2 domain of SEQ ID NO: 6) consisting of SEQ ID NO: 28 or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 28; a nucleic acid sequence encoding an L3 consisting of a sequence having at least 50% identity to SEQ ID NO:28, and encoding a variant with conservative substitutions in the L3 domain or both residues of SEQ ID NO:9; a nucleic acid sequence encoding an L4.1 consisting of SEQ ID NO:125 or a sequence having at least 50%, at least 75% sequence identity to SEQ ID NO:125 (e.g., encoding a variant with conservative substitutions in the L4.1 domain or any of the L4.1 residues of SEQ ID NO:110); and a nucleic acid sequence encoding an L4.2 consisting of SEQ ID NO:126 or a sequence having at least 50%, at least 75% sequence identity to SEQ ID NO:126 (e.g., encoding a variant with conservative substitutions in the L4.2 domain or any of the L4.2 residues of SEQ ID NO:89).

[0165] In various embodiments, the nucleic acid comprises a nucleotide sequence encoding a micro-dystrophin having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:79, SEQ ID NO:91, SEQ ID NO:92, or SEQ ID NO:93. In embodiments, the nucleic acid comprises a nucleotide sequence that is SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:81, SEQ ID NO:101, SEQ ID NO:102, or SEQ ID NO:103 (encoding the micro-dystrophins of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:79, SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:93, respectively). In various embodiments, the nucleotide sequence encoding the micro-dystrophin has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the nucleotide sequence of SEQ ID NO:20, 21, 83, 101, 102, or 103 (Table 5) or their reverse complements, and may encode a therapeutically effective micro-dystrophin. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] Table 5-9 Table 5-10 Table 5-11 Table 5-12 Table 5-13 Table 5-14 Table 5-15 Table 5-16 Table 5-17 Table 5-18 Table 5-19 Table 5-20

[0166] 5.2.2.1 Optimization of コドン and removal of びCpG In one embodiment, the nucleotide sequence encoding the microdystrophin cassette is modified by codon optimization and removal of CpG dinucleotides and CpG islands. Immune responses to the microdystrophin transgene are a concern in human clinical applications, as demonstrated in the first Duchenne muscular dystrophy (DMD) gene therapy clinical trial and several adeno-associated virus (AAV)-mini-dystrophin gene therapies in canine animal models (Mendell, JR, et al., Dystrophin immunity in Duchenne's muscular dystrophy. N Engl J Med, 2010. 363(15): p. 1429-37; and Kornegay, JN, et al., Widespread muscle expression of an AAV9 human mini-dystrophin vector after intravenous injection in neonatal dystrophin-deficient dogs. Mol Ther, 2010. 18(8): p. 1501-8).

[0167] AAV-induced immune responses can be suppressed by reducing the number of CpG dinucleotides in the AAV genome [Faust, SM, et al., CpG-depleted adeno-associated viral vectors evade immune detection. J Clin Invest, 2013. 123(7): p. 2994-3001]. Removal of CpG motifs from the transgene sequence can result in stable and long-term transgene expression by reducing the role of TLR9 in activating innate immunity upon recognition of the transgene as non-self. [See also Wang, D., P. W. L. Tai, and G. Gao, Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov, 2019.18(5):358-378; and Rabinowitz, J., Y. K. Chan, and R. J. Samulski, Adeno-associated virus (AAV) versus immune response. Viruses, 2019.11(2)]. In an embodiment, the micro-dystrophin cassette is human codon-optimized with CpG deletion. The codon-optimized and CpG-deleted nucleotide sequence can be designed by any method known in the art, including, for example, Thermo Fisher Scientific GeneArt Gene Synthesis tool utilizing GeneOptimizer (Waltham, MA USA). The nucleotide sequences of SEQ ID NOs: 20, 21, 57-72, 80, 81, and 101-103 described herein represent sequences that have been codon-optimized and CpG-removed.

[0168] By reducing the number of CpG dinucleotide sequences, micro-dystrophin transgenes are provided that have a reduced number of CpG islands. In certain embodiments, the micro-dystrophin nucleotide sequence has fewer than two (2) CpG islands, or one (1) CpG island, or zero (0) CpG islands. In embodiments, micro-dystrophin transgenes are provided that have fewer than two or one CpG island, or zero CpG islands, which have reduced immunogenicity compared to micro-dystrophin transgenes with more than two CpG islands, as measured by anti-drug antibody titers. In certain embodiments, a micro-dystrophin nucleotide sequence consisting essentially of SEQ ID NO: 20, 21, 81, 101, 102, or 103 has zero (0) CpG islands. In other embodiments, the nucleotide sequence of a micro-dystrophin transgene consisting essentially of a micro-dystrophin gene operably linked to a promoter has fewer than two (2) CpG islands, wherein the micro-dystrophin consists of SEQ ID NO: 20, 21, 81, 101, 102, or 103. In yet other embodiments, the nucleotide sequence of a micro-dystrophin transgene consisting essentially of a micro-dystrophin gene operably linked to a promoter has one (1) CpG island, wherein the micro-dystrophin consists of SEQ ID NO: 20, 21, 81, 101, 102, or 103.

[0169] 5.3. Gene Cassettes and Regulatory Elements Another aspect of the present invention relates to nucleic acid expression cassettes containing regulatory elements designed to confer or enhance expression of micro-dystrophin. The present invention further includes regulatory elements for enhancing or promoting expression of the transgene, including a promoter element and, optionally, an enhancer element and / or an intron. In some embodiments, the rAAV vector also contains regulatory control elements known to those skilled in the art to affect expression of the RNA and / or protein product encoded by the nucleic acid (transgene) in target cells of a subject. The regulatory control elements may be tissue-specific, i.e., active only (or substantially more active or significantly more active) in the target cells / tissues.

[0170] 5.3.1 Promoter 5.3.1.1 Tissue-specific promoters In certain embodiments, the expression cassette of the AAV vector contains a regulatory sequence, such as a promoter, operably linked to the transgene, enabling expression in the target tissue. The promoter can be a constitutive promoter, such as the CB7 promoter. Additional promoters include the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the MMT promoter, the EF-1 alpha promoter (SEQ ID NO: 118), the UB6 promoter, the chicken beta-actin promoter, the CAG promoter (SEQ ID NO: 116), the RPE65 promoter, the opsin promoter, the TBG (thyroxine-binding globulin) promoter, the APOA2 promoter, the SERPINA1 (hAAT) promoter, or the MIR122 promoter. In some embodiments, an inducible promoter, such as a hypoxia-inducible or rapamycin-inducible promoter, is used, particularly when it is desirable to turn off transgene expression.

[0171] In certain embodiments, the promoter is a muscle-specific promoter. The terms "muscle-specific," "muscle-selective," or "muscle-targeted" refer to a nucleic acid element whose activity is adapted to a muscle cell or tissue by interaction of such element with the intracellular environment of the muscle cell. Such muscle cells can include myocytes, myotubes, cardiomyocytes, etc. Specialized forms of muscle cells with distinct properties, such as cardiomyocytes, skeletal cells, and smooth muscle cells, are also included. Various therapies would benefit from muscle-specific expression of transgenes. In particular, gene therapies to treat various forms of muscular dystrophy that are delivered to muscle cells and allow for high transduction efficiency have the added advantage of directing transgene expression in cells where the transgene is most needed. Cardiac tissue would also benefit from muscle-targeted expression of transgenes. A muscle-specific promoter can be operably linked to a transgene of the invention. In some embodiments, the muscle-specific promoter is selected from the group consisting of SPc5-12 promoter, muscle creatine kinase myosin light chain (MLC) promoter, myosin heavy chain (MHC) promoter, desmin promoter (SEQ ID NO: 119), MHCK7 promoter (SEQ ID NO: 120), CK6 promoter, CK8 promoter (SEQ ID NO: 115), MCK promoter (or a truncated form thereof) (SEQ ID NO: 121), alpha actin promoter, beta actin promoter, gamma actin promoter, E-syn promoter, cardiac troponin C promoter, troponin I promoter, myoD gene family promoter, or a muscle-selective promoter present within intron 1 of ocular Pitx3.

[0172] The synthetic promoter c5-12, known as the SPc5-12 promoter (Li, X. et al. Nature Biotechnology Vol. 17, pp. 241-245, March 1999), has been shown to have cell type-restricted expression, particularly muscle cell-specific expression. The SPc5-12 promoter is less than 350 bp in length, shorter than most endogenous promoters, and can be advantageous when the length of the nucleic acid encoding the therapeutic protein is relatively long. In one embodiment, a gene therapy cassette having the SPc5-12 promoter (SEQ ID NO: 39) is provided.

[0173] To further reduce the length of the vector, the regulatory element may be a shortened or truncated version of any one of the promoters described herein (referred to herein as a "minimal promoter"). A minimal promoter contains at least the full-length transcriptional activation domain and is therefore still capable of driving expression. For example, in some embodiments, the AAV vector may contain the transcriptional activation domain of a muscle-specific promoter, such as a minimal SPc5-12 promoter (e.g., SEQ ID NO: 40), operably linked to a therapeutic protein transgene. In embodiments, the therapeutic protein is microdystrophin, as described herein. The minimal promoter of the present disclosure may or may not contain portions of the promoter sequence that contribute to regulating tissue-specific expression.

[0174] Thus, in an embodiment, a gene therapy cassette is provided having the SPc5-12 promoter (SEQ ID NO: 39). In an embodiment, a gene therapy cassette is provided comprising a minimal promoter that induces the expression of micro-dystrophin in muscle cells. One such promoter is the minimal SPc5-12 promoter of SEQ ID NO: 40. The sequences of these promoters are provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3]

[0175] In certain embodiments, the promoter is a CNS-specific promoter. For example, the expression cassette may comprise a promoter selected from the group consisting of a promoter isolated from the gene for neuron-specific enolase (NSE), any neural promoter, such as the promoter for dopamine-1 receptor or dopamine-2 receptor, a synapsin promoter, a CB7 promoter (chicken β-actin promoter and CMV enhancer), a RSV promoter, a GFAP promoter (glial fibrillary acidic protein), a MBP promoter (myelin basic protein), a MMT promoter, an EF-1α promoter, a U86 promoter, a RPE65 promoter or an opsin promoter, an inducible promoter, such as a hypoxia-inducible promoter, and a drug-inducible promoter, such as a promoter induced by rapamycin and related drugs.

[0176] In yet another embodiment, the expression cassette may include multiple promoters that can be arranged in tandem in the expression cassette containing the microdystrophin transgene. Thus, tandem or hybrid promoters may be used to enhance expression and / or direct expression to multiple tissue types (see, for example, PCT International Publication No. WO2019154939A1, published August 15, 2019, which is incorporated herein by reference), and in particular, LMTP6, LMTP13, LMTP14, LMTP15, LMTP18, LMTP19, or LMTP20, as disclosed in PCT International Application No. PCT / US2020 / 043578, filed July 24, 2020 (which is incorporated herein by reference).

[0177] 5.3.2 Introns Another aspect of the present disclosure relates to an AAV vector containing an intron within the regulatory cassette. Example 2 shows that a 5' VH4 intron in the microdystrophin coding sequence promotes proper splicing and thus promotes microdystrophin expression. Thus, in some embodiments, the intron is linked to the 5' end of the sequence encoding the microdystrophin protein, such as ABD-H1-R1-R2-R3-H3-R24-H4-CR, ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT. In particular, the intron may be linked to an actin-binding domain. In other embodiments, the intron is less than 100 nucleotides in length.

[0178] In an embodiment, the intron is a VH4 intron. The VH4 intron nucleic acid may comprise SEQ ID NO: 41, as shown in Table 7 below. [Table 7]

[0179] In another embodiment, the intron is a chimeric intron derived from human β-globin and Ig heavy chain (also known as a β-globin splice donor / immunoglobulin heavy chain splice acceptor intron, or a β-globin / IgG chimeric intron) (Table 7, SEQ ID NO: 75). Other introns well known to those skilled in the art may also be employed, such as the chicken β-actin intron, minute virus of mice (MVM) intron, human factor IX intron (e.g., FIX truncated intron 1), β-globin splice donor / immunoglobulin heavy chain splice acceptor intron, adenovirus splice donor / immunoglobulin splice acceptor intron, or SV40 late splice donor / splice acceptor (19S / 16S) intron (Table 7, SEQ ID NO: 76).

[0180] 5.3.3 Other regulatory elements 5.3.3.1 PolyA Another aspect of the present disclosure relates to an expression cassette comprising a polyadenylation (polyA) site downstream of the coding region of the microdystrophin transgene. Any polyA site that signals the end of transcription and induces the synthesis of a polyA tail is suitable for use in the AAV vector of the present disclosure. Exemplary polyA signals include, but are not limited to, those derived from the SV40 late gene, rabbit β-globin gene, bovine growth hormone (BPH) gene, human growth hormone (hGH) gene, and synthetic polyA (SPA) sites. In one embodiment, the polyA signal comprises SEQ ID NO: 42, as shown in Table 8. [Table 8]

[0181] 5.3.4 Viral vectors The micro-dystrophin transgenes disclosed herein can be included in AAV vectors for gene therapy administration to human subjects. In some embodiments, recombinant AAV (rAAV) vectors can include an AAV viral capsid and a viral genome or artificial genome containing an expression cassette flanked by AAV inverted terminal repeats (ITRs), the expression cassette containing a micro-dystrophin transgene operably linked to one or more regulatory sequences that control expression of the transgene in human muscle or CNS cells to express and deliver micro-dystrophin. Provided methods are suitable for use in producing any of the isolated recombinant AAV particles described herein for delivering micro-dystrophin, in producing compositions comprising any of the isolated recombinant AAV particles encoding micro-dystrophin, or in methods for treating a disease or disorder suitable for micro-dystrophin treatment in a subject in need thereof, the method comprising administering any of the isolated recombinant AAV particles encoding micro-dystrophin described herein. Thus, rAAV can be any serotype, variant, modification, hybrid, or derivative thereof, or any combination thereof (collectively referred to as "serotype") known in the art. In certain embodiments, the AAV serotype has tropism for muscle tissue. In other embodiments, the AAV serotype has tropism for the CNS. In other embodiments, the AAV serotype has tropism for both muscle tissue and the CNS. In yet other embodiments, the AAV serotype has tropism for the liver, where AAV-transduced hepatocytes form a depot of microdystrophin-secreting cells and secrete microdystrophin into the circulation.

[0182] In some embodiments, the rAAV particles are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, and having a capsid protein derived from an AAV serotype selected from AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a derivative, variant, or pseudotype thereof.In some embodiments, the rAAV particles may be any of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, rAAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, The capsid proteins include those that are at least 80% identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the VP1, VP2 and / or VP3 sequences of an AAV capsid serotype selected from AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a derivative, variant, or pseudotype thereof.

[0183] For example, a population of rAAV particles can include two or more serotypes, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PH two or more of P.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 or other rAAV particles, or a combination of two or more thereof).

[0184] In some embodiments, the rAAV particles comprise capsids of Anc80 or Anc80L65, as described in Zinn et al., 2015, Cell Rep. 12(6):1056-1068, which are incorporated by reference in their entireties. In certain embodiments, the rAAV particles comprise capsids containing one of the following amino acid insertions: LGETTRP or LALGETTRP, as described in U.S. Patent Nos. 9,193,956; 9,458,517; and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is incorporated by reference in its entirety. In some embodiments, the rAAV particles comprise an AAV.7m8 capsid, as described in U.S. Patent Nos. 9,193,956; 9,458,517; and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is incorporated by reference in its entirety. In some embodiments, the rAAV particles comprise any AAV capsid, such as AAVPHP.B, disclosed in U.S. Patent No. 9,585,971. In some embodiments, the rAAV particles comprise any AAV capsid, such as AAV.Rh74 and RHM4-1, disclosed in U.S. Patent No. 9,840,719 and WO2015 / 013313, each of which is incorporated by reference in its entirety. In some embodiments, the rAAV particles comprise any AAV capsid, such as AAV rh.74, as disclosed in WO2014 / 172669, which is incorporated herein by reference in its entirety. In some embodiments, the rAAV particles comprise an AAV2 / 5 capsid, as described in Georgiadis et al., 2016, Gene Therapy 23:857-862 and Georgiadis et al., 2018, Gene Therapy 25:450, each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV particles comprise any AV capsid, such as AAV2tYF, as disclosed in WO2017 / 070491, which is incorporated herein by reference in its entirety.In some embodiments, the rAAV particles comprise an AAVLK03 or AAV3B capsid, as described in Puzzo et al., 2017, Sci. Transl. Med. 29(9):418, which is incorporated by reference in its entirety. In some embodiments, the rAAV particles comprise any AAV capsid, such as HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, or HSC16, as disclosed in U.S. Patent Nos. 8,628,966; 8,927,514; 9,923,120; and WO2016 / 049230, each of which is incorporated by reference in its entirety.

[0185] In some embodiments, the rAAV particles comprise an AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated by reference herein in its entirety: U.S. Pat. Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; 9,284,357; and 9,409,953. ; 9,169,299; 9,193,956; 9458517; and 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335. In some embodiments, the rAAV particles have capsid proteins that are at least 80% identical or greater, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the VP1, VP2, and / or VP3 sequences of the AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated by reference herein in its entirety: U.S. Pat. Nos. 7,282,199; 7,906,111; 8,524,446; and 8,999,678. Nos. 8,628,966; 8,927,514; 8,734,809; 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9,458,517; and 9,587,282; U.S. Patent Application Publication No. 2015 / 037 4803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335.

[0186] In some embodiments, the rAAV particles are prepared using the methods described in International Application Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2 in '051), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88 in '321), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97 in '397), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6 in '888), WO 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38 in '689 ... It has capsid proteins as disclosed in WO2009 / 104964 (see, e.g., SEQ ID NOS: 1-5, 7, 9, 20, 22, 24, and 31 of '964), WO2010 / 127097 (see, e.g., SEQ ID NOS: 5-38 of '097), and WO2015 / 191508 (see, e.g., SEQ ID NOS: 80-294 of '508), and U.S. Application Publication No. 20150023924 (see, e.g., SEQ ID NOS: 1, 5-10 of '924), the contents of which are incorporated herein by reference in their entireties.In some embodiments, the rAAV particles are prepared using techniques described in International Application Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2 in '051), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88 in '321), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97 in '397), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6 in '888), WO 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38 in '689), WO 2009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24, and 31 in '964), WO 2010 / 127097 No. 2015 / 0023924 (see, e.g., SEQ ID NOS: 1, 5-10 in '924), each of which is incorporated herein by reference in its entirety.

[0187] Nucleic acid sequences for AAV-based viral vectors and methods for producing recombinant AAV and AAV capsids are described in, e.g., U.S. Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; and 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 01265 88; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; International Patent Application No. PCT / US2015 / 034799; PCT / EP2015 / 053335; WO2003 / 052051, WO2005 / 033321, WO03 / 042397, WO2006 / 068888, WO2006 / 110689, WO2009 / 104964, WO2010 / 127097, and WO2015 / 191508, and U.S. Patent Publication No. 20150023924.

[0188] In additional embodiments, the rAAV particles comprise pseudotyped AAV capsids. In some embodiments, the pseudotyped AAV capsids are rAAV2 / 8 or rAAV2 / 9 pseudotyped AAV capsids. Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001)).

[0189] In certain embodiments, single-stranded AAV (ssAAV) can be used. In certain embodiments, self-complementary vectors, such as scAAV, can be used (see, for example, Wu, 2007, Human Gene Therapy, 18(2):171-82; McCarty et al, 2001, Gene Therapy, Vol. 8, Number 16, Pages 1248-1254; and U.S. Patent Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety).

[0190] In some embodiments, the rAAV particles comprise capsid proteins derived from an AAV capsid serotype selected from AAV8 or AAV9. In some embodiments, the rAAV particles comprise capsid proteins derived from an AAV capsid serotype selected from the group consisting of AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8. In some embodiments, rAAV particles comprise capsid proteins with high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37. In some embodiments, rAAV particles have an AAV1 or a derivative, variant, or pseudotyped AAV capsid serotype. In some embodiments, rAAV particles have an AAV4 or a derivative, variant, or pseudotyped AAV capsid serotype. In some embodiments, rAAV particles have an AAV5 or a derivative, variant, or pseudotyped AAV capsid serotype. In some embodiments, rAAV particles have an AAV8 or a derivative, variant, or pseudotyped AAV capsid serotype. In some embodiments, the rAAV particles have an AAV capsid serotype of AAV9 or a derivative, variant, or pseudotype thereof.

[0191] In some embodiments, rAAV particles comprise capsid proteins that are derivatives, variants, or pseudotypes of AAV8 or AAV9 capsid proteins. In some embodiments, rAAV particles comprise capsid proteins that have at least 80% or more identity to the VP1, VP2, and / or VP3 sequences of AAV8 capsid proteins, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity to AAV8 capsid proteins. In some embodiments, rAAV particles comprise capsid proteins that are derivatives, variants, or pseudotypes of AAV9 capsid proteins. In some embodiments, the rAAV particles comprise capsid proteins having at least 80% or more identity to the VP1, VP2 and / or VP3 sequences of the AAV9 capsid protein, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity to the AAV8 capsid protein.

[0192] In some embodiments, the rAAV particles comprise capsid proteins that have at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity, to the VP1, VP2 and / or VP3 sequences of the AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, or AAV.7m8 capsid protein. In some embodiments, the rAAV particles comprise capsid proteins that have at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity, to the VP1, VP2, and / or VP3 sequences of AAV capsid proteins that have high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37.

[0193] In additional embodiments, the rAAV particles comprise a mosaic capsid. Mosaic AAV particles are composed of a mixture of viral capsid proteins from different AAV serotypes. In some embodiments, the rAAV particles comprise AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP and a mosaic capsid containing capsid proteins of a serotype selected from AAV.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16.

[0194] In some embodiments, the rAAV particles comprise a mosaic capsid containing capsid proteins of a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0195] In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles. In some embodiments, the pseudotyped rAAV particles comprise (a) a nucleic acid vector comprising AAV ITRs, and (b) a capsid composed of capsid proteins derived from an AAVx (e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16). In additional embodiments, the rAAV particles are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.P and pseudotyped rAAV particles composed of capsid proteins of an AAV serotype selected from HP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles containing AAV8 capsid proteins. In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles composed of AAV9 capsid proteins. In some embodiments, the pseudotyped rAAV8 or rAAV9 particles are rAAV2 / 8 or rAAV2 / 9 pseudotyped particles.Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001)).

[0196] In additional embodiments, the rAAV particles comprise capsids containing capsid protein chimeras of two or more AAV capsid serotypes, hi further embodiments, the capsid proteins are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, and AAV.PHP.eB. , AAV2.5, AAV2tYF, AAV3B, rAAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In a further embodiment, the capsid protein is a chimera of two or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0197] In some embodiments, the rAAV particles comprise an AAV8 capsid protein and one or more of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.e and AAV capsid protein chimeras with one or more AAV capsid proteins derived from an AAV serotype selected from AAV.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In some embodiments, the rAAV particles comprise an AAV capsid protein chimera of an AAV8 capsid protein and one or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0198] In some embodiments, the rAAV particles contain the AAV9 capsid proteins AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF ... and AAV capsid protein chimeras of capsid proteins of one or more AAV capsid serotypes selected from AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16.

[0199] In some embodiments, the rAAV particles comprise AAV capsid protein chimeras of capsid proteins of one or more AAV capsid serotypes selected from AAV9 capsid proteins AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.8, and AAVrh.10.

[0200] In some embodiments, the rAAV particles comprise AAV capsid proteins of Clade A, B, E, or F. In some embodiments, the rAAV particles comprise AAV capsid proteins of Clade F. In some embodiments, the rAAV particles comprise AAV capsid proteins of Clade E.

[0201] Table 9 below provides examples of the amino acid sequences of AAV8, AAV9, AAV.rh74, AAV.hu31, AAV.hu32, and AAV.hu37 capsid proteins and the nucleic acid sequences of the 5'-ITR and 3'-ITR of AAV2. Table 9-1 Table 9-2 Table 9-3 Table 9-4 Table 9-5

[0202] The provided methods are suitable for use in producing recombinant AAVs encoding transgenes. In certain embodiments, the transgene is the microdystrophin described herein. In some embodiments, the rAAV genome comprises the following components: (1) AAV inverted terminal repeats flanking an expression cassette; (2) regulatory control elements, such as a) a promoter / enhancer, b) a polyA signal, and c) optionally an intron; and (3) a vector comprising a nucleic acid sequence encoding the described transgene. In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 inverted terminal repeats (ITRs) flanking an expression cassette; (2) control elements including the muscle-specific SPc5.12 promoter and a small polyA signal; and (3) a transgene providing (e.g., encoding) a nucleic acid encoding the microdystrophin described herein. In certain embodiments, the constructs described herein contain the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) control elements including a) the muscle-specific SPc5.12 promoter, b) a small polyA signal; and (3) a micro-dystrophin cassette containing, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT. In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) control elements including a) a CNS promoter, b) a small polyA signal; and (3) a micro-dystrophin cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT.In certain embodiments, the constructs described herein contain the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) regulatory elements including a) the muscle-specific SPc5.12 promoter, b) an intron (e.g., VH4), and c) a small poly(A) signal; and (3) a micro-dystrophin cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT (ABD1 is linked directly to VH4). In certain embodiments, the constructs described herein include the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) control elements including a) a CNS promoter, b) an intron (e.g., VH4), and c) a small polyA signal; and (3) a micro-dystrophin cassette (ABD1 is linked directly to VH4) comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT. In certain embodiments, the constructs described herein contain the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) regulatory elements including a) the muscle-specific SPc5.12 promoter or a CNS promoter, b) an intron (e.g., VH4), and c) a small polyA signal; and (3) a micro-dystrophin cassette (ABD1 is linked directly to VH4) comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT.In certain embodiments, the constructs described herein contain the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) regulatory elements including a) the muscle-specific SPc5.12 promoter, b) an intron (e.g., VH4), and c) a small polyA signal; and (3) a micro-dystrophin cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT (ABD1 is linked directly to VH4). In some embodiments, constructs described herein containing AAV ITRs flanking a micro-dystrophin expression cassette include, from N- to C-terminus, ABD1-H1-R1-R2-R3-H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT and can be between 4,000 and 5,000 nt in length. In some embodiments, such constructs are less than 4,900 nt, 4,800 nt, 4,700 nt, 4,600 nt, 4,500 nt, 4,400 nt, or 4,300 nt in length.

[0203] Some nucleic acid embodiments of the present disclosure include a micro-dystrophin-encoding rAAV vector comprising or consisting of the nucleotide sequence of SEQ ID NO: 53, 54, 55, 56, or 82, as provided below in Table 10. In various embodiments, the rAAV vector comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 53, 54, 55, 56, 82, or their reverse complements, and encoding an rAAV vector suitable for therapeutically effective expression of micro-dystrophin in muscle cells. Table 10-1 Table 10-2 Table 10-3 Table 10-4 Table 10-5 Table 10-6 Table 10-7 Table 10-8 Table 10-9 Table 10-10 Table 10-11 Table 10-12 Table 10-13 Table 10-14 Table 10-15 Table 10-16 Table 10-17 Table 10-18 Table 10-19 Table 10-20 Table 10-21 Table 10-22 Table 10-23 Table 10-24 Table 10-25 Table 10-26 Table 10-27 Table 10-28 [Table 10-29] [Table 10-30] [Table 10-31] [Table 10-32]

[0204] 5.3.5 Methods for producing rAAV particles Another aspect of the invention involves producing the molecules disclosed herein. In some embodiments, the molecules of the invention are produced by providing a nucleotide sequence comprising a nucleic acid encoding any of the capsid protein molecules described herein and using a packaging cell line to prepare corresponding rAAV particles having a capsid coat composed of the capsid protein. Such capsid proteins are described above in Section 5.3.4. In some embodiments, the nucleic acid sequence encodes a sequence having at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99%, or 99.9%, identity to the sequence of a capsid protein molecule described herein, and retains (or substantially retains) the biological function of the capsid protein and an inserted peptide from a heterologous protein or domain thereof. In some embodiments, the nucleic acid encodes a sequence having at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99%, or 99.9%, identity to the sequence of the AAV8 capsid protein, while retaining (or substantially retaining) the biological function of the AAV8 capsid protein and inserted peptide.

[0205] Capsid proteins, coats, and rAAV particles can be produced by techniques known in the art. In some embodiments, the viral genome contains at least one inverted terminal repeat sequence that allows packaging into a vector. In some embodiments, the viral genome further contains a cap gene and / or a rep gene for expression and splicing of the cap gene. In embodiments, the cap and rep genes are provided by the packaging cell and are not present in the viral genome.

[0206] In some embodiments, the nucleic acid encoding the engineered capsid protein is cloned into an AAV Rep-Cap plasmid in place of the existing capsid gene. When co-introduced into a host cell, this plasmid helps package the rAAV genome into the engineered capsid protein as the capsid coat. Packaging cells can be any cell type that contains the genes necessary to facilitate AAV genome replication, capsid assembly, and packaging.

[0207] Many cell culture systems are known in the art for producing rAAV particles, any of which can be used to practice the methods disclosed herein. Cell culture systems include transfection, stable cell line production, and infectious hybrid virus production systems, including, but not limited to, adenovirus-AAV hybrids, herpesvirus-AAV hybrids, and baculovirus-AAV hybrids. rAAV production cultures for the production of rAAV viral particles require: (1) suitable host cells, including, for example, a human-derived cell line, a mammalian cell line, or an insect-derived cell line; (2) suitable helper virus functions provided by wild-type or mutant adenovirus (such as a temperature-sensitive adenovirus), herpesvirus, baculovirus, or a plasmid construct providing helper functions; (3) AAV rep and cap genes and gene products; (4) a transgene (such as a therapeutic transgene) and optional regulatory elements flanked by AAV ITR sequences; and (5) suitable media and media components (nutrients) to support cell growth / survival and rAAV production.

[0208] Non-limiting examples of host cells include A549, WEHI, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC1, BSC40, BMT10, VERO, W138, HeLa, HEK293 and their derivatives (HEK293T cells, HEK293F cells), Saos, C2C12, L, HT1080, HepG2, primary fibroblasts, hepatocytes, myoblasts, CHO cells or CHO-derived cells, or insect-derived cell lines such as SF-9 (e.g., in the case of baculovirus production systems). For a review, see Aponte-Ubillus et al., 2018, Appl. Microbiol. Biotechnol. 102:1045-1054, which is incorporated herein by reference in its entirety for production techniques.

[0209] In one aspect, provided herein are methods for producing rAAV particles, comprising: (a) providing a cell culture comprising insect cells; (b) introducing into the cells one or more baculovirus vectors encoding at least one of: i. an rAAV genome to be packaged; ii. an AAV rep protein sufficient for packaging; and iii. an AAV cap protein sufficient for packaging; and (c) providing sufficient nutrients to the cell culture and maintaining the cell culture under conditions that allow for the production of rAAV particles. In some embodiments, the method comprises using a first baculovirus vector encoding the rep and cap genes and a second baculovirus vector encoding the rAAV genome. In some embodiments, the method comprises using a baculovirus encoding the rAAV genome and insect cells that express the rep and cap genes. In some embodiments, the method comprises using a baculovirus vector encoding both the rep and cap genes and the rAAV genome. In some embodiments, the insect cells are Sf-9 cells. In some embodiments, the insect cells are Sf-9 cells that contain one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0210] In some embodiments, the methods disclosed herein use a baculovirus production system. In some embodiments, the baculovirus production system uses a first baculovirus encoding the rep and cap genes and a second baculovirus encoding the rAAV genome. In some embodiments, the baculovirus production system uses a baculovirus encoding the rAAV genome and a host cell that expresses the rep and cap genes. In some embodiments, the baculovirus production system uses a baculovirus encoding the rep and cap genes and the rAAV genome. In some embodiments, the baculovirus production system uses insect cells such as Sf-9 cells.

[0211] Those skilled in the art are aware of numerous methods by which the AAV rep and cap genes, AAV helper genes (e.g., adenovirus E1a, E1b, E4, E2a, and VA genes), and rAAV genome (comprising one or more genes of interest flanked by inverted terminal repeats (ITRs)) can be introduced into cells to produce or package rAAV. The phrase "adenovirus helper functions" refers to the numerous viral helper genes that are expressed in cells (as RNA or protein) to enable AAV to grow efficiently within the cell. Those skilled in the art understand that helper viruses, including adenovirus and herpes simplex virus (HSV), facilitate AAV replication, and that certain genes that provide essential functions have been identified; for example, helpers can induce changes to the cellular environment that facilitate the expression and replication of such AAV genes. In some embodiments of the methods disclosed herein, the AAV rep and cap genes, helper genes, and rAAV genome are introduced into cells by transfection with one or more plasmid vectors encoding the AAV rep and cap genes, helper genes, and rAAV genome. In some embodiments of the methods disclosed herein, the AAV rep and cap genes, helper genes, and rAAV genome can be introduced into cells by transduction with a viral vector, such as an rHSV vector encoding the AAV rep and cap genes, helper genes, and rAAV genome. In some embodiments of the methods disclosed herein, one or more of the AAV rep and cap genes, helper genes, and rAAV genome are introduced into cells by transduction with an rHSV vector. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes the helper genes. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes.In some embodiments, the rHSV vector encodes helper genes and the rAAV genome. In some embodiments, the rHSV vector encodes helper genes and the AAV rep and cap genes.

[0212] In one aspect, provided herein is a method for producing rAAV particles, comprising: (a) providing a cell culture comprising host cells; (b) introducing into the cells one or more rHSV vectors encoding at least one of: i. the rAAV genome to be packaged; ii. helper functions required for packaging of the rAAV particles; iii. AAV rep protein sufficient for packaging; and iv. AAV cap protein sufficient for packaging; and (c) providing sufficient nutrients to the cell culture and maintaining the cell culture under conditions that permit the production of rAAV particles. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions. In some embodiments, the rHSV vector comprises one or more endogenous genes encoding helper functions. In some embodiments, the rHSV vector comprises one or more heterologous genes encoding helper functions. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions and the rAAV genome. In some embodiments, the rHSV vector comprises helper functions and the AAV rep and cap genes. In some embodiments, the cell comprises one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0213] In one aspect, provided herein is a method for producing rAAV particles, comprising: (a) providing a cell culture comprising mammalian cells; (b) introducing into the cells one or more polynucleotides encoding at least one of: i. the rAAV genome to be packaged; ii. helper functions necessary for packaging of the rAAV particles; iii. AAV rep protein sufficient for packaging; and iv. AAV cap protein sufficient for packaging; and (c) providing sufficient nutrients to the cell culture and maintaining the cell culture under conditions that permit the production of rAAV particles. In some embodiments, the helper functions are encoded by adenovirus genes. In some embodiments, the mammalian cells contain one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0214] Molecular biology techniques for developing plasmids or viral vectors encoding AAV rep and cap genes, helper genes, and / or rAAV genomes are generally known in the art. In some embodiments, the AAV rep and cap genes are encoded by a single plasmid vector. In some embodiments, the AAV helper genes (e.g., the adenovirus E1a, E1b, E4, E2a, and VA genes) are encoded by a single plasmid vector. In some embodiments, the E1a or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection with a single viral vector. In some embodiments, the E1a and E1b genes are stably expressed by the host cell, and the E4, E2a, and VA genes are introduced into the cell by transfection with a single plasmid vector. In some embodiments, one or more helper genes are stably expressed by the host cell, and one or more helper genes are introduced into the cell by transfection with a single plasmid vector. In some embodiments, the helper genes are stably expressed by the host cell. In some embodiments, the AAV rep and cap genes are encoded by a single viral vector. In some embodiments, the AAV helper genes (e.g., the adenovirus E1a, E1b, E4, E2a, and VA genes) are encoded by a single viral vector. In some embodiments, the E1a or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection with a single viral vector. In some embodiments, the E1a and E1b genes are stably expressed by the host cell, and the E4, E2a, and VA genes are introduced into the cell by transfection with a single viral vector.In some embodiments, one or more helper genes are stably expressed by the host cell, and the one or more helper genes are introduced into the cell by transfection with a viral vector. In some embodiments, the AAV rep and cap genes, adenoviral helper functions required for packaging, and the rAAV genome to be packaged are introduced into the cell by transfection with one or more polynucleotides, e.g., vectors. In some embodiments, the methods disclosed herein involve transfecting a cell with a mixture of three polynucleotides: one encoding the cap and rep genes, one encoding the adenoviral helper functions required for packaging (e.g., the adenoviral E1a, E1b, E4, E2a, and VA genes), and one encoding the rAAV genome to be packaged. In some embodiments, the AAV cap gene is the AAV8 or AAV9 cap gene. In some embodiments, the AAV cap gene is an AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.PHB, or AAV.7m8 cap gene. In some embodiments, the AAV cap gene encodes a capsid protein with high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, and AAV.hu37. In some embodiments, the vector encoding the rAAV genome to be packaged contains a gene of interest flanked by AAV ITRs.In some embodiments, the AAV ITRs are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, Derived from AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 or other AAV serotypes.

[0215] Any combination of vectors can be used to introduce the AAV rep and cap genes, AAV helper genes, and rAAV genome into cells where rAAV particles are produced or packaged. In some embodiments of the methods disclosed herein, a first plasmid vector encoding an rAAV genome containing a gene of interest flanked by AAV inverted terminal repeats (ITRs), a second vector encoding the AAV rep and cap genes, and a third vector encoding the helper genes can be used. In some embodiments, a mixture of the three vectors is co-transfected into cells. In some embodiments, a combination of transfection and infection is used by using both a plasmid vector and a viral vector.

[0216] In some embodiments, the rep and cap genes and one or more of the AAV helper genes are constitutively expressed by the cells, eliminating the need to transfect or transduce the cells. In some embodiments, the cells constitutively express the rep and / or cap genes. In some embodiments, the cells constitutively express one or more AAV helper genes. In some embodiments, the cells constitutively express E1a. In some embodiments, the cells contain a stable transgene encoding the rAAV genome.

[0217] In some embodiments, the AAV rep, cap, and helper genes (e.g., Ela, E1b, E4, E2a, or VA genes) can be of any AAV serotype. Similarly, the AAV ITRs can be of any AAV serotype. For example, in some embodiments, the AAV ITRs are of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AA In some embodiments, the cap gene of an AAV is derived from an AAV8 or AAV9 cap gene.In some embodiments, the AAV cap gene is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.H The rAAV particles may be derived from AAV serotypes such as AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.rh74, AAV.hu31, AAV.hu32, or AAV.hu37, or other AAV serotypes (e.g., hybrid serotypes having sequences from two or more serotypes). In some embodiments, the AAV rep and cap genes for production of rAAV particles are derived from different serotypes. For example, the rep gene is derived from AAV2, but the cap gene is derived from AAV8. In another example, the rep gene is derived from AAV2, but the cap gene is derived from AAV9.

[0218] In some embodiments, the rep gene is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF ... The capsid may be derived from AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 or other AAV serotypes (e.g., hybrid serotypes having sequences from two or more serotypes). In other embodiments, the rep and cap genes are derived from the same serotype. In yet other embodiments, the rep and cap genes are derived from the same serotype, and the rep gene comprises at least one modified protein domain or modified promoter domain. In certain embodiments, at least one modified domain comprises a nucleotide sequence of a serotype different from the capsid serotype. The modified domain within the rep gene may be a hybrid nucleotide sequence composed of fragments of different serotypes.

[0219] The hybrid rep gene provides improved packaging efficiency for rAAV particles, including packaging of viral genomes containing micro-dystrophin transgenes of greater than 4 kb, greater than 4.1 kb, greater than 4.2 kB, greater than 4.3 kB, greater than 4.4 kB, greater than 4.5 kB, or greater than 4.6 kb. The AAV rep gene consists of nucleic acid sequences encoding nonstructural proteins required for viral replication and production. Transcription of the rep gene is initiated from the p5 or p19 promoter, resulting in the production of two large nonstructural Rep proteins (Rep78 and Rep68) and two small nonstructural Rep proteins (Rep52 and Rep40), respectively. Additionally, the Rep78 / 68 domain contains a DNA-binding domain that recognizes specific ITR sequences within the ITRs. All four Rep proteins share a common helicase and ATPase domain and function in genome replication and / or encapsidation (Maurer AC, 2020, DOI: 10.1089 / hum.2020.069). Transcription of the cap gene is initiated from the p40 promoter, but because this sequence is located within the C-terminus of the rep gene, it has been suggested that other elements in the rep gene may induce p40 promoter activity. The p40 promoter domain contains transcription factor binding elements EF1A, MLTF, and ATF, a Fos / Jun binding element (AP-1), an Sp1-like element (Sp1 and GGT), and a TATA element (Pereira and Muzyczka, Journal of Virology, June 1997, 71(6):4300-4309). In some embodiments, the rep gene comprises a modified p40 promoter. In some embodiments, the p40 promoter is modified with any one or more of an EF1A binding element, an MLTF binding element, an ATF binding element, a Fos / Jun binding element (AP-1), an Sp1-like element (Sp1 or GGT), or a TATA element.In other embodiments, the rep gene is serotype 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, rh8, rh10, rh20, rh39, rh.74, RHM4-1, or hu37, and a portion or element of the p40 promoter domain has been modified to serotype 2. In yet other embodiments, the rep gene is serotype 8 or 9, and a portion or element of the p40 promoter domain has been modified to serotype 2.

[0220] The ITRs contain complementary sequences of A and A', B and B', and C and C', and the D sequence is contiguous with the ssDNA genome. The complementary sequences of the ITRs form a hairpin structure by self-annealing (Berns KI. The Unusual Properties of the AAV Inverted Terminal Repeat. Hum Gene Ther 2020). The D sequence contains a Rep binding element (RBE) and a terminal resolution site (TRS), which together constitute the AAV replication origin. The ITRs also serve as packaging signals for encapsidation of the genome after replication. In some embodiments, the ITR sequences and the cap gene are derived from the same serotype, except that one or more of the complementary sequences of A and A', B and B', C and C', or D sequences may be modified to contain sequences derived from a different serotype than the capsid. In some embodiments, the modified ITR sequences are derived from the same serotype as the rep gene. In other embodiments, the ITR sequences and cap gene are from different serotypes, except that one or more of the ITR sequences selected from A and A' complements, B and B' complements, C and C' complements, or D sequences are from the same serotype as the capsid (cap gene), and one or more of the ITR sequences are from the same serotype as the rep gene.

[0221] In some embodiments, the rep and cap genes are derived from the same serotype, and the rep gene comprises a modified Rep78 domain, a DNA-binding domain, an endonuclease domain, an ATPase domain, a helicase domain, a p5 promoter domain, a Rep68 domain, a p5 promoter domain, a Rep52 domain, a p19 promoter domain, a Rep40 domain, or a p40 promoter domain. In other embodiments, the rep and cap genes are derived from the same serotype, and the rep gene comprises at least one protein domain or promoter domain from a different serotype. In one embodiment, the rAAV comprises a transgene flanked by AAV2 ITR sequences, an AAV8 cap, and a hybrid AAV2 / 8 rep. In another embodiment, the AAV2 / 8 rep comprises serotype 8 rep, except that the p40 promoter domain or a portion thereof is derived from serotype 2 rep. In other embodiments, the AAV2 / 8 rep comprises serotype 2 rep, except that the p40 promoter domain or a portion thereof is derived from serotype 8 rep. In some embodiments, more than two serotypes may be utilized to construct a hybrid rep / cap plasmid.

[0222] Any suitable method known in the art can be used to transfect cells and can be used to produce rAAV particles according to the methods disclosed herein. In some embodiments, the methods disclosed herein involve transfecting cells using a chemical transfection method. In some embodiments, the chemical transfection method uses calcium phosphate, highly branched organic compounds (dendrimers), cationic polymers (e.g., DEAE-dextran or polyethyleneimine (PEI)), or lipofection. In some embodiments, the chemical transfection method uses a cationic polymer (e.g., DEAE-dextran or polyethyleneimine (PEI)). In some embodiments, the chemical transfection method uses polyethyleneimine (PEI). In some embodiments, the chemical transfection method uses DEAE-dextran. In some embodiments, the chemical transfection method uses calcium phosphate.

[0223] Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures can generally be performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout the specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), which is incorporated herein by reference for all purposes. Unless specific definitions are provided, the nomenclature utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0224] Nucleic acid sequences of AAV-based viral vectors, as well as methods for producing recombinant AAV and AAV capsids, are taught, for example, in US 7,282,199; US 7,790,449; US 8,318,480; US 8,962,332; and PCT / EP2014 / 076466, each of which is incorporated herein by reference in its entirety.

[0225] In a preferred embodiment, rAAV provides a transgene delivery vector that can be used in therapeutic and prophylactic applications, as discussed in more detail below.

[0226] 5.4. Therapeutic utility Methods are provided for assaying constructs containing recombinant gene therapy vectors encoding microdystrophin as disclosed herein for therapeutic efficacy, including both in vitro and in vivo testing in animal models described herein, or using any other method known in the art for testing the activity and efficacy of microdystrophin.

[0227] 5.4.1 In vitro assays 5.4.1.1 In vitro infection systems for muscle cells Methods for testing the infectivity of recombinant vectors, e.g., rAAV particles, disclosed herein are provided. For example, the infectivity of recombinant gene therapy vectors in muscle cells can be tested in C2C12 myoblast cells, as described in Example 2 herein. Several muscle or cardiac cell lines can be used, including, but not limited to, T0034 (human), L6 (rat), MM14 (mouse), P19 (mouse), G-7 (mouse), G-8 (mouse), QM7 (quail), H9c2(2-1) (rat), Hs74.Ht (human), and Hs171.Ht (human) cell lines. Vector copy number can be assessed using polymerase chain reaction technology, and microdystrophin expression levels can be tested by measuring microdystrophin mRNA levels in the cells.

[0228] 5.4.2 Animal models The efficacy of viral vectors containing the micro-dystrophin-encoding transgenes described herein can be tested by administering them to animal models to replace mutant dystrophin, for example, using mdx mice and / or golden retriever muscular dystrophy (GRMD) models, and assessing the biodistribution, expression, and therapeutic efficacy of transgene expression. Therapeutic efficacy can be assessed, for example, by assessing changes in muscle strength in animals administered with the micro-dystrophin transgene. Animal models using large mammals and non-mammalian vertebrates and invertebrates can also be used to assess the preclinical therapeutic efficacy of the vectors described herein. Thus, compositions and methods for therapeutic administration are provided, including a dose of the micro-dystrophin-encoding vectors disclosed herein in an amount demonstrated to be effective according to the methods for assessing therapeutic efficacy disclosed herein.

[0229] 5.4.2.1 Mouse model The efficacy of gene therapy vectors can be evaluated in mouse models of DMD. The mdx mouse model (Yucel, N., et al., Humanizing the mdx mouse model of DMD: the long and the short of it, Regenerative Medicine volume 3, Article number: 4 (2018)) contains a nonsense mutation in exon 23, resulting in a premature stop codon and a truncated protein (mdx). Mdx mice have threefold higher serum levels of pyruvate kinase compared to littermate controls. Similar to human DMD, mdx skeletal muscle exhibits active myofiber necrosis, cellular infiltration, a wide range of myofiber sizes, and regenerating myofibers with numerous central nuclei. This phenotype is accentuated in the diaphragm, where progressive degeneration and myofiber loss result in an approximately fivefold decrease in isometric muscle contraction. Necrosis and regeneration in hindlimb muscles peak around 3–4 weeks after birth and then plateau. A mild but significant reduction in cardiac ejection fraction is observed in mdx mice and mdx mice crossed with other mouse backgrounds (e.g., DBA / 2J) (Van Westering, Molecules 2015, 20, 8823-8855). Such DMD model mice with cardiac dysfunction can be used to evaluate the cardioprotective effects of the gene therapy vectors described herein, or the improvement or maintenance of cardiac function or the alleviation of cardiac dysfunction. Example 3 herein details the use of the mdx mouse model to evaluate gene therapy vectors encoding microdystrophin.

[0230] Additional mdx mouse models: Many alternative versions with different genetic backgrounds have been generated, including the mdx2cv, mdx3cv, mdx4cv, and mdx5cv strains (C57BL / 6 genetic background). These models were generated by treatment with the chemical mutagen N-ethyl-N-nitrosourea. Each strain carries a different point mutation. Overall, the mdxcv model exhibits little difference in disease phenotype presentation compared to mdx mice. The mdx strain has been used in conjunction with various knockout mouse models (e.g., Myod1).- / - , α-integrin 7 - / - , α-dystrobrevin - / - , and utrophin - / - Further mouse models have been generated by crossing the mdx mouse model with the mdx mouse model. All mouse models currently used to study DMD are detailed in Yucel, N., et al., Humanizing the mdx mouse model of DMD: the long and the short of it, npj Regenerative Medicine volume 3, Article number: 4 (2018), which is incorporated herein by reference.

[0231] 5.4.2.2 Dogs Most canine studies have been conducted in the Golden Retriever Muscular Dystrophy (GRMD) model (Korneygay, JN, et al., The golden retriever model of Duchenne muscular dystrophy. Skeleton Muscle. 2017;7:9, incorporated by reference in its entirety). Dogs with GRMD have a skeletal and cardiac phenotype and suffer from a progressive, fatal disease with selective muscle pathology, a severe phenotype that more closely resembles that of DMD. Dogs with GRMD have a single nucleotide change that results in exon skipping and out-of-frame DMD transcripts. Phenotypic features in dogs include elevated serum CK, CRD on EMG, and histopathological evidence of clustered muscle fiber necrosis and regeneration. Phenotypic variability is frequently observed in GRMD, as in humans. Dogs with GRMD develop paradoxical muscle hypertrophy, which may contribute to the affected dog's phenotype, and are commonly characterized by gait stiffness, reduced range of motion, and trismus. Objective biomarkers for assessing disease progression include tonic flexion, tibiofibular joint angle, decreased eccentric contraction rate, maximum hip flexion angle, pelvic angle, sartorius anterior circumference, and quadriceps muscle mass.

[0232] 5.5. Treatment method Methods for treating human subjects with any muscular dystrophic disease that can be treated by providing functional dystrophin are provided. Although DMD is the most common of such diseases, the gene therapy vectors expressing microdystrophin provided herein can be administered to treat Becker muscular dystrophy (BMD), myotonic dystrophy (Steinert disease), facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy. The micro-dystrophin of the present disclosure can be any micro-dystrophin described herein, including those having, in N-terminal to C-terminal order, the domains ABD-H1-R1-R2-R3-H3-R24-H4-CR, ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, and R1 is the dystrophin actin-binding domain. R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 16 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT is at least a portion of the C-terminal region of dystrophin containing the α1-syntrophin binding site and / or the α-dystrobrevin binding site. In embodiments, the micro-dystrophin has the amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93. Micro-dystrophin-encoding vectors, in certain embodiments, include those having the nucleic acid sequence of SEQ ID NO: 20, 21, 81, 101, 102, or 103 operably linked to regulatory elements for constitutive expression, muscle-specific expression (including skeletal, smooth, and cardiac muscle-specific expression), or CNS-specific expression, and other regulatory elements such as polyA sites.Such nucleic acids may be, for example, in the context of a rAAV genome flanked by ITR sequences, particularly AAV2 ITR sequences. In certain embodiments, methods and compositions include administering to a subject in need thereof an rAAV containing a construct having the nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106. In embodiments, the patient has been diagnosed with DMD and / or has a symptom(s) associated with DMD. Recombinant vectors used to deliver a transgene encoding microdystrophin are described in Section 5.3.4.1. Such vectors should have tropism for human muscle cells (including skeletal, smooth, and / or cardiac muscle) and may include non-replicating rAAVs, particularly those with an AAV8 capsid. Recombinant vectors, such as those shown in Figures 1A and 22, can be administered in any manner that allows the recombinant vector to enter muscle tissue or the CNS, preferably by introducing the recombinant vector into the bloodstream.

[0233] The subject receiving such gene therapy may be a subject who responds to gene therapy via delivery of microdystrophin to muscle.In certain embodiments, the method involves treating a patient who has been diagnosed with or has one or more symptoms associated with other muscular dystrophy diseases, such as DMD or Becker muscular dystrophy (BMD), myotonic dystrophy (Steinert disease), facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy, and has been confirmed to respond to treatment with microdystrophin or is considered to be a good candidate for gene therapy via delivery of microdystrophin.In certain embodiments, the patient has previously been treated with synthetic dystrophin and has been found to respond to one or more of the synthetic dystrophin versions.To determine responsiveness, synthetic dystrophin (e.g., produced in human cell culture, bioreactor, etc.) can be directly administered to the subject.

[0234] A therapeutically effective dose of any such recombinant vector should be administered in any manner that allows the recombinant vector to enter muscle (e.g., skeletal or cardiac muscle), preferably by introducing the recombinant vector into the bloodstream. In certain embodiments, the vector is administered subcutaneously, intramuscularly, or intravenously. Intramuscular, subcutaneous, or intravenous administration should result in expression of a soluble transgene product within cells of muscle (including skeletal, cardiac, and / or smooth muscle) and / or the CNS. Expression of the transgene product results in delivery and maintenance of the transgene product in muscle and / or the CNS. Alternatively, delivery may result in gene therapy delivery and expression of microdystrophin in the liver, which then transports the soluble microdystrophin product through the bloodstream to muscle, where it can exert its therapeutic effect. In other embodiments, the recombinant vector may be administered to the CNS, for example, but not limited to, intrathecally, intracerebroventricularly, intranasally, or suprachoroidally.

[0235] The actual dose administered to a particular subject can be determined by the clinician, taking into account parameters such as physical and physiological factors, including, but not limited to, body weight, severity of the condition, disease type, previous or current therapeutic interventions, idiopathic features of the subject, and / or route of administration.

[0236] The dose is 1 x 10 8 Vector genome / (vg / kg) ~ 1 × 10 15 A therapeutically effective amount can be achieved by administering a single or multiple doses over the course of a treatment regimen (i.e., daily, weekly, monthly, etc.).

[0237] A pharmaceutical composition suitable for intravenous, intramuscular, subcutaneous, or hepatic administration comprises a suspension of a recombinant vector containing a transgene encoding micro-dystrophin in a formulation buffer comprising a physiologically compatible aqueous buffer, which may comprise one or more of a polysaccharide, a surfactant, a polymer, or an oil.

[0238] The gene therapy vectors provided herein can be administered in combination with other therapeutic agents for muscular dystrophies, including corticosteroids, beta-blockers, and ACE inhibitors.

[0239] 5.5.1 Muscle degeneration / regeneration Dystrophin deficiency results in mechanical instability, weakening muscle fibers and ultimately causing them to collapse during contraction. DMD patients initially exhibit skeletal muscle deterioration in early childhood, which then rapidly progresses to muscle loss, a curvature of the spine known as kyphosis, paralysis, and ultimately death from cardiopulmonary failure before the age of 30. Skeletal muscle from DMD patients also exhibits muscle hypertrophy, particularly in the calf, evidence of focal necrotic muscle fibers, abnormal variation in muscle fiber diameter, increased fat deposition and fibrosis, and a lack of dystrophin staining in immunohistochemical sections.

[0240] The goal of the gene therapy treatments provided herein is to slow or prevent the progression of DMD or other muscular dystrophy diseases, or to reduce the severity of one or more symptoms associated with DMD or other muscular dystrophy diseases. In particular, the goal of the gene therapy treatments provided herein is to reduce muscle degeneration, induce / improve muscle regeneration, and / or prevent / reduce downstream pathologies, including inflammation and fibrosis, that impede muscle regeneration and lead to reduced exercise capacity, orthopedic complications, and ultimately respiratory and cardiac failure.

[0241] Efficacy can be monitored by measuring change from baseline in gross motor function using the North Star Ambulatory Assessment (NSAA) (an ordinal scale with 34 indicating complete independent function) or a modified age-appropriate assessment; assessing change in gait function (e.g., 6-minute walk distance <300 m, 300-400 m, or >400 m); performing timed functional tests to measure change from baseline in supine-to-stand time (1-8 seconds (good), 8-20 seconds (moderate), and 20-35 seconds (poor)); stair climbing time (4 steps); and timed run / walk assessment (10 meters); and by performing strength tests to assess change from baseline in upper and lower limb muscle strength [Mazzone et al., North Star Ambulatory Assessment, 6-minute walk test, and timed items in ambulant boys with Duchenne muscular dystrophy, Neuromuscular Disorders 20 (2010) 712-716].

[0242] Efficacy can also be monitored by measuring the change (decrease) from baseline in serum creatine kinase (CK) levels, an enzyme that becomes abnormally high when muscle is damaged (normal: 35-175 U / L, DMD: 500-20,000 U / L), serum or urinary creatinine levels (DMD: 10-25 μmol / L, mild BMD: 20-30 μmol / L, normal >53 μmol / L, DMD), and microdystrophin protein levels in muscle biopsies. Magnetic resonance imaging (MRI) can also be performed to assess the infiltration of adipose tissue into skeletal muscle (Burakiewicz, J. et al. "Quantifying fat replacement of muscle by quantitative MRI in muscular dystrophy." Journal of Neurology vol. 264, 10 (2017): 2053-2067. doi: 10.1007 / s00415-017-8547-3).

[0243] Thus, nucleic acid compositions and methods of administering the compositions are provided that improve gross motor function or slow the decline of gross motor function compared to untreated controls or subjects before treatment with the nucleic acid composition, as measured, for example, using the North Start Ambulatory Assessment, which evaluates walking function. Alternatively, the nucleic acid compositions and methods of administering the nucleic acid compositions described herein result in an improvement in gross motor function or a reduction in the decline of gross motor function as assessed by a timed function test measuring the time it takes to stand from a supine position or muscle strength measurement, or a reduction in serum creatine kinase (CK) levels or a reduction in adipose tissue infiltration. Serum creatine kinase (CK) levels can be further divided into its isoenzyme fractions: MM-CPK (skeletal muscle), BB-CPK (brain), and MB-CPK (heart).

[0244] Also provided are compositions comprising an amount of a nucleic acid composition, particularly a vector, viral vector, and AAV vector, comprising a nucleic acid sequence encoding micro-dystrophin as described herein that is effective in improving or slowing the decline of gross motor function, or showing improvement in muscle strength or a decrease in serum creatine kinase levels, compared to untreated controls or subjects prior to treatment with the nucleic acid composition, as measured, for example, using the North Start Ambulatory Assessment, which evaluates walking function, or by a timed function test, which measures the time it takes to stand up from a supine position.

[0245] 5.5.2 Cardiac output Although skeletal muscle symptoms are considered the defining feature of DMD, patients most commonly die from respiratory or cardiac failure. DMD patients develop dilated cardiomyopathy (DCM) due to the absence of dystrophin, necessary for contractile function, in cardiomyocytes. This results in extracellular calcium influx, triggering protease activation, cardiomyocyte death, tissue necrosis, and inflammation, ultimately leading to fat accumulation and fibrosis. This process first affects the left ventricle (LV), which is responsible for pumping blood throughout the body and becomes thicker and therefore experiences a greater workload. Atrophied cardiomyocytes exhibit loss of striated muscle, vacuolization, fragmentation, and nuclear degeneration. Functionally, atrophy and scarring cause structural instability and hypokinesis of the LV, ultimately progressing to generalized DCM. DMD can be accompanied by a variety of ECG changes, including sinus tachycardia, decreased circadian index, decreased heart rate variability, shortened PR interval, right ventricular hypertrophy, ST segment depression, and QTc prolongation.

[0246] The gene therapy treatments provided herein can slow or prevent the progression of DMD and other dystrophinopathies, and in particular can reduce or alleviate the progression of cardiac dysfunction and / or maintain or improve cardiac function. Efficacy can be monitored by regularly assessing cardiac pathology or signs and symptoms of heart failure according to the age and stage of the study population using serial electrocardiograms and noninvasive serial imaging tests (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). CMR can be used to monitor changes from baseline in forced vital capacity (FVC), forced expiratory volume in one second (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), maximum expiratory flow rate (PEF), peak expiratory flow rate during coughing, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis. ECG can be used to monitor conduction abnormalities and arrhythmias. In particular, the ECG can be used to assess the PR interval, R waves in V1, Q waves in V6, ventricular repolarization, QS waves in the inferior and / or superior lateral walls, conduction defects in right bundle branch block, QT C, and normalization of the QRS.

[0247] Thus, provided are nucleic acid compositions, including compositions comprising gene expression cassettes and viral vectors containing nucleic acids encoding the micro-dystrophin proteins disclosed herein, and methods of administering the compositions, which improve or maintain cardiac function or slow the loss of cardiac function, e.g., by preventing a decline in LVEF below 45% and / or a decrease in function to normal (LVFS≧28%), as measured by serial electrocardiograms and / or non-invasive serial imaging (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). Measurements may be compared to untreated controls or subjects prior to treatment with the nucleic acid compositions. Alternatively, the nucleic acid compositions and methods of administering the nucleic acid compositions described herein result in improved cardiac function or reduced loss of cardiac function as assessed by monitoring changes from baseline in forced vital capacity (FVC), forced expiratory volume in one second (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), maximum expiratory flow (PEF), peak expiratory flow during coughing, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis. An ECG can be used to monitor conduction abnormalities and arrhythmias. In particular, an ECG can be used to assess the PR interval, R wave in V1, Q wave in V6, ventricular repolarization, QS waves in the inferior and / or superior lateral walls, conduction defects in right bundle branch block, QT C, and normalization of QRS.

[0248] 5.5.3 Central nervous system Some people with DMD may also have epilepsy, learning and cognitive disabilities, dyslexia, neurodevelopmental disorders such as attention deficit hyperactivity disorder (ADHD), autism, and / or psychiatric disorders such as obsessive-compulsive disorder, anxiety disorders, or sleep disorders.

[0249] The goal of the gene therapy treatment disclosed herein may be to improve cognitive function or alleviate symptoms of epilepsy and / or psychiatric disorders. Efficacy may be assessed by periodic assessment of behavioral and cognitive function according to the age and stage of the study population, or by quantification and qualification of seizure events.

[0250] Thus, provided are methods of administering nucleic acid compositions and micro-dystrophin gene therapy compositions that improve cognitive function, reduce the occurrence or severity of seizures, and alleviate symptoms of ADHD, obsessive-compulsive disorder, anxiety disorders, and / or sleep disorders.

[0251] 5.5.4 Primary patient endpoints The efficacy of the compositions (including dosages of the compositions) and methods described herein can be assessed in clinical evaluations of treated subjects. Primary patient endpoints include change from baseline in forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak expiratory flow during cough, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), change from baseline in NSAA, change from baseline in Performance of Upper Limp (PUL) score, and Brooke Upper Extremity Score (BSE). These may include changes from baseline in the Brooke's Scale score, changes from baseline in grip strength, pinch strength, changes in myocardial fibrosis score by MRI, changes in biceps muscle fat and fibrosis assessed by MRI, leg strength measurements using a dynamometer, changes in a 6-minute walk test, a 10-minute walk test, gait analysis by 3D gait recording, changes in utrophin membrane staining via quantitative imaging of immunostained biopsy sections, and monitoring changes in regenerating fibers (via muscle biopsy) by measuring a combination of fiber size and fetal myosin positivity.For example, Mazzone E et al,North Star Ambulatory Assessment,6-minute walk test and timed items in ambulant boys with Duchenne muscular dystrophy. Neuromuscular Disorders 20(2010)712-716.;Abdelrahim Abdrabou Sadek,et al,Evaluation of cardiac functions in children with Duchenne Muscular Dystrophy:A prospective case-control study. Electron Physician(2017)Nov;9(11):5732-5739;Magrath,P.et al,Cardiac MRI biomarkers for Duchenne muscular dystrophy. BIOMARKERS IN MEDICINE(2018)VOL.12,NO.11.;Pane,M.et al,Upper limb function in Duchenne muscular dystrophy:24 month longitudinal data. PLoS One.2018 Jun See 20;13(6):e0199223. [Example]

[0252] 6.1 Example 1 - Construction of a microdystrophin (DMD) gene expression cassette for insertion of Cis plasmids. The DMD constructs had a similar backbone: 5'-ABD-H1-R1-R2-R3-H3-R24-H4-CR-3' (Figure 1). The four constructs differed in promoter length: one lacking the C-terminus (RGX-DYS3), one lacking an intron (RGX-DYS1), and one with a truncated muscle-specific promoter (RGX-DYS4). All were cloned into a Cis plasmid flanked by ITRs. All DNA sequences encoding the DMD gene were codon-optimized and CpG-removed.

[0253] 6.1.1. Recombinant Engineering of RGX-DYS1 and RGX-DYS2 Transgenes Briefly, the human codon-optimized and CpG-depleted nucleotide sequences of the RGX-DYS1 and RGX-DYS2 microdystrophin constructs, encoding the N-terminus-ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT-C terminus shown in Figure 1A, were synthesized using GeneArt Gene Synthesis (Invitrogen, Thermo Fisher Scientific, Waltham, MA). The desired C-terminus was generated by site-directed mutagenesis using the following two primers: 5': TGA CTC GAG AGG CCT AAT AAA GAG C (SEQ ID NO: 43), 3': CCT TGG AGA CTG TGG AGA GGT G (SEQ ID NO: 44). To generate RGX-DYS2 with a VH4 intron sequence (see Section 6.1.4 below), a fragment containing the nucleotide sequence encoding microdystrophin was cohesively ligated into a backbone plasmid containing AAV ITRs, an origin of replication, and antibiotic resistance to generate the RGX-DYS2 plasmid construct. Sequence analysis revealed an extra cytosine (C) at the 5' splice site of the intron, so the extra C nucleotide was removed by site-directed mutagenesis. The resulting construct, RGX-DYS2, contains the VH4 intron. Similarly, site-directed mutagenesis was used to remove the VH4 intron, resulting in RGX-DYS1.

[0254] 6.1.2. Recombinant Engineering of RGX-DYS3 and RGX-DYS4 Transgenes Construct RGX-DYS3 (Figure 1A) was engineered to encode the microdystrophin of the RGX-DYS1 and RGX-DYS2 constructs detailed above, but without the CT domain. This construct contains a VH4 intron at the 5' end of the construct.

[0255] RGX-DYS4 (Figure 1A) contains a cassette encoding micro-dystrophin and a VH4 intron similar to RGX-DYS2 linked to a minimal SPc5-12 promoter (SEQ ID NO: 40; see Section 6.1.3) rather than the full-length SPc5-12 promoter.

[0256] 6.1.3. RGX-DYS5 Recombination Construct RGX-DYS5 (FIG. 1A) was engineered to encode a microdystrophin designated DYS5 (amino acid sequence of SEQ ID NO: 79) with a 140 amino acid long C-terminal domain (a truncated C-terminal domain having the amino acid sequence of SEQ ID NO: 83) that contains the α1-syntrophin binding site but not the dystrobrevin binding site. The plasmid encodes a human codon-optimized and CpG-depleted version of the microdystrophin DYS5 transgene, a synthetic muscle promoter (e.g., spc5-12), and a small poly(A) signal sequence flanked by ITRs (nucleotide sequence of SEQ ID NO: 82).

[0257] Plasmid RGX-DYS5 was generated by replacing the C-terminal tail of the long version of DYS1 in plasmid RGX-DYS1 with the C-terminal tail of the intermediate version. Briefly, Integrated DNA Technologies synthesized the gBlock-DMD-1.5 tail, which contains the C-terminal end of the intermediate version flanked by EcoRV and NheI sites and a 17-bp overlapping sequence of the RGX-DYS1 plasmid. The source plasmid RGX-DYS1 was digested with the restriction enzymes NheI and EcoRV (New England Biolabs) and then in-fusion ligated with the gBlock-DMD1.5 tail. The final plasmid, RGX-DYS5, was confirmed by enzyme digestion and subsequent sequencing.

[0258] Protein length and expression were confirmed by Western blot. To this end, the myoblast cell line C2C12 cells were transfected with different plasmids. After 4 days of differentiation, cells were harvested in lysis buffer. 20 μg of cell lysate from each plasmid sample was loaded onto an SDS-PAGE gel. To detect the microdystrophin protein bands, an antibody against dystrophin (1c7) (MANEX1011B, Developmental Studies Hybridoma Bank) was used. The microdystrophin protein band generated from the RGX-DYS5 plasmid (expressing DYS5) was significantly shorter than that from RGX-DYS1 (expressing DYS1) and longer than that from DYS3 (Figures 1B and C). In the experiment generating Figure 1B, the DYS3 transgene was driven by the ubiquitous CB promoter, whereas DYS1 and DYS5 transgene expression was driven by muscle-specific promoters. α-actin protein control was used as an indicator of consistent total protein recovery (Figure 1C).

[0259] To examine the packaging efficiency of RGX-DYS5, we packaged RGX-DYS5 into an AAV8 vector using HEK293 cells, and determined the titer of the vector RGX-DYS5 after shake flask culture and affinity purification. The average titer was higher than that of AAV8 packaged with RGX-DYS1 and comparable to that of AAV8 packaged with RGX-DYS3 in these benchtop production experiments (data not shown).

[0260] 6.1.4. VH4 intron and minSPc5-12 promoter The VH4 introns of RGX-DYS2, RGX-DYS3, and RGX-DYS4 are derived from the human immunoglobulin heavy chain variable region (SEQ ID NO: 41; GenBank accession number AB019438.1). The splicing efficiency and accuracy of the VH4 intron were tested in vitro in C2C12 cells. First, reverse transcription PCR products were sequenced to determine whether the correct splicing events had occurred. The RGX-DYS2 plasmid was transfected into C2C12 myoblasts, and the cells were cultured in differentiation medium for 3 days. The cells were then subjected to RNA extraction, cDNA synthesis, and PCR. The primers used for PCR were Primer 1: GGC CCA CGA GCT ACC CGG AG (SEQ ID NO: 45) and Primer 2: CTT CCA GCA GAT CCA GCA GCC (SEQ ID NO: 46). The expected PCR products were gel-purified and subjected to Sanger sequencing. Sequencing revealed that the correct splicing events had occurred. We then tested the function of the VH4 intron in a construct in which the microdystrophin coding sequence was replaced with the coding sequence for a GFP reporter protein. We also tested various doses of AAV8 vectors containing the GFP gene driven by the SPc5-12 promoter with or without the VH4 intron in differentiated C2C12 cells. Images were captured and quantified using a Cytation 5 Cell Imaging Multi-Mode Reader. All quantification and imaging data showed that the VH4 intron increased GFP expression by approximately 5-fold (Figures 2A-F and 3).

[0261] 6.2 Example 2 - In vitro potency assay of micro-dystrophin vectors using differentiated C2C12 cells An in vitro assay was developed to test the efficacy of microdystrophin vectors by assaying the infectivity of AAV8-CAG-GFP vectors in HEK293 cells. Three days after infection (1 × 10E5 vg / cell), few GFP-positive HEK293 cells were observed (data not shown), indicating the low infectivity of AAV8 vectors in HEK293 cells. The ability of AAV8-CAG-GFP vectors to transduce C2C12 myoblasts was then similarly tested. Undifferentiated C2C12 myoblasts were infected with the AAV8-CAG-GFP vector (1 × 10E6 vg / cell) and then differentiated for 3 days. Similar to HEK293 cells, few GFP-positive cells were observed, indicating that undifferentiated C2C12 myoblasts were poorly infectable by rAAV8 (data not shown). C2C12 cells were cultured in differentiation medium (DMEM + 2% horse serum) for 3 days and then infected with AAV8-CAG-GFP to test the infectivity of differentiated C2C12 cells. Images were taken 3 days after infection and 3 days after differentiation. Many GFP-positive cells were visible, suggesting that differentiated myotubes were susceptible to transduction with AAV8 vectors (Figure 4A-C).

[0262] After successfully establishing an in vitro infection system for muscle cells, we assayed the efficacy of the microdystrophin vectors. For example, the efficacy of two batches of vectors (RGX-DYS1-RS and RGX-DYS1-03), produced using the same production process several months apart, was tested in differentiated C2C12 cells. The primary antibody used was a monoclonal antibody against human dystrophin (DSHB catalog number MANHINGE1A (6F11)). Data were analyzed using JMP software. The relative efficacy of the test vector (RGX-DYS1-03) was 81.47% of that of the reference control (RGX-DYS1-RS, 100%), indicating that the infectivity of these two vectors was very similar (Figure 5A–H).

[0263] Batches of recombinant AAVs packaged with DYS1, DYS2, DYS3, or DYS4 vectors were produced, and their relative infectivity was compared in differentiated muscle cell line C2C12 cells as an indicator of vector potency (Figure 6). Briefly, mouse muscle cell line C2C12 cells were seeded at 2 x 10E5 cells / well in 6-well plates and cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS). On day 2, the cells were then transferred to differentiation medium (DMEM containing 2% bovine serum supplemented with insulin (1 μg / ml)). After 3 days of differentiation, the cells were infected with different DMD vectors at a dose of 2.5E4 vg / cell. Three days after infection, infected cells were harvested, and DNA was extracted, followed by Q-PCR. DNA was extracted using the DNeasy Blood and Tissue Kit (Cat. No. 69504, Qiagen). Taqman assays were used for both the endogenous control (glucagon gene) and the AAV vector. The mouse glucagon gene served as an endogenous control, allowing for normalization of vector copy numbers. The sequences of the mouse glucagon primers and probes were as follows: Glucagon-Real-F (mouse): AAGGGACCTTTACCAGTGATGTG (SEQ ID NO: 47); Glucagon-Real-R (mouse): ACTTACTCTCGCCTTCCTCGG (SEQ ID NO: 48); Taqman mouse glucagon probe: FAM-CAGCAAAGGAATTCA-MGB (SEQ ID NO: 49). For the target AAV vector, primers and probes were designed to recognize the micro-dys sequence and were as follows: Dys-CF: TGG GCC TGC TCC TGC ATG (SEQ ID NO: 50); Dys-CR: ATC TCA GGC TTG GCA AAC (SEQ ID NO: 51); Dys-C-probe: FAM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 52). The copy number per diploid cell was calculated as follows:

number

[0264] The DYS1-RS batch was considered the reference control (set at 1.0), and all other vectors were compared to the reference control (vector copy number / reference control (fold change)). As shown in Figure 6, the infectivity of all AAV8 vectors was comparable (50-150% infectivity was within the acceptable range), indicating good quality vectors.

[0265] We determined the RNA expression levels of the microdystrophin gene after infecting differentiated C2C12 cells with various AAV8 vectors at two different doses (1e5 vg / cell and 5e4 vg / cell). Cells transfected with the RGX-DYS3 vector had 2- to 3-fold higher microdystrophin mRNA levels compared to those in cells transfected with the RGX-DYS1 vector (Figure 7). This difference is likely due to the presence of the VH4 intron in the RGX-DYS3-stabilized mRNA.

[0266] 6.3 Example 3 - Gene Therapy Administration to the mdx Mouse Model 6.3.1 Test Method RGX-DYS1 was packaged into an AAV8 vector using HEK293 cells, and the titer of the RGX-DYS1 vector was 4.6E13vg / ml. Briefly, the RGX-DYS1 AAV8 vector was systemically delivered via tail vein injection at a dose of 2E14vg / kg to 5-week-old male mdx mice (n=13). Mice were weighed periodically. Muscle grip strength was measured 5 weeks after treatment, and an in vitro muscle contractile function assay was performed 6 weeks after injection. The results are shown in Table 11. [Table 11]

[0267] 6.3.2. Body and tissue weights Due to the pathogenesis of skeletal muscle degeneration and regeneration, mdx mice are typically heavier than wild-type mice. As can be seen in Figure 8, treatment with the RGX-DYS1 vector significantly reduced body weight. In fact, the weight of treated mice was comparable to that of wild-type mice 2 weeks after treatment.

[0268] Six weeks after injection, all mice were euthanized and various organs and muscles were weighed. RGX-DYS1-treated mice showed significant reductions in organ and muscle weights, including the soleus, quadriceps, and triceps muscles, as well as the tibialis anterior (TA) muscle (Figures 9A and 9B).

[0269] Grip strength To measure grip strength, mice were allowed to acclimate to the testing room for approximately 10 minutes before the procedure began. The experimenter was blinded to the treatment, and each mouse was handed to the experimenter by another person. The mouse was gently placed on the wire grid with its forelimbs so that only its front paws could grasp one of the horizontal bars. After ensuring that both forelimbs were grasping the same bar and that the body was horizontal to the ground and parallel to the bar, the mouse was pulled steadily with uniform force across the entire length of the grid until the grip was released. For acclimatization and testing, each animal performed five successful pulls over five consecutive days. To analyze the maximum grip strength of each individual mouse, the single best recorded value (maximum force) was calculated. Normalized muscle strength (kgf / kg) was calculated based on body weight.

[0270] Grip strength measurements 5 weeks after treatment revealed that treatment significantly increased muscle strength in RGX-DYS1-treated mice compared to diseased vehicle controls (p≦0.001) (FIG. 10).

[0271] 6.3.4. In vitro muscle strength Mice were anesthetized using ketamine and xylazine. The EDL muscle from the right hindlimb was removed from each mouse and immersed in an oxygenated bath (95% O2, 5% CO2) containing Ringer's solution (pH 7.4) at 25°C. Non-fatiguing twitch contractions were used to condition the muscle to its optimal length for force production. Tetanic contractions were induced by stimulating the muscle with electrodes, followed by a 2-minute rest interval. With each subsequent tetanic contraction, the stimulation frequency was increased in 20, 30, or 50 Hz increments until the force reached a plateau (usually occurring around 250 Hz). Muscle cross-sectional area was measured based on muscle mass, fiber length, and tissue density. Finally, specific muscle strength (kN / m2) was calculated based on the muscle cross-sectional area.

[0272] Vehicle mdx mice (n=13) showed a significant decrease in maximal and specific strength compared to healthy BL10 mice (historical data, n=14). Treatment of mdx mice with RGX-DYS1 resulted in a significant improvement in both maximal and specific strength compared to vehicle controls at 6 weeks (FIG. 11).

[0273] Cardiac function To measure blood pressure (BP), mice are sedated using 1.5% isofluorane, and the level of anesthesia is constantly monitored. Body temperature is maintained at 36.5–37.5°C. Heart rate is maintained at 450–550 beats / min. A BP cuff is placed around the tail, and the tail is then placed on a sensor assembly to monitor BP noninvasively during anesthesia. Ten consecutive BP measurements are taken. Qualitative and quantitative measurements of tail BP, including systolic, diastolic, and mean pressure, are performed offline using analysis software. See, for example, Wehling-Henricks et al., Human Molecular Genetics, 2005, Vol. 14, No. 14; Uaesoontrachoon et al., Human Molecular Genetics, 2014, Vol. 23, No. 12.

[0274] A wireless telemetry device was used to monitor ECG peak and interval times in awake, freely moving mice. A transmitter unit was implanted intraperitoneally in anesthetized mice, and two electrical leads were secured near the apex and right acromion in lead II orientation. Mice were individually housed in cages above an antenna receiver connected to a data-recording computer system. Unfiltered ECG data were collected for 10 seconds every hour for 35 days. The first 7 days of data were discarded to allow for recovery from surgery and ensure that the effects of anesthesia had subsided. Data waveforms and parameters were analyzed using DSI analysis packages (ART 3.01 and Physiostat 4.01), and measurements were aggregated and averaged to determine heart rate, ECG peak and interval times. Raw ECG waveforms were examined for arrhythmias by two independent observers.

[0275] Picrosirius red staining was performed to measure the degree of fibrosis in the hearts of test mice. Briefly, at the end of the study, immediately after euthanasia, the myocardium was removed and fixed in 10% formalin for further processing. The hearts were sectioned, and the paraffin sections were deparaffinized in xylene, followed by nuclear staining with Weigert's hematoxylin for 8 minutes. They were then washed and stained with picrosirius red (0.5 g of Sirius Red F3B in aqueous solution saturated with picric acid) for an additional 30 minutes. The sections were cleared three times with xylene and mounted in Permount. Five random digital images were taken using an Eclipse E800 (Nikon, Japan) microscope, and blinded analysis was performed using Image J (NIH).

[0276] Upon euthanasia of the animals, blood samples are collected by cardiac puncture and the collected serum is used to measure muscle CK levels.

[0277] 6.4 Example 4 Vector Biodistribution Vehicle-treated and RGX-DYS1-treated mdx mice were sacrificed 6 weeks after treatment, and vector copy numbers were assessed in various tissues, including skeletal muscle, cardiac muscle, and hepatocytes, using a Naica crystal digital PCR system from Stilla Technologies.

[0278] Four-week-old male dystrophic mdx mice were administered the RGX-DYS1 vector via tail vein injection. Six weeks after injection, the mice were sacrificed, and tissues were subjected to total DNA extraction and ddPCR assay to obtain vector copy numbers.

[0279] Total DNA was extracted from the collected tissues using the DNeasy Blood & Tissue Kit, and the DNA concentration was measured using a Nanodrop spectrophotometer. To determine the vector copy number in the tissues, digital PCR was performed using a Naica Crystal Digital PCR system (Stilla Technologies). Here, a two-color multiplex system was applied to simultaneously measure the dystrophin transgene and the endogenous control gene. Briefly, the dystrophin probe was labeled with FAM (6-carboxyfluorescein) dye, and the endogenous control glucagon probe was labeled with VIC fluorescent dye. The sequences of the mouse glucagon primers and probe were as follows: Glucagon-Real-F (mouse): AAG GGA CCT TTA CCA GTG ATG TG (SEQ ID NO: X); Glucagon-Real-R (mouse): ACT TAC TCT CGC CTT CCT CGG; Taqman mouse glucagon probe: VIC-CAG CAA AGG AAT TCA-MGB. For the AAV vectors, primers and probes were designed to recognize the C-terminus of the dystrophin gene: Dys-dd-F2: ACA GAT ACC TGT TCA AGC AAG TGG C (SEQ ID NO: 122); Dys-dd-R2: TCA ATC TCA GGC TTG GC (SEQ ID NO: 123); Dys-C-probe: FAM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 124). The copy number of the delivered vector in a specific tissue per diploid cell was calculated as follows:

number

[0280] RGX-DYS1 administration resulted in the highest vector copy number in liver tissue (437 ± 78 copies / cell, n = 13), while cardiac muscle (23 ± 9, n = 13) and skeletal muscle (TA: 28 ± 10 copies / cell, EDL: 23 ± 11 copies / cell, diaphragm: 28 ± 29 copies / cell, triceps: 49 ± 22 copies / cell) all showed significant vector distribution (Figure 12).

[0281] 6.5 Example 5 - Recovery of nNOS-containing DAPCs Dystrophin-associated proteins, together with dystrophin, form a complex known as the dystrophin-associated protein complex (DAPC), which functions as a bridge, connecting the intracellular actin cytoskeleton to the basement membrane through the extracellular matrix. Sadoulet-Puccio, HM, et al., Dystrobrevin and dystrophin: an interaction through coiled-coil motifs. (1997) Proc Natl Acad Sci USA 94:12413-8. The DAPC is composed of several subcomplexes: dystroglycan, sarcoglycan, and syntrophin / dystrobrevin, which are collectively involved in maintaining fibril integrity and cell signaling during repeated cycles of contraction and relaxation. Ibid. (Figure 13). In wild-type dystrophin, the β-dystroglycan binding site is located in hinge 4 and the cysteine-rich (CR) domain. The WW domain of dystrophin requires the EF-hand region to interact with beta-dystroglycan (Rentschler, S., et al., 1999, Biol Chem 380:431-42). RGX-DYS1 contains a portion of the C-terminus containing the dystrobrevin and syntrophin-binding domains (SEQ ID NO: 16) (see Table 1). One of the important functions of syntrophin is to anchor signaling proteins such as neuronal nitric oxide synthase (nNOS) to the sarcolemma. Adams, ME, et al., 2000. Absence of α1-syntrophin leads to structurally aberrant neuromuscular synapses deficient in utrophin. J Cell Biol 150:1385-98. Therefore, expression of microdystrophin from RGX-DYS1 in the muscles of mdx mice is expected to restore dystrobrevin, syntrophin, and nNOS to the muscle membrane.

[0282] Immunofluorescence staining for dystrophin, nNOS, α1-syntrophin, and α-dystrobrevin was performed on cry-thin sections of treated and control gastrocnemius muscles. The reagents and antibodies used in the experimental procedures are listed in Tables 12 and 13. [Table 12]

[0283] Freshly isolated mouse tissue was snap-frozen by immediate immersion in an isopentane / liquid nitrogen double bath and then stored at -80°C. The tissue was fixed to a cutting block by adding a few drops of OCT (optimal cutting temperature) compound, and then placed on the block in the desired cutting direction. The OCT and tissue were frozen in a cryostat (maintaining the tissue in the desired direction until the OCT solidified), and the tissue was sectioned at 10 μm (tolerance range: 8–10 μm). Four to six sections were placed on each slide and stored at -80°C.

[0284] The muscle cryosection slides were removed from -80°C storage and air-dried at room temperature (RT) for 10 minutes. The area around the tissue section was then marked with a PAP pen. If the primary antibody was derived from a mouse monoclonal antibody, two blocking steps were required. First, an appropriate amount of 1x MOM was pipetted to cover the entire area circled with the PAP pen, and the sample was then incubated at room temperature for 1.5 hours. The MOM was then removed by aspiration, and the sample was then blocked with 10% horse serum (PBS) for 1 hour at room temperature. If the primary antibody was not derived from a mouse, the sample was directly blocked with 10% horse serum (PBS) by pipetting an appropriate amount of PBS to cover the entire area circled with the PAP pen, and then incubated at room temperature for 1 hour.

[0285] The primary antibody was diluted in 2% horse serum (in PBS), and the samples were incubated at room temperature for 1-2 hours. The slides were then washed with 1X PBS by adding an appropriate amount of PBS to cover the entire area circled with the PAP pen, followed by incubation at room temperature for 3 minutes and aspirating. This was repeated 3-4 times. The secondary antibody (equivalent to CY3, Alexa Fluor 594, or 488-conjugated antibody) was diluted in 2% horse serum in PBS, and the slides were incubated at room temperature for 1 hour. The slides were then washed 3-4 times with 1X PBS for 3 minutes at room temperature. Counterstaining with DAPI to reveal nuclei was performed by incubating slides with 1x DAPI diluted in PBS for 5-8 minutes at room temperature. After DAPI staining, slides were washed with 1x PBS for 3 minutes at room temperature and then mounted with antifade mounting medium at room temperature with 1-2 drops per slide. After mounting, slides were air-dried at room temperature and protected from light. Fluorescence was analyzed and images were taken using a fluorescence microscope. [Table 13]

[0286] As shown in Figure 14, except for a few revertant mutant fibers, dystrophin protein and the investigated DAPC proteins were all absent in the muscles of mdx mice treated with RGX-DYS1. Systemic delivery of RGX-DYS1 efficiently restored dystrophin expression and immobilized α1-syntrophin, α-dystrobrevin, β-dystroglycan, and nNOS to the sarcolemma (Table 14). Two commercially available antibodies were used for nNOS staining. In both cases, nNOS expression in the muscle membrane was significantly restored compared to the untreated control group. In conclusion, RGX-DYS1 microdystrophin was able to restore dystrophin-associated protein complexes, including nNOS, to the sarcolemma in vivo. [Table 14]

[0287] 6.6 Example 6 - Gene Therapy Administration to mdx Mouse Model In vivo testing of the AAV8-RGX-DYS3 and AAV8-RGX-DYS5 vectors was conducted in 13 male C57BL / 10ScSn-Dmdmdx / J (mdx) mice. All vectors were delivered systemically via tail vein injection to 5-week-old mdx mice at a dose of 2E14 vg / kg (Group 1, AAV8-RGX-DYS3, n = 5; Group 2, AAV8-RGX-DYS5, n = 5f; mdx negative (untreated) control, n = 3). Animal weights on the day of administration ranged from 15.9 g to 22.0 g. Six weeks after vector administration, blood was collected for serum, and animals were euthanized and necropsied for tissue collection. Major skeletal muscles, including gastrocnemius (Gas), tibialis anterior (TA), diaphragm, triceps, and quadriceps, as well as heart, liver, and major organs were harvested, snap-frozen in an isopentane / liquid nitrogen double bath, and placed in pre-cooled cryotubes.

[0288] The weight of each animal was recorded twice weekly and the mean weight change for each group was calculated. All animals except for animal #12 (R13-135-012) gained weight over the 7 weeks as expected. [Table 15]

[0289] Mdx mice typically weigh more than wild-type mice due to a pathology of skeletal muscle degeneration and regeneration. As seen in Table 15, mdx mice treated with RGX-DYS3 or RGX-DYS5 vectors experienced significantly less weight change compared to untreated mdx mice.

[0290] 6.7 Example 7 - Evaluation of micro-dystrophin (μ-Dys) protein expression in treated mdx mice 6.7.1 Comparison of μ-Dys expression, mRNA expression, and DNA vector copy number by Western blot. Data and samples described in this Example related to the RGX-DYS1 experiments were obtained after treatment as described in Section 6.3 below (mice administered AAV8-RGX-DYS1, n=13). Data and samples described below for experiments with animals administered AAV8-RGX-DYS3 and AAV8-RGX-DYS5 were obtained after treatment as described in Section 6.6 above (n=5 per treated mdx mouse group). Experiments were performed in a separate facility.

[0291] Microdystrophin protein expression in gastrocnemius muscles harvested from treated mdx mice was examined by Western blot. Briefly, 20–30 mg of tissue was homogenized in protein lysis buffer (15% SDS, 75 mM Tri-HCl pH 6.8, protease inhibitors, 20% glycerol, 5% beta-mercaptoethanol) (Bead Mill homogenizer Bead Ruptor 12, SKU: 19050A, OMNI International). After homogenization, samples were spun down at maximum speed for 5 minutes at room temperature, and the supernatant was subjected to protein quantification. Protein stock supernatants were quantified using the Qubit Protein Assay Kit (Cat. No. Q33211, ThermoFisher Scientific). The total protein concentration per stock was calculated, and then 20 μg of protein stock supernatant was loaded onto an SDS-PAGE gel. Western blots were performed using a primary anti-dystrophin antibody (MANEX1011B (1C7), Developmental Studies Hybridoma Bank) at a dilution of 1:1000, and the secondary antibody applied was a goat anti-mouse IgG2a horseradish peroxidase (HRP) conjugate (Thermo Fisher Scientific, catalog number 62-6520). α1-actin served as a loading control in each lane of the gel. For anti-α1-actin blots, a rabbit polyclonal anti-α1-actin antibody (PA5-78715, Thermo Fisher Scientific) was used at a dilution of 1:10,000, and a secondary goat anti-rabbit antibody (Thermo Fisher Scientific, catalog number 31460) was used at a dilution of 1:20,000. Protein signals were detected using ECL Prime Western Blotting Detection Reagent (according to the manufacturer's instructions; AMERSHAM, RPN2232) and quantified by densitometry guided by Image Lab software (Bio-Rad).

[0292] The Western blot results (Figure 15) revealed several findings: First, the predicted size of each μ-dystrophin protein corresponded well with the observed migration volume on the gel. For example, the RGX-DYS1 μ-dystrophin protein was 148 kDa, while the RGX-DYS5 and RGX-DYS3 proteins were 142 kDa and 132 kDa, respectively. Second, the band intensity varied for each protein present in the gastrocnemius muscle tissue. The RGX-DYS1 vector, which is the long version of μ-dystrophin, showed the strongest transgene expression, followed by the intermediate version, RGX-DYS5, and the short version, RGX-DYS3 (Figures 15 and 16A). The difference in μ-dystrophin expression levels among these three constructs is likely due to either variations in the levels of the AAV vector genome or the stability of the μ-dystrophin construct proteins with different lengths.

[0293] To determine the genome copy number per cell, ddPCR was performed to examine the AAV-μ-dys vector genome copy number in these tissues using the method described above in Section 6.4 (Example 4). As shown in Figure 16B, tissues delivered with the RGX-DYS1 vector indeed exhibited a higher vector genome copy number (50±14 gc / cell) than tissues delivered with the RGX-DYS5 (17±4 gc / cell) and RGX-DYS3 (16±5 gc / cell) vectors (values ​​normalized to glucagon genome copies). Relative μ-dystrophin expression was then compared to vector copy number. As shown in Figure 16C, the relative μ-dystrophin expression in RGX-DYS1-treated muscles (1.33 ± 0.39) and RGX-DYS5-treated muscles (1.774 ± 0.40) was all significantly higher than that in RGX-DYS3-treated muscles (0.77 ± 0.22, p < 0.05, n = 3–5). This data indicates that the longer versions of μ-dystrophin (with C-terminus) produced by the RGX-DYS1 and RGX-DYS3 vectors improve the stability of μ-dystrophin protein in muscle cells in vivo.

[0294] Furthermore, we measured the mRNA expression of μ-dystrophin and wild-type (WT) dystrophin in the skeletal muscle of untreated wild-type B6 and mdx mice compared with treated mice using ddPCR. Total RNA was extracted from muscle tissue using the RNeasy Fibrous Tissue Mini Kit (REF 74704, Qiagen), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit with RNAse inhibitor (Ref 4374966, Thermo Fisher Scientific, Applied Biosystems). RNA concentration was measured using a Nanodrop spectrophotometer. Digital PCR (Naica Crystal Digital PCR system, Stilla Technologies) was used to measure the mRNA copy numbers of μ-dystrophin, WT-dystrophin, and the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers and probes for mouse WT-dystrophin (mm01216951_m1, Thermo Fisher Scientific) (also described in the biodistribution study in Section 6.4 (Example 4) above) and mouse GAPDH (mm99999915_g1, Thermo Fisher Scientific) were commercially available. As shown in Figure 17A, the relative WT-dystrophin transcript in naive B6 mice was 1 ± 0.64, and the WT-dystrophin mRNA expression in mdx mice was 1.55 ± 0.77 (p = 0.15, n = 4). The relative μ-dystrophin mRNA in the treated animals was as follows: RGX-DYS1-treated muscle 22.66 ± 11.6 (p < 0.01, n = 5), RGX-DYS5-treated 16.83 ± 11.07 (p = 0.06, n = 3), and RGX-DYS3-treated muscle 11.87 ± 7.90 (p < 0.05, n = 4). This data demonstrated that delivery of the μ-dystrophin vector in all RGX-DYS1, RGX-DYS5, and RGX-DYS3 groups resulted in the production of μ-dystrophin transcripts significantly higher than wild-type levels.In addition to GAPDH normalization, μ-dystrophin mRNA copy numbers were normalized to the AAV vector genome copy number per cell, and WT-dystrophin mRNA was normalized to the genome copy number per cell (2 copies / cell). As shown in Figure 17B, all groups showed essentially the same level of mRNA expression per genome (n = 3-5, p > 0.05). This indicates that the muscle-specific Spc5-12 promoter driving the AAV-μ-dystrophin transgene is as potent as the native dystrophin promoter in mouse skeletal muscle cells.

[0295] 6.7.2 μ-Dystrophin Expression and Dystrophin-Associated Protein Complex (DAPC) Assembly by Immunofluorescence (IF) Staining Next, immunofluorescence (IF) staining was performed to examine the expression of dystrophin and the dystrophin-associated protein complex, including dystrobrevin, β-dystroglycan, syntrophins, and nNos, in the gastrocnemius muscles of the different groups. The IF staining protocol and applied antibodies were as previously described in Section 6.5 above (Example 5). As shown in Figure 18, dystrophin protein and the investigated DAPC proteins were completely absent in untreated mdx muscles but strongly present in wild-type B6 muscle membrane. In all three treatment groups, μ-dystrophin protein was expressed in nearly 100% of muscle fibers, with no distinction between the different treatment groups. The three treatment groups showed restoration of dystrobrevin expression on the muscle membrane, with very similar patterns observed. β-dystroglycan staining revealed more uniform and stronger β-dystroglycan staining (expression) in muscles from the RGX-DYS1 treatment group.

[0296] More dramatic differences between treatment groups were observed in syntrophin staining. Syntrophin expression on muscle membranes was significantly enhanced in the RGX-DYS1 group, which contains longer μ-dystrophin, followed by RGX-DYS5 and RGX-DYS3 (Figures 18 and 19A). The same trend was further confirmed by Western blot analysis of muscle lysates (Figure 19B). Western blots for syntrophin were performed on skeletal muscle tissue lysates (three gastrocnemius muscle tissues each from the treated mdx and untreated groups, one gastrocnemius muscle, and two triceps muscles from the B6 mouse group). A polyclonal anti-syntrophin antibody (Abcam, ab11187) was used at 1:10,000 and incubated at room temperature for 1 hour. A rabbit monoclonal antibody against α-actinin (ab68167, Abcam) was applied at a 1:5000 dilution. A secondary goat anti-rabbit antibody (Thermo Fisher Scientific, catalog no. A-10685) was applied. The ratio of syntrophin expression to endogenous control actinin expression in WT muscle was 4.56 ± 0.76 (n = 3, p < 0.001 by one-way ANOVA) compared with the mdx group (0.84 ± 0.22). The ratios in the RGX-DYS1 and RGX-DYS5 groups were 2.72 ± 0.97 (n = 3, p < 0.05, compared with the mdx group) and 1.35 ± 0.03, respectively (Figure 19C). Furthermore, the level of syntrophin expression in skeletal muscle was examined in total muscle membrane extracts by Western blot. Total skeletal muscle protein was extracted using the Mem-Per Plus Membrane Protein Extraction Kit (catalog no. 89842, Thermo Fisher Scientific) from the gastrocnemius muscle tissues of the treated and untreated mdx mice, and the quadriceps muscle tissues of the B6 mice. 20 μg of total membrane protein was loaded per lane (Figure 19D). A polyclonal anti-syntrophin antibody (Abcam, ab11187) was used at a dilution of 1:10,000 and incubated overnight at 4°C. A loading control, polyclonal anti-actin antibody (PA5-78715, Thermo Fisher Scientific) was applied at a dilution of 1:10,000 and incubated overnight at 4°C.In slight contrast to the whole lysate Western experiments, in which WT muscle showed the highest syntrophin expression levels, total membrane protein Western blots showed the highest relative syntrophin expression in the RGX-DYS1 group (0.81 ± 0.26, n = 3), followed by the B6_WT group (0.6623 ± 0.05, n = 3), the RGX-DYS3 group (0.59 ± 0.08), and the mdx group (0.32 ± 0.07, n = 3), as seen in Figure 19E. These results clearly demonstrate that μ-dystrophin produced by the μ-dystrophin vector can restore muscle membrane syntrophin expression and that the long version, RGX-DYS1, is better able to anchor syntrophin to muscle membranes than the short version, RGX-DYS3.

[0297] Western blots for nNOS were similarly prepared using muscle membranes (gastrocnemius muscle tissue / mdx group and quadriceps muscle / B6 group). Total muscle membrane proteins were extracted using the Mem-Per Plus Membrane Protein Extraction Kit (catalog no. 89842, Thermo Fisher Scientific). 20 μg of total membrane protein was loaded into each lane of an SDS-PAGE gel. A primary antibody against nNOS (SC-5302, Santa Cruz Biotechnology) was used at a dilution of 1:500, and a polyclonal anti-actin antibody (PA5-78715, Thermo Fisher Scientific) was applied at a dilution of 1:10,000. A secondary goat anti-mouse IgG HRP antibody (62-6520, Thermo Fisher Scientific) was applied. Significant differences in nNOS expression were observed between the RGX-DYS1 and RGX-DYS3 group images after IF staining (Figure 20A). However, Western blot results did not reveal any significant differences between the RGX-DYS1, RGX-DYS3, and untreated mdx groups (Figures 20B-C), indicating that the RGX-DYS1 vector only poorly restored nNOS.

[0298] Overall, delivery of the RGX-DYS1, RGX-DYS3, and RGX-DYS5 vectors in mdx mice all resulted in robust μ-dystrophin expression and restoration of the dystrophin-associated protein complex (DAPC). The longer version of the RGX-DYS1 vector promoted restoration of DAPCs, particularly syntrophins and β-dystroglycan. The RGX-DYS1 vector was less able to restore nNOS to membrane DAPCs, but it was visible by IF staining.

[0299] 6.8 Example 8 - Transduction of Satellite Cells with RGX-DYS1 Vectors and Alleviation of Muscular Dystrophic Muscle Regeneration Skeletal muscle stem cells, or satellite cells (SCs), are normally quiescent and located between the basement membrane and sarcolemma of muscle fibers. When the myogenic program of SCs is activated during growth and after muscle injury, SCs self-renew to maintain their pool and / or differentiate to form myoblasts, which ultimately become muscle fibers. Because adeno-associated virus (AAV) vectors are well known for transducing differentiated muscle fibers, we investigated whether satellite cells can be transformed by AAV vectors. Because satellite cells are small and have very little cytoplasm, studying transgene expression in these cells is technically challenging. Here, we applied RNAscope to investigate whether AAV can transduce satellite cells. RNAscope is a cutting-edge in situ hybridization (ISH) technique that simultaneously enables signal amplification and background noise suppression, allowing direct visualization of single-molecule gene expression at single-cell resolution in intact tissues. RNAscope multiplex fluorescence analysis used an AAV μ-dystrophin probe labeled with the fluorescent dye Opal 570 (red) and the muscle satellite cell marker pax7 labeled with the fluorescent dye Opal 520 (green). RNAscope multiplex fluorescence analysis of AAV transgene and Pax7 mRNA expression was performed at Advanced Cell Diagnostics Inc. (Newark, CA). Total RNA was extracted from skeletal muscle using the RNeasy® Fibrous Tissue Mini Kit (Qiagen catalog no. 74704), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit with RNAse inhibitors (Applied Biosystems catalog no. 4374966). Digital PCR (Naica Crystal Digital PCR system, Stilla Technologies) was used to measure the absolute copy numbers of μ-dystrophin mRNA and endogenous control GAPDH mRNA. Primers and probes for μ-dystrophin were the same as those described above.The mouse pax7 primer and probe set (TaqMan™ MGB probe, Applied Biosystems catalog number 4316034) was purchased commercially.

[0300] As shown in Figures 21A-B, red (left panel, Figure 21A) indicates μ-dystrophin signal (either mRNA expression or the presence of the AAV genome), and green indicates pax7+ satellite cells (indicated by the arrow in Figures 21A-B). The blue DAPI staining (left and right panels, Figures 21A-B) indicates nuclear staining. Colocalization of green, red, and blue (white arrows) indicates transduction of AAV-DMD vectors into muscle satellite cells, while cells with only green and blue (white arrows with black lines) indicate satellite cells without AAV transduction. μ-dystrophin-transduced satellite cells were counted, and the satellite cell transduction rate was calculated. In skeletal muscle transduced with AAV-μ-dys, the satellite cell transduction rate was 23 ± 1.5% (Figure 21C). This demonstrates that muscle satellite cells can be transduced with AAV vectors, although the transduction rate was significantly lower than that of mature muscle fibers.

[0301] Next, the total number of pax7+ satellite cells was counted in RNAscope images to determine whether the number of satellite cells was similar across different treatment groups. As shown in Figure 21D, the pax7-positive cell count per image in untreated mdx mice was 39.12 ± 15.14, while the positive cell counts in wild-type B6 mice and DMD vector-treated mice were 11.87 ± 3.23 (counts in 8 images, one-way ANOVA, p < 0.0001) and 14.66 ± 5.91 (counts in 12 images, one-way ANOVA, p < 0.0001), respectively. The increased number of satellite cells in untreated mdx muscles indicates the regenerative potential of dystrophic muscle. Delivery of μ-dystrophin with the RGX-DYS1 vector reversed this pathology and alleviated muscle regeneration.

[0302] In addition to analysis using RNAscope technology, total muscle RNA was extracted and cDNA analysis was performed. Total RNA was extracted from skeletal muscle using the RNeasy® Fibrous Tissue Mini Kit (Qiagen, Catalog No. 74704), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit with RNAse inhibitors (Applied Biosystems, Catalog No. 4374966). Samples were subjected to ddPCR analysis using mouse pax7-specific primers and probe sets (commercially available: mm01354484_m1 Pax7, Thermo Fisher Scientific; and Applied Biosystems' TaqMan™ MGB probe, Catalog No. 4316034). RNA and cDNA inputs were normalized using mouse GAPDH primers and probe sets. Absolute copy numbers of μ-dystrophin mRNA and endogenous control GAPDH mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). The ratio of pax7 mRNA copy number to GAPDH mRNA copy number was compared between groups (Figure 21E). As expected, the relative expression of pax7 in mdx mice was 7.56 ± 3.14, significantly higher than that in WT-B6 mice (1 ± 0.68, n = 5, p < 0.001 by one-way ANOVA). The relative pax7 expression in the groups treated with the three different μ-dystrophin vectors was significantly reduced (4.40 ± 1.50 in RGX-DYS5 (n = 3, p = 0.06), 3.12 ± 0.74 in RGX-DYS3 (n = 5, p < 0.01), and 2.98 ± 0.68 in RGX-DYS1 (n = 5, p < 0.01). The reduction in pax7 mRNA expression by ddPCR was consistent with the findings using RNAscope technology, further demonstrating that one of the therapeutic mechanisms of the μ-dystrophin vectors of the present invention in dystrophic muscle is through the alleviation of muscle regeneration.

[0303] 6.9 Example 9 - Construction of additional microdystrophin (DMD) gene expression cassettes To potentially further improve μ-dystrophin function and reduce overall transgene size (kB), several additional μ-dystrophin constructs were engineered (Figure 22). In RGX-DYS6 (SEQ ID NO: 91), approximately 50 amino acids of the cysteine-rich domain were removed (truncated CR, SEQ ID NO: 90) to reduce the size of the AAV genome for efficient packaging. In RGX-DYS7 (SEQ ID NO: 92), the previous construct was used as a scaffold for engineering to insert the nNOS-anchoring spectrin repeat domains R16 and R17 (SEQ ID NO: 86 and 87) between the R2 and R24 regions. RGX-DYS8 (SEQ ID NO: 93) is similar to RGX-DYS7 in that the nNOS-anchoring domains R16 and R17 were inserted, but the C-terminal domain (CT) was removed to reduce the size of the AAV vector.

[0304] Package all μ-dystrophin Cis plasmids into AAV8 vectors and inject the vectors (2 × 10) into differentiated C2C12 myotubes as described in section 6.2 (Example 2). 5The cells were infected with 100 μg / cells. Five days after infection, the cells were harvested and subjected to Western blot analysis using an anti-dystrophin primary antibody (MANEX1011B (1C7)) as described herein to detect μ-dystrophin protein. All methods used were similar to those described in Section 6.7 (Example 7). As shown in Figure 23A, the AAV vectors carrying different versions of μ-dystrophin produced μ-dystrophin proteins of different lengths, and their sizes were consistent as expected. Two notable findings were: 1) In general, the longer versions of μ-dystrophin protein had stronger bands (Figures 23A-B). μ-dystrophin mRNA expression levels examined by ddPCR (Figure 23C) did not correlate with protein expression levels. This suggests that the stronger bands produced by the longer versions of μ-dystrophin were not due to increased mRNA expression but rather to increased protein stability. 2) μ-dystrophin RGX-DYS6 was not particularly stable compared to the others. We reasoned that the 50 amino acid deletion in the CR domain might affect the stability of μ-dystrophin.

[0305] Although the present invention will be described in detail with reference to specific embodiments thereof, it will be understood that functionally equivalent variations are within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to be within the scope of the appended claims. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

[0306] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

[0307] The discussion herein is provided to better understand the nature of the problems facing the art and should not be construed as an admission of prior art in any sense, and the citation of any document herein shall not be construed as an admission that such document constitutes "prior art" to the instant application.

[0308] All references cited herein, including patent applications and publications, are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent or patent application were specifically and individually indicated to be incorporated by reference in its entirety for all purposes. The present invention is susceptible to many modifications and variations without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the present invention is to be limited only by the scope of the appended claims, including all equivalents to which such claims are entitled. Various embodiments of the present invention are described below. 1. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin nucleotide sequence. the nucleic acid composition, wherein R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin or the β-dystroglycan-binding portion thereof, and CT is the C-terminal region of dystrophin or a portion of the C-terminal region containing the α1-syntrophin-binding site or the dystrobrevin-binding site. 2. The nucleic acid composition described in 1 above, which comprises: (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 1, 79 or 91, or a nucleic acid sequence that is at least 90%, 95% or 98% identical thereto, or a reverse complement thereof that encodes a therapeutically functional micro-dystrophin protein; or (2) a nucleic acid sequence of SEQ ID NO: 20, 81 or 100, or a nucleic acid sequence that is at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid sequence encodes a therapeutically functional micro-dystrophin protein. 3. (1) the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, and increases binding of the microdystrophin protein to α1-syntrophin and / or dystrobrevin compared to a reference microdystrophin lacking the CT domain sequence; or the nucleic acid sequence encoding the CT domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 70, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, and increases binding of the microdystrophin protein to α1-syntrophin and / or dystrobrevin compared to a reference microdystrophin lacking the CT domain sequence. 3. The nucleic acid composition of claim 1 or 2, wherein the nucleic acid sequence encoding the minimal CT domain consists of the nucleic acid sequence of SEQ ID NO: 80, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or the reverse complement thereof, and wherein the nucleic acid sequence encoding the CT domain encodes the amino acid sequence of SEQ ID NO: 16 or 83, or comprises the amino acid sequence of SEQ ID NO: 84, and wherein the nucleic acid composition of claim 1 or 2, wherein the nucleic acid sequence encoding the minimal CT domain consists of the nucleic acid sequence of SEQ ID NO: 80, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto, or the reverse complement thereof, and wherein the nucleic acid composition of claim 1 or 2, wherein the nucleic acid sequence encoding the CT domain encodes the amino acid sequence of SEQ ID NO: 16 or 83, or comprises the amino acid sequence of SEQ ID NO: 84. 4. A nucleic acid composition comprising a nucleic acid sequence comprising an intron (I) linked to the 5' end of a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to carboxy-terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin. 5. The nucleic acid composition described in 4 above, comprising (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 2, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, or (2) a nucleic acid sequence of SEQ ID NO: 21, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional dystrophin. 6. (1) The nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 34 or 69, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases the binding of the microdystrophin protein to beta-dystroglycan compared to a reference microdystrophin protein lacking the CR domain sequence; (2) The nucleic acid sequence encoding the CR domain comprises or consists of the nucleic acid sequence of SEQ ID NO: 100 or 109, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reverse complement thereof, and increases the binding of the microdystrophin to beta-dystroglycan compared to a reference microdystrophin protein lacking the CR domain sequence; or (2) The nucleic acid composition of any one of 1 to 5 above, wherein the nucleic acid sequence encoding the CR domain comprises or consists of the amino acid sequence of SEQ ID NO: 15 or 90. 7. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 22 or 57, and the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 24 or 59. the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26 or 61; and the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 27 or 62. wherein the nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 or 64; and the nucleic acid sequence encoding H2 consists of SEQ ID NO: 38, or a sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 or 65, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 30 or 65; and the nucleic acid sequence encoding R24 consists of SEQ ID NO: 32 or 67, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 32 or 67.the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 33 or 68; the nucleic acid sequence encoding CR consists of SEQ ID NO: 34, 69, 100 or 109, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 34, 69, 100 or 109; 7. The nucleic acid composition according to any one of 1 to 6 above, wherein the nucleic acid sequence to be loaded, if present, consists of SEQ ID NO: 35, 70 or 80, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 35, 70 or 80, and optionally the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 41, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to SEQ ID NO: 41, linked to the 5' end of the nucleic acid sequence encoding micro-dystrophin. 8. The nucleic acid composition according to any one of 1 to 7 above, wherein the nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, the nucleic acid sequence encoding H1 consists of SEQ ID NO: 24 or 59, the nucleic acid sequence encoding R1 consists of SEQ ID NO: 26 or 61, the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62, the nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, the nucleic acid sequence encoding H2 consists of SEQ ID NO: 38, the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 or 65, the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, the nucleic acid sequence encoding R24 consists of SEQ ID NO: 32 or 67, the nucleic acid sequence encoding CR consists of SEQ ID NO: 34, 69, 100 or 109, I consists of SEQ ID NO: 41, and / or the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80. 9. The nucleic acid composition according to any one of 1 to 8 above, wherein the micro-dystrophin protein comprises or consists of a dystrophin sequence arranged from amino terminus to carboxy terminus as follows: ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR, wherein L1, L2, L3, and L4 are linkers. 10. The nucleic acid composition according to any one of 1 to 9 above, wherein the nucleic acid sequence encoding L1 comprises or consists of SEQ ID NO: 23 or 58, the nucleic acid sequence encoding L2 comprises or consists of SEQ ID NO: 25 or 60, the nucleic acid sequence encoding L3 comprises or consists of SEQ ID NO: 28 or 63, and the nucleic acid sequence encoding L4 comprises or consists of SEQ ID NO: 31, 36, 37, 66, 71 or 72. 11. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein, wherein the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino-terminus to carboxy-terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin. 12. The nucleic acid composition according to claim 11, further comprising a nucleotide sequence encoding a CT domain comprising an α1-syntrophin binding site and / or a dystrobrevin binding site at the C-terminal end of the CR domain. 13. The nucleic acid composition described in 11 or 12 above, which comprises (1) a nucleic acid sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 92 or 93, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, or (2) a nucleic acid sequence of SEQ ID NO: 102 or 103, or a nucleic acid sequence that is at least 90%, 95%, or 98% identical thereto, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional dystrophin. 14. The nucleic acid composition described in any one of 1 to 3 or 6 to 13 above, further comprising an intron (I) linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein, optionally wherein I is a human immunoglobulin heavy chain variable region (VH) 4 intron (VH4) or an SV40 intron or a chimeric intron located 5' to the micro-dystrophin coding sequence. 15. The nucleic acid composition described in any one of 1 to 14 above, wherein the nucleic acid is a nucleic acid vector comprising a transcriptional regulatory element operably linked to a nucleic acid sequence encoding the micro-dystrophin protein, the transcriptional regulatory element promoting expression in muscle and / or CNS tissue. 16. The nucleic acid composition according to claim 15, wherein the promoter is SPc5-12 or a transcriptionally active portion thereof. 17. The nucleic acid is selected from the group consisting of: (i) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged, from N-terminus to C-terminus, as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT-polyadenylation sequence-AAV ITR; (ii) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged, from N-terminus to C-terminus, as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-polyadenylation sequence-AAV ITR; (iii) AAV ITR-transcriptional regulatory element-nucleic acid sequence encoding a microdystrophin domain arranged, from N-terminus to C-terminus, as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT-polyadenylation sequence-AAV ITR; or (iv) AAV 17. The nucleic acid composition according to any one of 1 to 16 above, comprising an AAV vector nucleotide sequence comprising: ITR-transcriptional regulatory element-nucleic acid sequence encoding a micro-dystrophin domain arranged from N-terminus to C-terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-polyadenylation sequence-AAV ITR, wherein the AAV ITR is optionally an AAV2 ITR. 18. The nucleic acid composition according to any one of 1 to 17 above, wherein the nucleotide sequence is codon-optimized and / or CpG sequences are removed. 19. The nucleic acid composition according to any one of 1 to 18 above, comprising the nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106. 20. An rAAV particle comprising an expression cassette containing the nucleic acid composition described in any one of 1 to 19 above. 21. The rAAV particle described in claim 20, wherein the capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO: 77 (AAV8 capsid), has the amino acid sequence of SEQ ID NO: 77, has an amino acid sequence that is at least 95% identical to SEQ ID NO: 78 (AAV9 capsid), or has the amino acid sequence of SEQ ID NO: 78. 22. A pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles described in 20 or 21 above and a pharmaceutically acceptable carrier. 23. A method for delivering a transgene to a cell, comprising contacting the cell with an rAAV particle described in 20 or 21 above, wherein the cell is contacted with the vector. 24. A pharmaceutical composition for treating a dystrophinopathy in a human subject in need thereof, comprising a therapeutically effective amount of the rAAV particles described in 20 or 21 above, optionally formulated for administration to the circulation, muscle tissue, or CNS of the subject. 25. A method of treating a dystrophinopathy in a human subject in need thereof, comprising: The method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles described in 20 or 21 above, wherein the administration results in delivery of the micro-dystrophin protein to the muscle or CNS of the subject. 26. The pharmaceutical composition or method according to claim 24 or 25, wherein the dystrophinopathy is DMD, BMD, or X-linked dilated cardiomyopathy, or the subject is a female DMD or BMD carrier. 27. A micro-dystrophin protein comprising or consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT is at least a portion of the C-terminal region of dystrophin containing the α1-syntrophin binding site or the dystrobrevin binding site. 28. The microdystrophin protein according to 27 above, comprising or consisting of the amino acid sequence of SEQ ID NO: 1, 79, or 91. 29. A micro-dystrophin protein comprising or consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R16 is the spectrin 16 region of dystrophin, R17 is the spectrin 17 region of dystrophin, R24 is the spectrin 24 region of dystrophin, and CR is the cysteine-rich region of dystrophin. 30. A micro-dystrophin protein according to claim 29, comprising or consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, where CT is at least a portion of the C-terminal region of dystrophin containing the α1-syntrophin binding site or the dystrobrevin binding site. 31. The micro-dystrophin protein according to 29 or 30 above, comprising or consisting of the amino acid sequence of SEQ ID NO: 92 or 93. 32. A method for treating a dystrophinopathy in a human subject in need thereof, comprising delivering a therapeutically effective amount of a micro-dystrophin protein described in any one of 27 to 31 above to the circulation, muscle tissue and / or cerebrospinal fluid of the human subject. 33. A pharmaceutical composition for treating dystrophinopathy in a human subject, comprising a therapeutically effective amount of a micro-dystrophin protein described in any one of 27 to 31 above, formulated for delivery to the circulation, muscle tissue and / or cerebrospinal fluid of the human subject. 34. A method for producing a recombinant AAV, comprising: (a) culturing a host cell, said host cell comprising: (i) an artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises the nucleic acid composition according to any one of 17 to 19 above; (ii) a trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and provide the rep and cap proteins in trans; (iii) contains sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by the AAV capsid proteins; The culturing, (b) recovering the recombinant AAV encapsidated with the artificial genome from the cell culture; The method comprising: 35.a. An artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises the nucleic acid composition according to any one of 17 to 19 above. b. a trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and provide the rep and cap proteins in trans; and c. Sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by the AAV capsid proteins. A host cell comprising:

Claims

1. (i) a nucleotide sequence encoding a micro-dystrophin protein comprising (a) the amino acid sequence of SEQ ID NO: 79, or (b) the amino acid sequence of SEQ ID NO: 1, or (ii) A nucleic acid comprising (a) the reverse complement of a nucleotide sequence encoding a micro-dystrophin protein comprising the amino acid sequence of SEQ ID NO: 79, or (b) the amino acid sequence of SEQ ID NO:

1.

2. 2. The nucleic acid of claim 1, comprising: (1) a nucleotide sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO: 1; or (2) a nucleotide sequence of SEQ ID NO: 20, or a nucleic acid sequence at least 97% identical thereto, or a reverse complement thereof, wherein the nucleotide sequence encodes a therapeutically functional micro-dystrophin protein.

3. 2. The nucleic acid of claim 1, wherein the nucleic acid is a nucleic acid vector comprising a transcriptional regulatory element operably linked to a nucleotide sequence encoding the micro-dystrophin protein that promotes expression in muscle and / or CNS tissue.

4. The nucleic acid of claim 3, wherein the transcriptional regulatory element that promotes expression in muscle and / or CNS tissue is SPc5-12 or a transcriptionally active portion thereof.

5. 2. The nucleic acid of claim 1, wherein the nucleic acid comprises an AAV vector nucleotide sequence comprising, from 5' to 3', an AAV ITR-a transcriptional regulatory element-a nucleotide sequence encoding a micro-dystrophin domain arranged in the following order from N-terminus to C-terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT-a polyadenylation sequence-AAV ITR.

6. The nucleic acid of claim 5 , wherein the AAV ITR is an AAV2 ITR.

7. The nucleic acid of claim 1, wherein the nucleotide sequence is codon-optimized and / or CpG sequences are removed.

8. The nucleic acid of claim 1, comprising a nucleotide sequence comprising a transcriptional regulatory element operably linked to a nucleotide sequence encoding a micro-dystrophin protein having the amino acid sequence of SEQ ID NO:

1.

9. 10. An rAAV particle comprising an expression cassette comprising the nucleic acid of claim 1 and a capsid comprising a capsid protein.

10. 10. The rAAV particle of claim 9, wherein the capsid protein has an amino acid sequence that is at least 95% identical to SEQ ID NO: 77 (AAV8 capsid), has the amino acid sequence of SEQ ID NO: 77, has an amino acid sequence that is at least 95% identical to SEQ ID NO: 78 (AAV9 capsid), or has the amino acid sequence of SEQ ID NO:

78.

11. A pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of claim 9 or 10 and a pharmaceutically acceptable carrier.

12. A composition comprising the rAAV particles described in claim 9 or 10 for use in a method for delivering an introduced gene to a cell, the method comprising contacting the cell with the rAAV particles.

13. A pharmaceutical composition for use in treating a dystrophinopathy in a human subject in need thereof, comprising a therapeutically effective amount of rAAV particles described in claim 9 or 10.

14. The pharmaceutical composition of claim 13, wherein the rAAV particles are formulated for administration to the circulation, muscle tissue, or CNS of the subject.

15. 14. The pharmaceutical composition of claim 13, wherein the dystrophinopathy is DMD, BMD, X-linked dilated cardiomyopathy, or the subject is a female DMD or BMD carrier.

16. 1. A method for producing a recombinant AAV, comprising: (a) culturing a host cell, said host cell comprising: (i) an artificial genome comprising a cis expression cassette, wherein the cis expression cassette comprises a nucleic acid according to claim 4 or 5; (ii) a trans expression cassette lacking AAV ITRs, encoding AAV rep and capsid proteins operably linked to expression control elements that drive expression of the AAV rep and capsid proteins in the host cell in culture and supply the rep and capsid proteins in trans; (iii) contain sufficient adenovirus helper functions to allow replication and packaging of the artificial genome by the AAV capsid proteins; The culturing, (b) recovering the recombinant AAV encapsidated with the artificial genome from the cell culture; The method comprising:

17. A host cell comprising a plasmid containing a cis expression cassette, the cis expression cassette comprising a nucleic acid according to claim 4 or 5.

Images